Composition for discrimination goat identification and breeds, and uses thereof
By employing SNP markers to analyze mitochondrial DNA sequences, the method addresses the challenge of distinguishing native black goats from other breeds, ensuring accurate breed identification and traceability, thereby preventing economic losses and social unrest.
Patent Information
- Application Number
- KR1020230165264
- Authority / Receiving Office
- KR · KR
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2023-11-24
- Publication Date
- 2026-07-15
- Estimated Expiration
- 2043-11-24
AI Technical Summary
The increasing indiscriminate crossbreeding between imported and native black goats has led to difficulties in distinguishing purebred black goats, causing economic losses and social unrest, as well as challenges in establishing proper selection criteria and traceability systems.
The use of specific SNP markers, including polynucleotides and primer sets, to identify individual goats and breeds by analyzing mitochondrial DNA sequences, enabling rapid, accurate, and economical differentiation between native black goats and other breeds.
This method allows for precise identification of goat breeds, supporting pedigree management and traceability systems, preventing illegal distribution of goat meat, and enhancing breeding effectiveness.
Smart Images

Figure 112023131462567-PAT00001
Abstract
Description
Technology Field
[0001] The present invention relates to a composition for identifying individual goats and breeds, a kit using the same, and a method for identifying breeds. Background Technology
[0003] In traditional Korean medicine, black goat meat is classified as a warming food. It has long been widely used as a tonic for pregnant women, as it is believed that consuming goat meat warms the entire body when the elderly feel cold. From a nutritional perspective, black goat meat is known to be low in fat but rich in protein, calcium, and iron; furthermore, its tender muscle fibers result in a very high digestion and absorption rate. Examining the efficacy of black goat meat recorded in the *Donguibogam* (a classic Korean medical text), it is referred to as a food of "three lows and four highs." It is stated that it warms the body, nourishes internal organs, and increases vital energy (qi), while also stabilizing the heart and calming nervousness. Additionally, it is recorded that goat milk treats cold and deficiency, goat lungs nourish the lungs and stop coughing, kidneys address kidney weakness, and the gallbladder treats blindness and improves eyesight. Notably, it is noted that the horns eliminate postpartum pain and headaches caused by wind, and the bone marrow treats a deficiency of yang energy.
[0004] However, since 1990, as the import of black goats has been liberalized, the number of black goats being raised has gradually increased due to indiscriminate crossbreeding between imported black goats and native black goats, while the number of native black goats being raised has been rapidly decreasing.
[0005] Furthermore, as the demand for black goats increases, including in specialty restaurants and processed products such as steamed black goat stew, irregularities are becoming rampant where imported black goats and meat from other breeds are being disguised and sold as traditional black goat meat. This is causing immense economic losses and damage to both purebred traditional black goat farmers and consumers, while also creating social unrest.
[0006] Therefore, in order to establish proper selection criteria for Korea's native black goats and to validate their pure bloodline, it is crucial to develop technology for identifying pure native black goat individuals and breeds that can be differentiated from imported black goat breeds and imported goat meat.
[0007] Accordingly, the inventor utilized the fact that the genetic (DNA) structure differs for each individual goat to discover individual-specific SNPs from the mitochondrial DNA of native black goats and foreign breed goats, and arrived at the present invention, which enables the identification of individual goats and breeds by utilizing these SNPs.
[0008] In addition, according to the present invention, the breed of goat can be identified in a more rapid, accurate, and economical way, and through pedigree management and breeding improvement using this, it can be very usefully utilized to provide a scientific basis for future goat pedigree investigations and to supplement a traceability system that can prevent illegal distribution of goat meat. Prior art literature
[0010] Republic of Korea Published Patent No. 10-2021-0157179 The problem to be solved
[0011] The present invention aims to provide SNP markers for identifying individual goats and breeds.
[0012] In addition, the present invention aims to provide a composition and a kit for identifying one or more selected from the group consisting of native black goats, Alpine, Nubian, Saanen, Tokkenburg, Holstein, and Bohr, including SNP markers for identifying individual goats and breeds.
[0013] In addition, the present invention aims to provide a method for identifying individual goats and breeds using the above-mentioned composition for identifying individual goats and breeds.
[0014] However, the technical problems that the present invention aims to solve are not limited to those mentioned above, and other unmentioned problems will be clearly understood by those skilled in the art from the description below. means of solving the problem
[0016] According to one embodiment of the present invention, the 2446th of the nucleotide sequence represented by SEQ ID NO. 1; the 3648th of the nucleotide sequence represented by SEQ ID NO. 2; the 4635th of the nucleotide sequence represented by SEQ ID NO. 3; the 5288th of the nucleotide sequence represented by SEQ ID NO. 4; the 7365th of the nucleotide sequence represented by SEQ ID NO. 5; the 7904th of the nucleotide sequence represented by SEQ ID NO. 6; the 9507th of the nucleotide sequence represented by SEQ ID NO. 7; the 13847th of the nucleotide sequence represented by SEQ ID NO. 8; the 14319th of the nucleotide sequence represented by SEQ ID NO. 9; the 15836th of the nucleotide sequence represented by SEQ ID NO. 10; the 15975th of the nucleotide sequence represented by SEQ ID NO. 11; the 16012th of the nucleotide sequence represented by SEQ ID NO. 12; and the 16033rd of the nucleotide sequence represented by SEQ ID NO. 13; A SNP marker for identifying goat individuals and breeds is provided, comprising one or more polynucleotides selected from the group consisting of a polynucleotide composed of 10 to 500 consecutive bases including a singlenucleotide polymorphism located at the 16038th base of the base sequence indicated by SEQ ID NO. 14; and a polynucleotide located at the 16140th base of the base sequence indicated by SEQ ID NO. 15, and a polynucleotide complement thereof, or a polynucleotide complement thereof.
[0017] In the present invention, the goat may be characterized as being one or more selected from the group consisting of native black goat, Alpine, Nubian, Saanen, Tockenburg, Holstein, and Boer.
[0018] According to another embodiment of the present invention, a composition for identifying goat individuals and breeds is provided, comprising a preparation capable of detecting or amplifying SNP markers for identifying goat individuals and breeds according to the present invention.
[0019] In the present invention, the formulation may be characterized as being a primer set or probe capable of detecting or amplifying a polynucleotide in a region containing one or more SNP markers selected from the group consisting of SNP markers of SEQ ID NOs 1 to 15, or a polynucleotide complementary thereto.
[0020] In the present invention, the primer set may be characterized as being one or more selected from the group consisting of primer sets represented by SEQ ID NOs 16 and 17; 18 and 19; 20 and 21; 22 and 23; 24 and 25; 26 and 27; 28 and 29; 30 and 31; 32 and 33; 34 and 35; 36 and 37; 38 and 39; 40 and 41; 42 and 43; 44 and 45; and 46 and 47.
[0021] According to another embodiment of the present invention, a kit for identifying goat individuals and breeds is provided, comprising a composition for identifying goat individuals and breeds according to the present invention.
[0022] According to another embodiment of the present invention, a method for identifying a goat individual and breed is provided, comprising: (a) a step of isolating nucleic acid from a goat individual to be identified; (b) a step of amplifying an SNP marker for identifying a goat individual and breed according to claim 1 from the isolated nucleic acid; and (c) a step of determining the nucleotide sequence of each amplified SNP marker of step (b) and analyzing the same.
[0023] In the present invention, step (C) comprises: the 2446th base of the base sequence represented by SEQ ID NO. 1 is T or C; the 3648th base of the base sequence represented by SEQ ID NO. 2 is T or C; the 4635th base of the base sequence represented by SEQ ID NO. 3 is C or T; the 5288th base of the base sequence represented by SEQ ID NO. 4 is T or C; the 7365th base of the base sequence represented by SEQ ID NO. 5 is T or C; the 7904th base of the base sequence represented by SEQ ID NO. 6 is C or T; the 9507th base of the base sequence represented by SEQ ID NO. 7 is T or C; the 13847th base of the base sequence represented by SEQ ID NO. 8 is T or C; the 14319th base of the base sequence represented by SEQ ID NO. 9 is C or T; and the 15836th base of the base sequence represented by SEQ ID NO. 10 is G or A; The identification of individual goats and breeds may be characterized in that the 15975th base of the base sequence indicated by SEQ ID NO. 11 is A or G; the 16012th base of the base sequence indicated by SEQ ID NO. 12 is G or A; the 16033rd base of the base sequence indicated by SEQ ID NO. 13 is T or C; the 16038th base of the base sequence indicated by SEQ ID NO. 14 is C or T; or the 16140th base of the base sequence indicated by SEQ ID NO. 15 is T or C.
[0024] In the present invention, step (c) comprises: the 2446th base of the base sequence represented by SEQ ID NO. 1 is T or C; the 3648th base of the base sequence represented by SEQ ID NO. 2 is T or C; the 4635th base of the base sequence represented by SEQ ID NO. 3 is C or T; the 5288th base of the base sequence represented by SEQ ID NO. 4 is T or C; the 7904th base of the base sequence represented by SEQ ID NO. 6 is C or T; the 9507th base of the base sequence represented by SEQ ID NO. 7 is T or C; the 13847th base of the base sequence represented by SEQ ID NO. 8 is T or C; the 14319th base of the base sequence represented by SEQ ID NO. 9 is C or T; the 15836th base of the base sequence represented by SEQ ID NO. 10 is G or A; and the 15975th base of the base sequence represented by SEQ ID NO. 11 is A or G; It may be characterized by identifying a native black goat breed when the 16012th base of the base sequence indicated by SEQ ID NO. 12 is G or A; the 16033rd base of the base sequence indicated by SEQ ID NO. 13 is T or C; or the 16140th base of the base sequence indicated by SEQ ID NO. 15 is T or C.
[0025] In the present invention, step (c) may be characterized by identifying as one or more of Alpine, Nubian, Saanen, or Toggenburg varieties when the 2446th base of the base sequence indicated by SEQ ID NO. 1 is T or C; the 3648th base of the base sequence indicated by SEQ ID NO. 2 is T or C; the 4635th base of the base sequence indicated by SEQ ID NO. 3 is C or T; the 5288th base of the base sequence indicated by SEQ ID NO. 4 is T or C; the 7365th base of the base sequence indicated by SEQ ID NO. 5 is T or C; the 7904th base of the base sequence indicated by SEQ ID NO. 6 is C or T; the 14319th base of the base sequence indicated by SEQ ID NO. 9 is C or T; or the 16140th base of the base sequence indicated by SEQ ID NO. 15 is T or C.
[0026] In the present invention, step (c) may be characterized by identifying the native black goat breed and one or more of the Alpine, Nubian, Saanen, or Toggenburg breeds when the 2446th base of the base sequence represented by SEQ ID NO. 1 is T or C; the 3648th base of the base sequence represented by SEQ ID NO. 2 is T or C; the 4635th base of the base sequence represented by SEQ ID NO. 3 is C or T; the 5288th base of the base sequence represented by SEQ ID NO. 4 is T or C; the 7904th base of the base sequence represented by SEQ ID NO. 6 is C or T; the 14319th base of the base sequence represented by SEQ ID NO. 9 is C or T; or the 16140th base of the base sequence represented by SEQ ID NO. 15 is T or C.
[0027] According to another embodiment of the present invention, a method for identifying a native black goat individual is provided using the goat individual and breed identification method according to the present invention. Effects of the invention
[0029] When using the composition and identification method for identifying individual goats and breeds according to the present invention, the breed of a goat can be identified in a more rapid, accurate, and economical manner. Furthermore, through pedigree management and breed improvement using this method, it provides the effect of being very useful for establishing a scientific basis for future goat pedigree investigations and supplementing a traceability system that can prevent the illegal distribution of goat meat. Specific details for implementing the invention
[0031] Hereinafter, to explain more specifically, examples will be provided for detailed description. However, the following examples are illustrative and the scope of the present invention is not limited thereto.
[0032] Additionally, for convenience, specific terms are defined herein to facilitate a better understanding of the present invention. Unless otherwise defined herein, scientific and technical terms used in this invention shall have the meanings generally understood by those skilled in the art. Furthermore, unless specifically indicated in the context, terms in their singular form shall be understood to include their plural form, and terms in their plural form shall be understood to include their singular form.
[0033] According to one embodiment of the present invention, the 2446th of the nucleotide sequence represented by SEQ ID NO. 1; the 3648th of the nucleotide sequence represented by SEQ ID NO. 2; the 4635th of the nucleotide sequence represented by SEQ ID NO. 3; the 5288th of the nucleotide sequence represented by SEQ ID NO. 4; the 7365th of the nucleotide sequence represented by SEQ ID NO. 5; the 7904th of the nucleotide sequence represented by SEQ ID NO. 6; the 9507th of the nucleotide sequence represented by SEQ ID NO. 7; the 13847th of the nucleotide sequence represented by SEQ ID NO. 8; the 14319th of the nucleotide sequence represented by SEQ ID NO. 9; the 15836th of the nucleotide sequence represented by SEQ ID NO. 10; the 15975th of the nucleotide sequence represented by SEQ ID NO. 11; the 16012th of the nucleotide sequence represented by SEQ ID NO. 12; and the 16033rd of the nucleotide sequence represented by SEQ ID NO. 13; The present invention provides an SNP marker for identifying goat individuals and breeds, comprising one or more polynucleotides selected from the group consisting of a polynucleotide composed of 10 to 500 consecutive nucleotides including a singlenucleotide polymorphism located at the 16038th nucleotide of the nucleotide sequence indicated by SEQ ID NO. 14; and a polynucleotide complementary thereof, and a polynucleotide complementary thereof.
[0034] The term "SNP (Single Nucleotide Polymorphism)" used in the present invention refers to a single nucleotide polymorphism. An SNP refers to one or tens of nucleotide variations that represent individual deviations among the 3 billion nucleotide sequences in the chromosomes within the cell nucleus, and as a result, differences such as phenotype, responsiveness to drugs, and resistance to diseases occur.
[0035] The term "SNP marker" in the present invention refers to a single nucleotide polymorphism allele base pair on a DNA sequence used to identify an individual or species. Since SNPs are relatively high-frequency, stable, and distributed throughout the genome, and thus cause genetic diversity in individuals, SNP markers can serve as indicators of genetic proximity between individuals. SNP markers generally include phenotypic changes associated with single nucleotide polymorphisms, but in some cases, they may not.
[0036] The term “nucleotide” in the present invention refers to a deoxyribonucleotide or ribonucleotide existing in a single-stranded or double-stranded form, and includes analogs of natural nucleotides unless otherwise specifically noted (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90:543-584 (1990)).
[0037] Additionally, the polynucleotide or its complementary polynucleotide has a polymorphic sequence. A polymorphic sequence refers to a sequence containing a polymorphic site containing an SNP within the polynucleotide sequence, and the polynucleotide may be 10 or more, and may consist of, for example, 5 to 100, 10 to 80, 10 to 60, or 10 to 40 consecutive bases, but may not be limited thereto.
[0038] The term "polymorphism" in the present invention refers to the case where two or more alleles exist at a single gene locus, and among the polymorphic regions, those in which only a single nucleotide differs depending on the individual are called single nucleotide polymorphisms. A preferred polymorphism marker has two or more alleles that exhibit an occurrence frequency of 1% or more, more preferably 5% or 10% or more, in a selected population.
[0039] The term "allele" in this invention refers to multiple types of a single gene located at the same locus on homologous chromosomes. Alleles are also used to indicate polymorphism; for example, an SNP has two types of alleles.
[0040] Accordingly, in the present invention, the SNP marker for identifying goat individuals and breeds may refer to a region located within the mitochondrial DNA base sequence of the goat.
[0041] Specifically, the 2446th base of the base sequence represented by SEQ ID NO. 1 may be a polynucleotide containing an SNP site in which the base is T or C.
[0042] In addition, the 3648th base of the base sequence indicated by SEQ ID NO. 2 may be a polynucleotide containing an SNP site in which the base is T or C.
[0043] In addition, the 4635th base of the base sequence indicated by SEQ ID NO. 3 may be a polynucleotide containing an SNP site in which the base is C or T.
[0044] In addition, the 5288th base of the base sequence indicated by SEQ ID NO. 4 may be a polynucleotide containing an SNP site in which the base is T or C.
[0045] In addition, the 7365th base of the base sequence indicated by SEQ ID NO. 5 may be a polynucleotide containing an SNP site in which the base is T or C.
[0046] In addition, the 7904th base of the base sequence indicated by SEQ ID NO. 6 may be a polynucleotide containing an SNP site in which the base is C or T.
[0047] In addition, the 9507th base of the base sequence indicated by SEQ ID NO. 7 may be a polynucleotide containing an SNP site in which the base is T or C.
[0048] In addition, the 13847th base of the base sequence indicated by SEQ ID NO 8 may be a polynucleotide containing an SNP site in which the base is T or C.
[0049] In addition, the 14319th base of the base sequence indicated by SEQ ID NO 9 may be a polynucleotide containing an SNP site in which the base is C or T.
[0050] In addition, the 15836th base of the base sequence represented by SEQ ID NO 10 may be a polynucleotide containing an SNP site in which the base is G or A.
[0051] In addition, the 15975th base of the base sequence represented by SEQ ID NO 11 may be a polynucleotide containing an SNP site that is A or G.
[0052] In addition, the 16012th base of the base sequence represented by SEQ ID NO. 12 may be a polynucleotide containing an SNP site in which the base is G or A.
[0053] In addition, the 16033rd base of the base sequence indicated by SEQ ID NO. 13 may be a polynucleotide containing an SNP site in which the base is T or C.
[0054] In addition, the 16038th base of the base sequence represented by SEQ ID NO 14 may be a polynucleotide containing an SNP site in which the base is C or T.
[0055] In addition, the 16140th base of the base sequence represented by SEQ ID NO 15 may be a polynucleotide containing an SNP site that is T or C.
[0056] In the present invention, the SNP markers for identifying goat individuals and breeds are useful individually as markers for identifying goat individuals and breeds, and since the accuracy of prediction can be increased as the number of markers included increases when combining the markers, they can also be utilized as a set of SNP markers for identifying goat individuals and breeds.
[0057] In the present invention, the goat may be characterized as being one or more selected from the group consisting of native black goat, Alpine, Nubian, Saanen, Tockenburg, Holstein, and Boer.
[0058] The above chlorine is Capra aegagrus hircus It is an animal of the family Bovidae, order Artiodactyla, with the scientific name of...
[0059] The above-mentioned native black goat refers to a Korean native black goat with an overall black body color, characterized by an adult body length of 60 to 80 cm and a shoulder height of around 50 cm.
[0060] The aforementioned Alpine goat originated in the French Alps and is a medium-to-large domestic breed known for its excellent milking ability; it is characterized by straight, erect ears, although it does not have a fixed color or marking.
[0061] The above Nubian originated from a cross between a mixed population of native British goats and large-eared floppy goats imported from India, the Middle East, and North Africa in the 19th century, and is also called the Anglo-Nubian. It is characterized by long legs, a noticeably convex facial contour, and long, floppy ears.
[0062] The aforementioned Saanen is called Saanen or Saanen species and is a representative useful species originating from the Saanen Valley in Switzerland. It is distributed globally and is divided into various species depending on the region inhabited.
[0063] The aforementioned Toggenburger is a traditional goat breed from the Toggenburg and Werdenberg regions of the eastern Swiss canton of St. Gallen, which is distributed worldwide and used as a useful breed.
[0064] The aforementioned Holstein Friesians are native to the Friesland region of the Netherlands, are distributed worldwide, and are used as both utility and meat breeds.
[0065] The above Boer is called the Boer or Boerbok, and it is a breed originating from South Africa that is used as a meat breed.
[0066] In addition, the present invention may refer to Alpine, Nubian, Saanen, Tockenburg, or Holstein as dairy goats or utility breeds, and may refer to Boer as meat breeds, but is not limited thereto.
[0067] In this case, the above dairy goat or useful breed refers to an individual or breed intended for milk production, and the above meat breed refers to an individual or breed intended for food.
[0068] According to another embodiment of the present invention, a composition for identifying goat individuals and breeds is provided, comprising a preparation capable of detecting or amplifying SNP markers for identifying goat individuals and breeds according to the present invention.
[0069] The above "preparation" is a preparation capable of specifically binding to and recognizing a polymorphic site containing an SNP for identifying the goat individual and breed, or amplifying the polymorphic site, and specifically may mean a probe capable of specifically binding to a polymorphic site containing an SNP, a polynucleotide containing the SNP marker, or a primer capable of specifically amplifying a polynucleotide complementary thereto.
[0070] In the present invention, the formulation may be characterized as being a primer set or probe capable of detecting or amplifying a polynucleotide in a region containing one or more SNP markers selected from the group consisting of SNP markers of SEQ ID NOs 1 to 15, or a polynucleotide complementary thereto.
[0071] The term “primer” above refers to a short sequence having a short free 3’ hydroxyl group, capable of forming base pairs with a complementary template, and functioning as a starting point for template strand replication.
[0072] Additionally, the primer used for amplifying the SNP marker of the present invention may be a single-stranded oligonucleotide capable of acting as a starting point for template-directed DNA synthesis under appropriate conditions in a suitable buffer (e.g., four different nucleoside triphosphates and a polymerizer such as DNA, RNA polymerase, or reverse transcriptase) and a suitable temperature, wherein the appropriate length of the primer may vary depending on the purpose of use, but is typically used in a size of 15 to 30 nucleotides. The primer sequence does not need to be completely complementary to the polynucleotide containing the SNP marker or its complementary polynucleotide, and may be used if it is sufficiently complementary to hybridize.
[0073] The above "probe" is used to bind to and recognize an SNP marker and includes a sequence complementary to a polynucleotide sequence containing the SNP, and may be in the form of DNA, RNA, or a DNA-RNA hybrid, though not limited thereto. Additionally, a fluorescent marker, a radioactive marker, etc., may be additionally attached to the 5' or 3' end of the probe to make it recognizable visually.
[0074] Additionally, “probe” refers to a linear oligomer having a natural or modified monomer or bond comprising deoxyribonucleotides and ribonucleotides that can hybridize to a specific nucleotide sequence. Specifically, the probe is single-stranded for maximum hybridization efficiency. More specifically, the probe is a deoxyribonucleotide.
[0075] Additionally, the probe may be used as a sequence that is perfectly complementary to the sequence containing the SNP, but may also be used as a substantially complementary sequence within a range that does not interfere with specific hybridization. Specifically, the probe used in the present invention comprises a sequence that can hybridize to a sequence containing 10 to 30 consecutive nucleotide residues containing the SNP of the present invention, and more specifically, the 3'-terminus or 5'-terminus of the probe has a base complementary to the SNP base. Generally, since the stability of a duplex formed by hybridization tends to be determined by the matching of the terminal sequences, if the terminal portion of a probe having a base complementary to the SNP base at the 3'-terminus or 5'-terminus does not hybridize, such a duplex may be disassembled under strict conditions. Suitable conditions for hybridization can be determined by referring to Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, DC (1985). The stringent conditions used for hybridization can be determined by controlling the temperature, ionic strength (buffer concentration), and the presence of compounds such as organic solvents. These stringent conditions may vary depending on the sequence being hybridized.
[0076] The term "complementary" in the present invention means that a primer or probe is sufficiently complementary to selectively hybridize to a target nucleic acid sequence under specific annealing or hybridization conditions, and encompasses both substantially complementary and perfectly complementary; specifically, it refers to perfectly complementary. Furthermore, the term "substantially complementary sequence," used in relation to the amplification or detection of a target sequence, includes not only perfectly matching sequences but also sequences that are partially mismatched with the sequence to the comparison target, provided that they can serve as a primer after annealing to a specific sequence.
[0077] In addition, primers can be modified, for example, by methylation, capping, substitution of nucleotides, or modification between nucleotides, for example, by modification into uncharged linkages (e.g., methyl phosphonate, phosphotriester, phosphoroamidate, carbamate, etc.) or charged linkages (e.g., phosphorothioate, phosphorodithioate, etc.).
[0078] More specifically, the formulation capable of detecting the SNP marker of the present invention may be characterized as being a primer or a primer set.
[0079] In the present invention, the primer may be any one selected from the group consisting of primers represented by SEQ ID NOs 16 and 17; 18 and 19; 20 and 21; 22 and 23; 24 and 25; 26 and 27; 28 and 29; 30 and 31; 32 and 33; 34 and 35; 36 and 37; 38 and 39; 40 and 41; 42 and 43; 44 and 45; 46 and 47.
[0080] In the present invention, the primer set may be characterized as being one or more selected from the group consisting of primer sets represented by SEQ ID NOs 16 and 17; 18 and 19; 20 and 21; 22 and 23; 24 and 25; 26 and 27; 28 and 29; 30 and 31; 32 and 33; 34 and 35; 36 and 37; 38 and 39; 40 and 41; 42 and 43; 44 and 45; and 46 and 47.
[0081] As another embodiment of the present invention, a kit or microarray for identifying goat individuals and breeds is provided, comprising the composition for identifying goat individuals and breeds of the present invention.
[0082] In the present invention, the kit for identifying goat individuals and breeds can identify or distinguish goat individuals and breeds by confirming the genotype of the 15 types of SNP markers provided in the present invention through amplification or by confirming the expression level of mRNA.
[0083] The above "kit" may be a kit comprising a composition capable of detecting or amplifying a marker, a reagent for detection or amplification, and a restriction enzyme, and specifically, may be a PCR (Polymerase Chain Reaction) kit or a kit for DNA analysis (e.g., a DNA chip).
[0084] The reagent for the amplification above may include dNTPs, DNA polymerase, and a buffer, wherein the dNTPs include dATP, dCTP, dGTP, or dTTP, and the DNA polymerase may be a heat-resistant DNA polymerase such as commercially available polymerases like Taq DNA polymerase or Tth DNA polymerase, and the restriction enzyme may be one or more of BfaI or BsaAI, but is not limited thereto.
[0085] Additionally, the kit may further include a user guide describing optimal reaction conditions, and the guide may be a printed document explaining the use of the kit, for example, the method of preparing PCR buffer, the presented reaction conditions, etc. The guide may include instructions in the form of a pamphlet or leaflet, a label attached to the kit, and on the surface of a package containing the kit. Furthermore, the guide may include information disclosed or provided through electronic media, such as the Internet.
[0086] In addition, the kit may further include a reagent for amplifying the SNP marker, and the reagent for amplification may include DNA polymerase, dNTPs, and a buffer.
[0087] Another embodiment of the present invention provides a method for identifying a goat individual and breed, comprising: (a) a step of isolating nucleic acid from a goat individual to be identified; (b) a step of amplifying an SNP marker for identifying a goat individual and breed according to claim 1 from the isolated nucleic acid; and (c) a step of determining the nucleotide sequence of each amplified SNP marker in step (b) and analyzing it.
[0088] The step of isolating nucleic acid from the goat individual to be identified in step (a) of the present invention can be carried out through methods known in the art.
[0089] In addition, the goat to be identified may be characterized as being one or more selected from the group consisting of native black goats, Alpine, Nubian, Saanen, Tokkenburg, Holstein, and Boer.
[0090] For example, this can be achieved by directly purifying DNA from the tissue or cells of the goat to be identified, or by using an amplification method such as PCR to specifically amplify a specific region and isolate it. Additionally, nucleic acids include not only DNA but also cDNA and RNA molecules synthesized from mRNA. The step of extracting DNA from the subject may utilize, for example, PCR amplification, ligase chain reaction (LCR) (Wu and Wallace, Genomics 4, 560 (1989); Landegren et al., Science 241, 1077 (1988)), transcription amplification (Kwoh et al., Proc. Natl. Acad. Sci. USA 86, 1173 (1989)), self-maintaining sequence cloning (Guatelli et al., Proc. Natl. Acad. Sci. USA 87, 1874 (1990)), and nucleic acid-based sequence amplification (NASBA).
[0091] The step of amplifying the SNP marker for goat individual and breed identification according to claim 1 from the isolated nucleic acid in step (b) of the present invention may be carried out by applying various methods known in the art.
[0092] The step (c) of the present invention may be carried out by applying various methods known in the art that are used to identify specific sequences in the step (b) of determining the nucleotide sequence of each amplified SNP marker and analyzing it.
[0093] For example, techniques applicable to the present invention include, but are not limited to, fluorescence in situ hybridization (FISH), direct DNA sequencing, PFGE analysis, Southern blot analysis, single-strand confirmation analysis (SSCA, Orita et al., PNAS, USA 86:2776(1989)), RNase protection analysis (Finkelstein et al., Genomics, 7:167(1990)), dot blot analysis, denaturing gradient bezel electrophoresis (DGGE, Wartell et al., Nucl.Acids Res., 18:2699(1990)), methods using proteins that recognize nucleotide mismatches (e.g., E. coli mutS protein) (Modrich, Ann. Rev. Genet., 25:229-253(1991)), and allele-specific PCR. Sequence changes cause differences in single-stranded intramolecular base pairs, resulting in the appearance of bands with different mobilities, which SSCA detects. DGGE analysis utilizes a denaturation gradient gel to detect sequences exhibiting mobilities different from the wild-type sequence. Other techniques generally utilize probes or primers complementary to the sequence containing the SNP of the present invention. In analyses utilizing hybridization signals, a probe complementary to the sequence containing the SNP of the present invention is used. In such techniques, the presence of an SNP variant can be directly determined by detecting the hybridization signal between the probe and the target sequence.
[0094] In step (c) of the present invention, the 2446th base of the base sequence represented by SEQ ID NO. 1 is T or C; the 3648th base of the base sequence represented by SEQ ID NO. 2 is T or C; the 4635th base of the base sequence represented by SEQ ID NO. 3 is C or T; the 5288th base of the base sequence represented by SEQ ID NO. 4 is T or C; the 7365th base of the base sequence represented by SEQ ID NO. 5 is T or C; the 7904th base of the base sequence represented by SEQ ID NO. 6 is C or T; the 9507th base of the base sequence represented by SEQ ID NO. 7 is T or C; the 13847th base of the base sequence represented by SEQ ID NO. 8 is T or C; the 14319th base of the base sequence represented by SEQ ID NO. 9 is C or T; and the 15836th base of the base sequence represented by SEQ ID NO. 10 is G or A; The identification of individual goats and breeds may be characterized in that the 15975th base of the base sequence indicated by SEQ ID NO. 11 is A or G; the 16012th base of the base sequence indicated by SEQ ID NO. 12 is G or A; the 16033rd base of the base sequence indicated by SEQ ID NO. 13 is T or C; the 16038th base of the base sequence indicated by SEQ ID NO. 14 is C or T; or the 16140th base of the base sequence indicated by SEQ ID NO. 15 is T or C.
[0095] In step (C) of the present invention, the 2446th base of the base sequence represented by SEQ ID NO. 1 is T or C; the 3648th base of the base sequence represented by SEQ ID NO. 2 is T or C; the 4635th base of the base sequence represented by SEQ ID NO. 3 is C or T; the 5288th base of the base sequence represented by SEQ ID NO. 4 is T or C; the 7904th base of the base sequence represented by SEQ ID NO. 6 is C or T; the 9507th base of the base sequence represented by SEQ ID NO. 7 is T or C; the 13847th base of the base sequence represented by SEQ ID NO. 8 is T or C; the 14319th base of the base sequence represented by SEQ ID NO. 9 is C or T; the 15836th base of the base sequence represented by SEQ ID NO. 10 is G or A; and the 15975th base of the base sequence represented by SEQ ID NO. 11 is A or G; If the 16012th base of the base sequence indicated by SEQ ID NO. 12 is G or A; the 16033rd base of the base sequence indicated by SEQ ID NO. 13 is T or C; or the 16140th base of the base sequence indicated by SEQ ID NO. 15 is T or C, it can be identified as a native black goat breed, and more specifically, if the 2446th base of the base sequence indicated by SEQ ID NO. 1 is C; the 3648th base of the base sequence indicated by SEQ ID NO. 2 is C; the 4635th base of the base sequence indicated by SEQ ID NO. 3 is T; the 5288th base of the base sequence indicated by SEQ ID NO. 4 is C; the 7904th base of the base sequence indicated by SEQ ID NO. 6 is T; the 9507th base of the base sequence indicated by SEQ ID NO. 7 is T; and the 13847th base of the base sequence indicated by SEQ ID NO. 8 is T; The 14319th base of the base sequence indicated by SEQ ID NO. 9 is T; the 15836th base of the base sequence indicated by SEQ ID NO. 10 is A; the 15975th base of the base sequence indicated by SEQ ID NO. 11 is A;In the case where the 16012th base of the base sequence indicated by SEQ ID NO. 12 is A; the 16033rd base of the base sequence indicated by SEQ ID NO. 13 is C; or the 16140th base of the base sequence indicated by SEQ ID NO. 15 is C, it can be characterized as being identified as a native black goat breed with approximately 90% or more accuracy.
[0096] In step (c) of the present invention, the 2446th base of the base sequence represented by SEQ ID NO. 1 is T or C; the 3648th base of the base sequence represented by SEQ ID NO. 2 is T or C; the 4635th base of the base sequence represented by SEQ ID NO. 3 is C or T; the 5288th base of the base sequence represented by SEQ ID NO. 4 is T or C; the 7365th base of the base sequence represented by SEQ ID NO. 5 is T or C; the 7904th base of the base sequence represented by SEQ ID NO. 6 is C or T; and the 14319th base of the base sequence represented by SEQ ID NO. 9 is C or T; Or, if the 16140th base of the nucleotide sequence indicated by SEQ ID NO. 15 is T or C, it can be identified as one or more of the Alpine, Nubian, Saanen, or Toggenburg varieties, and more specifically, the 2446th base of the nucleotide sequence indicated by SEQ ID NO. 1 is T; the 3648th base of the nucleotide sequence indicated by SEQ ID NO. 2 is T; the 4635th base of the nucleotide sequence indicated by SEQ ID NO. 3 is C; the 5288th base of the nucleotide sequence indicated by SEQ ID NO. 4 is T; the 7365th base of the nucleotide sequence indicated by SEQ ID NO. 5 is T; the 7904th base of the nucleotide sequence indicated by SEQ ID NO. 6 is C; and the 14319th base of the nucleotide sequence indicated by SEQ ID NO. 9 is C; Alternatively, if the 16140th base of the base sequence indicated by SEQ ID NO. 15 is T, it may be characterized by being identified as one or more of the Alpine, Nubian, Saanen, or Toggenburg varieties with about 99% or more accuracy.
[0097] In step (c) of the present invention, the 2446th base of the base sequence represented by SEQ ID NO. 1 is T or C; the 3648th base of the base sequence represented by SEQ ID NO. 2 is T or C; the 4635th base of the base sequence represented by SEQ ID NO. 3 is C or T; the 5288th base of the base sequence represented by SEQ ID NO. 4 is T or C; the 7904th base of the base sequence represented by SEQ ID NO. 6 is C or T; and the 14319th base of the base sequence represented by SEQ ID NO. 9 is C or T; Alternatively, if the 16140th base of the base sequence indicated by SEQ ID NO. 15 is T or C, it may be characterized by identifying the native black goat breed and one or more of the Alpine, Nubian, Saanen, or Toggenburg breeds, and more specifically, it may be characterized by identifying the native black goat breed with about 93% or more and one or more of the Alpine, Nubian, Saanen, or Toggenburg breeds with about 99% or more.
[0098] With the goat individual and breed identification method according to the present invention, it is possible to identify native black goats or dairy goats including Alpine, Nubian, Saanen, or Toggenburg, and to identify native black goats and dairy goats together.
[0099] In particular, by identifying including single nucleotide polymorphism (SNP) markers of mitochondrial DNA (mtDNA), maternal inheritance can be traced using these SNP markers, which offers a highly economical effect. For example, it can be utilized for rapid and accurate breed identification, enabling the management of goat pedigrees on a farm. In particular, it can enhance breeding effectiveness through the management of female goats and can be effectively used to prevent the illegal distribution of goat meat by supporting the goat DNA traceability system, which is expected to be mandated nationwide in the future.
[0100] In another embodiment of the present invention, a method for identifying native black goat individuals can be provided by using the goat individual and breed identification method according to the present invention.
[0102] The present invention will be described in more detail below through examples. However, these examples are intended solely to illustrate the present invention, and the scope of the present invention should not be interpreted as being limited by these examples.
[0104] Examples
[0105] PCR amplification and nucleotide sequencing for SNP identification by black goat breed
[0106] 1. Extraction of disclosed materials and genomic DNA
[0107] The blood DNA of 96 goats of 6 breeds was used as the test material for this study, including 28 Korean black goats, 6 Alpine goats, 2 Nubian goats, 20 Saanen goats, 20 Togenburg goats, and 20 Boer goats. The number of individuals by goat breed is shown in Table 1 below.
[0108] number varieties Number of individuals (n) 1 native black goat 28 2 Alpine 6 3 Nubian 2 4 Saanen 20 5 Togenburg 20 6 complement 20 Total(n) 6 varieties 96
[0110] 2. Polymerase Chain Reaction (PCR) Primer Design and Gene Amplification
[0111] For mtDNA sequencing analysis, gene information registered in the NCBI (National Center for Biotechnology Information) GenBank (NCBI Reference Sequence: NC_005044.2) was used, and 16 pairs of primers were designed, synthesized, and produced using the Primer3 program (http: / / bioinfo.ut.ee / primer3-0.4.0 / ) and are shown in [Table 2] below.
[0112] The constructed primers were designed so that the reference nucleotide sequences overlapped (forward and reverse primer sequences overlapped) to verify gene amplification and sequencing of the entire mtDNA region.
[0113] For mtDNA gene amplification PCR, distilled water was added to a mixture composed of 2 µl of gDNA (20 ng / µl), 2 µl of 10X buffer, 1.6 µl of 2.5 mM dNTP, 0.8 µl of primer (10 pmol / µl) (F-0.4 µl, R-0.4 µl), and 0.2 µl of Hot start Taq DNA polymerase (2 U / µl), so that the total reaction volume was 20 µl. The above mixture was subjected to 35 cycles using a Verti 96-well Thermal Cycler (Applied Biosystem, CA, USA), starting with an initial reaction at 95°C for 11 minutes, followed by denaturation at 94°C for 40 seconds, binding at 60°C for 40 seconds, and extension at 72°C for 1 minute, and finally, a final extension reaction was performed at 60°C for 60 minutes.
[0114] Primer number amplification product length (bp) Forward direction (5'→3') Reverse direction (5'→3') 1 1285 TAGGTTTGGTCCCAGCCTTC (Sequence No. 16) TGAGTAGCTCGTCTGGTTTCG(Sequence No. 17) 2 1062 TGGCGCTATAGAGAAAGTACCG(Sequence No. 18) TCACCCCAACCAAAACTGCT(Sequence No. 19) 3 1227 CAGTGAAATTGACCTCCCCGT(Sequence No. 20) GTGCTCGGTTTGTTTCTGCT(Sequence No. 21) 4 1282 GCCTTACGAGCAGTAGCACAA(Sequence No. 22) TAGTCCTCCTCAGCCTCCAATTAT(Sequence No. 23) 5 1219 AGCTCCATTCCACTTCTGAGTC(Sequence No. 24) TTCGGCGCGAATTAGTAAGC(Sequence No. 25) 6 1260 AACCAACCACAAAGACATCGG (Sequence No. 26) TGTTGTGGGAAGAAGGTCATGT(Sequence No. 27) 7 1127 TCAATAGGAGCTGTGTTCGCT(Sequence No. 28) GGCCGTAGAATAGACCTGGAC (Sequence No. 29) 8 1157 AGACGCAATTCCAGGTCGTTTA(Sequence No. 30) GTAGGAGAGCGGATAGTGCC (Sequence No. 31) 9 1132 AGCCAACATCACAGCAGGAC(Sequence No. 32) TAGTTGGGGGAGTCAAAATGCG(Sequence No. 33) 10 1272 GCTGCCTGATACTGACACTTTG(Sequence No. 34) GCTCTGTTTGGTTTCCTCATCG (Sequence No. 35) 11 1297 ACATTCACCGCTACAGAACTAATTT (Sequence No. 36) AGGGTTAGGGTGGTTAGTGC(Sequence No. 37) 12 1080 AACGGGGTAAACATACCCATCA(Sequence No. 38) TGGAGTAATGCTGAAACGGGT(Sequence No. 39) 13 1129 GCAAACACAGCAGCCTTACAG(Sequence No. 40) TGTAGGGGGTTAAGCGGTG(Sequence No. 41) 14 1207 AACCGCCCTAGCAGTTACAATC(Sequence No. 42) TTGATGCTCCGTTTGCGTGTA (Sequence No. 43) 15 1149 TTGGATCCCTCCTAGGAATTTGC(Sequence No. 44) GGTGCTGATAGTGAGGCTATGG(Sequence No. 45) 16 1667 GGAGGACAGCCAGTCGAAC(Sequence No. 46) TGTGTGCTTGATACCTGCTCC (Sequence No. 47)
[0116] 3. Verification using purification of amplified products and base sequence determination
[0117] The amplification products were purified using MultiScreen HTS™ PCR (MILLIPORE, Seoul, Korea). After purification in a 96-well PCR clean-up filter plate, sequencing reactions were performed using each primer for 35 cycles at 60°C for 4 minutes. The PCR products were purified using isopropanol and ethanol, and 10 µl of Hi-Di formamide was added to the dried 96-well plate pellet. After a denaturation process at 95°C for 2 minutes, sequencing was performed using an ABI 3500 XL sequencer (Applied Biosystems, Foster City, CA, USA) equipped with a 36 cm capillary.
[0119] 4. Selection of Variety Identification Markers through DNA Sequencing and Genotype Frequency Analysis
[0120] After determining the base sequence, genotype frequencies were analyzed, and among them, 15 loci capable of distinguishing breeds for 6 goat breeds were selected and shown in [Table 3] below, and the base sequence information of the locus regions was specified and shown in [Table 4] below.
[0121]
[0122] number Location (bp) SNP two-sided nucleotide sequence Flanking sequence (5'→3') 1 2446 GTCCATATCGACAATAGGGTTTACGACCTCGATGTTGGATCAGGACATCC [T / C] GATGGTGCAACCGCTATCAAAGGTTCGTTTGTTCAACGATTAAAGTCCT (서열번호1) 2 3648 CTAATACACTTATTATGAAAAAATTTCCTACCCCTAACACTGGCCCTATGTATG [T / C] GACACGTGTCACTACCCATTCTCCTATCAAGCATCCCCCCACAAA (서열번호2) 3 4635 AACCACCCTATCACTATCACTCACATGAAATAAAATACCTATCATAACAA [C / T] CCTAGTCCTCATCACCCTCCTATCAATAGGAGGACTCCCCCCACTATCA (서열번호3) 4 5288 TCAATATGTTAATTCACTACAGGACTTGGTAAAAAGAGGAATCAAACCTC [T / C] GTTCTTAGATTTACAGTCTATTGCTTTGCTCAGCCATTTTACCCATGTT (서열번호4) 5 7365 CTATGGGACATCAATGATACTGAAGCTATGAGTATACAGACTATGAAGAC [T / C] TAAGCTTCGATTCCTATATAATTCCAACATCAGAATTAAAACCTGGAGA (서열번호5) 6 7904 AAATCTCAAAGTACGACTTCTACCACAACCCAGAACTAACAGCAAAAATA [C / T] TAAAGCATAACACCCCTTGAGAAACAAAATGAACGAAAATCTATTTACC (서열번호6) 7 9507 AAAAGAACAATAAACCTCATAATTACTCTCCTGACTAATTTTACACTAGC [T / C] ACATTACTCGTAACTATCGCATTTTGACTCCCCCAACTAAACGTTTACT (서열번호7) 8 13847 CGCCCCTAGAACAACTTTACTAGAAACTCAAACCTCAGGATATTGCTCAG [T / C] AGCCATAGCCGTCGTATAACCAAAAACTACCATTATACCCCCCAAATAA (서열번호8) 9 14319 ATCTTACAAATCCTGACAGGCCTATTCCTAGCAATACACTATACATCCGA [C / T] ACAATAACAGCATTTTCCTCTGTAACTCACATTTGTCGAGATGTAAATT (서열번호9) 10 15836 TATGATCTACTTCATGTGTACGTACATAATATTAATGTAACAGGGACATA [G / A] TATGTATATAGTACATTAAACGATTTTCCACATGCATATTAAGTACGTA (서열번호10) 11 15975 TACATTAAACGATCTTCCTCATGCATATAAGCACGTACAATGTCCTTATT [A / G] GCAGTACATGGTACATTTTACTGTATACCCGTACATGGCACATGAAGTC (서열번호11) 12 16012 CAATGTCCTTATTAGCAGTACATGGTACATTTTACTGTATACCCGTACAT [G / A] GCACATGAAGTCAAATCCGTTCTTGCCAACATGCGTATCCCGTCCACTA (서열번호12) 13 16033 ATGGTACATTTTACTGTATACCCGTACATGGCACATGAAGTCAAATCCGT [T / C] CTTGCCAACATGCGTATCCCGTCCACTAGATCACGAGCTTGTTGACCAT (서열번호13) 14 16038 ACATTTTACTGTATACCCGTACATGGCACATGAAGTCAAATCCGTTCTTG [C / T] CAACATGCGTATCCCGTCCACTAGATCACGAGCTTGTTGACCATGCCGC (서열번호14) 15 16140 GAAACCAGCAACCCGCTTGGCAGGGATCCCTCTTCTCGCTCCGGGCCCAT [T / C] AACCGTGGGGGTAGCTATTTAATGAACTTTATCAGACATCTGGTTCTTT (서열번호15)
[0123] result
[0124] According to the above example, 15 breed identification gene markers for 6 breeds and 96 goats were selected within the mitochondrial DNA region, and the positions of the 15 loci within the entire mtDNA region were confirmed to be 2446, 3648, 4635, 5288, 7365, 7904, 9507, 13847, 14319, 15836, 15975, 16012, 16033, 16038, or 16140, and sequences including these were represented as sequence numbers 1 to 15.
[0125] Among these, 13 gene loci that can identify native black goats with about 90% or more accuracy were 2446, 3648, 4635, 5288, 7904, 9507, 13847, 14319, 15836, 15975, 16012, 16033, or 16140.
[0126] (In this case, the above 13 gene loci are included in SEQ ID NOs 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, or 15.)
[0127] In addition, eight genetic loci, 2446, 3648, 4635, 5288, 7365, 7904, 14319, or 16140, were found to be capable of distinguishing Alpine, Nubian, Saanen, or Toggenburg goats raised as dairy goats (useful breeds) with over 99% accuracy.
[0128] (In this case, the above 8 gene loci are included in SEQ ID NOs 1, 2, 3, 4, 5, 6, 9, or 12.)
[0129] In addition, there were 7 loci that could distinguish at least one of the four dairy goat breeds consisting of native black goats and Alpine, Nubian, Saanen, and Toggenburg goats with about 93% accuracy, namely 2446, 3648, 4635, 5288, 7904, 14319, or 16140.
[0130] (In this case, the above 7 gene loci are included in SEQ ID NOs 1, 2, 3, 4, 6, 9, or 15.)
[0131] In summary, for 6 breeds and 96 goats, 7 markers capable of distinguishing native black goats and dairy goats (utility breed) with over 93% accuracy, 13 markers capable of distinguishing only native black goats with over 90% accuracy, and 8 markers capable of distinguishing only dairy goats with over 99% accuracy were derived.
[0132] Through the genetic markers of mtDNA based on this, it is possible to quickly and accurately identify the various breeds that may appear in a single goat, thereby enabling pedigree management of goats on the farm.
[0133] Furthermore, this can be used to enhance breeding effectiveness through individual female goat management and can be effectively utilized to prevent the illegal distribution of goat meat by supplementing the goat DNA traceability system, which is expected to be mandated nationwide in the future.
[0135] Specific parts of the present invention have been described in detail above. It is evident to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. Accordingly, the actual scope of the invention is defined by the appended claims and their equivalents.
Claims
Claim 1 A polynucleotide composed of 10 to 100 consecutive nucleic acids containing a singlenucleotide polymorphism (SNP) site in which the 51st base of the base sequence represented by SEQ ID NO. 1 is T or C; a polynucleotide composed of 10 to 100 consecutive nucleic acids containing a singlenucleotide polymorphism (SNP) site in which the 55th base of the base sequence represented by SEQ ID NO. 2 is T or C; a polynucleotide composed of 10 to 100 consecutive nucleic acids containing a singlenucleotide polymorphism (SNP) site in which the 51st base of the base sequence represented by SEQ ID NO. 3 is C or T; a polynucleotide composed of 10 to 100 consecutive nucleic acids containing a singlenucleotide polymorphism (SNP) site in which the 51st base of the base sequence represented by SEQ ID NO. 4 is T or C; and a polynucleotide in which the 51st base of the base sequence represented by SEQ ID NO. 5 is T or A polynucleotide composed of 10 to 100 consecutive nucleic acids including a single-nucleotide polymorphism (SNP) site where the 51st base of the base sequence represented by SEQ ID NO. 6 is C or T; a polynucleotide composed of 10 to 100 consecutive nucleic acids including a single-nucleotide polymorphism (SNP) site where the 51st base of the base sequence represented by SEQ ID NO. 7 is T or C; a polynucleotide composed of 10 to 100 consecutive nucleic acids including a single-nucleotide polymorphism (SNP) site where the 51st base of the base sequence represented by SEQ ID NO. 8 is T or C;A polynucleotide composed of 10 to 100 consecutive nucleic acids containing a singlenucleotide polymorphism (SNP) site in which the 51st base of the base sequence represented by SEQ ID NO. 9 is C or T; a polynucleotide composed of 10 to 100 consecutive nucleic acids containing a singlenucleotide polymorphism (SNP) site in which the 51st base of the base sequence represented by SEQ ID NO. 10 is G or A; a polynucleotide composed of 10 to 100 consecutive nucleic acids containing a singlenucleotide polymorphism (SNP) site in which the 51st base of the base sequence represented by SEQ ID NO. 11 is A or G; a polynucleotide composed of 10 to 100 consecutive nucleic acids containing a singlenucleotide polymorphism (SNP) site in which the 51st base of the base sequence represented by SEQ ID NO. 12 is G or A; the 51st of the base sequence represented by SEQ ID NO. 13 A polynucleotide composed of 10 to 100 consecutive nucleic acids containing a singlenucleotide polymorphism (SNP) site where the base is T or C; a polynucleotide composed of 10 to 100 consecutive nucleic acids containing a singlenucleotide polymorphism (SNP) site where the 51st base of the base sequence represented by SEQ ID NO. 14 is C or T; and a polynucleotide composed of 10 to 100 consecutive nucleic acids containing a singlenucleotide polymorphism (SNP) site where the 51st base of the base sequence represented by SEQ ID NO. 15 is T or C, comprising an SNP marker composition for identifying one or more goat breeds selected from the group consisting of native black goat, Alpine, Nubian, Saanen, Tockenburg, Holstein, and Bohr. Claim 2 delete Claim 3 A composition for identifying one or more goat breeds selected from the group consisting of native black goat, Alpine, Nubian, Saanen, Tockenburg, Holstein, and Bohr, comprising a primer set or probe capable of detecting or amplifying the SNP marker composition for identifying goat breeds according to claim 1, wherein the primer set is one or more selected from the group consisting of primer sets represented by SEQ ID NOs 16 and 17; 18 and 19; 20 and 21; 22 and 23; 24 and 25; 26 and 27; 28 and 29; 30 and 31; 32 and 33; 34 and 35; 36 and 37; 38 and 39; 40 and 41; 42 and 43; 44 and 45; and 46 and 47. Claim 4 delete Claim 5 delete Claim 6 delete Claim 7 A goat breed identification kit comprising the composition for goat breed identification of paragraph 3. Claim 8 A method for identifying one or more goat breeds selected from the group consisting of native black goat, Alpine, Nubian, Saanen, Tokkenburg, Holstein, and Bohr, comprising: (a) a step of isolating nucleic acid from a goat individual to be identified; (b) a step of amplifying an SNP marker composition for goat breed identification according to claim 1 from the isolated nucleic acid; and (c) a step of determining the base sequence of the amplified SNP marker composition of step (b) and analyzing it. Claim 9 delete Claim 10 In claim 8, the above step (b) is such that the 51st base of the base sequence represented by SEQ ID NO. 1 is T or C; The 55th base of the base sequence indicated by SEQ ID NO. 2 is T or C; the 51st base of the base sequence indicated by SEQ ID NO. 3 is C or T; the 51st base of the base sequence indicated by SEQ ID NO. 4 is T or C; the 51st base of the base sequence indicated by SEQ ID NO. 5 is T or C; the 51st base of the base sequence indicated by SEQ ID NO. 6 is C or T; the 51st base of the base sequence indicated by SEQ ID NO. 7 is T or C; the 51st base of the base sequence indicated by SEQ ID NO. 8 is T or C; the 51st base of the base sequence indicated by SEQ ID NO. 9 is C or T; the 51st base of the base sequence indicated by SEQ ID NO. 10 is G or A; the 51st base of the base sequence indicated by SEQ ID NO. 11 is A or G; the 51st base of the base sequence indicated by SEQ ID NO. 12 is G or A; the base sequence indicated by SEQ ID NO. 13 A method for identifying a goat breed, characterized by identifying a goat breed when the 51st base is T or C; the 51st base of the base sequence represented by SEQ ID NO. 14 is C or T; or the 51st base of the base sequence represented by SEQ ID NO. 15 is T or C. Claim 11 In claim 8, the above step (c) is such that the 51st base of the base sequence represented by SEQ ID NO. 1 is T or C; The 55th base of the base sequence indicated by SEQ ID NO. 2 is T or C; the 51st base of the base sequence indicated by SEQ ID NO. 3 is C or T; the 51st base of the base sequence indicated by SEQ ID NO. 4 is T or C; the 51st base of the base sequence indicated by SEQ ID NO. 6 is C or T; the 51st base of the base sequence indicated by SEQ ID NO. 7 is T or C; the 51st base of the base sequence indicated by SEQ ID NO. 8 is T or C; the 51st base of the base sequence indicated by SEQ ID NO. 9 is C or T; the 51st base of the base sequence indicated by SEQ ID NO. 10 is G or A; the 51st base of the base sequence indicated by SEQ ID NO. 11 is A or G; the 51st base of the base sequence indicated by SEQ ID NO. 12 is G or A; the 51st base of the base sequence indicated by SEQ ID NO. 13 is T or C; A method for identifying a goat breed, characterized by identifying it as a native black goat breed when the 51st base of the base sequence represented by SEQ ID NO 15 is T or C. Claim 12 A method for identifying goat breeds according to claim 8, wherein step (c) is characterized by identifying as one or more of Alpine, Nubian, Saanen, and Toggenburg breeds when the 51st base of the nucleotide sequence represented by SEQ ID NO. 1 is T or C; the 55th base of the nucleotide sequence represented by SEQ ID NO. 2 is T or C; the 51st base of the nucleotide sequence represented by SEQ ID NO. 3 is C or T; the 51st base of the nucleotide sequence represented by SEQ ID NO. 4 is T or C; the 51st base of the nucleotide sequence represented by SEQ ID NO. 5 is T or C; the 51st base of the nucleotide sequence represented by SEQ ID NO. 6 is C or T; the 51st base of the nucleotide sequence represented by SEQ ID NO. 9 is C or T; or the 51st base of the nucleotide sequence represented by SEQ ID NO. 15 is T or C. Claim 13 A method for identifying goat breeds according to claim 8, wherein step (c) is characterized by identifying as one or more of the native black goat, Alpine, Nubian, Saanen, and Toggenburg breeds when the 51st base of the nucleotide sequence represented by SEQ ID NO. 1 is T or C; the 55th base of the nucleotide sequence represented by SEQ ID NO. 2 is T or C; the 51st base of the nucleotide sequence represented by SEQ ID NO. 3 is C or T; the 51st base of the nucleotide sequence represented by SEQ ID NO. 4 is T or C; the 51st base of the nucleotide sequence represented by SEQ ID NO. 6 is C or T; the 51st base of the nucleotide sequence represented by SEQ ID NO. 9 is C or T; or the 51st base of the nucleotide sequence represented by SEQ ID NO. 15 is T or C. Claim 14 A method for identifying native black goat individuals using a goat breed identification method according to any one of paragraphs 8 and 10 to 13.
Citation Information
Patent Citations
Novel SNP marker for identification of black goat and uses thereof
KR102243308B1
Novel SNP marker for identifying variety of black goat and uses thereof
KR102254614B1