Composition for preventing or treating inflammation and arteriosclerosis

Abstract

The present disclosure relates to a peptide represented by the amino acid sequence of SEQ ID NO. 1. The peptide can bind to ENO1 to inhibit NF-κB or p38 signaling and inhibit the expression of inflammatory factors such as IL1B, IL6, TNF, PTGS2, and CXCL8. In addition, the peptide can be usefully employed in the prevention or treatment of inflammatory diseases and atherosclerotic cardiovascular diseases by inhibiting foam cell formation, plaque formation, or macrophage infiltration.

Description

Technology Field

[0001] The present invention relates to a composition for preventing or treating inflammation and arteriosclerosis. Background Technology

[0003] Atherosclerosis is a chronic inflammatory disease in which lipids, inflammatory cells, and fibrous tissue accumulate in the inner lining of medium and large arteries to form plaque, causing the blood vessels to gradually narrow and harden. It is known to be a direct cause of major cardiovascular diseases such as myocardial infarction, stroke, and peripheral artery disease. Although there are no distinct symptoms in the early stages, the disease can lead to fatal complications as it progresses.

[0004] Atherosclerosis is understood not merely as a simple lipid accumulation disease, but as a chronic inflammatory pathological condition involving a complex interplay of vascular endothelial dysfunction, deposition of oxidized low-density lipoprotein (oxLDL), macrophage infiltration and foam cell formation, and the overexpression of inflammatory cytokines such as interleukin-6 (IL-6), interleukin-8 (IL-8), and tumor necrosis factor-α (TNF-α). In particular, macrophage activation and inflammatory responses are reported to play a significant role in plaque growth and instability.

[0005] Currently approved treatments mainly consist of statins, PCSK9 inhibitors, and ezetimibe, which reduce low-density lipoprotein (LDL) cholesterol and are effective in inhibiting disease progression by regulating lipid metabolism. However, residual risk, in which the risk of cardiovascular events persists even after lipid levels are controlled, is observed in some patients, raising the need for new treatment strategies that can directly control inflammatory mechanisms.

[0006] Therefore, there is a need for the development of therapeutic agents with a new mechanism capable of regulating inflammatory responses within plaques by suppressing the expression or secretion of inflammatory factors and inhibiting foam cell formation. Prior art literature

[0008] Republic of Korea Published Patent No. 10-2010-0028442 The problem to be solved

[0009] In one aspect, the present disclosure aims to provide a peptide represented by the amino acid sequence of SEQ ID NO. 1.

[0010] In another aspect, the present disclosure aims to provide a composition for preventing or treating inflammation comprising the peptide, or a polynucleotide encoding the same.

[0011] In another aspect, the present disclosure aims to provide a pharmaceutical composition for the prevention or treatment of atherosclerotic cardiovascular disease comprising the peptide or a polynucleotide encoding the same.

[0012] In another aspect, the present disclosure aims to provide a health functional food composition for improving blood circulation, or for preventing or improving inflammatory diseases or arteriosclerotic cardiovascular diseases, comprising the peptide or a polynucleotide encoding the same. means of solving the problem

[0014] In one aspect, the present disclosure provides a peptide represented by the amino acid sequence of SEQ ID NO. 1.

[0015] In an exemplary embodiment, the N-terminus of the peptide may be bonded to a protecting group selected from the group consisting of an acetyl group, a fluorenylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and polyethylene glycol (PEG), or the C-terminus of the peptide may be bonded to a protecting group selected from the group consisting of an amino group and an azide.

[0016] In an exemplary embodiment, the peptide can bind to ENO1 (Enolase 1).

[0017] In an exemplary embodiment, the peptide may inhibit the expression of one or more selected from the group consisting of IL1B (Interleukin-1 beta), IL6 (Interleukin-6), TNFα (Tumor necrosis factor-alpha), PTGS2 (Prostaglandin-endoperoxide synthase 2) and CXCL8 (CXC motif chemokine ligand 8), or inhibit the signal transduction of NF-κ (Nuclear factor kappa B) or p38 (p38 mitogen-activated protein kinase).

[0018] In an exemplary embodiment, the peptide may inhibit foam cell formation or plaque formation, or reduce macrophage infiltration.

[0019] In another aspect, the present disclosure provides a pharmaceutical composition for the prevention or treatment of inflammatory diseases comprising the peptide, or a polynucleotide encoding the same.

[0020] In another aspect, the present disclosure provides a pharmaceutical composition for the prevention or treatment of atherosclerotic cardiovascular disease comprising the peptide or a polynucleotide encoding the same.

[0021] In an exemplary embodiment, the atherosclerotic cardiovascular disease may be an ischemic vascular disease.

[0022] In an exemplary embodiment, the ischemic vascular disease may be one selected from the group consisting of myocardial infarction, angina pectoris, ischemic encephalopathy, stroke, and peripheral artery disease.

[0023] In another aspect, the present disclosure provides a health functional food composition for improving blood circulation, or for preventing or improving inflammatory diseases or arteriosclerotic cardiovascular diseases, comprising the peptide or a polynucleotide encoding the same.

[0024] In an exemplary embodiment, the atherosclerotic cardiovascular disease may be an ischemic vascular disease.

[0025] In an exemplary embodiment, the ischemic vascular disease may be one selected from the group consisting of myocardial infarction, angina pectoris, ischemic encephalopathy, stroke, and peripheral artery disease. Effects of the invention

[0027] The peptide represented by the amino acid sequence of SEQ ID NO. 1 according to the present disclosure can bind to ENO1 to inhibit NF-κB or p38 signaling and reduce the expression of inflammatory factors such as IL1B, IL6, TNF, PTGS2, and CXCL8. In addition, the peptide can be usefully used for the prevention or treatment of atherosclerotic cardiovascular disease by inhibiting foam cell formation and plaque formation and reducing macrophage infiltration.

[0028] In addition, the novel peptide of the present disclosure exhibits superior inhibitory effects on inflammatory signaling due to ENO1 binding compared to the unmodified peptide, thereby enhancing the effects of inhibiting inflammatory cytokine expression, inhibiting foam cell formation, and reducing plaque formation. Therefore, the peptide according to the present disclosure can be usefully utilized as a pharmaceutical composition or a health functional food composition for the prevention or treatment of ischemic vascular diseases, including atherosclerotic cardiovascular disease. Brief explanation of the drawing

[0030] Figure 1 illustrates the reorganization and expression patterns of myeloid cells in atherosclerosis. (A) shows the results of visualizing nine myeloid cell clusters identified through single-cell transcriptome analysis using UMAP (Uniform Manifold Approximation and Projection), where each dot represents a single cell and colors indicate different clusters. (B) shows the UMAP results representing the distribution of myeloid cell clusters in arterial tissue between the non-atherosclerotic plaque group (normal tissue adjacent to the carotid artery, PA) and the atherosclerotic plaque group (carotid artery atherosclerotic plaque, AC). (C) shows a heatmap representing the top 30 differentially expressed genes for each cluster. (D) visualizes high-expression genes using a dot plot, where color intensity represents the average gene expression level and the size of the dot represents the expression ratio of the corresponding gene. (E) shows a stacked bar graph representing changes in the cell ratio between the two groups. (F) shows a violin plot representing ENO1 and CD68 expression across the nine clusters. (G) highlights the expression of ENO1 and CD68 in myeloid UMAP cells of the non-atherosclerotic plaque group (left) and the atherosclerotic plaque group (right). Figure 2 shows that ENO1 is highly expressed in atherosclerotic plaques and colocalizes with M1 macrophages. (A) shows representative serial staining results for CD68 (green), CD163 (blue), and ENO1 (red) in the coronary arteries of a patient with dilated cardiomyopathy. (B) shows representative serial staining results for CD68 (green), CD163 (blue), and ENO1 (red) in the coronary arteries of a patient with myocardial infarction and atherosclerosis. The black and white scale bar represents 100 μm. Figure 3 shows the translocation of ENO1 to the cell membrane under atherosclerotic conditions. (A) shows the results of detecting cell surface expression of enolase-1 using a flow cytometer after differentiating THP-1-derived macrophages induced by treatment with 25 ng / mL PMA for 72 hours into M1 macrophages with 100 ng / mL LPS (n=8 independent experiments). (B) shows the results of fixing BMDMs treated with LPS for specified times (0, 6, 12, and 24 hours), staining with ENO1 (red) without permeability to specifically detect cell surface ENO1, counterstaining the nuclei with DAPI (blue), and analyzing them by confocal microscopy. The scale bar is 25 μm. Each experiment was performed as at least two independent experiments, and each experiment was performed in triple replicates. (C) shows the Western blot results for the membrane and cytoplasmic fractions of ENO1 in BMDMs stimulated with LPS for different durations. At least two independent experiments were performed in triple replicates. (D) shows the immunoblot analysis results for ENO1 levels in the membrane and cytoplasmic fractions of BMDMs stimulated with oxLDL for 24 hours. Na+ / K+ ATPase-α1 and AKT were detected to confirm the purity of the membrane and cytoplasmic fractions, respectively. Each experiment was performed in at least two independent experiments, and each experiment was performed in triple replicates. The Wilcoxon signed-rank test was used for statistical analysis, and *p < 0.05 was considered statistically significant. ENO1 refers to enolase 1, and oxLDL refers to oxidized low-density lipoprotein. Figure 4 shows that ApoB100-derived peptides inhibit inflammatory cytokines at the gene and protein levels in stimulated PBMCs. (A) shows the experimental results comparing PBMCs stimulated with 5 μg / mL of ApoB for 24 hours with pretreatment with 14.4 μM of peptide 1 hour prior to ApoB100 treatment or without pretreatment. IL-6 and CXCL8 levels were measured in the cell culture supernatant via ELISA (n=16-18), and the cytokine induction rate (percent induction) was normalized to the untreated control group (No tx). (B) shows the results comparing PBMCs stimulated with 80 pg / mL of LPS with pretreatment with 14.4 μM of peptide 1 hour prior to LPS treatment or without pretreatment (n=10-11). The relative expression levels of IL1B, IL6, TNF, PTGS2, and CXCL8 mRNA were measured by qPCR. (C) shows the results of detecting the secretion of IL-6, CXCL8, and TNF-α by ELISA, and the cytokine induction rate was normalized to the untreated control group. All bar graphs are expressed as mean ± standard error. Wilcoxon signed-rank tests were used for statistical analysis, where *p < 0.05 and **p < 0.01. Figure 5 shows that the ApoB-derived peptide inhibits the induction of inflammation-related genes in THP-1-derived macrophages. (A) shows the results of analyzing mRNA expression levels (ITGAM, TNF, and MMP9) by qPCR after pre-treating THP-1 cells (n=11-13 independent experiments) with 7.2 μM of the peptide, followed by treatment with 50 ng / mL PMA for 24 hours, and harvesting the cells after an additional 48 hours. mRNA levels are expressed as Log2 fold change normalized to the PMA-alone treatment group. (B) shows the relative expression of M1 macrophage-related mRNA according to the presence or absence of peptide co-treatment in THP-1-derived macrophages (n=5-9 independent experiments) treated with 100 ng / mL LPS for 24 hours. Values ​​are expressed as Log2 fold change normalized to the PMA-alone treatment group. (C) shows the results of Western blot analysis (6–15 independent experiments) evaluating the effects of peptides on LPS-induced inflammatory signaling pathways in THP-1-derived macrophages, and representative blots are presented. (D) shows the results of quantifying the relative protein levels of p-Akt, p-NF-κB, p-p38, and p-Erk and normalizing them to β-actin. Quantitative data are expressed as fold change relative to the unstimulated group. The Wilcoxon signed-rank test was used for statistical analysis. All bar graphs are expressed as mean ± standard error. * indicates p < 0.05; ** indicates p < 0.01. PEP stands for peptide. Figure 6 shows that ApoB100-derived peptides reduce oxLDL-induced foam cell formation and DiI-oxLDL uptake in macrophages. (A) shows the experimental results of THP-1 cells (n=5 independent experiments) cultured for 2 hours in the presence or absence of PP3m (low concentration: 2.5 μg / ml and high concentration: 5 μg / ml), followed by culture with oxLDL at a concentration of 20 μg / ml for 24 hours. THP-1 foam cell formation was observed via Oil Red O staining. (B) shows a representative microscopic image of THP-1 cells loaded with DiI-oxLDL (oxidized low-density lipoprotein labeled with 1,1′-Dioctadecyl-3,3,3′,3′-Tetramethylindocarbocyanine Perchlorate). Cells (n=5 independent experiments) were cultured for 2 hours in the presence or absence of PP3m (2.5 μg / ml and 5 μg / ml), followed by 4 hours with DiI-oxLDL at a concentration of 20 μg / ml. (C) represents the quantitative analysis of the results presented in (B). Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. All bar graphs are presented as mean ± standard error. ** indicates p < 0.01. The scale bar is 100 μm. Figure 7 shows that administration of the ApoB100-derived peptide PP3m inhibits the progression of atherosclerosis in Ldlr- / - mice. (A) shows a schematic diagram of the in vivo experiment. (BE) Male Ldlr- / - mice aged 8 weeks were fed a Paigen atherosclerotic-inducing diet for 8 weeks, after which phenol red-free RPMI-1640 or PP3m (25 μg / mouse, twice a week) was administered as a vehicle for 5 weeks. The aorta collected after sacrifice was fixed. (B) shows the results of evaluating the lesion area of ​​the en-face aorta by ORO staining and quantifying the size of the lesion area. (C) shows the results of measuring the size of atheroma plaques via H&E staining, detecting lipid deposition levels via ORO staining, and representatively representing collagenous fibrosis via Masson's Trichome staining in a cross-section of the aortic sinus. (D) shows quantitative data on the lesion area, and (E) shows quantitative data on the ORO-positive area in the aortic sinus. Data represent the results of three independent experiments including at least 6 mice per group. Values ​​are expressed as mean ± standard error, where *p<0.05, ***p<0.001, and ****p<0.0001. Figure 8 shows that administration of PP3m reduces macrophage accumulation in the aorta of Ldlr- / - mice. Male Ldlr- / - mice aged 8 weeks were fed Paigen's atherosclerotic-inducing diet for 8 weeks, followed by administration of either vehicle or PP3m (25 μg / kg / mouse, twice a week) for 5 weeks. Aorta collected after sacrifice were fixed for immunohistochemical staining (IHC) (A) or enzymatically digested for flow cytometry (BF). (A) shows a representative image (left) of the F4 / 80-positive area within the aortic sinus lesion detected by immunohistochemical staining and its quantitative results (right). (B) shows representative analysis results of the F4 / 80+ CD11b+ macrophage population in the aorta of Ldlr- / - mice treated with vehicle (top) or PP3m (bottom). (C) shows the frequency of aortic macrophages in vehicle or PP3m-treated mice. (E) shows the frequency of aortic dendritic cells (DCs) among total leukocytes and the frequency of dendritic cell subpopulations (CD11b+ DCs and CD11b- DCs). (F) shows the quantitative results of aortic CD3+ T cells among total leukocytes (left) and the frequency of CD4+ T cells and CD8+ T cells in the aorta of control and PP3m-treated mice. Data represent the results of three independent experiments including more than 6 mice per group. Values ​​are expressed as mean ± standard error, *p<0.05. Figure 9 shows that PP3m administration reduces inflammatory cytokines in Ldlr- / - mice without altering plasma lipid profiles. Male Ldlr- / - mice aged 8 weeks were fed Paigen's atherosclerotic-inducing diet for 8 weeks, followed by the administration of either vehicle or PP3m (25 μg / kg / mouse, twice a week) for 5 weeks. (A) shows the levels of circulating inflammatory cytokines TNF-α, IL-6, and IL-1β measured by ELISA in the serum of Ldlr- / - mice. (B) shows the levels of serum total cholesterol (TC), LDL-cholesterol, HDL-cholesterol, and total triglycerides (TG) measured using the corresponding kit. Data represent the results of three independent experiments involving more than 6 mice per group. Values ​​are expressed as mean ± standard error, and represent **p<0.01, ***p<0.001, and ****p<0.0001 compared to the control group. Figure 10 shows that the ApoB-derived peptide PP3m inhibits LPS-induced inflammation in BMDMs. (A) BMDMs were pretreated with PP3m (10 μg / mL) for 15 minutes, followed by treatment with 10 ng / mL LPS for 24 hours (A) or 30 minutes (BD). After harvesting the cells, the expression levels of pro-inflammatory mRNAs (Tnf, Il6, and Il1b) were detected by qRT-PCR (n=3). (B) The expression of proteins associated with the NF-κ signaling pathway in BMDMs was evaluated by Western blot analysis (3–7 independent experiments), and representative blots are presented on the left. The relative protein levels of p-IKKα / β and p-NF-κB were quantified by normalizing to total IKKα / β and NF-κB, respectively (right). (C) A representative image showing the detection of p65 nuclear translocation in BMDMs via immunofluorescence staining is shown on the left. The frequency of cells exhibiting nuclear NF-κB relative to the total number of cells is quantified and presented on the right. Quantification was performed in at least three random regions out of five imaging regions. All bar graphs are expressed as mean ± standard error, where *p < 0.05, **p < 0.01, and ***p < 0.001. Figure 11 indicates that the effect of ENO1 antagonists on LPS-induced glycolysis reprogramming in macrophages is limited. (AB) RAW264.7 macrophages were transfected with si-NC or si-ENO1 (10 nM) for 24 hours, followed by treatment with 100 ng / ml LPS for 24 hours. (CD) BMDMs were differentiated with mouse M-CSF (20 ng / ml) for 6 days. Cells were pretreated with PP3m (10 μg / ml) for 15 minutes, followed by stimulation with 10 ng / ml LPS for 24 hours. Glycolytic activity of the cells was evaluated using a Seahorse analyzer, and (A, C) shows the extracellular acidification rate (ECAR), while (B, D) show the results of quantifying non-glycolytic acidification, glycolysis, glycolytic capacity, and glycolytic reserve. Data are expressed as mean ± standard error (n=3), where *p<0.05 and **p<0.01 relative to the control group. Figure 12 shows that knockdown of enolase-1 reduces LPS-induced inflammation in RAW264.7 macrophages. (A) RAW264.7 macrophages were transfected with si-control (si-NC) or si-ENO1 (10 nM) and cultured for 24 hours, followed by treatment with 100 ng / ml LPS for 30 minutes (n=3). After harvesting the cells, the expression levels of ENO1, pNF-κB, and NF-κB were evaluated by immunoblot analysis. ENO1 and pNF-κB protein expression were quantified by normalization to HSP90 and NF-κB expression, respectively. (B) Immunofluorescence staining was performed to confirm the nuclear translocation of p65 in RAW264.7 cells. The scale bar is 25 μm. Data are expressed as mean ± standard error, where *p<0.05, **p<0.01, ***p<0.001, and ****p<0.0001. Figure 13 shows that administration of the ApoB-derived peptide PP3m did not affect the body weight and liver weight of Ldlr- / - mice. (A) shows the body weight measured at the end of the experiment, and (B) shows the liver weight and relative liver weight. Figure 14 shows a gating strategy for flow cytometry to detect immune cells in the aorta of Ldlr- / - mice. Figure 15 shows the results of evaluating the direct interaction between PP3m and ENO1 using protein chip-based binding analysis. The direct interaction between PP3m (PP3N3T-2m3) and ENO1 was evaluated through protein chip-based binding analysis. (A) ENO1 was immobilized on the chip surface, and PP3m (PP3N3T-2m3) was pre-labeled with Cy5 fluorescent dye. PP3m was applied at different concentrations (0, 0.76, 3.78, 18.9, and 94.5 μg / ml), and fluorescence intensity was measured at the PMT-580 wavelength. (B) Fluorescence intensity increased in a concentration-dependent manner, indicating that PP3m directly binds to ENO1 within the tested concentration range (0.76–94.5 μg / ml). Specific details for implementing the invention

[0031] The present invention will be described in detail below.

[0033] In one aspect, the present disclosure provides a peptide represented by the amino acid sequence of SEQ ID NO. 1.

[0034] The inventors confirmed that the interaction between ApoB100 and ENO1 can act as a major mechanism inducing macrophage-mediated inflammatory responses in atherosclerosis, and developed a peptide capable of inhibiting this interaction. As a result, it was confirmed that a peptide represented by a specific amino acid sequence binds to ENO1 to inhibit the ApoB100-ENO1 interaction and regulates NF-κB or p38 signaling, thereby reducing the expression of inflammatory cytokines and inhibiting foam cell formation and plaque progression. Furthermore, it was confirmed that the peptide can inhibit vascular inflammatory responses without changes in blood lipid levels, and the present invention was completed.

[0035] The above SEQ ID NO. 1 has the amino acid sequence Asparagine-Lysine-D-Tyrosine-Glycine-Methionine-Valine-α-aminoisobutyric acid-Glutamine-Valine. For example, the present disclosure may provide a peptide composed of the amino acid sequence of SEQ ID NO. 1, but is not limited thereto.

[0037] In an exemplary embodiment, the N-terminus of the peptide may be bonded to a protecting group selected from the group consisting of an acetyl group, a fluorenylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and polyethylene glycol, or the C-terminus of the peptide may be bonded to a protecting group selected from the group consisting of an amino group and an azide. For example, hydrophobic substituents such as an acetyl group or fatty acid derivatives (palmitoyl group, myristyl group, stearyl group) can increase the membrane affinity of the peptide to improve intracellular delivery efficiency, and substituents such as polyethylene glycol can improve the solubility and in vivo stability of the peptide. In addition, such terminal modifications can increase the resistance of the peptide to degrading enzymes, thereby improving persistence in vivo.

[0038] In an exemplary embodiment, the peptide may bind to ENO1 (Enolase 1). ENO1 is a protein involved in the activation of macrophages and the regulation of inflammatory responses, and by binding the peptide to ENO1, it can regulate inflammatory signaling pathways associated with ENO1. Accordingly, the inflammatory response of macrophages may be suppressed and the inflammatory microenvironment within the blood vessels may be alleviated.

[0039] In an exemplary embodiment, the peptide may inhibit the expression of one or more selected from the group consisting of IL1B, IL6, TNF, PTGS2, and CXCL8, or inhibit the signaling of NF-κB or p38. NF-κB or p38 signaling is known as a major signaling pathway that induces an inflammatory response, and the peptide may reduce the production and secretion of inflammatory cytokines and alleviate the inflammatory response by regulating this signaling pathway.

[0040] In an exemplary embodiment, the peptide may inhibit foam cell formation or plaque formation, or reduce macrophage infiltration. Foam cell formation and plaque accumulation are known to be major pathological features of atherosclerosis, and the peptide may reduce lipid accumulation and plaque progression within blood vessels and inhibit the progression of atherosclerotic cardiovascular disease by inhibiting macrophage-mediated inflammatory responses.

[0042] In another aspect, the present disclosure provides a pharmaceutical composition for the prevention or treatment of inflammatory diseases comprising the peptide, or a polynucleotide encoding the same.

[0043] The above peptide is as described above.

[0044] The above-mentioned inflammatory disease refers to a disease in which an inflammatory response is induced or persists in a tissue or organ due to the activation of an immune response or an inflammatory response. For example, the above-mentioned inflammatory disease may include, but is not limited to, diseases associated with acute or chronic inflammatory responses.

[0045] The above composition can alleviate an inflammatory response by regulating signal transduction related to the inflammatory response and suppressing the expression of inflammatory cytokines.

[0046] The above polynucleotide may be included without limitation as long as it is a polynucleotide encoding the above peptide. In addition, the above polynucleotide may be manufactured through known gene synthesis or recombinant techniques known in the art, but is not limited thereto.

[0047] In an exemplary embodiment, the pharmaceutical composition may further contain pharmaceutical adjuvants such as preservatives, stabilizers, hydrating agents or emulsification promoters, salts and / or buffers for osmotic pressure regulation, and other therapeutically useful substances, and may be formulated into various oral or parenteral forms according to conventional methods.

[0048] In an exemplary embodiment, the oral dosage form may be, for example, a tablet, pill, hard and soft capsule, liquid, suspension, emulsifier, syrup, powder, granule, granule, pellet, etc., and these formulations may contain, in addition to the active ingredient, a surfactant, a diluent (e.g., lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, and glycine), and a lubricant (e.g., silica, talc, stearic acid and its magnesium or calcium salt, and polyethylene glycol). The tablet may also contain binders such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, and polyvinylpyrrolidine, and, in some cases, may contain pharmaceutical additives such as disintegrants, absorbents, coloring agents, flavoring agents, and sweeteners, such as starch, agar, alginic acid, or its sodium salt. The tablet may be manufactured by conventional mixing, granulation, or coating methods. Additionally, the parenteral agent may be in the form of a rectal, topical, subcutaneous, or transdermal administration, and may be in the form of, for example, an injection, drops, ointment, lotion, gel, cream, spray, suspension, emulsion, suppository, or patch, but is not limited thereto.

[0049] In an exemplary embodiment, the determination of the dosage of the active ingredient is within the level of a person skilled in the art, and the daily dosage of the drug varies depending on various factors such as the degree of symptom progression, onset time, age, health condition, and complications of the subject to administration, but generally, based on adults, the composition may be administered in divided doses of 1 μg / kg to 200 mg / kg, preferably 50 μg / kg to 50 mg / kg, 1 to 3 times a day, and the dosage does not limit the scope of this specification in any way.

[0051] In another aspect, the present disclosure provides a pharmaceutical composition for the prevention or treatment of atherosclerotic cardiovascular disease comprising the peptide or a polynucleotide encoding the same.

[0052] The above peptide, polynucleotide, and pharmaceutical composition are as described above.

[0053] The above-mentioned arteriosclerotic cardiovascular disease refers to a disease in which lipids, inflammatory cells, and fibrous substances accumulate on the inner wall of the artery, forming plaque, and consequently causing vascular stenosis or impaired blood flow.

[0054] In an exemplary embodiment, the atherosclerotic cardiovascular disease may be an ischemic vascular disease.

[0055] The above-mentioned ischemic vascular disease refers to a disease in which the supply of oxygen and nutrients to tissues is reduced as plaque accumulates within blood vessels due to arteriosclerosis, the lumen of the blood vessels narrows, or blood flow is restricted. Since the peptide according to the present disclosure can inhibit inflammatory responses within blood vessels and reduce foam cell formation and plaque formation, it can be usefully utilized to inhibit the progression of arteriosclerosis and to prevent or treat ischemic vascular disease caused by it.

[0056] In an exemplary embodiment, the ischemic vascular disease may be one selected from the group consisting of myocardial infarction, angina pectoris, ischemic encephalopathy, stroke, and peripheral artery disease.

[0058] In another aspect, the present disclosure provides a health functional food composition for improving blood circulation, or for preventing or improving inflammatory diseases or arteriosclerotic cardiovascular diseases, comprising the peptide or a polynucleotide encoding the same.

[0059] The above-mentioned peptides, polynucleotides, inflammatory diseases, and atherosclerotic cardiovascular diseases are as described above.

[0060] The above-mentioned improvement of blood circulation means improving vascular function by facilitating blood flow within the blood vessels or reducing inflammatory responses within the blood vessels.

[0061] In an exemplary embodiment, the health functional food composition may include a food additive that is acceptable in terms of health functional food science, and may further include a suitable carrier, excipient, and diluent commonly used in the manufacture of health functional foods. The formulation of the health functional food composition is not particularly limited, but may be formulated in the form of, for example, tablets, granules, pills, powders, capsules, liquids, drinks, jellies, bars, candies, tea bags, etc. For each formulation of the health functional food composition, ingredients commonly used in the field in addition to the active ingredient can be appropriately selected and combined by a person skilled in the art without difficulty according to the formulation or purpose of use, and a synergistic effect may occur when applied simultaneously with other functional ingredients.

[0062] In an exemplary embodiment, the health functional food composition may include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavorings and natural flavorings, coloring agents, sweeteners, pectin and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, and carbonating agents. Additionally, the health functional food composition according to one embodiment may include fruit pulp for the production of natural fruit juice, fruit juice beverages, or vegetable beverages. These ingredients may be used alone or in combination, and while the content of these additives is not particularly limited, they may be included in a range of about 0 to about 50 parts by weight per 100 parts by weight of the composition according to one embodiment.

[0063] In an exemplary embodiment, the atherosclerotic cardiovascular disease may be an ischemic vascular disease.

[0064] In an exemplary embodiment, the ischemic vascular disease may be one selected from the group consisting of myocardial infarction, angina pectoris, ischemic encephalopathy, stroke, and peripheral artery disease.

[0066] The present invention will be described in more detail below through examples and the like. These examples are solely for illustrating the present invention, and it will be obvious to those skilled in the art that the scope of the present invention is not to be interpreted as being limited by these examples.

[0068] Examples

[0070] 1. Experimental method

[0071] (1) Peptides

[0072] Peptides were synthesized using the solid-phase peptide synthesis (SPPS) technique. Synthesis began by covalently bonding C-terminal amino acids to a polystyrene-based resin (chlorotrityl resin). Each amino acid was used in the Fmoc protected form, and the side chains were protected by tert-butyl (tBu) protecting groups. The Fmoc protecting groups were removed using a 20% piperidine solution in dimethylformamide (DMF) and subsequently washed thoroughly with DMF. The activated amino acids were bonded to the resin in the presence of HBTU and 4-(dimethylamino)pyridine (DIEA) to promote the bonding reaction. After each bonding step, the samples were washed with DMF and then sequentially washed with dichloromethane (DCM) to remove unreacted amino acids and byproducts. After synthesis was completed, the peptide was cleaved from the resin using a cleavage mixture containing trifluoroacetic acid (TFA) and a suitable scavenger. The synthesized peptide was purified using reversed-phase high-performance liquid chromatography (RP-HPLC). The inventors developed peptide PP3 designed to inhibit ApoB100-ENO1 binding and subsequently optimized it into PP3m (Example), a metabolically stabilized variant with an improved in vivo half-life (Table 1; stability test of ApoB100-derived peptide).

[0074] PP3m consists of 9 amino acids, with the 3rd residue being D-type tyrosine (D-Tyr) and the 7th residue being α-aminoisobutyric acid (Aib).

[0075] Amino acid sequence of PP3m (Sequence No. 1): Asn-Lys-D-Tyr-Gly-Met-Val-Aib-Gln-Val

[0077] Liver microsome stability test Compound Species K e (my -1 ) T 1 / 2 (min) PP3 Human 0.0400 17.3 Rat 0.00981 70.7 Mouse 0.0290 23.9 Dog 0.0250 27.7 PP3m Human 0.00136 510 Rat 0.000630 1100 Mouse 0.0000482 14400 Dog 0.00116 598 Plasma stability test Compound Species K e (my -1 ) T 1 / 2 (min) PP3 Rat 0.122 5.68 PP3m Rat 0.00283 245 K e : elimination rate constant, T 1 / 2 : half-life

[0078] (2) Reanalysis of single-cell RNA-sequencing data

[0079] The single-cell RNA sequencing (scRNA-seq) dataset GSE159677 provides a high-resolution atlas of cellular diversity within human carotid artery atherosclerotic plaques. This dataset consists of paired samples of three patients with calcified atherosclerotic cores (ACs) and their anatomically corresponding proximal adjacent carotid tissues (PAs). Quality control, data clustering, and visualization were performed using the R package Seurat (v4.1.2) (PMID: 34062119). To remove low-quality cells and doublets, the following cells were excluded: i) cells with a mitochondrial gene ratio exceeding 10%, and ii) cells with fewer than 200 or more than 4,000 expressed genes. To correct for batch effects between different data, the FindIntegrationAnchors and IntegrateData functions were used with a dimension of 20 (PMID: 31178118). Clustering was performed using the FindNeighbors and FindClusters functions based on the top 30 principal components, and visualization was performed using uniform manifold approximation and projection (UMAP) with an appropriate resolution.

[0080] (3) Cell Culture Study

[0081] Peripheral blood mononuclear cells (PBMCs):Buffy coat concentrate (approximately 30 mL per donor) was provided by the Seoul National University Hospital (SNUH) Blood Bank. PBMCs were isolated by density gradient centrifugation using Ficoll-Paque Plus (GE Healthcare Bioscience, Uppsala, Sweden), stored in CellBanker 2 (Nippon Zenyaku Kogyo Co., Ltd, Japan), and then cryopreserved in liquid nitrogen. Thawed PBMCs were resuspended in RPMI 1640 medium (Welgene, Gyeongsan, Korea) supplemented with 10% FBS, 100 U / mL penicillin, and 100 μg / mL streptomycin. Cells were rested for 2 hours in FBS-free RPMI medium at 37 °C and 5% CO₂, then pretreated for 1 hour with PP3 (14.4 μM; equivalent to 20 μg / mL based on a molecular weight of 1386 g / mol) or PP3m (14.4 μM; equivalent to 14.7 μg / mL based on a molecular weight of 1022 g / mol), and then stimulated for 24 hours with ApoB100 (5 μg / mL; Athens Research & Technology Inc., Athens, GA) or LPS (80 pg / mL; Sigma-Aldrich, St. Louis, MO).

[0082] THP-1 cells:Human monocyte-derived THP-1 cells (Korean Cell Line Bank, Seoul, Korea) were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS), 100 U / mL penicillin, and 100 μg / mL streptomycin, and maintained at 37 °C and 5% CO₂. Differentiation into macrophages was induced by treatment with phorbol 12-myristate 13-acetate (PMA; Sigma-Aldrich) at concentrations of 25 to 50 ng / mL for 48 or 72 hours. After washing with PBS and replacing with PMA-free medium, cells were pretreated with ApoB-derived peptide (14.4 μM) for 1 hour, followed by stimulation with lipopolysaccharide (LPS; 100 ng / mL).

[0083] Foam cell formation: Foam cell formation was induced in THP-1-derived macrophages by culturing them with oxidized low-density lipoprotein (oxLDL; 20 μg / mL, Kalen Biomedical, MD) for 24 hours. Cells were fixed with 4% paraformaldehyde for 15 minutes, stained with filtered Oil Red O solution (Sigma-Aldrich, St. Louis, MO; 0.6% concentration in 60% isopropanol), and counterstained with crystal violet. Images were acquired using a Leica DM IL LED microscope (Leica Microsystems GmbH, Wetzlar, Germany) and Leica Application Suite v4.12.0. Lipid accumulation was evaluated using ImageJ software in at least five random fields per condition.

[0084] DiI-oxLDL uptake assay:To evaluate oxLDL uptake, THP-1 macrophages were cultured on 8-chamber slides (Becton Dickinson) and pretreated with PP3m (2.5 or 5 μg / mL) for 2 hours. After washing with PBS, the cells were incubated with DiI-labeled oxLDL (20 μg / mL, Kalen Biomedical) at 37°C for 4 hours. After washing and fixing the cells, images were taken using the EVOS FL Cell Imaging System (Life Technologies, Darmstadt, Germany). Quantitative analysis was performed using ImageJ.

[0085] Bone marrow-derived macrophages (BMDMs): Bone marrow cells were isolated from the tibia of 8-12 week old C57BL / 6N mice (Jackson Laboratory) and differentiated into BMDMs by culturing for 7 days in DMEM (Gibco) containing 10% FBS, 100 U / mL penicillin, 100 μg / mL streptomycin, and 20 ng / mL M-CSF. Cells were pretreated with PP3m (10 μg / mL) for 15 minutes and then stimulated with LPS (10 ng / mL or 100 ng / mL in some experiments) under conditions of 37 °C and 5% CO₂. In a separate experiment, cell surface ENO1 expression was evaluated by treatment with LPS (100 ng / mL) alone.

[0086] RAW264.7 cells: RAW264.7 mouse macrophages (ATCC) were maintained in DMEM supplemented with 10% FBS, penicillin (100 U / mL), and streptomycin (100 μg / mL). For the stimulation experiment, cells were pretreated with PP3m (10 μg / mL) for 15 minutes and then exposed to LPS (100 ng / mL) under standard culture conditions.

[0087] (4) Histological and Immunohistochemical Analysis

[0088] Atherosclerotic lesion staining and quantification.The thoracic aorta was excised from mice from the root to the abdominal region, and perivascular adipose tissue was removed under a dissecting microscope. The ascending aorta was fixed overnight in 4% paraformaldehyde, then longitudinally incised for en face analysis. Lipid-rich lesions were stained with Oil Red O (ORO; Sigma-Aldrich) and quantified using ImageJ software. For the analysis of the aortic root, the heart was fixed in 4% paraformaldehyde, embedded in an optimal cutting temperature (OCT) compound (Sakura Finetek), and frozen at -80 °C. Serial 8 μm frozen sections were prepared and stained with ORO, hematoxylin and eosin (H&E), and Masson's trichrome, respectively, to evaluate lipid deposition, lesion size, and collagen content.

[0089] Immunohistochemistry Aortic root sections were incubated overnight at 4 °C with anti-F4 / 80 antibody (rabbit IgG, Abcam). Subsequently, HRP-conjugated secondary antibody was applied, and color development was performed using a DAB detection kit (Abcam). The stained sections were counterstained with hematoxylin.

[0090] Sequential multiplex immunohistochemistryParaffin-embedded vascular tissues from patients with dilated cardiomyopathy (n=4) and patients with myocardial infarction accompanied by atherosclerosis (n=3) were sectioned to a thickness of 4 μm and deparaffinized. Endogenous peroxidase activity was removed using a 0.3% hydrogen peroxide solution in methanol. Sections were blocked with 10% normal serum and then stained sequentially with anti-CD68 (BV711, BioLegend), anti-CD163 (EPR19518, Abcam), and anti-ENO1 (MAB11222, Abnova) antibodies. Each antibody was incubated overnight at 4 °C, followed by HRP-conjugated secondary antibody treatment and DAB staining. Between stainings, antibody stripping was performed using a 1% 2-mercaptoethanol / 2% SDS buffer at 56 °C. Images were captured using an Aperio ScanScope XT (Leica Biosystems) and analyzed with Aperio ImageScope software.

[0091] Immunofluorescence of macrophages BMDMs were washed with PBS, fixed with 4% paraformaldehyde, and permeabilized with 0.3% Triton X-100. After blocking with 1% BSA, the samples were incubated overnight at 4 °C with anti-ENO1 (1:1000, mouse IgG, Abcam) or anti-p65 (rabbit IgG, Cell Signaling Technology) antibodies. Subsequently, the samples were treated with Alexa Fluor 594-conjugated anti-mouse secondary antibody and Alexa Fluor 488-conjugated anti-rabbit secondary antibody (Invitrogen). Images were acquired using a Leica DMi8 fluorescence microscope.

[0092] (5) Isolation of aorta leukocytes

[0093] After removing circulating blood by perfusing mice with cold PBS, the aorta was excised and perivascular adipose tissue was removed under a dissecting microscope. The aortic tissue was finely chopped and then digested in an enzyme mixture consisting of collagenase type I and XI, hyaluronidase type Is, and DNase I (all Sigma-Aldrich) at 37°C for 40 minutes while rotating continuously. The resulting cell suspension was passed through a 70-μm cell filter and centrifuged at 500 × g for 5 minutes at 4°C. The formed cell pellet was recovered and used for subsequent analysis.

[0094] (6) Flow cytometry analysis

[0095] For flow cytometry analysis of THP-1 cells or aortic immune cells, single-cell suspensions were prepared and reacted with Fc Blocker (BD Biosciences, San Jose, CA) at room temperature for 10 minutes. Subsequently, antibody staining was performed under dark conditions at 4°C for 30 minutes. The antibodies used are listed in Table 2. After staining, cells were washed twice with staining buffer and analyzed using a BD LSRII (BD Biosciences, San Jose, CA) or BD FACSCanto II (Beckon Dickinson, Sparks, MD, USA) flow cytometer. The acquired data were further analyzed using FlowJo software (version 10.6.2, Tree Star Inc., Ashland, OR).

[0097] Antibody Manufacturer Application Catalog# Fixable Viability Dye eFluor506 eBioscience FACS 65-0866-14 CD45 eFluor450 eBioscience FACS 48-0451-82 F4 / 80 PE eBioscience FACS 12-4801-80 CD11b PE-Cyanin7 eBioscience FACS 25-0112-81 CD11c APC-eFluor 780 eBioscience FACS 47-0114-82 Ly6C PerCP-Cyanin5.5 eBioscience FACS 45-5932-82 Ly6G (Gr-1) PE eBioscience FACS 12-9668-82 CD115 APC eBioscience FACS 17-1152-82 CD3e APC-eFluor 780 eBioscience FACS 47-0031-82 CD19 FITC eBioscience FACS 11-0193-82 CD3e PepCP-Cy5.5 eBioscience FACS 45-0031-80 CD4 PE-Cyanin7 eBioscience FACS 25-0042-82 CD8a eFluor450 eBioscience FACS 48-0081-82 Anti ENO 1 abcam IF & WB ab190365 Anti HSP90 SCBT WB sc-13119 Anti Β-Actin Sigma-Aldrich WB A1978 Anti NF-κB p65 CST IF & WB 6956S Anti Phospho-NF-κB p65 CST WB 3033S Anti IKKβ CST WB 8943S Anti Phospho-IKKα / β CST WB 2967S Anti IkBα CST WB 4841S Anti Phospho IkBα CST WB 2859S Anti Na + K + ATPase-α1 CST WB 3010S Anti α / β-Tubulin CST WB 2148S Anti F4 / 80 Abcam IHC ab100790 Anti phospho-AKT CST WB 4060S Anti AKT CST WB 9272S Anti NF-κB p65 CST WB 4764S Anti phospho-p38 CST WB 9216S Anti p38 CST WB 9228S Anti phospho-ERK CST WB 4370S Anti ERK CST WB 4695S Anti-βActin CST WB 3700S

[0098] (7) 면역블롯 분석(Immunoblot analysis)

[0099] After harvesting cells, whole cell lysates were prepared using RIPA buffer (Biosesang, Yongin, Korea) supplemented with protease and phosphatase inhibitors (Thermo Fisher Scientific, Waltham, MA), or subcellular fractionation was performed using the Mem-PER™Plus Membrane Protein Extraction Kit (Thermo Fisher) according to the manufacturer's instructions (5×10⁶ per condition for BMDMs). 6 (Using cells). Equal amounts of protein were separated by SDS-PAGE (4-12% or 10% gel) and transferred to a PVDF membrane (Millipore) using the semi-dry transfer device iBlot2 (Invitrogen, Waltham, MA). The membrane was blocked with 5% non-fat dry milk in TBST (BD Difco, Franklin Lakes, JN) or a phospho-block (Cell Biolabs Inc., San Diego, CA) for 1 hour at room temperature. Subsequently, the membrane was reacted with the primary antibody overnight at 4°C, followed by incubation with the HRP-conjugated secondary antibody (Cell Signaling Technology, Danvers, MA) for 2 hours at room temperature. The signal was expressed using an ECL substrate (ELIPISBIOTECH Inc., Daejeon, Republic of Korea) and detected using a C-Digit blot scanner (LI-COR, Lincoln, NE). Band intensity was quantified using ImageJ software. The antibodies used are listed in Table 2.

[0100] (8) 정량적 실시간 중합효소 연쇄반응(Quantitative real time polymerase chain reaction, qPCR)

[0101] Cells were harvested, and total RNA was extracted using the RNeasy Mini Kit (Qiagen, Hilden, Germany). Reverse transcription was performed with 1000 ng of total RNA using AccuPower®CycleScript RT PreMix (Bioneer, Daejeon, Korea) according to the manufacturer's instructions. qPCR amplification was performed on an Applied Biosystems™ 7500 Real-Time PCR System (Applied Biosystems™, Foster City, CA) using TOPreal SYBR green qPCR PreMix (Enzynomics, Daejeon, Korea). Relative expression of the target gene was calculated using the 2^-ΔΔCT method, and the primer sequences used in this experiment are listed in Table 3.

[0103] Species Target Sequences (5' to 3') 서열번호 Human IL1B Forward CCAGCTACGAATCTCCGACC 2 Reverse GGGAAAGAAGGTGCTCAGGT 3 IL6 Forward CCCCTGACCCAACCACAAAT 4 Reverse ATTTGCCGAAGAGCCCTCAG 5 TNF Forward CATCCAACCTTCCCAAACGC 6 Reverse CGAAGTGGTGGTCTTGTGC 7 CXCL8 Forward CTCCAAACCTTTCCACCCCA 8 Reverse TTCCTTGGGGTCCAGACAGA 9 CXCL10 Forward GCCATTCTGATTTGCTGCCT 10 Reverse ATGCTGATGCAGGTACAGCG 11 PTGS2 Forward CAAAACTAGGACTGGCCCTTCA 12 Reverse CAACACAGTGTCGCAGTGAAT 13 ITGAM Forward CAGGTGGTGAAAGGCAAGGA 14 Reverse CCTTCTCTTAGCCGATCCCCG 15 MMP9 Forward CAGTCCACCCTTGTGCTCTT 16 Reverse CGACTCTCCACGCATCTCTG 17 CSF1 Forward CTGGCGAGCAGGAGTATCAC 18 Reverse GCACGAGGTCTCCATCTGAC 19 CCL2 Forward ATGAAAGTCTCTGCCGCC 20 Reverse GGTGACTGGGGCATTGATTG 21 FN1 Forward AGTACGGCCACCAAGAAGTG 22 Reverse ACTGGCTGTGATTTCGGTCA 23 GAPDH Forward TCCAAAATCAAGTGGGGCGA 24 Reverse AAATGAGCCCCAGCTTCTC 25 Murine TNF Forward CAGGCGGTGCCTATGTCTC 26 Reverse CGATCACCCCGAAGTTCAGTAG 27 IL1B Forward GCAACTGTTCCTGAACTCAACT 28 Reverse ATCTTTTGGGGTCCGTCAACT 29 IL6 Forward TAGTCCTTCCTACCCCAATTTCC 30 Reverse TTGGTCCTTAGCCACTCCTTC 31 18s rRNA Forward TTGACGGAAGGGCACCACCAGCAG 32 Reverse GCACCACCACCCACGGAATCG 33

[0104] (9) Enzyme-linked immunosorbent assay, ELISA

[0105] The concentrations of IL-6, CXCL8, or TNF-α in the cell culture supernatant were quantified using DuoSet ELISA kits (all R&D Systems Inc., Minneapolis, MN) according to the manufacturer's instructions. Since there is inter-individual variability in basal cytokine secretion levels in human-derived cells, the data were normalized to an unstimulated control and expressed as a percentage (%) relative to the basal level.

[0106] (10) human vascular tissues

[0107] The human vascular tissues used in this experiment were provided by the Department of Pathology at Seoul National University Hospital and include tissues from patients with dilated cardiomyopathy and patients with myocardial infarction accompanied by arteriosclerosis. This experiment was approved by the Institutional Review Board (IRB) of Seoul National University Hospital (Approval No.: H-2212-166-1391), and the requirement to obtain informed consent from the subjects was waived by the IRB.

[0108] (11) animal studies

[0109] All animal experimental procedures for this study were approved by the Soonchunhyang University Animal Ethics Committee (SCH20-0082). Male Ldlr- / - mice purchased from Jackson Laboratory were housed under a 12-hour light-dark cycle and allowed to have free access to food and water. At 8 weeks of age, the mice were randomly divided into two groups with similar mean body weights and fed a purified diet to match Paigen's atherogenic rodent diet (Purified Diet to Match Paigen's Atherogenic Rodent Diet; Research Diets, New Brunswick, NJ, USA). After 8 weeks, the PP3m administration group was administered PP3m at a dose of 25 μg / mouse twice a week via retro-orbital injection. The control group was injected with the same dose of phenol red-free RPMI-1640 (Gibco). After 5 weeks of treatment, the mice were sacrificed, and serum, aorta, and liver were collected.

[0110] (12) statistical analysis

[0111] Data were expressed as mean ± standard error (SEM). A p-value of less than 0.05 was considered statistically significant. The Wilcoxon signed-rank test was performed for comparisons between the control and experimental groups, while one-way ANOVA was applied to comparisons of three or more groups, and the Games-Howell method was used for post-hoc testing. Statistical analysis was performed using SPSS software (version 26.0).

[0113] 2. test results

[0114] (1) ENO1 expression in atherosclerosis

[0115] To investigate the potential relevance of ENO1 in macrophages and its role in atherosclerosis, the inventors reanalyzed the publicly available GSE159677 single-cell RNA sequencing (scRNA-seq) dataset to more precisely characterize ENO1 expression within the myeloid compartment of atherosclerotic plaques. Data from three cases of carotid atherosclerotic plaques (AC) and three cases of proximal adjacent tissue (PA) were utilized for this analysis. To assess macrophage heterogeneity, the inventors analyzed a total of 9,636 cells, including 1,134 cells from PA and 8,502 cells from AC. These cells were classified into nine distinct types: resident macrophages (cluster 0), monocytes (cluster 1), TREM2 macrophages (cluster 2), ENO1 macrophages (cluster 3), natural killer cells (cluster 4), and two unidentified cell types (clusters 7 and 8) (Fig. 1A-B). For each cluster defined in Fig. 1A, the 30 genes most significantly upregulated in each cluster (in order of decreasing P-values) were shown as a heatmap and displayed along with the selected abundance-expressed genes used for the biological identification of each cluster, with the scale represented as a log2 fold change in Fig. 1C.Each cell cluster was annotated based on the following high-expression genes (Fig. 1D): resident macrophages (C1QA, MRC1, and FCGR3A), monocytes (S1000A8, FCN, LYZ), TREM macrophages (TREM2, APOC1, and APOE), ENO1 macrophages (ENO1, MACRO, and CCL2), conventional dendritic cells (FCER1A, CD1C, and PKIB), natural killer cells (NKG7, CD3E, and GZMA), smooth muscle cells (CALD1, MYL9, and COL14A1), and unidentified cells. Stacked bar plot analysis showed that the proportion of ENO1 macrophages and TREM macrophages in the atherosclerotic plaque group was significantly increased compared to the non-atherosclerotic plaque group, while the proportion of monocytes was significantly decreased and resident macrophages were slightly decreased (Fig. 1E). In addition, violin plots and comparative analyses of CD68 and ENO1 expression across nine clusters showed that CD68 expression in AC was increased in all clusters compared to PA, and ENO1 expression was particularly high in cluster 3 of AC (Figs. 1F and 1G).

[0116] These results suggest that a phenotypic shift occurs in the myeloid cellular environment of atherosclerotic plaques, with a decrease in monocytes and resident macrophages, and an increase in pro-atherogenic ENO1+ and TREM2+ macrophages.

[0117] (2) Distinct ENO1 expression patterns in M1 and M2 macrophages in atherosclerosis

[0118] scRNA-seq analysis confirmed a significant increase in ENO1+ macrophages in human atherosclerotic plaques, and accordingly, the inventors sought to verify these observations in independent patient samples. The inventors performed immunohistochemistry on vascular sections obtained from patients with dilated cardiomyopathy (n=4, non-atherosclerotic control group) and patients with confirmed myocardial infarction and atherosclerosis (n=3) (Figures 2A and 2B). ENO1 staining was significantly increased in atherosclerotic plaques and co-localized with CD68, a marker of M1 macrophages. CD68-positive macrophages with low CD163 expression exhibited higher levels of inflammatory cytokines, consistent with the characteristics of M1 macrophages. Conversely, macrophages with high CD163 expression were associated with reduced inflammation, suggesting M2 macrophage polarization. Comparative analysis between non-atherosclerotic patients (dilated cardiomyopathy) and atherosclerotic patients (myocardial infarction accompanied by atherosclerosis) revealed different patterns of macrophage polarization. In atherosclerotic patients, M1 macrophages were predominantly present in the plaque regions, suggesting an inflammatory microenvironment that contributes to disease progression. In contrast, ENO1 and CD68 expression were reduced in the vascular sections of non-atherosclerotic patients, and the proportion of CD163-positive macrophages was higher, indicating a lower inflammatory state.

[0119] These results verify that the upregulation of ENO1 in atherosclerotic lesions is accompanied by M1 polarization, while conversely, M2 macrophages are dominant in non-diseased vascular tissue.

[0120] (3) Atherogenic stimuli induce membrane translocation of ENO1 in macrophages

[0121] Next, the inventors investigated the expression and intracellular localization of ENO1 in macrophages exposed to atherosclerotic stimuli (LPS or oxLDL). Flow cytometry revealed a significant increase in surface ENO1 levels upon LPS treatment in PMA-differentiated THP-1 cells (Fig. 3A), which was subsequently verified in primary bone marrow-derived macrophages (BMDMs). Consistent with the THP-1 results, LPS induced strong and sustained upregulation of surface ENO1 in BMDMs for up to 24 hours (Fig. 3B). Subcellular fractionation and immunoblotting analyses showed a significant increase in membrane-associated ENO1 after LPS stimulation—peaking at 24 hours—while cytoplasmic ENO1 remained unchanged, suggesting that ENO1 was translocated to the cell membrane (Fig. 3C). As a result of the quantitative analysis in Fig. 3C, the level of ENO1 within the cell membrane increased more than twofold at 24 hours (0 h: 1, 6 h: 0.9, 12 h: 1.3, 24 h: 2.1). Similarly, oxLDL treatment also increased the localization of ENO1 on the cell surface in BMDMs, which was confirmed by membrane fraction immunoblot analysis (Fig. 3D).

[0122] These results show that atherosclerotic stimulation dynamically moves intracellularly stored ENO1 from macrophages to the cell surface.

[0123] (4) ApoB100-derived peptide PP3m attenuates inflammatory responses in PBMCs via differential modulation of cytokine secretion and transcriptional regulation

[0124] To evaluate the anti-inflammatory potential of ApoB100-derived peptides (PP3 and PP3m), the inventors stimulated PBMCs with ApoB100 to mimic the chronic, low-grade vascular inflammatory state characteristic of atherosclerosis. Subsequently, under these conditions, the ApoB100-derived peptides were applied to evaluate their regulatory effects within a complex immune environment. ELISA analysis of the culture supernatant revealed that ApoB100 strongly induced the secretion of IL-6 and CXCL8, whereas PP3m pretreatment—unlike PP3—significantly inhibited both cytokines to basal levels (Fig. 4A). Next, to evaluate the ability of the peptides to alleviate acute inflammatory responses, PBMCs were pretreated with PP3 or PP3m and then stimulated with LPS. LPS induced significant upregulation of IL1B, IL6, TNF, PTGS2, and CXCL8 mRNA, and both peptides significantly inhibited their respective transcripts (Fig. 4B). However, when cytokine protein levels were measured by ELISA after LPS stimulation, neither peptide statistically significantly reduced the secretion of IL-6, CXCL8, or TNF-α (Fig. 4C).

[0125] These results demonstrate that ApoB100-derived peptides—particularly the modified peptide PP3m—effectively inhibit chronic ApoB100-induced IL-6 and CXCL8 secretion and can suppress LPS-induced inflammatory gene transcription. The absence of immediate protein-level inhibition under strong LPS stimulation suggests that optimized dosage or adjustment of the timing of treatment may be necessary for transcriptional inhibition to lead to a reduction in actual cytokine secretion.

[0126] (5) ApoB100-derived peptides attenuate M1 polarization and NF-κB / p38 signaling in macrophages

[0127] To elucidate the anti-inflammatory potential of ApoB100-derived peptides and their underlying mechanisms, the inventors used several macrophage models, including human THP-1 macrophages, mouse RAW264.7 cells, and primary bone marrow-derived macrophages (primary BMDMs). First, the inventors evaluated the effects of these peptides on macrophage differentiation. THP-1 cells were pretreated with PP3 or PP3m before exposure to PMA. PP3m significantly reduced ITGAM expression compared to treatment with PMA alone (Fig. 5A). Simultaneously, PP3m reduced the expression of M1 macrophage-associated genes TNF and MMP9. Neither PP3 nor PP3m affected the upregulation of M2 macrophage markers CD163 and MRC1 induced by PMA (data not presented). These results suggest that PP3m specifically inhibits the development of a pro-inflammatory M1 phenotype during macrophage differentiation. Next, the inventors investigated the effects of the peptides on fully differentiated macrophages. THP-1 cells were first differentiated into PMA and then polarized to the M1 phenotype using LPS. In this model, treatment with PP3m significantly reduced MMP9 mRNA levels, whereas PP3 selectively reduced CXCL8 expression (Fig. 5B). This demonstrates that the ApoB100-derived peptide differentially regulates M1-related genes. To elucidate the molecular mechanism, the inventors evaluated the effects of the peptides on LPS-induced inflammatory signaling. LPS stimulation increased the phosphorylation of Akt, NF-κB p65, p38, and Erk. Notably, PP3 inhibited the phosphorylation of Akt, NF-κB p65, and Erk within 30 minutes, whereas PP3m selectively inhibited the phosphorylation of NF-κB p65 and p38 during the same time interval (Figs. 5C and 5D).These differing patterns of inhibition suggest that ApoB100-derived peptides limit inflammatory activation through inhibitory effects on major signaling pathways. To verify these results in primary cells, the inventors treated BMDMs with LPS in the presence or absence of PP3m. LPS strongly induced inflammatory cytokine mRNAs (Tnf, Il6, and Il1b), while PP3m treatment significantly reduced them (Fig. 10A). Western blot analysis revealed that PP3m significantly reduced the phosphorylation of IKK and NF-κB p65 induced by LPS (Fig. 10B), and immunofluorescence analysis confirmed that it inhibited the nuclear translocation of p65 (Fig. 10C). Importantly, Seahorse analysis showed that PP3m slightly reduced glycolytic activity, but this was not statistically significant (Fig. 11C-D), suggesting that the anti-inflammatory effects of PP3m occur primarily independently of glycolytic regulation. As an internal control, ENO1 knockdown significantly reduced the ability to do so (Fig. 11A-B), which confirms the sensitivity of the analysis of ENO1-dependent metabolic changes.

[0128] Taken together, these results establish that ApoB100-derived peptides effectively reduce pro-inflammatory gene expression and disrupt NF-κB-mediated signaling during acute inflammatory stimulation in both modified cells and primary macrophages through antagonism against ENO1.

[0129] (6) PP3m peptide inhibits oxLDL-induced foam cell formation and DiI-oxLDL uptake in macrophages

[0130] To investigate whether the ApoB100-derived peptide PP3m could inhibit atherosclerotic foam cell formation, THP-1 monocytes were differentiated into PMA and exposed to oxLDL with or without PP3m treatment. Foam cell formation was first evaluated using Oil Red O staining, and extensive intracellular lipid accumulation was observed in oxLDL-treated macrophages. PP3m pretreatment reduced both the proportion of Oil Red O-positive cells and the number of lipid droplets per cell in a dose-dependent manner (Fig. 6A). This indicates that excessive lipid accumulation was inhibited. Next, the inventors directly quantified oxLDL uptake using DiI-labeled oxLDL and fluorescence microscopy. PP3m pretreatment reduced the proportion of DiI-positive macrophages in a concentration-dependent manner (Fig. 6B), and image-based quantitative analysis confirmed a statistically significant decrease in average fluorescence intensity compared to the untreated control group (Fig. 6C).

[0131] The above results show that PP3m inhibits the intracellular influx of oxLDL and subsequent lipid accumulation in macrophages, supporting its potential to block foam cell formation during the atherosclerosis process.

[0132] (7) PP3m attenuates atherosclerosis and vascular inflammation in Ldlr- / - mice without altering plasma lipids

[0133] To evaluate the in vivo efficacy of PP3m, Ldlr- / - mice were fed an atherosclerotic diet for 13 weeks, and PP3m was administered intravenously twice a week for the last 5 weeks (Fig. 7A). At the time of sacrifice, there was no difference in body weight and liver weight between the PP3m treatment group and the control group (Figs. 13A and 13B). En-face analysis of the aorta showed a significant reduction in lesion area in PP3m-treated mice (Fig. 7B, P<0.05). Histological analysis of the aortic root revealed a significant reduction in plaque size (H&E staining), lipid deposition (Oil Red O staining), and collagen content (Masson's trichrome staining) after PP3m treatment (Fig. 7C), and quantitative analysis confirmed a reduction in lesion area (P<0.0001; Fig. 7D) and lipid burden (P<0.001; Fig. 7E). To investigate the cytological mechanism of these effects, the inventors evaluated macrophage accumulation within atherosclerotic lesions using F4 / 80 immunostaining and flow cytometry. PP3m-treated mice showed a slight decrease in F4 / 80+ cells in the aortic root (Fig. 8A), but this was not statistically significant. On the other hand, flow cytometry results confirmed a significant decrease in F4 / 80+ CD11b+ macrophages throughout the aorta of PP3m-treated mice (Figs. 8B-C), while no changes were observed in dendritic or T cell populations (Figs. 8D-E). Since atherosclerosis is a disease involving both lipid metabolism abnormalities and chronic inflammation, the inventors next evaluated systemic inflammatory markers and lipid profiles. PP3m treatment confirmed a potent anti-inflammatory effect by significantly reducing the levels of circulating inflammatory cytokines TNF-α, IL-6, and IL-1β compared to untreated mice (Fig. 9A). It is worth noting that there was no change in plasma total cholesterol, LDL-C, and HDL-C levels after PP3m treatment (Fig. 9B).

[0134] Taken together, these results show that PP3m limits the progression of atherosclerotic lesions by inhibiting inflammation and macrophage infiltration—particularly within the entire aorta—independently of systemic lipid levels.

Claims

Claim 1 A peptide represented by the amino acid sequence of SEQ ID NO.

1. Claim 2 A peptide according to claim 1, wherein the N-terminus of the peptide is bonded to a protecting group selected from the group consisting of an acetyl group, a fluorenylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and polyethylene glycol (PEG), or the C-terminus of the peptide is bonded to a protecting group selected from the group consisting of an amino group and an azide. Claim 3 In claim 1, the peptide is a peptide that binds to ENO1 (Enolase 1). Claim 4 The peptide of claim 1, wherein the peptide inhibits the expression of one or more selected from the group consisting of IL1B (Interleukin-1 beta), IL6 (Interleukin-6), TNFα (Tumor necrosis factor-alpha), PTGS2 (Prostaglandin-endoperoxide synthase 2) and CXCL8 (CXC motif chemokine ligand 8), or the peptide inhibits the signal transduction of NF-κB (Nuclear factor kappa B) or p38 (p38 mitogen-activated protein kinase). Claim 5 In claim 1, the peptide is a peptide that inhibits foam cell or plaque formation or reduces macrophage infiltration. Claim 6 A pharmaceutical composition for the prevention or treatment of inflammatory diseases comprising a peptide of any one of claims 1 to 5, or a polynucleotide encoding the same. Claim 7 A pharmaceutical composition for the prevention or treatment of atherosclerotic cardiovascular disease comprising a peptide of any one of claims 1 to 5, or a polynucleotide encoding the same. Claim 8 A composition according to claim 7, wherein the arteriosclerotic cardiovascular disease is an ischemic vascular disease. Claim 9 A composition according to claim 8, wherein the ischemic vascular disease is one selected from the group consisting of myocardial infarction, angina pectoris, ischemic encephalopathy, stroke, and peripheral artery disease. Claim 10 A health functional food composition for improving blood circulation, or for preventing or improving inflammatory diseases or arteriosclerotic cardiovascular diseases, comprising a peptide of any one of claims 1 to 5, or a polynucleotide encoding the same. Claim 11 In claim 10, the above-mentioned arteriosclerotic cardiovascular disease is an ischemic vascular disease, the composition. Claim 12 A composition according to claim 11, wherein the ischemic vascular disease is one selected from the group consisting of myocardial infarction, angina pectoris, ischemic encephalopathy, stroke, and peripheral artery disease.

Images