Microorganisms for producing purine nucleotides and process for producing purine nucleotides using the same
Enhancing serine hydroxymethyltransferase protein activity in microorganisms like Corynebacterium stationaryis addresses yield and economic challenges in purine nucleotide production, achieving higher yields through genetic modification and vector introduction.
Patent Information
- Authority / Receiving Office
- KR · KR
- Patent Type
- Patents
- Current Assignee / Owner
- CJ CHEILJEDANG CORP
- Filing Date
- 2022-12-08
- Publication Date
- 2026-07-29
AI Technical Summary
Existing methods for producing purine nucleotides, such as 5'-inosine monophosphate (IMP), 5'-xanthosine monophosphate (XMP), and 5'-guanosine monophosphate (GMP), face challenges including raw material supply issues, economic feasibility, and low yield due to cell membrane permeability, particularly during microbial fermentation where oxidative stress from reactive oxygen species (ROS) affects microorganism growth.
Enhancement of serine hydroxymethyltransferase protein activity in microorganisms, specifically those of the genus Corynebacterium, such as Corynebacterium stationaryis, to increase purine nucleotide production capacity through methods like gene modification and vector introduction, enhancing protein activity to levels up to 2000% compared to intrinsic activity.
The enhanced serine hydroxymethyltransferase activity leads to increased purine nucleotide production, addressing yield and economic feasibility issues, and providing a stable microbial fermentation process.
Smart Images

Figure 1020220170772
Abstract
Description
Technology Field
[0001] The present application relates to a microorganism in which serine hydroxymethyltransferase protein activity is enhanced relative to intrinsic activity; a method for producing purine nucleotides comprising the step of culturing said microorganism in a medium; a composition for producing purine nucleotides comprising said microorganism, a culture of said microorganism, a fermented product of said microorganism, or a combination of two or more of these; and a use of said microorganism for producing purine nucleotides. Background Technology
[0003] Purine nucleotides, such as 5'-inosine monophosphate (hereinafter IMP), 5'-xanthosine monophosphate (hereinafter XMP), and 5'-guanosine monophosphate (hereinafter GMP), are intermediates of the nucleic acid biosynthetic metabolic system, play physiologically important roles in the body, and are widely used in foods, pharmaceuticals, etc. Specifically, IMP is known to produce a beef flavor on its own, and GMP, derived from XMP, is known to produce a mushroom flavor; both substances are known to enhance the flavor of monosodium glutamate (MSG) and are gaining popularity as flavor-enhancing nucleic acid-based seasonings.
[0004] Meanwhile, methods for producing the above-mentioned purine nucleotides include (1) a method of enzymatically degrading ribonucleic acid (RNA) extracted from yeast cells, (2) a fermentation method of culturing microorganisms that produce the same and directly recovering purine nucleotides from the culture medium, (3) a method of chemically phosphorylating nucleosides produced by fermentation, and (4) a method of enzymatically phosphorylating nucleosides produced by fermentation (Korean Patent Registration No. 10-1049023, Japanese Patent Publication No. 4363042, Korean Patent Registration No. 10-1210704, Agri. Biol. Chem., 36(9), 1511-1522). Among these, method (1) has problems with raw material supply and economic feasibility, while method (2) is widely used because it is advantageous both economically and environmentally. Meanwhile, the production of GMP, one of the purine nucleotides, has the disadvantage of low yield due to cell membrane permeability issues, so a method of producing GMP by enzymatically converting XMP produced through microbial fermentation is also being utilized.
[0005] However, during the fermentation production of purine nucleotides using microorganisms, the microorganisms experience stress due to temperature, pH, osmotic pressure, nutrient deficiency, and oxidative factors. Among these, oxidative stress is particularly caused by reactive oxygen species (ROS), which are unavoidable factors generated during fermentation production, and this can lead to abnormal growth of microorganisms.
[0006] Therefore, research for effective purine nucleotide production is still necessary. The problem to be solved
[0008] One aspect of the present application provides a microorganism having the ability to produce purine nucleotides, wherein serine hydroxymethyltransferase protein activity is enhanced relative to intrinsic activity.
[0009] In one embodiment, the serine hydroxymethyltransferase protein may consist of the amino acid sequence of SEQ ID NO. 46.
[0010] As a microorganism according to any one of the aforementioned embodiments, the microorganism may additionally have formate-dependent phosphoribosylglycinamide formyl transferase protein activity enhanced relative to intrinsic activity.
[0011] As a microorganism according to any one of the aforementioned embodiments, the microorganism may be a microorganism of the genus Corynebacterium.
[0012] As a microorganism according to any one of the aforementioned embodiments, the microorganism of the genus Corynebacterium may be Corynebacterium stationaryis.
[0013] As a microorganism according to any one of the aforementioned embodiments, the microorganism may have increased purine nucleotide production capacity compared to a non-modified microorganism.
[0014] Another aspect of the present application provides a method for producing purine nucleotides, comprising the step of culturing a microorganism in a medium in which the serine hydroxymethyltransferase protein activity is enhanced relative to the intrinsic activity.
[0015] In one embodiment, the method may additionally include the step of recovering a target substance from the cultured microorganism, the culture of the microorganism, the fermented product of the microorganism, or the culture medium.
[0016] Another aspect of the present application provides a composition for producing purine nucleotides comprising a microorganism having serine hydroxymethyltransferase protein activity enhanced relative to its intrinsic activity, a culture of said microorganism, a fermented product of said microorganism, or a combination of two or more of these. means of solving the problem
[0018] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application should not be considered limited by the specific descriptions provided below.
[0019] In addition, a person skilled in the art can recognize or identify a number of equivalents to the specific embodiments of the present application described herein by using only ordinary experiments. In addition, such equivalents are intended to be included in the present application.
[0020] As used in the specification and appended claims of this application, singular articles (“a,” “an,” and “the”) include plural references unless the context clearly indicates otherwise. Unless the context indicates otherwise, singular terms include plural forms and plural terms include singular forms. In the specification and appended claims of this application, unless otherwise noted, the use of “or” may be used to mean “and / or”.
[0022] In this application, the term "about" may be placed before a specific numerical value. As used in this application, the term "about" includes not only the exact number specified after the term, but also a range that is approximately that number or close to that number. Whether the number is close to or nearly that specific number may be determined by considering the context in which the number is presented. For example, the term "about" may refer to a range of -10% to +10% of a numerical value. For another example, the term "about" may refer to a range of -5% to +5% of a given numerical value. However, it is not limited thereto.
[0023] In this application, terms such as “first, second, third,” “i), ii), iii)…” or “(a), (b), (c), (d)…” are used to distinguish similar configurations and do not imply that they are performed sequentially or in order. For example, when the terms are used in relation to steps of a method, use, or analysis, there may be no time interval between these steps, they may be performed simultaneously, or they may be performed with intervals of seconds, minutes, hours, days, or months.
[0024] In this application, the term "consisting essentially of" means that said unspecified component may be present in such a case that the features of the subject matter claimed in this application are not substantially affected by the presence of said unspecified component.
[0025] In this application, the term “consisting of” means that the proportion of a specific component(s) is 100% of the total. The component or feature following the term “consisting of” may be essential or mandatory. In some embodiments, any other component or non-essential component may be excluded in addition to the component or feature following the term “consisting of”.
[0026] In this application, the term "comprising" means the presence of the features, steps, or components described below the above term, and does not exclude the presence or addition of one or more features, steps, or components. In this application, the components or features described below "comprising" may be essential or mandatory, but some embodiments may further include other optional or non-essential components or features.
[0028] One aspect of the present application provides a microorganism having the ability to produce purine nucleotides, wherein serine hydroxymethyltransferase protein activity is enhanced relative to intrinsic activity.
[0029] The above-mentioned enhanced serine hydroxymethyltransferase protein activity may be defined as, but is not limited to, the increased purine nucleotide production capacity of the microorganism of the present application compared to the production capacity of a natural wild-type microorganism or an unmodified microorganism (e.g., a microorganism expressing a polypeptide having wild-type serine hydroxymethyltransferase protein activity (e.g., the polypeptide of SEQ ID NO. 46) or a strain in which the serine hydroxymethyltransferase protein activity of the present application is not enhanced relative to its intrinsic activity or is not enhanced).
[0030] For example, the above serine hydroxymethyltransferase protein activity may be measured by measuring the purine nucleotide production capacity or yield, but is not limited thereto.
[0032] In this application, the term “Serine Hydroxymethyltransferase” refers to an enzyme that catalyzes the conversion of serine to glycine. The Serine Hydroxymethyltransferase of this application may be used interchangeably with GlyA. Specifically, the Serine Hydroxymethyltransferase of this application glyA It may be a protein having serine hydroxymethyltransferase activity encoded by a gene, but is not particularly limited to that type as long as it has activity corresponding to serine hydroxymethyltransferase. The above glyA Serine hydroxymethyltransferase encoded by a gene is known in the art, and the amino acid and polynucleotide sequences of said serine hydroxymethyltransferase can be obtained from known databases, such as NCBI’s GenBank, but are not limited thereto.
[0033] For example, the serine hydroxymethyltransferase protein may include the amino acid sequence of SEQ ID NO. 46 or an amino acid sequence having 60% or more homology or identity therewith, but is not limited thereto as long as it has serine hydroxymethyltransferase protein activity. Specifically, the polypeptide having serine hydroxymethyltransferase protein activity may have, include, be composed of, or be essentially composed of the amino acid sequence of SEQ ID NO. 46 or an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with SEQ ID NO. 46. For example, the above-mentioned serine hydroxymethyltransferase protein may refer to a protein that is inherently present in microorganisms of the genus Corynebacterium or Corynebacterium stationaryis, but is not limited thereto. Specifically, it may be a serine hydroxymethyltransferase protein composed of the amino acid sequence of SEQ ID NO. 46 that is inherently present in microorganisms of the genus Corynebacterium or Corynebacterium stationaryis, but is not limited thereto.
[0034] With respect to amino acid sequences in this application, even if it is described as a polypeptide "comprising" the amino acid sequence described by a specific sequence number, a polypeptide "consisting" of the amino acid sequence described by a specific sequence number, or a polypeptide or protein "having" the amino acid sequence described by a specific sequence number, it is obvious that a protein having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted, or added is included within the scope of this application if it has the same or corresponding activity as a protein consisting of the amino acid sequence of said sequence number. For example, if it has the same or corresponding activity as said variant protein, it does not exclude sequence additions before or after said amino acid sequences that do not alter the function of the protein, naturally occurring mutations, their silent mutations, or conservative substitutions, and it is obvious that such cases of sequence additions or mutations also fall within the scope of this application.
[0035] For example, the amino acid sequence may have additions to sequences that do not alter the function of the variant polypeptide of the present application, naturally occurring mutations, silent mutations, or conservative substitutions at the N-terminus, C-terminus, and / or within it. For example, the polypeptide may be conjugated with a signal (or leader) sequence at the protein N-terminus that is involved in the co-translational or post-translational transfer of the protein. Additionally, the polypeptide may be conjugated with other sequences or linkers to enable identification, purification, or synthesis of the polypeptide.
[0036] In this application, the term "conservative substitution" means substituting one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. For example, positively charged (basic) amino acids are arginine, lysine, and histidine; negatively charged (acidic) amino acids are glutamic acid and aspartic acid; amino acids having a nonpolar side chain (nonpolar amino acids) are glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline; Amino acids with polar or hydrophilic side chains (polar amino acids) can be classified to include serine, threonine, cysteine, tyrosine, asparagine, and glutamine. As another example, they can be classified into electrically charged amino acids with side chains (arginine, lysine, histidine, glutamic acid, and aspartic acid) and uncharged amino acids (also referred to as neutral amino acids) with side chains (glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. As another example, phenylalanine, tryptophan, and tyrosine can be classified as aromatic amino acids. As another example, valine, leucine, and isoleucine can be classified as branched amino acids.As another example, the 20 amino acids can be classified by size into five groups, starting with the group of amino acids with the smallest volume: glycine, alanine, serine; cysteine, proline, threonine, aspartic acid, asparagine; valine, histidine, glutamic acid, glutamine; isoleucine, leucine, methionine, lysine, arginine; and phenylalanine, tryptophan, and tyrosine. However, this is not necessarily limited to these groups. Typically, conservative substitutions have little to no effect on the activity of polypeptides.
[0038] In addition, the base sequence encoding the serine hydroxymethyltransferase may be a base sequence encoding a protein that exhibits the activity of serine hydroxymethyltransferase.
[0039] For example, the serine hydroxymethyltransferase protein having the amino acid sequence of SEQ ID NO. 46 may have or include a sequence of bases having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% homology or identity with the sequence of SEQ ID NO. 47, or may be coded by a polynucleotide that is composed of or essentially composed of said base sequence, but is not limited thereto. Additionally, the base sequence of SEQ ID NO. 47 can be obtained from known databases, such as GenBank of NCBI, but is not limited thereto.
[0040] In the present application, for example, a gene comprising the nucleotide sequence of SEQ ID NO. 47 may be used in combination with a polynucleotide comprising the nucleotide sequence of SEQ ID NO. 47, a gene or polynucleotide having the nucleotide sequence of SEQ ID NO. 47, or a gene or polynucleotide consisting of the nucleotide sequence of SEQ ID NO. 47.
[0041] The polynucleotide of the present application may have various modifications made to its coding region within the scope of not altering the amino acid sequence of the serine hydroxymethyltransferase protein of the present application, due to codon degeneracy or in consideration of the preferred codons in the organism intended to express the serine hydroxymethyltransferase protein of the present application. Accordingly, it is obvious that the polynucleotide may also include a polypeptide consisting of the amino acid sequence of the serine hydroxymethyltransferase protein of the present application or a polypeptide having homology or identity therewith, due to codon degeneracy. For example, the polynucleotide of the present application may be SEQ ID NO. 47 or its degenerated sequence.
[0042] In another example, the polynucleotide of the present application may have or include a base sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% homology or identity with SEQ ID NO. 47, or may be composed of or essentially composed of a base sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% homology or identity with SEQ ID NO. 47, but is not limited thereto.
[0043] In addition, the polynucleotide of the present application may be included without limitation as long as it is a sequence encoding the serine hydroxymethyltransferase protein of the present application, by hybridizing under strict conditions with a probe that can be prepared from a known gene sequence, for example, a sequence complementary to all or part of the polynucleotide sequence of the present application.
[0044] In this application, the terms “homology” or “identity” refer to the degree of relationship between two given amino acid sequences or base sequences and may be expressed as a percentage. The terms homology and identity may often be used interchangeably.
[0045] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard arrangement algorithms, and a default gap penalty established by the program used may be utilized. Substantially, homologous or identical sequences can generally be hybridized under moderate or high stringent conditions along the entire sequence or at least about 50%, 60%, 70%, 80%, or 90% of the total length. It is evident that hybridization also involves polynucleotides containing common codons or codons that account for codon degeneracy.
[0046] Whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity can be determined using a known computer algorithm, such as the “FASTA” program, using default parameters as in, for example, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, it can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, and [CARILLO et al .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST from the National Biotechnology Information Database Center or ClustalW.
[0047] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information using GAP computer programs, such as those disclosed in, for example, Smith and Waterman, Adv. Appl. Math (1981) 2:482, and, for example, Needleman et al. (1970), J Mol Biol. 48:443. In summary, a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). The default parameters for a GAP program are (1) unitary matrices (containing values of 1 for identity and 0 for non-identity), the PAM Matrix (see contents disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation (1978)), and Gribskov et al. (1986) Nucl. Acids Res. 14: A weighted comparison matrix of 6745 (or an EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.
[0048] Additionally, whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity can be determined by comparing the sequences through Southern hybridization experiments under defined strict conditions, and the defined appropriate hybridization conditions may be determined by methods within the scope of the art and well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York), but are not limited thereto.
[0049] In this application, the term “stringent condition” means a condition that enables specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8). For example, conditions may be listed in which polynucleotides with high homology or identity are hybridized with each other, with homology or identity of 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more, and polynucleotides with lower homology or identity are not hybridized with each other, or conditions in which the polynucleotides are washed once, specifically two to three times, at a salt concentration and temperature equivalent to the washing conditions of conventional southern hybridization, such as 60°C, 1 χSSC, 0.1% SDS, specifically 60°C, 0.1 χSSC, 0.1% SDS, more specifically 68°C, 0.1 χSSC, 0.1% SDS.
[0050] The above hybridization requires that two nucleotides have complementary sequences, even though a mismatch between bases may be possible depending on the degree of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, regarding DNA, adenosine is complementary to thymine, and cytosine is complementary to guanine. Accordingly, the polynucleotides of the present application may also include isolated nucleic acid fragments that are complementary to the entire sequence, as well as substantially similar base sequences.
[0051] For example, a polynucleotide having homology or identity with the polynucleotide of the present application can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. Additionally, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and can be appropriately adjusted by a person skilled in the art according to the purpose.
[0052] The appropriate strictness for hybridizing the above polynucleotides depends on the length and degree of complementarity of the polynucleotides, and the variables are well known in the art (e.g., J. Sambrook et al., i.e.).
[0054] In this application, the term "purine nucleotide" may specifically be one or more nucleotides selected from the group consisting of 5'-inosine monophosphate (hereinafter IMP), 5'-xanthosine monophosphate (hereinafter XMP), and 5'-guanosine monophosphate (hereinafter GMP). The above IMP refers to a nucleotide composed of one molecule each of hypoxanthine, ribose, and phosphate, which is a compound in which adenine has been deaminated. It can be biosynthesized from 5'-phosphoribosyl-1-pyrophosphate (PRPP), specifically by replacing the pyrophosphate group bonded to the 1st carbon of PRPP with a nitrogen atom and forming an imidazole ring and a pyrimidine ring over nine steps. The above XMP refers to a nucleotide dehydrogenated from IMP. It can be synthesized from IMP by 5'-inosine-5'-monophosphate dehydrogenase. The above GMP refers to a nucleotide having a structure in which a phosphate group is ester-bonded to the ribose portion within a guanosine molecule. The above GMP can be synthesized by adding an ammonia molecule to XMP by 5'-guanic acid biosynthesizer (GMP synthase). The method for producing GMP from XMP and / or the means used in said method may be selected from known techniques.
[0056] In this application, the term "microorganism (or strain)" includes both wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification. It refers to a microorganism in which specific mechanisms are weakened or enhanced due to causes such as the insertion of external genes or the increase or inactivation of the activity of endogenous genes, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein, or product. In this application, "microorganism" and "strain" may be used interchangeably without limitation as having the same meaning.
[0057] For example, the microorganism of the present application may be a microorganism in which the serine hydroxymethyltransferase protein activity is enhanced compared to the intrinsic activity (e.g., a recombinant strain), but is not limited thereto.
[0058] In this application, the term "microorganism having the ability to produce purine nucleotides" refers to a prokaryotic or eukaryotic microbial strain capable of producing purine nucleotides within an organism, and may include both microorganisms in which the ability to produce purine nucleotides is conferred to a parent strain that lacks the ability to produce purine nucleotides, and microorganisms that inherently possess the ability to produce purine nucleotides. The ability to produce purine nucleotides may be conferred or enhanced by species improvement.
[0059] In this application, the term "non-mutated microorganism" does not exclude strains containing mutations that may naturally occur in microorganisms, and may refer to wild-type strains or natural-type strains themselves, or strains prior to genetic mutations caused by natural or artificial factors. The term "non-mutated microorganism" may be used interchangeably with "pre-mutation strain," "pre-mutation microorganism," "non-mutated strain," "non-mutated microorganism," "pre-mutation parent strain," "wild-type microorganism," "reference microorganism," or "standard microorganism." In this application, a non-mutated microorganism may refer to a strain in which the serine hydroxymethyltransferase protein activity of this application is not enhanced compared to its intrinsic activity, or prior to enhancement, but is not limited thereto. Additionally, in this application, a non-mutated microorganism may be a microorganism comprising the amino acid sequence of SEQ ID NO. 46 or the polynucleotide of SEQ ID NO. 47, but is not limited thereto.
[0061] For the purposes of this application, the microorganisms of this application may include all microorganisms capable of producing a desired purine nucleotide by enhancing serine hydroxymethyltransferase protein activity relative to its intrinsic activity. For example, the microorganisms of this application are characterized by increased purine nucleotide production capacity by enhancing serine hydroxymethyltransferase protein activity relative to its intrinsic activity, and may be genetically modified microorganisms or recombinant microorganisms, but are not limited thereto. Specifically, the recombinant strain with increased purine nucleotide production capacity may be a microorganism with increased purine nucleotide production capacity compared to a natural wild-type microorganism or an unmodified microorganism having the intrinsic activity of serine hydroxymethyltransferase protein, but is not limited thereto.
[0062] For example, a microorganism having the ability to produce purine nucleotides is a prokaryotic or eukaryotic microbial strain capable of producing purine nucleotides within an organism, and may include both a microorganism that inherently has the ability to produce purine nucleotides and a microorganism in which the ability to produce purine nucleotides is conferred due to the enhanced serine hydroxymethyltransferase protein activity of the present application to a parent strain that does not have the ability to produce purine nucleotides. The ability to produce purine nucleotides may be conferred or enhanced by species improvement.
[0063] For example, the recombinant microorganism having the ability to produce purine nucleotides according to the present application may include all microorganisms capable of producing purine nucleotides by being transformed through a vector and having the serine hydroxymethyltransferase protein activity of the present application enhanced.
[0065] In this application, the term "increase" of polypeptide activity means that the activity of the polypeptide is enhanced compared to its intrinsic activity. The enhancement may be used interchangeably with terms such as activation, up-regulation, overexpression, and enhancement.
[0066] The above enhancement may include exhibiting activity that was not originally possessed, or exhibiting activity that is enhanced compared to the intrinsic activity or activity prior to modification.
[0067] For example, the above "exhibiting activity that was not originally possessed" may be the "introduction of a protein," but is not limited thereto. The introduction of the protein refers to the manifestation of activity of a specific protein as a result of a gene that was not originally possessed by the microorganism being expressed within the microorganism, or the manifestation of enhanced or improved activity compared to the intrinsic activity of the said protein or its activity prior to modification. For example, a polynucleotide encoding a specific protein may be introduced into the chromosome of the microorganism, or a vector containing a polynucleotide encoding a specific protein may be introduced into the microorganism, resulting in the manifestation of its activity.
[0068] The above “intrinsic activity” refers to the activity of a specific polypeptide originally possessed by the parent strain or non-modified microorganism prior to the change in traits caused by genetic variation due to natural or artificial factors. This term may be used interchangeably with “pre-modification activity.”
[0069] The enhancement of polypeptide activity relative to intrinsic activity means that it has improved compared to the activity and / or concentration (expression level) of a specific polypeptide originally possessed by the parent strain or non-modified microorganism prior to transformation.
[0070] For example, the above enhancement may be such that the activity of the corresponding protein, which was previously absent, appears, or the activity or concentration thereof is enhanced to approximately 1%, approximately 10%, approximately 25%, approximately 50%, approximately 75%, approximately 100%, approximately 150%, approximately 200%, approximately 300%, approximately 400%, or approximately 500%, up to approximately 1000% or approximately 2000% or more, based on the activity or concentration in the wild-type protein or the initial microbial strain, but is not limited thereto.
[0071] Enhancement of the activity of the above polypeptide can be achieved by introducing an exogenous polypeptide or by enhancing the activity of the intrinsic polypeptide. Whether the activity of the above polypeptide has been enhanced can be confirmed by the enhancement of the activity level, expression amount, or amount of product released from the said polypeptide.
[0072] The enhancement of the activity of the above polypeptide may be achieved by applying various methods well known in the art, and is not limited to, as long as the activity of the target polypeptide can be enhanced compared to that of the microorganism before modification. Specifically, it may utilize, but is not limited to, gene engineering and / or protein engineering known to a person skilled in the art, which are routine methods of molecular biology (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
[0073] Specifically, the enhancement of the activity of the polypeptide of the present application is
[0074] 1) Enhancement of the intracellular copy number of polynucleotides encoding polypeptides;
[0075] 2) Modification of a gene expression regulatory region on a chromosome encoding a polypeptide (e.g., occurrence of a mutation within the expression regulatory region, replacement with a sequence having greater activity, or insertion of a sequence having greater activity);
[0076] 3) A modification of the nucleotide sequence encoding the start codon or the 5'-UTR region of the gene transcript encoding the polypeptide;
[0077] 4) Modification of the amino acid sequence of the polypeptide to enhance polypeptide activity;
[0078] 5) Modification of the polynucleotide sequence encoding the polypeptide to enhance polypeptide activity (e.g., modification of the polynucleotide sequence of the polypeptide gene to code for a polypeptide modified to enhance polypeptide activity);
[0079] 6) Introduction of an exogenous polypeptide exhibiting polypeptide activity or an exogenous polynucleotide encoding the same;
[0080] 7) Codon optimization of polynucleotides encoding polypeptides;
[0081] 8) Analyze the tertiary structure of the polypeptide to select and modify or chemically modify the exposed sites; or
[0082] 9) It may be a combination of two or more selected from 1) to 8) above, but is not specifically limited thereto.
[0083] for example,
[0084] The enhancement of the intracellular copy number of the polynucleotide encoding the polypeptide in the above 1) may be achieved by introducing into a host cell a vector to which the polynucleotide encoding the polypeptide is operablely linked, which can replicate and function independently of the host. Alternatively, one or more copies of the polynucleotide encoding the polypeptide may be introduced into the chromosomes within the host cell. The introduction into the chromosomes may be performed by introducing into the host cell a vector capable of inserting the polynucleotide into the chromosomes within the host cell, but is not limited thereto. The vector is as described above.
[0085] Replacing the gene expression regulatory region (or expression regulatory sequence) on the chromosome encoding the polypeptide mentioned in 2) above with a sequence having potent activity may, for example, involve deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to further enhance the activity of the expression regulatory region, or may involve a sequence mutation, or replacement with a sequence having stronger activity. The expression regulatory region may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, the original promoter may be replaced with a potent promoter, but is not limited thereto.
[0086] Examples of known strong promoters include, but are not limited to, cj1 to cj7 promoters (US Patent No. 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13(sm3) promoter (US Patent No. 10584338 B2), O2 promoter (US Patent No. 10273491 B2), tkt promoter, and yccA promoter.
[0087] The above 3) sequence modification of the start codon or 5'-UTR region of the gene encoding the polypeptide may, for example, be a substitution with another start codon that has a higher polypeptide expression rate compared to the intrinsic start codon, but is not limited thereto.
[0088] The modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above may involve the occurrence of sequence mutations in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to enhance the activity of the polypeptide, or may involve replacement with an amino acid sequence or polynucleotide sequence modified to have stronger activity or an amino acid sequence or polynucleotide sequence modified to enhance activity, but is not limited thereto. Specifically, the replacement may be performed by inserting the polynucleotide into the chromosome by homologous recombination, but is not limited thereto. The vector used in this case may additionally include a selection marker to confirm whether chromosome insertion has occurred. The selection marker is as described above.
[0089] The introduction of an exogenous polynucleotide exhibiting the activity of the polypeptide described in 6) above may be the introduction into a host cell of an exogenous polynucleotide encoding a polypeptide that exhibits the same or similar activity as the polypeptide. As long as the exogenous polynucleotide exhibits the same or similar activity as the polypeptide, there are no restrictions on its origin or sequence. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the polypeptide may be generated and its activity enhanced by the expression of the introduced polynucleotide within the host cell.
[0090] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be a codon optimization of the intrinsic polynucleotide to enhance transcription or translation within the host cell, or a codon optimization of the extrinsic polynucleotide to enable optimized transcription or translation within the host cell.
[0091] 8) Analyzing the tertiary structure of the polypeptide above to select and modify or chemically modify an exposed site may, for example, involve determining a template protein candidate based on the degree of sequence similarity by comparing the sequence information of the polypeptide to be analyzed with a database in which sequence information of known proteins is stored, and confirming the structure based on this to select and modify or chemically modify an exposed site.
[0092] Such enhancement of polypeptide activity may involve enhancing the activity or concentration of the corresponding polypeptide based on the activity or concentration of the polypeptide expressed in the wild-type or pre-modification microbial strain, or increasing the amount of product produced from said polypeptide, but is not limited thereto.
[0094] Modification of part or all of a polynucleotide in the microorganism of the present application may be induced by (a) homologous recombination using a vector for chromosome insertion within the microorganism or genome editing using engineered nucleases (e.g., CRISPR-Cas9) and / or (b) treatment by light and / or chemicals such as ultraviolet rays and radiation, but is not limited thereto. The method of modifying part or all of the gene may include methods using DNA recombination technology. For example, deletion of part or all of the gene may be achieved by inducing homologous recombination by injecting a nucleotide sequence or vector containing a nucleotide sequence homologous to the target gene into the microorganism. The injected nucleotide sequence or vector may include a dominant selection marker, but is not limited thereto.
[0096] For example, the recombinant microorganism having the ability to produce purine nucleotides according to the present application may include all microorganisms capable of producing purine nucleotides by being transformed through a vector and having the serine hydroxymethyltransferase protein activity of the present application enhanced.
[0097] The vector of the present application may comprise a DNA product comprising a sequence of a polynucleotide encoding said target polypeptide, which is operably linked to a suitable expression control region (or expression control sequence) to enable the expression of said target polypeptide within a suitable host. The expression control region may comprise a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence coding for a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After being transformed into a suitable host cell, the vector may replicate or function independently of the host genome and may be incorporated into the genome itself.
[0098] The vectors used in this application are not particularly limited, and any vector known in the art may be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, pSK-based, pSKH-based, and pET-based vectors may be used as plasmid vectors. Specifically, vectors such as pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pSK, pSKH130, pECCG117, pUC19, pBR322, pMW118, and pCC1BAC can be used.
[0099] For example, a polynucleotide encoding a target polypeptide can be inserted into a chromosome using a vector for intracellular chromosome insertion. The insertion of said polynucleotide into the chromosome may be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker may be additionally included to confirm whether the chromosome insertion has occurred. The selection marker is intended to select cells transformed by the vector, that is, to confirm whether the target nucleic acid molecule has been inserted, and markers conferring selectable phenotypes such as drug resistance, nutritional requirements, resistance to cytotoxic agents, or expression of surface polypeptides may be used. Since only cells expressing the selection marker survive or exhibit other phenotypes in an environment treated with a selective agent, the transformed cells can be selected.
[0100] In this application, the term "transformation" means introducing a vector containing a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoded by said polynucleotide can be expressed within the host cell. The transformed polynucleotide may include both inserted into and located within the chromosomes of the host cell and extrachromosomally, as long as it can be expressed within the host cell. Additionally, said polynucleotide includes DNA and / or RNA encoding the target polypeptide. said polynucleotide may be introduced in any form that can be introduced into and expressed within the host cell. For example, said polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic structure containing all the elements necessary for self-expression. said expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal operably linked to said polynucleotide. said expression cassette may be in the form of a self-replicating expression vector. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
[0101] In this application, the term "operably linked" refers to a configuration in which a regulatory sequence is positioned at an appropriate location so that the regulatory sequence directs the expression of a coding sequence. Accordingly, "operably linked" includes a regulatory region of a functional domain having known or desired activity, such as a promoter, terminator, signal sequence, or enhancer region, being attached to or linked to a target (gene or polypeptide) so as to regulate the expression, secretion, or function of the target according to said known or desired activity. For example, it means that a promoter sequence and a polynucleotide sequence are functionally linked to initiate and mediate the transcription of a polynucleotide encoding the target variant polypeptide of this application.
[0102] In this application, the term "expression" includes, but is not limited to, any step involved in the generation of a polypeptide, e.g., transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
[0103] In this application, the term "expression vector" means a linear or circular nucleic acid molecule comprising a coding sequence and a regulatory sequence operably linked for the expression thereof.
[0104] In this application, the term "regulatory sequence" refers to a polynucleotide sequence required for the expression of a coding sequence. Each regulatory sequence may be of the same origin as the coding sequence or foreign (derived from a different gene) origin. Examples of the regulatory sequences include a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal peptide sequence, an operator sequence, a sequence coding for a ribosome binding site, and a sequence regulating transcription and translation termination. The minimum unit of the regulatory sequence may include a promoter, a transcription and translation termination sequence.
[0105] With respect to cells, polynucleotides, polypeptides, or vectors, the term “recombinant” in this application means that a cell, polynucleotide, polypeptide, or vector has been modified by the introduction of a heterologous nucleic acid or polypeptide or by a modification of a natural polynucleotide or polypeptide, or that a cell is derived from a cell so modified. Thus, for example, a recombinant cell may express a gene not found in the natural (non-recombinant) form of the cell, or may express a natural gene that is expressed, not expressed at all, or otherwise abnormally expressed.
[0107] For example, the microorganism producing the purine nucleotide may be a microorganism that inherently contains a protein composed of the amino acid sequence of SEQ ID NO. 46, or a protein composed of an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more of homology or identity with SEQ ID NO. 46.
[0108] For example, the microorganism producing the purine nucleotide may be a microorganism that inherently contains a polynucleotide sequence capable of encoding a protein comprising an amino acid sequence having at least 80% homology with SEQ ID NO. 46, a nucleotide sequence of SEQ ID NO. 47, or a nucleotide sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% homology or identity with the nucleotide sequence of SEQ ID NO. 47.
[0110] The microorganisms of the present application may include all microorganisms in which the serine hydroxymethyltransferase protein activity is enhanced relative to the intrinsic activity by various known methods.
[0112] For example, the microorganism with increased purine nucleotide production capacity of the present application may be a microorganism with increased purine nucleotide production capacity compared to a non-modified microorganism, but is not limited thereto. For example, the non-modified microorganism, which is the target strain for comparing whether the purine nucleotide production capacity has increased, may be the CJX1664 strain or the KCCM12151P strain, but is not limited thereto.
[0113] For example, the microorganism with increased purine nucleotide production capacity may be increased by about 1% or more compared to the purine nucleotide production capacity of the parent strain before mutation or the non-mutated microorganism, specifically about 1% or more, about 2.5% or more, about 5% or more, about 6% or more, about 7% or more, about 8% or more, about 9% or more, about 10% or more, about 15% or more, about 20% or more, about 25% or more, about 30% or more, or about 35% or more (there is no special limitation on the upper limit value, for example, it may be about 200% or less, about 150% or less, about 100% or less, about 50% or less, about 45% or less, or about 40% or less), but is not limited thereto as long as it has a positive increase amount compared to the production capacity of the parent strain before mutation or the non-mutated microorganism. In another example, the recombinant strain with increased purine nucleotide production capacity may have increased purine nucleotide production capacity by about 1.1 times or more, about 1.15 times or more, about 1.2 times or more, about 1.25 times or more, about 1.3 times or more, or about 1.35 times or more compared to the parent strain before mutation or the non-mutated microorganism (there is no special limitation on the upper limit, for example, it may be about 10 times or less, about 5 times or less, about 3 times or less, about 2 times or less, about 1.5 times or less, or about 1.4 times or less), but is not limited thereto.
[0115] For example, the microorganism having the ability to produce purine nucleotides may be either a prokaryotic or a eukaryotic cell, but specifically may be a prokaryotic cell. The prokaryotic cell is, for example, of the genus Escherichia (Escherichia sp.), genus Erwinia ( Erwinia sp.), Serratia genus ( Serratia sp.), genus Providencia ( Providencia sp.), genus Corynebacterium ( Corynebacteria sp.), genus Pseudomonas ( Pseudomonas sp.), genus Leptospira ( Leptospira ), Salmonella genus( Salmonella sp.), genus Brevibacteria ( Brevibacteria sp.), Hypomonas genus ( Hypomononas sp.), genus Chromobacterium ( Chromobacterium sp.) and the genus Nocardia ( Norcardia It may include microbial strains belonging to the fungi or yeasts, or sp.), or fungi. Specifically, microbial strains of the genera Escherichia, Corynebacterium, and Leptospira, and yeasts. More specifically, Corynebacterium ( Corynebacterium It may be a microbial strain of the genus ).
[0116] As a microorganism according to any one of the aforementioned embodiments, the microorganism of the present application may be a microorganism of the genus Corynebacterium.
[0117] As an example of the present application, the microorganism of the present application is Corynebacterium stearis ( Corynebacterium stationis ), Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis( Corynebacterium crudilactis ), Corynebacterium deserti( Corynebacterium deserti ), Corynebacterium epiphysiens( Corynebacterium efficiens ), Corynebacterium calunae( Corynebacterium callunae ), Corynebacterium singulare( Corynebacterium singulare ), Corynebacterium halotolerans( Corynebacterium halotolerans ), Corynebacterium striatum ( Corynebacterium striatum ), Corynebacterium ammoniagenes( Corynebacterium ammoniagenes ), Corynebacterium pollatisoli ( Corynebacterium pollutisoli ), Corynebacterium imitans( Corynebacterium imitans ), Corynebacterium testudinoris( Corynebacterium testudinoris) or Corynebacterium flavescens ( Corynebacterium flavescens ) may be. Specifically, the microorganism of the present application is a microorganism of the genus Corynebacterium, more specifically Corynebacterium stearis ( Corynebacterium stationis ) or Corynebacterium glutamicum ( Corynebacterium glutamicum It may be, but is not limited to.
[0119] The microorganism having the ability to produce purine nucleotides according to the present application may additionally have enhanced purine nucleotide production ability by enhancing the formate-dependent phosphoribosylglycinamide formyl transferase protein activity relative to the intrinsic activity, but is not limited thereto.
[0120] In this application, the term “formate-dependent phosphoribosylglycinamide formyltransferase” has activity that catalyzes the chemical reaction 10-formyltetrahydrofolate + N1-(5-phospho-D-ribosyl)glycinamide ⇔ tetrahydrofolate + N2-formyl-N1-(5-phospho-D-ribosyl)glycinamide. The formate-dependent phosphoribosylglycinamide formyltransferase of this application may be used interchangeably with PurT. Specifically, the formate-dependent phosphoribosylglycinamide formyltransferase of this application purT It may be a protein having formate-dependent phosphoribosylglycinamide formyl transferase activity encoded by a gene, but is not particularly limited to that type as long as it has activity corresponding to formate-dependent phosphoribosylglycinamide formyl transferase. purTFormate-dependent phosphoribosylglycinamide formyl transferases encoded by genes are known in the art, and the amino acid and polynucleotide sequences of said formate-dependent phosphoribosylglycinamide formyl transferases can be obtained from known databases, such as GenBank of NCBI, but are not limited thereto.
[0121] For example, the formate-dependent phosphoribosylglycinamide formyl transferase protein may include the amino acid sequence of SEQ ID NO. 62 or an amino acid sequence having 60% or more homology or identity therewith, but is not limited thereto as long as it has formate-dependent phosphoribosylglycinamide formyl transferase protein activity. Specifically, the polypeptide having the formate-dependent phosphoribosylglycinamide formyl transferase protein activity may have, include, be composed of, or be essentially composed of the amino acid sequence of SEQ ID NO. 62 or an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with SEQ ID NO. 62. For example, the formate-dependent phosphoribosylglycinamide formyl transferase protein may refer to a protein that is intrinsically present in microorganisms of the genus Corynebacterium or Corynebacterium stationaryis, but is not limited thereto. Specifically, it may be a formate-dependent phosphoribosylglycinamide formyl transferase protein composed of the amino acid sequence of SEQ ID NO. 62 that is intrinsically present in microorganisms of the genus Corynebacterium or Corynebacterium stationaryis, but is not limited thereto.
[0122] In addition, the base sequence encoding the formate-dependent phosphoribosylglycinamide formyl transferase may be a base sequence encoding a protein that exhibits the activity of the formate-dependent phosphoribosylglycinamide formyl transferase.
[0123] For example, the formate-dependent phosphoribosylglycinamide formyl transferase protein having the amino acid sequence of SEQ ID NO. 62 may have or include a sequence of SEQ ID NO. 63 or a sequence having homology or identity with SEQ ID NO. 63 of 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100%, or may be encoded by a polynucleotide that is composed of said sequence or essentially composed of said sequence, but is not limited thereto. Additionally, the sequence of SEQ ID NO. 63 can be obtained from known databases, such as GenBank of NCBI, but is not limited thereto.
[0125] As a microorganism according to any one of the preceding embodiments, the microorganism having the purine nucleotide production ability of the present application may additionally have one or more protein activities selected from the group consisting of (a) to (d) below regulated to enhance the purine nucleotide production ability, but is not limited thereto:
[0126] (a) Formate-dependent phosphoribosylglycinamide formyl transferase protein activity is enhanced relative to intrinsic activity;
[0127] (b) Serine dehydrase protein activity is weakened compared to intrinsic activity;
[0128] (c) Glycine-degrading enzyme protein activity is enhanced relative to intrinsic activity; and
[0129] (d) Formate dehydrogenase protein activity is weakened relative to intrinsic activity.
[0131] In this application, the term "weakening" of polypeptide activity is a concept that encompasses both reduced activity and lack of activity compared to intrinsic activity. The term "weakening" may be used interchangeably with terms such as deficiency, inactivation, deletion, disruption, down-regulation, decline, attenuation, repression, and reduction.
[0132] For example, the above weakening refers to a state in which the protein exhibits activity but is not completely inactivated by deletion, and may mean a case where the protein's activity is weakened compared to the non-modified microorganism, wild-type strain, or parent strain, but is not limited thereto.
[0133] For example, the above weakening may be inactivation, but is not limited thereto. The above inactivation may mean that the expression of the protein is not expressed at all compared to the parent strain or the unmodified strain, or that even if expressed, its activity is absent or weakened.
[0134] The above weakening may also include cases where the activity of the polypeptide itself is weakened or eliminated compared to the activity of the polypeptide originally possessed by the microorganism due to mutations in the polynucleotide encoding the polypeptide, etc., cases where the overall polypeptide activity level within the cell is lower than that of the natural strain due to inhibition of gene expression encoding it or inhibition of translation into the polypeptide, cases where the expression of the said gene does not occur at all, and cases where there is no polypeptide activity even if the gene is expressed.
[0135] The weakening of polypeptide activity relative to intrinsic activity means that the activity of a specific polypeptide has decreased compared to the activity originally possessed by the parent strain or non-modified microorganism prior to transformation. Whether the activity of the polypeptide has weakened can be confirmed by a decrease in the degree of activity, expression amount, or amount of product released from the polypeptide.
[0136] For example, the above weakening may be less than about 100%, about 90% or less, about 80% or less, about 70% or less, about 60% or less, about 50% or less, about 40% or less, about 30% or less, about 20% or less, about 10% or less, about 5% or less, or 0% of the protein activity of the parent strain or non-modified microorganism before transformation, but is not limited thereto.
[0137] For example, the above inactivation may mean that protein expression does not occur at all compared to non-modified microorganisms, or that even if expressed, its activity is absent or weakened.
[0138] The attenuation of the activity of such polypeptides can be performed by any method known in the art, but is not limited thereto, and can be achieved by the application of various methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012 et al.).
[0139] Specifically, the weakening of polypeptide activity of the present application
[0140] 1) Deletion of all or part of a gene encoding a polypeptide;
[0141] 2) Modification of the expression regulatory region (or expression regulatory sequence) to weaken the expression of the gene encoding the polypeptide;
[0142] 3) Modification of the amino acid sequence constituting the polypeptide so as to remove or weaken the activity of the polypeptide (e.g., deletion / substitution / addition of one or more amino acids in the amino acid sequence);
[0143] 4) Modification of the polynucleotide sequence encoding the polypeptide so as to remove or weaken the activity of the polypeptide (e.g., deletion / substitution / addition of one or more nucleotides on the nucleotide sequence of the polypeptide gene to code for a polypeptide modified so as to remove or weaken the activity of the polypeptide);
[0144] 5) Modification of the start codon or 5'-UTR region nucleotide sequence of a gene encoding a polypeptide;
[0145] 6) Introduction of an antisense oligonucleotide (e.g., antisense RNA) that binds complementarily to the transcript of the gene encoding the polypeptide;
[0146] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence to the front of the Shine-Dalgarno sequence of a polypeptide-coding gene to form a secondary structure that prevents ribosome attachment;
[0147] 8) Addition of a reverse-transcribed promoter to the 3' end of the open reading frame (ORF) of a polynucleotide sequence encoding a polypeptide (Reverse transcription engineering, RTE); or
[0148] 9) It may be a combination of two or more selected from 1) to 8) above, but is not specifically limited thereto.
[0149] for example,
[0150] The deletion of part or all of the gene encoding the polypeptide mentioned above 1) may be the removal of the entire polynucleotide encoding the intrinsic target polypeptide within the chromosome, replacement with a polynucleotide in which some nucleotide sequences have been deleted, or replacement with a marker gene.
[0151] Methods for deleting part or all of such polynucleotides may be performed by deleting the polynucleotide through homologous recombination using a vector for chromosome insertion into the microorganism, or by inducing mutations using light such as ultraviolet light or chemicals and selecting strains with a deleted target gene from the obtained mutants, but are not limited thereto. The method of deleting part or all of the gene may include methods using DNA recombination technology. For example, the deletion of part or all of the gene may be achieved by injecting a nucleotide sequence or vector containing a nucleotide sequence homologous to the target gene into the microorganism to cause homologous recombination. The injected nucleotide sequence or vector may include a dominant selection marker, but is not limited thereto.
[0152] Additionally, the modification of the expression-regulating sequence in step 2) above may be a deletion, insertion, non-conservative or conservative substitution, or a combination thereof, resulting in a mutation on the expression-regulating region (or expression-regulating sequence), or a replacement with a sequence having weaker activity. The expression-regulating region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.
[0153] In addition, the modification of the amino acid sequence or polynucleotide sequence of 3) and 4) above may be a sequence variation occurring by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to weaken the activity of the polypeptide, or a replacement with an amino acid sequence or polynucleotide sequence modified to have weaker activity or an amino acid sequence or polynucleotide sequence modified to have no activity, but is not limited thereto. For example, gene expression may be inhibited or weakened by introducing a variation within the polynucleotide sequence to form a stop codon, but is not limited thereto.
[0154] In addition, the nucleotide sequence modification of the start codon or 5'-UTR region of the gene encoding the polypeptide above 5) may, for example, be a substitution with another start codon that has a lower polypeptide expression rate compared to the intrinsic start codon, but is not limited thereto.
[0155] For the introduction of an antisense oligonucleotide (e.g., antisense RNA) that binds complementarily to the transcript of the gene encoding the polypeptide 6) mentioned above, refer to the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].
[0156] 7) Adding a sequence complementary to the Shine-Dalgarno sequence to the front of the Shine-Dalgarno sequence of a polypeptide-coding gene to form a secondary structure that prevents ribosome attachment may make mRNA translation impossible or slow it down.
[0157] Reverse transcription engineering (RTE) of a promoter that is transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the polynucleotide sequence encoding the polypeptide above 8) may weaken the activity by creating an antisense nucleotide complementary to the transcript of the gene encoding the polypeptide.
[0159] As an example of the present application, the microorganism having the ability to produce purine nucleotides according to the present application may additionally have serine dehydrase protein activity weakened relative to intrinsic activity, and thus may be a microorganism with enhanced ability to produce purine nucleotides, but is not limited thereto.
[0160] In this application, the term "serine dehydratase (L-serine dehydratase)" refers to an enzyme that catalyzes the chemical reaction L-serine ↔ pyruvate + NH3. The serine dehydratase of this application may be used interchangeably with SdaA or L-serine ammonia degrading enzyme. Specifically, the serine dehydratase of this application is sdaA It may be a protein having serine dehydrase activity encoded by a gene, but is not particularly limited to that type as long as it has activity corresponding to serine dehydrase. sdaA Serine dehydrases encoded by genes are known in the art, and the amino acid and polynucleotide sequences of said serine dehydrases can be obtained from known databases, examples of which include, but are not limited to, GenBank of NCBI.
[0161] For example, the serine dehydrase protein may include the amino acid sequence of SEQ ID NO. 48 or an amino acid sequence having 60% or more homology or identity therewith, but is not limited thereto as long as it has serine dehydrase protein activity. Specifically, the polypeptide having serine dehydrase protein activity may have, include, be composed of, or be essentially composed of the amino acid sequence of SEQ ID NO. 48 or an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with SEQ ID NO. 48. For example, the above serine dehydrase protein may refer to a protein that is inherently present in a microorganism of the genus Corynebacterium or Corynebacterium stationaryis, but is not limited thereto. Specifically, it may be a serine dehydrase protein composed of the amino acid sequence of SEQ ID NO. 48 that is inherently present in a microorganism of the genus Corynebacterium or Corynebacterium stationaryis, but is not limited thereto.
[0162] In addition, the base sequence encoding the serine dehydrase may be a base sequence encoding a protein that exhibits the activity of the serine dehydrase.
[0163] For example, the serine dehydrase protein having the amino acid sequence of SEQ ID NO. 48 may have or include a sequence of SEQ ID NO. 49 or a sequence having homology or identity with the sequence of SEQ ID NO. 49 of 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100%, or may be coded by a polynucleotide that is composed of or essentially composed of said sequence. In addition, the sequence of SEQ ID NO. 49 can be obtained from known databases, such as GenBank of NCBI, but is not limited thereto.
[0165] As an example of the present application, the microorganism having the ability to produce purine nucleotides according to the present application may be a microorganism in which the glycine degrading enzyme protein activity is further enhanced compared to the intrinsic activity, thereby improving the ability to produce purine nucleotides, but is not limited thereto.
[0166] In this application, the term “glycine-degrading enzyme protein” may be used to refer to a protein that is directly or indirectly involved in the glycine degradation pathway, and may mean each protein constituting the glycine degradation system, a complex of said proteins, or said glycine degradation system itself. Specifically, said glycine-degrading enzyme protein may be one or more proteins selected from the group consisting of T-protein (GcvT), P-protein (GcvP), L-protein (GcvL), H-protein (GcvH) constituting the glycine degradation system, and LipB and LipA, which are coenzymes of said glycine degradation system, but is not limited thereto (John E. Cronan, Microbiology and Molecular Biology Reviews., 13 April 2016). The glycine-degrading enzyme protein of this application may be used interchangeably with GcvPTH or the glycine cleavage system.
[0167] In this application, the term “glycine cleavage system (GCV)” consists of two or more subunits, namely subunits GcvP, GcvT, and GcvH, comprising carbon dioxide, ammonium ions, and N of glycine. 5-10 It is a multi-enzyme complex that catalyzes oxidative decarboxylation and deamination to methylene tetrahydrofolate. The glycine cleavage system of the present application can be used in combination with a glycine degradation system.
[0168] Specifically, the glycine-degrading enzyme protein of the present application gcvP, gcvT and gcvH It may be a protein having the GcvP, GcvT, and GcvH protein activities encoded by each of the genes, but is not particularly limited to that type as long as it has activity corresponding to a glycine-degrading enzyme protein. gcvP, gcvT and gcvH The GcvP, GcvT, and GcvH proteins encoded by each of the respective genes are each known in the art, and the amino acid and polynucleotide sequences of each of the said GcvP, GcvT, and GcvH proteins can be obtained from known databases, examples of which include, but are not limited to, GenBank of NCBI.
[0169] For example, the above GcvP, GcvT, and GcvH proteins may each include the amino acid sequence of SEQ ID NO. 56, SEQ ID NO. 58, and SEQ ID NO. 60, or an amino acid sequence having 60% or more homology or identity therewith, but are not limited thereto as long as they have glycine-degrading enzyme protein activity. Specifically, the polypeptides having the above GcvP, GcvT, and GcvH protein activity may each have, include, be composed of, or be essentially composed of the above amino acid sequence, said amino acid sequence, said amino acid sequence, said amino acid sequence, said amino acid sequence, or said amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with SEQ ID NO. 56, SEQ ID NO. 58, and SEQ ID NO. 60. For example, the above GcvP, GcvT, and GcvH proteins may refer to proteins that are inherently present in microorganisms of the genus Corynebacterium or Corynebacterium stationaryis, but are not limited thereto. Specifically, they may be the GcvP protein composed of the amino acid sequence of SEQ ID NO. 56, the GcvT protein composed of the amino acid sequence of SEQ ID NO. 58, and the GcvH protein composed of the amino acid sequence of SEQ ID NO. 60, which are inherently present in microorganisms of the genus Corynebacterium or Corynebacterium stationaryis, but are not limited thereto.
[0170] In addition, the base sequences encoding the above GcvP, GcvT, and GcvH proteins may be base sequences encoding a protein that exhibits the activity of a glycine degrading enzyme protein.
[0171] For example, the proteins GcvP, GcvT, and GcvH having the amino acid sequences of SEQ ID NO. 56, SEQ ID NO. 58, and SEQ ID NO. 60, respectively, may each have or include a sequence of SEQ ID NO. 57, SEQ ID NO. 59, and SEQ ID NO. 61, or a sequence of nucleotides having homology or identity of 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% with respect to the sequences of SEQ ID NO. 57, SEQ ID NO. 59, and SEQ ID NO. 61, respectively, or may be encoded by a polynucleotide that is composed of said nucleotide sequences or may essentially be composed of said nucleotide sequences, but are not limited thereto. Additionally, the nucleotide sequences of SEQ ID NO. 57, SEQ ID NO. 59, and SEQ ID NO. 61, respectively, may be obtained from known databases, such as GenBank of NCBI, but are not limited thereto.
[0173] As an example of the present application, the microorganism having the ability to produce purine nucleotides according to the present application may additionally have formate dehydrogenase protein activity weakened relative to intrinsic activity, thereby enhancing the ability to produce purine nucleotides, but is not limited thereto.
[0174] In this application, the term “formate dehydrogenase” is composed of formate dehydrogenase subunit 1 (Fdh subunit 1), formate dehydrogenase subunit 2 (Fdh subunit 2), and formate dehydrogenase subunit 3 (Fdh subunit 3), which catalyzes an oxidation reaction using formic acid as a substrate to produce NAD +It is an enzyme that reduces and produces NADH and CO2. Specifically, the formate dehydrogenase of the present application may be one or more proteins selected from the group consisting of formate dehydrogenase subunit 1 (Fdh subunit 1), formate dehydrogenase subunit 2 (Fdh subunit 2), and formate dehydrogenase subunit 3 (Fdh subunit 3), but is not limited thereto. The formate dehydrogenase of the present application may be used to mean a complex of formate dehydrogenase subunit 1 (Fdh subunit 1), formate dehydrogenase subunit 2 (Fdh subunit 2), and formate dehydrogenase subunit 3 (Fdh subunit 3), and may be used interchangeably with Fdh.
[0175] The "of this application" fdh "Genes" fdh 1, fdh 2, and fdh 3 It is composed of a gene and may be used to mean the gene encoding the formate dehydrogenase of the present application. Specifically, the present application fdh The term "gene" may be used to refer to the gene encoding the complex of formate dehydrogenase subunit 1 (Fdh subunit 1), formate dehydrogenase subunit 2 (Fdh subunit 2), and formate dehydrogenase subunit 3 (Fdh subunit 3) of the present application.
[0176] Specifically, the formic acid dehydrogenase of the present application fdh 1, fdh 2, and fdh 3 It may be a protein having the activities of formate dehydrogenase subunit 1 (Fdh subunit 1), formate dehydrogenase subunit 2 (Fdh subunit 2), and formate dehydrogenase subunit 3 (Fdh subunit 3) encoded by each of the genes, but is not particularly limited to that type as long as it has activity corresponding to formate dehydrogenase. fdh 1, fdh 2, and fdh 3Formate dehydrogenase subunit 1 (Fdh subunit 1), formate dehydrogenase subunit 2 (Fdh subunit 2), and formate dehydrogenase subunit 3 (Fdh subunit 3), each encoded by a gene, are known in the art, and the amino acid and polynucleotide sequences of each of the formate dehydrogenase subunit 1 (Fdh subunit 1), formate dehydrogenase subunit 2 (Fdh subunit 2), and formate dehydrogenase subunit 3 (Fdh subunit 3) can be obtained from known databases, examples of which include, but are not limited to, GenBank of NCBI.
[0177] For example, the formate dehydrogenase subunit 1 (Fdh subunit 1), formate dehydrogenase subunit 2 (Fdh subunit 2), and formate dehydrogenase subunit 3 (Fdh subunit 3) may each include the amino acid sequences of SEQ ID NO. 50, SEQ ID NO. 52, and SEQ ID NO. 54, or amino acid sequences having 60% or more homology or identity therewith, but are not limited thereto as long as they have formate dehydrogenase protein activity. Specifically, polypeptides having the activities of formate dehydrogenase subunit 1 (Fdh subunit 1), formate dehydrogenase subunit 2 (Fdh subunit 2), and formate dehydrogenase subunit 3 (Fdh subunit 3) may each have, include, be composed of, or be essentially composed of the amino acid sequences having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with each of SEQ ID NO. 50, SEQ ID NO. 52, and SEQ ID NO. 54.For example, the above-mentioned proteins formate dehydrogenase subunit 1 (Fdh subunit 1), formate dehydrogenase subunit 2 (Fdh subunit 2), and formate dehydrogenase subunit 3 (Fdh subunit 3) may refer to proteins that are inherently present in microorganisms of the genus Corynebacterium or Corynebacterium stationaryis, but are not limited thereto. Specifically, they may be the formate dehydrogenase subunit 1 (Fdh subunit 1) protein composed of the amino acid sequence of SEQ ID NO. 50, the formate dehydrogenase subunit 2 (Fdh subunit 2) protein composed of the amino acid sequence of SEQ ID NO. 52, and the formate dehydrogenase subunit 3 (Fdh subunit 3) protein composed of the amino acid sequence of SEQ ID NO. 54, which are inherently present in microorganisms of the genus Corynebacterium or Corynebacterium stationaryis, but are not limited thereto.
[0178] In addition, the base sequence encoding the formate dehydrogenase may be a base sequence encoding a protein that exhibits the activity of formate dehydrogenase.
[0179] For example, the base sequence encoding the formate dehydrogenase subunit 1 (Fdh subunit 1), formate dehydrogenase subunit 2 (Fdh subunit 2), and formate dehydrogenase subunit 3 (Fdh subunit 3) may be a base sequence encoding a protein that exhibits formate dehydrogenase activity.
[0180] The formate dehydrogenase subunit 1 (Fdh subunit 1), formate dehydrogenase subunit 2 (Fdh subunit 2), and formate dehydrogenase subunit 3 (Fdh subunit 3), each having the amino acid sequences of SEQ ID NO. 50, SEQ ID NO. 52, and SEQ ID NO. 54, may each have or include a base sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% homology or identity with the sequences of SEQ ID NO. 51, SEQ ID NO. 53, and SEQ ID NO. 55, respectively, or may be coded by a polynucleotide that may consist of or essentially consist of said base sequences. In addition, the nucleotide sequences of SEQ ID NO. 51, SEQ ID NO. 53, and SEQ ID NO. 55, respectively, can be obtained from known databases, such as NCBI’s GenBank, but are not limited thereto.
[0182] As a microorganism according to any one of the aforementioned embodiments, the microorganism having the purine nucleotide production ability of the present application may be a microorganism in which the serine dehydrase protein activity is weakened compared to the intrinsic activity, the serine hydroxymethyltransferase protein activity is strengthened compared to the intrinsic activity, the glycine dehydrogenase protein activity is strengthened compared to the intrinsic activity, the formate dehydrogenase protein activity is weakened compared to the intrinsic activity, and the formate-dependent phosphoribosylglycinamide formyl transferase protein activity is strengthened compared to the intrinsic activity, thereby improving the purine nucleotide production ability, but is not limited thereto.
[0184] Another aspect of the present application provides a method for producing purine nucleotides, comprising the step of culturing a microorganism in a medium in which the serine hydroxymethyltransferase protein activity of the present application is enhanced relative to the intrinsic activity.
[0185] In this application, the term "culture" means growing the strain of this application under appropriately controlled environmental conditions. The culture process of this application may be carried out according to suitable media and culture conditions known in the art. Such a culture process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culture may be batch, continuous, and / or fed-batch, but is not limited thereto.
[0186] In this application, the term "medium" refers to a substance mixed with nutrients as the main component required to culture the microorganism of this application, and supplies nutrients and growth factors, including water, which is indispensable for survival and growth. Specifically, any medium and other culture conditions used for culturing the strain of this application may be used without special limitations as long as they are media used for culturing ordinary microorganisms; however, the microorganism of this application may be cultured under aerobic conditions while controlling the temperature, pH, etc., in a conventional medium containing a suitable carbon source, nitrogen source, phosphorus, inorganic compounds, amino acids, and / or vitamins. For example, culture media for strains of the genus Corynebacterium can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981)].
[0187] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvate, lactic acid, citric acid, etc.; and amino acids such as glutamic acid, methionine, lysine, etc. Additionally, natural organic nutrient sources such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane residue, and corn steeping liquid may be used. Specifically, carbohydrates such as glucose and sterilized pre-treated molasses (i.e., molasses converted into reducing sugars) may be used, and other carbon sources in appropriate amounts may be used in various ways without limitation. These carbon sources may be used individually or in combination of two or more types, but are not limited thereto.
[0188] The above nitrogen sources may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; and organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc., peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquid, casein hydrolysate, fish or its decomposition products, defatted soybean cake or its decomposition products, etc. These nitrogen sources may be used alone or in combination of two or more types, but are not limited thereto.
[0189] The above ingredients may include monopotassium phosphate, dipotassium phosphate, or corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc., and may also include amino acids, vitamins, and / or suitable precursors. These components or precursors may be added to the culture medium in a batch or continuous manner. However, they are not limited thereto.
[0190] In addition, during the cultivation of the microorganism of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc., may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during cultivation, an antifoaming agent such as fatty acid polyglycol ester may be used to suppress the formation of bubbles. Furthermore, to maintain an aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection to maintain an anaerobic and microaerobic state, but is not limited thereto.
[0191] In the culture of the present application, the culture temperature can be maintained at 27 to 37°C, specifically 30 to 33°C, and culture can be carried out for about 20 to 120 hours, but is not limited thereto.
[0192] In this application, the term "culture" means a culture solution, concentrated culture solution, dried culture solution, culture filtrate, concentrated culture filtrate, or dried culture filtrate obtained by culturing a specific microorganism in a culture medium, wherein the culture solution means containing the specific microorganism, and the culture filtrate means not substantially containing the specific microorganism (wherein "substantially" means excluding the specific microorganism separated by filtration, etc., and does not mean that the microorganism is completely excluded from the filtrate). The formulation of the culture is not limited and may be, for example, a liquid, an emulsion, or a solid. Specifically, for the purposes of this application, the culture may contain a purine nucleotide.
[0193] In this application, the term "fermentation" refers to a process in which microorganisms decompose organic matter using their own enzymes, excluding putrefaction. Although fermentation and putrefaction proceed through similar processes, if useful substances are produced as a result of the decomposition, it is called fermentation, whereas if foul odors are emitted or harmful substances are produced, it is called putrefaction.
[0194] In this application, the method of obtaining a fermented product from the strain is not particularly limited and can be obtained according to methods commonly used in the relevant technical field or similar fields.
[0195] In this application, the term "fermented product" includes not only the fermented substance itself, but also all types of substances including a culture medium of a strain in which the strain and the culture coexist, a fermented product obtained by filtering the strain from the culture medium, a fermented product obtained by sterilizing the strain from the culture medium and filtering it, an extract obtained by extracting the fermented product or a culture medium containing it, a diluted solution obtained by diluting the fermented product or the extract thereof, a concentrate obtained by drying the fermented product or the extract thereof, a lysate obtained by capturing and crushing the cells of the strain, etc.
[0196] In the method of the present application, any culture conditions and methods known in the art may be used for the culture of microorganisms. Such a culture process can be easily adjusted and used by a person skilled in the art depending on the selected strain.
[0197] The purine nucleotides produced by the culture of the present application may be secreted into the culture medium or remain in the cell.
[0199] In one embodiment, the method for producing purine nucleotides of the present application may additionally include the step of preparing a microorganism of the present application, the step of preparing a medium for culturing said strain, or a combination thereof (in any order), for example, prior to the culturing step.
[0200] The method for producing purine nucleotides according to the present application may further include a step of recovering a target substance, specifically purine nucleotides, from the cultured microorganism, the culture of the microorganism, the fermented product of the microorganism, or the culture medium. The recovery step may be additionally included after the culture step.
[0201] The above recovery may involve collecting the desired purine nucleotides using a suitable method known in the art according to the culture method of the microorganism of the present application, such as a batch, continuous, or fed-batch culture method. For example, various chromatographs such as centrifugation, filtration, treatment with a crystallizing protein precipitating agent (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC, or a combination thereof may be used, and the target substance, specifically purine nucleotides, may be recovered from the culture medium or microorganism using a suitable method known in the art.
[0202] In addition, the method for producing purine nucleotides of the present application may additionally include a purification step. The purification may be performed using a suitable method known in the art. In one example, where the method for producing purine nucleotides of the present application includes both a recovery step and a purification step, the recovery step and the purification step may be performed continuously or discontinuously regardless of the order, or simultaneously or integrated into a single step, but are not limited thereto.
[0203] In the method of the present application, the enhancement of serine hydroxymethyltransferase protein activity and purine nucleotides, etc., are as described in the other embodiments above.
[0205] Another aspect of the present application provides a composition for producing purine nucleotides comprising a microorganism in which the serine hydroxymethyltransferase protein activity of the present application is enhanced relative to its intrinsic activity, a culture of said microorganism, a fermented product of said microorganism, or a combination of two or more of these.
[0206] The composition of the present application may further include any suitable excipients commonly used in compositions for producing purine nucleotides, and such excipients may be, for example, preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers, or isotonic agents, but are not limited thereto.
[0207] In one specific example, each component present in the composition of the present application may be included in a microbiologically effective amount or in an amount that can be appropriately present in a composition for production.
[0208] In the composition of the present application, the enhancement of serine hydroxymethyltransferase protein activity and purine nucleotides, etc., are as described in the other embodiments above.
[0210] Another aspect of the present application provides a use for the production of purine nucleotides in microorganisms in which the serine hydroxymethyltransferase protein activity of the present application is enhanced relative to the intrinsic activity.
[0211] In the use of the present application, the enhancement of serine hydroxymethyltransferase protein activity and purine nucleotides, etc., are as described in the other embodiments above. Effects of the invention
[0213] Microorganisms in which the serine hydroxymethyltransferase protein activity of the present application is enhanced compared to the intrinsic activity can produce purine nucleotides in high yield, and can be usefully utilized for the industrial production of purine nucleotides. Specific details for implementing the invention
[0215] The present application will be explained in more detail below through examples. However, the following examples are merely preferred embodiments for illustrating the present application and are therefore not intended to limit the scope of the rights of the present application. Meanwhile, technical matters not described in this specification can be fully understood and easily implemented by a person skilled in the art who is proficient in the technical field of the present application or a similar technical field.
[0217] Example 1. Preparation of glyA - enhanced microorganisms and confirmation of XMP production ability
[0219] Example 1 - 1. Preparation of glyA gene - enhanced recombinant vectors and strains
[0221] To investigate the effect of glyA gene enhancement on XMP and GMP production, a vector was constructed to enhance and replace the promoter of the endogenous glyA gene in Corynebacterium stationaryis strains. Specifically, while searching for regions with potent promoter sequences in Corynebacterium ammoniagenes, a vector was constructed to bind the CJ7 promoter (Korean Registered Patent No. 0620092 and WO 2006 / 065095), which was confirmed to be expressible in Corynebacterium ammoniagenes and Essericia and possess potent promoter activity, to the endogenous glyA gene. The vector was constructed as follows using the plasmid pDCM2 (Korean Publication No. 10-2020-0136813) for gene insertion and replacement within Corynebacterium chromosomes.
[0222] PCR was performed using the gDNA (genomic DNA) of wild-type Corynebacterium stationaryis ATCC6872 as a template, respectively, with primer pairs of sequences SEQ ID NOs. 1 and 2, primer pairs of sequences SEQ ID NOs. 3 and 4, and primer pairs of sequences SEQ ID NOs. 5 and 6. PCR was performed by denaturation at 94°C for 5 minutes, followed by 30 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute 30 seconds, and then 72°C for 5 minutes. The pDCM2 vector was prepared by treating with XbaI and fusion cloning the PCR products obtained above. Fusion cloning was performed using the In-Fusion® HD Cloning Kit (Clontech). The resulting plasmid was named pDCM2-Pcj7 / glyA.
[0223] The sequences of the primers used for vector construction are as follows.
[0225] Sequence number Name Sequence 1 primer 5'- gtacccggggatcct GAAATCATCAGCGTTGGCCC -3' 2 primer 5'- GAACTCGTGGTGATGGTGACTATATATTCCCTTCGTCG -3' 3 primer 5'- GGAATATATAGTCACCATCACCACGAGTTCCTTCAG -3' 4 primer 5'- ATTCTGGGTAGTCATGAGTGTTTCCTTTCGTTGGG -3' 5 primer 5'- CGAAAGGAAACACTCATGACTACCCAGAATTCTTCCG -3' 6 primer 5'- gcaggtcgactctag GGAAGACTGCAGAGTTGAGC -3'
[0227] After transforming the vector prepared above into the Corynebacterium stationaryis CJX1664 strain (KR 10-1950141 B1) by electroporation, strains with the vector inserted into the chromosome were selected as primary candidates in a screening medium containing 25 mg / L kanamycin. Subsequently, among the strains in which homologous recombination occurred, strains linked to the Pcj7 promoter were selected using the primer pair of SEQ ID NO. 1 and SEQ ID NO. 6. The selected strain was named CJX1664_Pcj7 / glyA.
[0229] Example 1-2. Evaluation of XMP production capacity of glyA-enhanced strains
[0231] XMP production capacity was evaluated for the strain and parent strain prepared in Example 1-1 above through flask fermentation activity evaluation.
[0232] First, each strain was inoculated into an 18 mm diameter test tube containing 2 ml of seed medium and cultured with shaking at 30°C for 24 hours to be used as the seed culture. 0.7 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 32 ml of the following production medium (24 ml of main medium + 8 ml of separate sterile medium) and cultured at 170 rmp at 30°C for 75 hours. After the culture was completed, the production capacity of XMP was measured by HPLC. The XMP concentration and the rate of increase in concentration in the culture medium for each tested strain are shown in Table 2 below.
[0234] <Seed medium (pH 7.5)>
[0235] Glucose 1%, Peptone 1%, Meat Juice 1%, Yeast Extract 1%, Sodium Chloride 0.25%, Adenine 100mg / l, Guanine 100mg / l (per 1 liter of distilled water)
[0237] <XMP 플라스크 생산배지 (본배지)>
[0238] Glucose 40 g / L, Magnesium sulfate 10 g / L, Calcium chloride 100 mg / L, Iron sulfate 20 mg / L, Manganese sulfate 10 mg / L, Zinc sulfate 10 mg / L, Copper sulfate 0.8 mg / L, Histidine 20 mg / L, Cystine 15 mg / L, Beta-alanine 15 mg / L, Biotin 100 ug / L, Thiamine 5 mg / L, Adenine 50 mg / L, Guanine 25 mg / L, Niacin 15 mg / L, pH 7.0
[0240] <XMP Flask Production Medium (Separate Sterilized Medium)>
[0241] Monopotassium phosphate 18 g / L, dipotassium phosphate 42 g / L, urea 7 g / L, ammonium sulfate 5 g / L (based on 1 liter of distilled water)
[0243] The above experiment was repeated 3 times, and the average value of the analysis results is shown in Table 2 below.
[0245] Comparison of XMP production capacity based on glyA promoter reinforcement Strain XMP Concentration (g / L) XMP Concentration Increase Rate (%) CJX1664 4.63 - CJX1664_Pcj7 / glyA 4.92 6.26%
[0247] As shown in Table 2 above, the CJX1664_Pcj7 / glyA strain exhibited a 6.26% increase in XMP production capacity compared to the control group. This confirmed that enhancing glyA expression can be usefully applied to XMP production.
[0249] Examples 1-3. Confirmation of GMP production capacity of glyA-enhanced microorganisms
[0251] To confirm the GMP production capacity of the strain prepared in Example 1-1 and the control parent strain, the strain was first cultured using the fermentation activity evaluation method of Example 2-1. After the culture was completed, the production amount of XMP (5'-xanthiic acid) was measured by the HPLC method. To convert the generated XMP into GMP, the following conversion reaction additives and E. coli XMP aminase were added to the flask fermentation liquid, and the conversion reaction was carried out at 40°C for 2.5 hours. As a result of the experiment, the conversion rate, which represents the amount of GMP produced relative to the amount of XMP consumed, is shown in Table 3 below.
[0253] Comparison of GMP production capacity based on glyA promoter reinforcement Strain Name Concentration (g / L) Conversion Rate (%) (GMP Production / XMP Consumption) XMP GMP CJX1664 4.61 3.33 72.3 CJX1664_Pcj7 / glyA 4.94 3.57 72.4
[0255] As shown in Table 3 above, it was confirmed that GMP is produced through a conversion reaction from XMP produced by the CJX1664_Pcj7 / glyA strain.
[0257] Conversion reaction additives
[0258] Phytic acid 1.8g / L, magnesium sulfate 4.8g / L, nymeen 3ml / L, xylene 2%, adenine 100mg / L, sodium hydrogen phosphate (Na2HPO4) 7.7g / L, glutamine 2g / L, glucose 46g / L
[0260] Example 2. Preparation of sdaA-deficient and glyA-additionally enhanced strains and evaluation of XMP production capacity
[0262] Example 2-1.
[0264] We intended to investigate the combined effects of sdaA deletion and glyA enhancement in XMP-producing strains by constructing a strain with a deletion of the endogenous gene sdaA of Corynebacterium stationaryis and a strain with an additional copy of the glyA gene at the sdaA gene site. To this end, a vector was constructed as follows using the plasmid pDCM2 (Republic of Korea Publication No. 10-2020-0136813), which is used for gene insertion and replacement within Corynebacterium chromosomes.
[0265] PCR was performed using the gDNA (genomic DNA) of wild-type Corynebacterium stationaryis ATCC6872 as a template, with primer pairs of sequences SEQ ID NOs. 7 and 8 and primer pairs of sequences SEQ ID NOs. 9 and 10, respectively. PCR was performed after denaturation at 94°C for 5 minutes, followed by 30 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute 30 seconds, and then at 72°C for 5 minutes. The pDCM2 vector was prepared by treating with XbaI and fusion cloning the PCR products obtained above. Fusion cloning was performed using the In-Fusion® HD Cloning Kit (Clontech). The resulting plasmid was named pDCM2-del sdaA.
[0266] In addition, PCR and cloning were performed in the same manner using the primer pairs of sequences SEQ ID NOs. 7 and 11, the primer pairs of sequences SEQ ID NOs. 12 and 13, and the primer pairs of sequences SEQ ID NOs. 14 and 10. The resulting plasmid was named pDCM2-del sdaA-Pn / glyA.
[0267] The sequences of the primers used for vector construction are as follows.
[0269] Construction of sdaA deletion and glyA additional reinforcement recombinant vectors Sequence Number Name 7 Sequence primer 8 5'- acccggggatcctctagaGTGCCGTTACCTCCCGC-3' primer 9 5'- TGGAGTGCGTAGCGTGCGAAATGACTCCTTTCTAAA-3' primer 10 5'- TTTAGAAAGGAGTCATTTCGCACGCTACGCACTCCA-3' primer 11 5'- AAGCTTGCATGCCTGCAGCGTCACCGCGCGGAGATA-3' primer 12 5'- GAAATGACTCCTTTCTAAAAAGGGG -3' primer 13 5'- TTAGAAAGGAGTCATTTCGAACTTGCAGCAAACGTGCTG -3' primer 14 5'- CCTTGGTGAGGCACTTTGTG -3' primer
[0271] 5'- CAAAGTGCCTCACCAAGGGCACGCTACGCACTCCATATA -3'
[0273] After transforming the two vectors prepared in 2-1 above into the Corynebacterium stationaryis CJX1664 strain (KR 10-1950141 B1) by electroporation, strains with the vector inserted on the chromosome were selected as primary candidates in a screening medium containing 25 mg / L of kanamycin. Subsequently, from the strains in which homologous recombination occurred, strains with a deletion of the sdaA gene were selected using the primer pair of SEQ ID NO. 7 and SEQ ID NO. 10, and strains with a deletion of the sdaA gene and a glyA gene linked to a self-promoter inserted at the corresponding location were selected using the primer pair of SEQ ID NO. 15 and SEQ ID NO. 13. The selected strains were named CJX1664_del sdaA and CJX1664_del sdaA-Pn / glyA, respectively.
[0275] Example 2-2. Preparation of sdaA-deficient and glyA-enhanced strains Sequence No. Name 15 Sequence Primer
[0277] 5'- GTCAACGCGCACTTGGATCT-3'
[0279] The XMP production capacity of the strain and parent strain prepared in Example 2-2 above was evaluated by evaluating flask fermentation activity in the same manner as in Example 1-2 above. The experiment was repeated three times, and the average value of the analysis results is shown in Table 6 below.
[0281] Comparison of XMP production capacity of sdaA-deficient and glyA-copy-added strains Example 2-3. Evaluation of XMP production capacity of sdaA-deficient and glyA-enhanced strains Strain XMP concentration (g / L) XMP concentration increase rate (%) 4.27 - CJX1664 4.36 2.10% CJX1664_del sdaA CJX1664_del sdaA-Pn / glyA 4.59 7.49%
[0283] As shown in Table 6 above, it was confirmed that the CJX1664_del sdaA strain exhibited a 2.10% increase in XMP production capacity compared to the control group, and the CJX1664_del sdaA -Pn / glyA strain exhibited a 7.49% increase in XMP production capacity compared to CJX1664. In other words, it was confirmed that sdaA deletion is effective in improving XMP production capacity, and that simultaneously enhancing glyA expression further improves XMP production capacity. Through this, it was confirmed that deleting sdaA and enhancing glyA can be usefully applied to XMP production.
[0285] Examples 2-4. Confirmation of GMP production capacity of sdaA-deficient and glyA-enhanced strains
[0287] GMP production was confirmed using the XMP culture solution of the strain prepared in Example 2-2 above in the same manner as in Example 1-3 above, and the results are shown in Table 7 below.
[0289] Confirmation of GMP production capacity of sdaA-deficient and glyA-copied strains strain name Concentration (g / L) Conversion Rate (%) (GMP Production / XMP Consumption) XMP GMP CJX1664 4.35 3.18 73.1 CJX1664_del sdaA 4.41 3.21 72.9 CJX1664_del sdaA-Pn / glyA 4.66 3.42 73.3
[0291] As shown in Table 7 above, it was confirmed that GMP is produced through a conversion reaction from XMP produced by the CJX1664_del sdaA and CJX1664_del sdaA-Pn / glyA strains.
[0293] Example 3. Development of gcvPTH-enhanced strains based on sdaA-deficient and glyA-added enhanced strains and evaluation of XMP production capacity
[0295] Example 3-1. Production of gcvPTH-enhanced recombinant vector
[0297] An experiment was conducted to add copies of the gcvPTH gene in the form of a native promoter to the glyA-enhanced strain.
[0298] A vector for this purpose was constructed as follows using the plasmid pDCM2 (Republic of Korea Publication No. 10-2020-0136813) for the insertion and replacement of genes within Corynebacterium chromosomes.
[0299] PCR was performed using the gDNA (genomic DNA) of wild-type Corynebacterium stationaryis ATCC6872 as a template, respectively, with primer pairs of sequences SEQ ID NOs. 16 and 17, primer pairs of sequences SEQ ID NOs. 18 and 19, primer pairs of sequences SEQ ID NOs. 20 and 21, and primer pairs of sequences SEQ ID NOs. 22 and 23. PCR was performed after denaturation at 94°C for 5 minutes, followed by 30 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute 30 seconds, and then at 72°C for 5 minutes. The pDCM2 vector was prepared by treating with XbaI and fusion cloning the PCR products obtained above. Fusion cloning was performed using the In-Fusion® HD Cloning Kit (Clontech). The resulting plasmid was named pDCM2-gcvPTH.
[0300] The sequences of the primers used for vector construction are as follows.
[0302] Sequence number designation order 16 primer 5'- AATTCGAGCTCGGTACCCAGGCACAGCCGACATTACGG -3' 17 primer 5'- GTAGCACATCTGACGAATGTCCAAGTCTAAGGAAA -3' 18 primer 5'- TTAGACTTGGACATTCGTCAGATGTGCTACTTGCC -3' 19 primer 5'- TGGCGCATTAGCGTGTTACTTCTCGCGGCTATAGA -3' 20 primer 5'-AGCCGCGAGAAGTAACACGCTAATGGCGCATTGAA-3' 21 primer 5'- TGAATTATCCGCGTCTTAGATGCCGTTTTTCTGCCG -3' 22 primer 5'- GAAAACGGCATCTAAGACGCGGATAATTCAGCTGT -3' 23 primer 5'- CGACTCTAGAGGATCCCCGATGAAGCGAACACTTAAAT-3'
[0304] Example 3-2. Production of gcvPTH-enhanced strains based on sdaA-deficient and glyA-added enhanced strains
[0306] After transforming the vector pDCM2-gcvPTH prepared in Example 3-1 above into the CJX1664_del sdaA-Pn / glyA prepared in Example 2-2 above by electroporation, strains with the vector inserted on the chromosome were selected as primary candidates in a screening medium containing 25 mg / L of kanamycin. Subsequently, strains with added gcvPTH gene copies were selected from the homologous recombination strains using the primer pair of SEQ ID NO. 24 and SEQ ID NO. 25. The selected strain was named CJX1664_del sdaA_Pn / glyA-Pn / gcvPTH.
[0308] Sequence number designation order 24 primer 5'- CCAGTACATTGTCATGGGAT -3' 25 primer 5'- GATTGGCATATCGCACCGAG -3'
[0310] Example 3-3. Evaluation of XMP production capacity of gcvPTH-enhanced strains based on sdaA-deficient and glyA-added enhanced strains
[0312] The XMP production capacity of the strain and parent strain prepared in Example 3-2 above was evaluated by evaluating flask fermentation activity in the same manner as in Example 1-2 above. The experiment was repeated three times, and the average value of the analysis results is shown in Table 10 below.
[0314] Evaluation of XMP production capacity of gcvPTH-enhanced strains based on sdaA deletion and glyA copy addition strains strain XMP concentration (g / L) XMP Concentration Increase Rate (%) CJX1664 4.29 - CJX1664_del sdaA_Pn / glyA 4.64 8.16% CJX1664_del sdaA_Pn / glyA-Pn-gcvPTH 5.13 19.58%
[0316] As shown in Table 10 above, the CJX1664_del sdaA_Pn / glyA-Pn / gcvPTH strain exhibited XMP production capacity increased by 19.58% compared to CJX1664 and by 10.56% compared to CJX1664_del sdaA_Pn / glyA. This confirms that XMP production capacity is further enhanced when gcvPTH expression is strengthened simultaneously with sdaA deletion and glyA enhancement.
[0318] Examples 3-4. Confirmation of GMP production capacity of gcvPTH-enhanced strains based on sdaA-deficient and glyA-additionally enhanced strains
[0320] GMP production was confirmed using the XMP culture solution of the strain prepared in Example 3-2 above and the method of Example 1-3 above, and the results are shown in Table 11 below.
[0322] Confirmation of GMP production capacity of gcvPTH-enhanced strains based on sdaA deletion and glyA copy addition strains strain name Concentration (g / L) Conversion Rate (%) (GMP Production / XMP Consumption) XMP GMP CJX1664 4.31 3.14 72.9 CJX1664_del sdaA_Pn / glyA-Pn / gcvPTH 5.04 3.68 73.0
[0324] As shown in Table 11 above, it was confirmed that GMP is produced through a conversion reaction from XMP produced by the CJX1664_del sdaA_Pn / glyA-Pn / gcvPTH strain.
[0326] Example 4. Development of fdh-deficient and purT-enriched strains based on sdaA-deficient, glyA-enriched, and gcvPTH-enriched strains and evaluation of XMP production capacity
[0328] Formate dehydrogenase derived from Corynebacterium stationaryis may consist of formate dehydrogenase subunit 1 (Fdh subunit 1), formate dehydrogenase subunit 2 (Fdh subunit 2), and formate dehydrogenase subunit 3 (Fdh subunit 3).
[0329] For the deletion of formate dehydrogenase subunit 1, formate dehydrogenase subunit 2, and formate dehydrogenase subunit 3 (hereinafter referred to as formate dehydrogenase), the endogenous gene of Corynebacterium stationaryis encoding said formate dehydrogenase subunit 1 (Fdh subunit 1), formate dehydrogenase subunit 2 (Fdh subunit 2), and formate dehydrogenase subunit 3 (Fdh subunit 3), respectively fdh 1, fdh 2, and fdh 3 Genes (hereinafter, fdh We intended to evaluate the production capabilities of XMP and GMP by constructing a strain in which the (represented by the gene) was deleted and the purT gene linked to the Pcj7 promoter was inserted at the corresponding location.
[0331] Example 4-1. Construction of fdh-deficient and purT-enhanced recombinant vectors
[0334] Specifically, to determine the effect on purine nucleotide production capacity when the purT enzyme is reinforced, experiments were conducted in which the formate dehydrogenase fdh was removed from sdaA-deficient, glyA-reinforced, and gcvPTH-reinforced strains, and the purT gene was simultaneously linked to the Pcj7 promoter (Korean Patent No. 0620092 and WO 2006 / 065095) to increase the copy number.
[0335] A vector for this purpose was constructed as follows using the plasmid pDCM2 (Republic of Korea Publication No. 10-2020-0136813) for the insertion and replacement of genes within Corynebacterium chromosomes.
[0336] PCR was performed using the gDNA (genomic DNA) of wild-type Corynebacterium stationaryis ATCC6872 as a template, respectively, with primer pairs of sequences SEQ ID NOs. 26 and 27, primer pairs of sequences SEQ ID NOs. 28 and 29, primer pairs of sequences SEQ ID NOs. 30 and 31, and primer pairs of sequences SEQ ID NOs. 32 and 33. PCR was performed after denaturation at 94°C for 5 minutes, followed by 30 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute 30 seconds, and then at 72°C for 5 minutes. The pDCM2 vector was prepared by treating with XbaI and fusion cloning the PCR products obtained above. Fusion cloning was performed using the In-Fusion® HD Cloning Kit (Clontech). The resulting plasmid was named pDCM2-del fdh_Pcj7 / purT.
[0337] The sequences of the primers used for vector construction are as follows.
[0339] Sequence number designation order 26 primer 5'- TCGAGCTCGGGTACCCGTTGCCGTATCAGACATGCTCAG -3' 27 primer 5'-GATTAGCCTGAAGGAATTGATTTATCTCGACCAAACAG-3' 28 primer 5'-GGTCGAGATAAATCAATTCCTTCAGGCTAATCTTTTCC-3' 29 primer 5'- CGATATAAGACTCCATCATATGTGTTTCCTTTCGTTGG-3' 30 primer 5'- AAAGGAAACACATATGATGGAGTCTTATATCGGTAGCC -3' 31 primer 5'- CTCATAGGTGCCGAACTTACTCGGAGATTTCGACCTCA-3' 32 primer 5'- CGAAATCTCCGAGTAAGTTCGGCACCTATGAGAATATG -3' 33 primer 5'- CTCTAGAGGATCCCCGGCAAGTGTTTCTTGGCGCCATTC-3'
[0341] Example 4-2. Production of fdh-deficient, purT-enhanced strains based on sdaA-deficient, glyA-enhanced, gcvPTH-enhanced strains
[0343] After transforming the vector pDCM2-del fdh_Pcj7 / purT prepared in 4-1 above into the CJX1664_del sdaA_Pn / glyA-Pn / gcvPTH prepared in Example 3-2 above by electroporation, strains with the vector inserted on the chromosome were selected as primary candidates in a screening medium containing 25 mg / L of kanamycin. Subsequently, using the primer pair of SEQ ID NO. 34 and SEQ ID NO. 35 from the homologous recombination strains, strains in which the fdh gene was deleted and the purT gene linked to the Pcj7 promoter was inserted at the corresponding location were selected. The selected strain was named CJX1664_del sdaA_Pn / glyA-Pn / gcvPTH-del fdh_Pcj7 / purT.
[0344] The sequences of the primers used for strain construction are as follows.
[0346] Sequence number designation order 34 primer 5'-GCGAGGGGGAAGAAAAGTA -3' 35 primer 5'- CGTTGCCCTTTTTCTTCT -3'
[0348] Example 4-3. Evaluation of XMP production capacity of fdh-deficient and purT-enhanced strains based on sdaA-deficient, glyA-enhanced, and gcvPTH-enhanced strains
[0350] The XMP production capacity of the strain and parent strain prepared in Example 4-2 above was evaluated by flask fermentation activity evaluation in the same manner as in Example 1-2 above. The experiment was repeated three times, and the average value of the analysis results is shown in Table 14 below.
[0352] Evaluation of XMP production capacity of fdh-deficient and purT-enriched strains based on sdaA-deficient, glyA-enriched, and gcvPTH-enriched strains strain XMP concentration (g / L) XMP Concentration Increase Rate (%) CJX1664 4.30 - CJX1664_del sdaA_Pn / glyA 4.66 8.37% CJX1664_del sdaA_Pn / glyA-Pn-gcvPTH 5.19 20.69% CJX1664_del sdaA_Pn / glyA-Pn / gcvPTH-del fdh_Pcj7 / purT 5.38 25.12%
[0354] As shown in Table 14 above, the CJX1664_del sdaA_Pn / glyA-Pn / gcvPTH-del fdh_Pcj7 / purT strain exhibited XMP production capacity increased by 25.12% compared to CJX1664 and by 3.66% compared to CJX1664_del sdaA_Pn / glyA-Pn / gcvPTH. This confirms that XMP production capacity is further enhanced when fdh is deleted and purT expression is enhanced simultaneously with sdaA deletion, glyA enhancement, and gcvPTH enhancement.
[0356] Example 4-4. Confirmation of GMP production capacity of fdh-deficient, purT-enhanced strains based on sdaA-deficient, glyA-enhanced, and gcvPTH-enhanced strains
[0358] GMP production was confirmed using the XMP culture solution of the strain prepared in Example 4-2 above and the method of Example 1-3 above, and the results are shown in Table 15 below.
[0360] of sdaA-deficient, glyA-enriched, gcvPTH-enriched strains of fdh-deficient, purT-enriched strains GMP production capacity verification strain name Concentration (g / L) Conversion Rate (%) (GMP Production / XMP Consumption) XMP GMP CJX1664 4.30 3.14 73.1 CJX1664_del sdaA_Pn / glyA-Pn / gcvPTH-del fdh_Pcj7 / purT 5.36 3.93 73.3
[0362] As shown in Table 15 above, it was confirmed that GMP is produced through a conversion reaction from XMP produced by the CJX1664_del sdaA_Pn / glyA-Pn / gcvPTH-del fdh_Pcj7 / purT strain.
[0364] Example 5. Development of glyA-enhanced strain and confirmation of IMP production capacity
[0366] Example 5-1. Preparation of glyA-enhanced strain
[0368] To confirm the effect of glyA gene enhancement on IMP production, the vector constructed in Example 1-1 above was transformed into Corynebacterium stationaryis KCCM12151P (IMP-producing strain) by electroporation, and strains with the vector inserted into the chromosome were selected as primary candidates in a screening medium containing 25 mg / L of kanamycin. Subsequently, from the strains in which homologous recombination occurred, strains linked to the Pcj7 promoter were selected using the primer pair of SEQ ID NO. 1 and SEQ ID NO. 6. The selected strain was named CJI-3175 (KCCM12151P_ Pcj7 / glyA).
[0370] Example 5-2. Evaluation of IMP production capacity of glyA-enhanced strains
[0372] Flask titer evaluation was performed to measure the IMP production capacity of the strains and parent strains prepared in Example 5-1 above. Corynebacterium stationaryis KCCM12151P, CJI-3175 was inoculated into a 14 ml tube containing 2.5 ml of the following seed medium and cultured at 30°C for 24 hours with shaking at 170 rpm. 2 ml of the seed culture was inoculated into a 250 ml Corner-Baffle flask containing 29 ml of the following production medium (24 ml main medium + 5 ml star-shaped medium) and cultured at 30°C for 72 hours with shaking at 170 rpm. After the culture was completed, the amount of IMP produced was measured by HPLC.
[0374] The composition of the above seed medium and fermentation medium is as follows.
[0376] <IMP 종배지>
[0377] Glucose 1%, Peptone 1%, Meat Juice 1%, Yeast Extract 1%, Sodium Chloride 0.25%, Adenine 100 mg / L, Guanine 100 mg / L, pH 7.2
[0379] <IMP 플라스크 발효배지>
[0380] Sodium glutamate 0.1%, ammonium chloride 1%, magnesium sulfate 1.2%, calcium chloride 0.01%, iron sulfate 20 mg / L, manganese sulfate 20 mg / L, zinc sulfate 20 mg / L, copper sulfate 5 mg / L, L-cysteine 23 mg / L, beta-alanine 24 mg / L, nicotinic acid 8 mg / L, biotin 45 µg / L, thiamine hydrochloride 5 mg / L, adenine 30 mg / L, phosphoric acid (85%) 1.9%, glucose 4.2%, fructose 2.4% added
[0382] The results of culture with glyA promoter enhancement in the IMP-producing strain Corynebacterium stationaryis KCCM12151P are shown in Table 16 below.
[0384] Confirmation of IMP production volume following glyA promoter reinforcement Strain number Introduction type OD 5'-inosinic acid (g / L) Concentration increase rate (%) KCCM12151P Control 38.5 4.9 - CJI-3175 KCCM12151P_Pcj7 / glyA 39.2 5.3 8.2
[0386] As shown in Table 16 above, the CJI-3175 strain exhibited an 8.2% increase in IMP production capacity compared to the control group. This confirmed that enhancing glyA expression can be usefully applied to IMP production.
[0388] Example 6. Development of sdaA-deficient and glyA-enhanced strains and evaluation of IMP production capacity
[0390] Example 6-1. Construction of sdaA deletion and glyA additional reinforcement recombinant vectors
[0392] We constructed a vector by deleting the endogenous gene sdaA of Corynebacterium stationaryis and adding a copy of the glyA gene to the corresponding gene site to investigate the synergistic effect of sdaA deletion and glyA enhancement in IMP-producing strains.
[0393] The chromosomal genes of the wild-type strain ATCC6872 of Corynebacterium stationaryis were isolated using Intron’s G-spin Total DNA extraction mini kit (Cat. No. 17045) according to the protocol provided in the kit, and gene fragments (del_sda::Pcj7 / glyA-A, del_sda::Pcj7 / glyA-B, del_sda::Pcj7 / glyA-C, del_sda::Pcj7 / glyA-D) were obtained by polymerase chain reaction using the primer pairs of SEQ ID NO. 36 and SEQ ID NO. 37, SEQ ID NO. 38 and SEQ ID NO. 39, SEQ ID NO. 40 and SEQ ID NO. 41, and SEQ ID NO. 42 and SEQ ID NO. 43. The conditions for the PCR method were as follows: denaturation at 94°C for 5 minutes, followed by denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute, repeated 20 times, followed by polymerization at 72°C for 7 minutes.
[0394] The gene fragment obtained by performing a 2nd PCR using the four fragments obtained above as templates was cut with the restriction enzyme XbaI (New England Biolabs, Beverly, MA). Using T4 ligase (New England Biolabs, Beverly, MA), the gene fragment was conjugated to the linear pDCM2 (Republic of Korea Publication No. 10-2020-0136813) that had been cut with the XbaI restriction enzyme. The resulting plasmid was named pDCM2-del_sdaA-Pn / glyA.
[0395] The sequences of the primers used for vector construction are as follows.
[0397] Sequence number designation order 36 primer 5'- AATTCGAGCTCGGTACCCCATTTCGTGACCATTAGCGT -3' 37 primer 5'- ATTAGCCTGAAGGAAGATCATGCCAATAGCGCCAG -3' 38 primer 5'- GCTATTGGCATGATCTTCCTTCAGGCTAATCTTTT -3' 39 primer 5'-ATTCTGGGTAGTCATCATATGTGTTTCCTTTCGTT-3' 40 primer 5'-AAGGAAACACATATGATGACTACCCAGAATTCTTC-3' 41 primer 5'- CTTTGTACTTGGTGACCAAGAGTCAGGATGCCGAA-3' 42 primer 5'- CATCCTGACTCTTGGTCACCAAGTACAAGAGACT -3' 43 primer 5'- CGACTCTAGAGGATCCCCGGTTACCGCGCATTAGGACT-3'
[0399] Example 6-2. Preparation of sdaA-deficient and glyA-enhanced strains
[0401] After transforming Corynebacterium stationaryis KCCM12151P (IMP-producing strain) with the vector prepared in Example 6-1 above by electroporation, strains with the vector inserted on the chromosome were selected as primary candidates in a screening medium containing 25 mg / L of kanamycin. Subsequently, using the primer pair of SEQ ID NO. 44 and SEQ ID NO. 45 from the homologous recombination strains, strains in which the sdaA gene was deleted and the glyA gene linked to the Pcj7 promoter was inserted at the corresponding location were selected. The selected strain was named CJI-3177 (KCCM12151P_del_sdaA_Pcj7 / glyA).
[0402] The sequences of the primers used for strain construction are as follows.
[0404] Sequence number designation order 44 primer 5'-TAATCCCCCAGCTCACCGGC-3' 45 primer 5'- TTTGGATGCCGAGGTCGTAG-3'
[0406] Example 6-3. Evaluation of IMP production capacity of sdaA-deficient and glyA-enhanced strains
[0408] The IMP production capacity of the strain and parent strain prepared in Example 6-2 above was evaluated by flask titer evaluation in the same manner as in Example 5-2 above. The culture results following the deletion of sdaA and the addition of a copy of glyA in the IMP-producing strain Corynebacterium stationaryis KCCM12151P are shown in Table 19 below.
[0410] Verification of IMP production volume due to sdaA deficiency and addition of glyA copy Strain number Introduction type OD 5'-inosinic acid (g / L) Concentration increase rate (%) KCCM12151P Control 38.5 4.9 - CJI-3177 KCCM12151P_del_sdaA_Pcj7 / glyA 39.2 5.6 14.3
[0412] As shown in Table 19 above, the CJI-3177 strain exhibited a 14.3% increase in IMP production capacity compared to the control group. This confirmed that the combination of sdaA deficiency and glyA enhancement can be usefully applied to IMP production.
[0414] Example 7. Development of gcvPTH-enhanced strains based on sdaA-deficient and glyA-added enhanced strains and evaluation of IMP production capacity
[0416] Example 7-1. Production of gcvPTH-enhanced strains based on sdaA-deficient and glyA-added enhanced strains
[0418] After transforming the vector pDCM2-gcvPTH prepared in 3-1 above into the CJI-3177 prepared in Example 6-2 above by electroporation, strains with the vector inserted on the chromosome were selected as primary candidates in a screening medium containing 25 mg / L of kanamycin. Subsequently, strains with added gcvPTH gene copies were selected from the homologous recombination strains using the primer pair of SEQ ID NO. 24 and SEQ ID NO. 25. The selected strain was named CJI-3167 (CJI-3177_Pn / gcvPTH).
[0420] Example 7-2. Evaluation of IMP production capacity of gcvPTH-enhanced strains based on sdaA-deficient and glyA-added enhanced strains
[0422] The IMP production capacity of the strain and parent strain prepared in Example 7-1 above was evaluated by flask titer evaluation in the same manner as in Example 5-2 above. The culture results following sdaA deletion, glyA copy addition, and gcvPTH copy addition in the IMP-producing strain Corynebacterium stationaryis KCCM12151P are shown in Table 20 below.
[0424] Confirmation of IMP production based on sdaA deletion and glyA copy addition strains, and gcvPTH copy addition Strain number Introduction type OD 5'-inosinic acid (g / L) Concentration increase rate (%) KCCM12151P Control 37.9 4.7 - CJI-3177 KCCM12151P_del_sdaA_Pcj7 / glyA 38.4 5.3 12.8 CJI-3167 CJI-3177_Pn / gcvPTH 38.1 5.7 21.3
[0426] As shown in Table 20 above, the CJI-3167 strain exhibited a 21.3% increase in IMP production capacity compared to the control group. This confirmed that the combination of sdaA deletion, glyA enhancement, and gcvPTH enhancement can be usefully applied to IMP production.
[0428] Example 8. Development of fdh-deficient and purT-enhanced strains based on sdaA-deficient, glyA-enhanced, and gcvPTH-enhanced strains and evaluation of IMP production capacity
[0430] Example 8-1. Preparation of fdh-deficient, purT-enhanced strains based on sdaA-deficient, glyA-enhanced, gcvPTH-enhanced strains
[0432] As in Example 4 above, to determine the effect of fdh deletion and increased purT copy number on IMP production, the vector pDCM2-del fdh_Pcj7 / purT constructed in 4-1 above was transformed into CJI-3167 constructed in Example 7-1 above by electroporation, and strains with the vector inserted on the chromosome were selected as primary candidates in a screening medium containing 25 mg / L kanamycin. Subsequently, from the homologous recombination strains, a strain in which the fdh gene was deleted and the purT gene linked to the Pcj7 promoter was inserted at the corresponding location was selected using the primer pair of SEQ ID NO. 34 and SEQ ID NO. 35. The selected strain was named CJI-3186 (CJI-3167_del fdh_Pcj7 / purT).
[0434] Example 8-2. Evaluation of IMP production capacity of fdh-deficient and purT-enhanced strains based on sdaA-deficient, glyA-enhanced, and gcvPTH-enhanced strains
[0436] The IMP production capacity of the strain and parent strain prepared in Example 8-1 above was evaluated by flask titer evaluation in the same manner as in Example 5-2 above. The culture results for the IMP-producing strain Corynebacterium stationaryis KCCM12151P with sdaA deletion, glyA copy addition, gcvPTH copy addition, fdh deletion, and purT enhancement are shown in Table 21 below.
[0438] Confirmation of IMP production based on sdaA deletion and glyA copy addition, gcvPTH copy addition strains, and fdh deletion and purT enrichment Strain number Introduction type OD 5'-inosinic acid (g / L) Concentration increase rate (%) KCCM12151P Control 38.2 4.8 - CJI-3167 CJI-3177_Pn / gcvPTH 38.4 5.7 20.8 CJI-3186 CJI-3167_del fdh_Pcj7 / purT 37.9 6.0 25.0
[0440] As shown in Table 21 above, the CJI-3186 strain exhibited a 25.0% increase in IMP production capacity compared to the control group. This confirmed that the combination of sdaA deletion, glyA enhancement, gcvPTH enhancement, and fdh deletion and purT enhancement can be usefully utilized for IMP production.
[0442] From the foregoing description, those skilled in the art to which this application pertains will understand that this application may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of this application should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.
Claims
Claim 1 A microorganism of Corynebacterium stationaris having the ability to produce purine nucleotides selected from the group consisting of 5'-inosinic acid, 5'-xanthilic acid, and 5'-guanic acid, wherein the serine hydroxymethyltransferase protein activity is enhanced relative to the intrinsic activity, and the purine nucleotide production ability is increased, wherein the purine nucleotide is selected from the group consisting of 5'-inosinic acid, 5'-xanthilic acid, and 5'-guanic acid. Claim 2 A microorganism according to claim 1, wherein the serine hydroxymethyltransferase protein is composed of the amino acid sequence of SEQ ID NO.
46. Claim 3 In claim 1, the microorganism is further a microorganism in which the formate-dependent phosphoribosylglycinamide formyl transferase protein activity is enhanced relative to the intrinsic activity. Claim 4 delete Claim 5 delete Claim 6 delete Claim 7 A method for producing a purine nucleotide, comprising the step of culturing a microorganism of any one of claims 1 to 3 in a culture medium, wherein the purine nucleotide is selected from the group consisting of 5'-inosinic acid, 5'-xanthilic acid, and 5'-guanic acid. Claim 8 A method according to claim 7, further comprising the step of recovering a target substance from the cultured microorganism, the culture of the microorganism, the fermented product of the microorganism, or the culture medium. Claim 9 A composition for producing purine nucleotides comprising a microorganism of any one of claims 1 to 3, a culture of said microorganism, a fermented product of said microorganism, or a combination of two or more of these, wherein said purine nucleotides are selected from the group consisting of 5'-inosinic acid, 5'-xanthilic acid, and 5'-guanic acid.