Novel Lacticaseibacillus rhamnosus strain and use thereof

Abstract

The present invention relates to a novel Lacticaseibacillus rhamnosus IR06 strain (accession number KFCC12014P) which exhibits excellent antioxidant activity, inhibition of skin inflammation, inhibition of skin damage, protection of the skin barrier, and inhibition of skin photoaging. Furthermore, the invention relates to a health functional food composition, a cosmetic composition, and a pharmaceutical composition using the said strain, its culture, fermentation product, and metabolite. The present invention has the advantage of exhibiting excellent antioxidant activity, such as ABTS radical scavenging activity, reactive oxygen species (ROS) inhibition activity, and activity promoting the expression of antioxidant activity regulators; excellent efficacy in inhibiting skin damage-related enzymes including collagenase, elastase, tyrosinase, and hyaluronidase; inhibiting excessive activation of MAPK and NF-κB signaling pathways; and effectively inhibiting skin inflammation by reducing the expression of skin damage and inflammation-related factors such as MMPs, COX-2, and iNOS. In addition, the present invention has the advantage of exhibiting skin barrier protective activity by inhibiting epidermal damage caused by UV irradiation in a three-dimensional human skin reconstruction model and restoring the expression of skin barrier-related genes such as loricrin, filaggrin, and involucrin.

Description

Technology Field

[0001] The present invention relates to a novel Lacticase Bacillus rhamnosus having excellent antioxidant activity, inhibition of skin inflammation, inhibition of skin damage, protection of the skin barrier, and inhibition of skin photoaging ( Lacticaseibacillus rhamnosus This invention relates to the IR06 strain (accession number KFCC12014P). It also relates to a health functional food composition, a cosmetic composition, and a pharmaceutical composition using the said strain, its culture, fermented product, and metabolite. Background Technology

[0002] The skin is the largest organ in the human body and plays a crucial role as the primary defense barrier protecting the body from the external environment. However, the skin is continuously exposed to various external stimuli, such as ultraviolet rays, microorganisms, toxic substances, and environmental pollution, leading to the gradual occurrence of skin aging phenomena such as wrinkles, loss of elasticity, dryness, and inflammation. In particular, Ultraviolet B (UVB) is known as a major cause of direct skin damage and is known to accelerate photoaging by promoting the generation of reactive oxygen species (ROS), thereby impairing the intracellular antioxidant defense system, and inducing DNA mutations, protein damage, and apoptosis. Recently, as the frequency of exposure to ultraviolet rays has increased due to environmental pollution and changes in lifestyle, social interest in photoaging has also been rapidly rising.

[0003] Various ingredients have been studied to prevent or improve such skin damage. Representative ingredients known for improving skin health include vitamins, collagen, and hyaluronic acid; however, their mechanisms of action have not been fully elucidated, and their efficacy is reported to be limited regarding complex skin damage mechanisms such as intestinal immune disturbance or inflammatory skin diseases. Furthermore, concerns regarding safety and side effects have been raised with the long-term use of existing synthetic compounds and some natural-based materials, leading to a continuous need for the development of new alternative technologies.

[0004] Meanwhile, probiotics are defined as living microorganisms that provide beneficial effects to the health of a host. Recently, research has been conducted on the anti-inflammatory, antioxidant, and metabolic disease-improving effects of postbiotic substances generated by probiotics during metabolic processes, such as exopolysaccharides (EPS), functional peptides, and short-chain fatty acids. In particular, exopolysaccharides are high-molecular substances synthesized by microorganisms that are known to exhibit diverse physiological activities depending on their molecular weight, monosaccharide composition, and structural characteristics. They are attracting attention across the food, cosmetics, and pharmaceutical industries due to their high potential for use as drug delivery systems, stabilizers, and absorbents, as well as their antioxidant, anti-inflammatory, and antibacterial activities.

[0005] However, the mechanistic evidence for the skin health-improving efficacy of previously reported polysaccharide materials is often insufficient, and research specifically focused on protective effects against skin damage associated with photoaging is relatively lacking. Therefore, there is a need to develop novel materials that are highly safe with minimal concerns regarding side effects, while simultaneously effectively suppressing oxidative stress and inflammatory responses induced by ultraviolet radiation. Prior art literature

[0006] (Patent Document 0001) KR 10-2693965 B1 The problem to be solved

[0007] In order to solve the aforementioned conventional problems, the present invention relates to a novel lactic acid bacterium, Lacticase Bacillus rhamnosus, which exhibits excellent preventive, corrective, and therapeutic efficacy against skin damage, particularly skin damage caused by ultraviolet rays such as photoaging ( Lacticaseibacillus rhamnosus The main purpose is to provide the IR06 strain (accession number KFCC12014P).

[0008] In addition, another objective of the present invention is to provide a health functional food composition, a cosmetic composition, and a pharmaceutical composition comprising one or more selected from the group consisting of the strain, its culture, fermented product, and metabolite.

[0009] The purpose of the present invention is not limited to the description above and is provided for all cases in which appropriate effects can be obtained by utilizing the present invention. means of solving the problem

[0010] The inventors have conducted research and development on a technology to protect and maintain skin health using natural product-based materials, particularly probiotics. As a result, Lacticase Bacillus rhamnosus, a novel lactic acid bacteria strain isolated from the feces of infants ( Lacticaseibacillus rhamnosusIt was found that a fermented product prepared using the IR06 strain (accession number KFCC12014P) and the extracellular polysaccharides derived therefrom (Exopolysaccharides IR06, EPS-IR06) exhibit excellent antioxidant activity, such as ABTS radical scavenging ability and reactive oxygen species (ROS) inhibition ability, and demonstrate excellent efficacy in protecting against skin damage by inhibiting skin damage-related enzymes including collagenase, elastase, tyrosinase, and hyaluronidase. In addition, it was found that the extracellular polysaccharide (EPS-IR06) effectively suppresses skin inflammation by inhibiting the excessive activation of MAPK and NF-κB signaling pathways and reducing the expression of skin damage and inflammation-related factors such as MMPs, COX-2, and iNOS. Furthermore, it was found that in a three-dimensional human skin reconstruction model, the extracellular polysaccharide (EPS-IR06) exhibits skin barrier protective activity by inhibiting epidermal damage caused by UV irradiation and restoring the expression of skin barrier-related genes such as loricrin, filaggrin, and involucrin. Accordingly, the present invention was completed by comprehensively identifying that the novel strain Lacticase Bacillus rhamnosus IR06 and its culture, fermentation product, and metabolite can be utilized as a health functional food, cosmetic, and pharmaceutical composition that effectively exhibits antioxidant activity, skin damage-related enzyme inhibition activity, skin inflammation inhibition activity, skin barrier protection activity, and skin photoaging inhibition activity.

[0012] Specifically, the present invention relates to Lacticase Bacillus rhamnosus ( Lacticaseibacillus rhamnosus ) Provides the IR06 strain (accession number KFCC12014P).

[0013] In addition, the present invention provides a composition comprising one or more selected from the group consisting of the Lacticase Bacillus rhamnosus IR06 strain, a culture of the strain, a fermented product, and a metabolite.

[0014] In addition, the present invention provides a composition wherein, in the above composition, the metabolite is an exopolysaccharide (EPS).

[0015] In addition, the present invention provides a composition having one or more activities selected from the group consisting of antioxidant activity, skin damage-related enzyme inhibitory activity, skin inflammation inhibitory activity, skin barrier protective activity, and skin photoaging inhibitory activity.

[0016] In addition, the present invention provides a composition wherein the antioxidant activity is ABTS radical scavenging activity, reactive oxygen species (ROS) inhibitory activity, and an activity that promotes the expression of antioxidant activity regulating factors.

[0017] In addition, the present invention provides a composition in which the antioxidant activity regulating factor in the above composition is Nrf2 or CAT (Catalase).

[0018] In addition, the present invention provides a composition in which the skin damage-related enzyme is one or more selected from the group consisting of collagenase, elastase, tyrosinase, and hyaluronidase.

[0019] In addition, the present invention provides a composition in which the skin inflammation-inhibiting activity is an activity that inhibits the expression of NF-κB signaling pathway proteins or inflammatory cytokines.

[0020] In addition, the present invention provides a composition in which the skin barrier protective activity is an activity that promotes the expression of one or more skin barrier-forming proteins selected from the group consisting of loricrin, filaggrin, and involucrin.

[0021] In addition, the present invention provides a composition wherein the skin photoaging inhibitory activity is an activity that inhibits skin aging or skin damage caused by skin exposure to ultraviolet (UV) rays.

[0022] In addition, the present invention provides a health functional food composition comprising the above composition as an active ingredient.

[0023] In addition, the present invention provides a cosmetic composition comprising the above composition as an active ingredient.

[0024] In addition, the present invention provides a pharmaceutical composition comprising the above composition as an active ingredient and having a preventive or therapeutic use for one or more diseases selected from the group consisting of skin aging, skin inflammation, skin barrier damage, and skin photoaging.

[0026] The present invention will be described in more detail below.

[0028] In one specific embodiment, the present invention relates to Lacticase Bacillus rhamnosus ( Lacticaseibacillus rhamnosus ) Provides the IR06 strain (accession number KFCC12014P).

[0029] In a specific embodiment of the present invention, the Lacticase Bacillus rhamnosus IR06 strain was obtained by isolating and identifying it from the feces of infants.

[0030] The Lacticase Bacillus rhamnosus IR06 strain of the present invention includes the 16S rRNA nucleotide sequence of SEQ ID NO. 1 and has been identified up to the species level based on 16S rRNA gene sequence analysis.

[0031] In a specific embodiment of the present invention, the Lacticaseibacillus rhamnosus IR06 strain was isolated from the feces of a newborn, and as a result of genetic information analysis, it was confirmed that the 16S rRNA sequence of the Lacticaseibacillus rhamnosus IR06 strain showed 99.86% identity with other Lacticaseibacillus rhamnosus strains, thus identifying it as a strain belonging to Lacticaseibacillus rhamnosus. Sequence No. 1 below shows the 700 bp sequence used for identification among the 16S rRNA sequences of the Lacticaseibacillus rhamnosus IR06 strain.

[0032] [Sequence No. 1] Lacticaseibacillus rhamnosus ( Lacticaseibacillus rhamnosus ) 16S rRNA sequence of IR06 strain (accession number KFCC12014P)

[0033]

[0035] The novel strain of the present invention, Lacticase Bacillus rhamnosus IR06, was isolated from the feces of infants and named IR06, and was deposited with the Korean Culture Center of Microorganisms (KCCM) on September 20, 2024, and was assigned accession number KFCC12014P.

[0037] In another specific embodiment, the present invention provides a composition comprising one or more selected from the group consisting of the Lacticase Bacillus rhamnosus IR06 strain, a culture of the strain, a fermented product, and a metabolite.

[0038] In the present invention, the strain may be a live or dead strain, and the concept may include not only the strain itself but also a lysate obtained by crushing the strain.

[0039] In the present invention, the culture is generally a concept that includes all substances obtained by culturing a strain, and may be, for example, a medium or culture solution itself containing cells of the strain, or a medium or culture supernatant obtained by removing cells from it, and may also be a filtrate, concentrate, or dried product thereof. In addition, the culture may include components produced or secreted by the strain, such as metabolic products including organic acids, peptides, polysaccharides, extracellular polysaccharides, etc.

[0040] In the present invention, the fermented product generally encompasses all products obtained through a fermentation process by inoculating a strain onto a specific substrate. For example, it may be the culture medium or the fermentation liquid itself in which fermentation has taken place, or the supernatant of the fermentation liquid obtained by removing cells from it, and may also be a filtrate, concentrate, or dried product thereof. Furthermore, the fermented product may include components generated or secreted by the strain during the fermentation process, such as metabolic products including organic acids, peptides, polysaccharides, and extracellular polysaccharides.

[0041] In the present invention, the type of fermentation substrate used in the preparation of the fermented product is not particularly limited and may generally include any carbohydrate, protein, lipid, or mixture thereof capable of supporting the growth and fermentation of lactic acid bacteria. Non-limiting examples of the fermentation substrate may include milk protein substrates such as milk, skim milk powder, whole milk powder, whey, or casein; cereal or starch extracts such as soybeans, rice, barley, oats, corn, wheat, potatoes, and sweet potatoes; vegetable extracts such as carrots, broccoli, and spinach; fruit extracts such as apples, grapes, berries, and citrus fruits; monosaccharides and disaccharides such as glucose, lactose, maltose, and sucrose; and peptone, yeast extract, and amino acid mixtures. Additionally, the fermentation substrate may be used as a single component or as a mixture of two or more components. In a specific embodiment of the present invention, in order to obtain fermented products and metabolites of superior activity using the Lacticase Bacillus rhamnosus IR06 strain, skim milk powder and glucose were used as major fermentation substrates, and peptone and yeast extract were used as auxiliary substrates.

[0042] In the present invention, the metabolite generally refers to a concept comprising various products produced or secreted by a strain during the culture or fermentation process. The metabolite may be obtained directly from the culture medium or fermentation medium, or obtained through processes such as filtration, concentration, purification, and drying. Non-limiting examples of the metabolite may include primary metabolites such as organic acids, amino acids, peptides, alcohols, vitamins, and volatile compounds; and secondary metabolites such as extracellular polysaccharides, antimicrobial peptides, enzymes, polypeptides, and functional low-molecular-weight compounds produced specifically by the strain. In a specific embodiment of the present invention, extracellular polysaccharides were isolated from a fermentation product using the Lacticase-Bacillus rhamnosus IR06 strain and used as a metabolite of superior activity among the metabolites obtained using the Lacticase-Bacillus rhamnosus IR06 strain.

[0043] The composition of the present invention, comprising one or more selected from the group consisting of the Lacticase Bacillus rhamnosus IR06 strain, a culture of the strain, a fermented product, and a metabolite, may exhibit one or more activities selected from the group consisting of antioxidant activity, activity to inhibit skin damage-related enzymes, activity to inhibit skin inflammation, activity to protect the skin barrier, and activity to inhibit skin photoaging.

[0044] In the present invention, the antioxidant activity generally refers to an activity that protects cells or molecules from free radicals, reactive oxygen species (ROS), or oxidative stress, or removes already generated radicals. Non-limiting examples of the antioxidant activity may include radical scavenging activity, the ability to inhibit the generation of reactive oxygen species (ROS), and the ability to restore the expression of genes / proteins related to antioxidant activity (e.g., Nrf2, CAT (Catalase), etc.), such as regulating antioxidant activity or restoring the antioxidant defense system. In a specific embodiment of the present invention, it was confirmed that the extracellular polysaccharide derived from the fermentation product using the Lacticase Bacillus rhamnosus IR06 strain of the present invention exhibits excellent ABTS radical scavenging activity, and as a result of measuring DCF fluorescence after irradiating HaCaT cells with ultraviolet B (UVB), it was confirmed that it significantly reduces the amount of reactive oxygen species (ROS) generated by ultraviolet B. In addition, it was confirmed using qRT-PCR that the expression levels of Nrf2 and CAT, which are factors related to the regulation of antioxidant activity, were effectively restored. Through this, the excellent antioxidant activity of the present invention was confirmed.

[0045] In the present invention, the skin damage-related enzyme inhibitory activity generally refers to an activity that inhibits the activity of enzymes that damage the structure or appearance of the skin or contribute to pigment formation. Non-limiting examples of the skin damage-related enzyme inhibitory activity may include inhibiting the activity of enzymes such as collagenase, elastase, tyrosinase, and hyaluronidase. In a specific embodiment of the present invention, it was confirmed that the extracellular polysaccharide derived from the fermentation product using the Lacticase Bacillus rhamnosus IR06 strain of the present invention exhibits excellent inhibitory activity against all of collagenase, elastase, tyrosinase, and hyaluronidase. Through this, it was confirmed that the present invention can prevent, improve, and treat structural damage to skin tissue by exhibiting excellent inhibitory activity against enzymes that cause the degradation of collagen and elastic fibers.

[0046] In the present invention, the skin inflammation-inhibiting activity generally refers to an activity that reduces the expression or activity of inflammatory signaling pathways or inflammatory mediators. Non-limiting examples of the skin inflammation-inhibiting activity may include the ability to inhibit the NF-κB signaling pathway (e.g., inhibition of IκB degradation, inhibition of p65 phosphorylation, etc.), the ability to reduce the expression of inflammatory cytokines (e.g., TNF-α, IL-1β, IL-6, etc.), and the ability to reduce the expression of inflammatory mediator enzymes (COX-2, iNOS, etc.). In a specific embodiment of the present invention, it was confirmed that the extracellular polysaccharide derived from the fermentation product using the Lacticase Bacillus rhamnosus IR06 strain of the present invention effectively reduces the phosphorylation of IκB and p65 induced by UV-B treatment, the expression of COX-2 and iNOS proteins, and the gene expression of TNF-α, IL-1β, and IL-6. Through this, it was confirmed that the present invention can prevent, improve, and treat skin inflammatory reactions by excellently suppressing the inflammatory signaling pathway and the expression of inflammatory cytokines.

[0047] In the present invention, the skin barrier protective activity generally refers to an activity that preserves the structural stability of the skin barrier and preserves functions such as moisture retention ability by maintaining or promoting the expression of major proteins involved in the differentiation, keratinization, and formation of the stratum corneum of the epidermis. Non-limiting examples of the skin barrier protective activity may include the ability to promote the expression of skin barrier formation-related proteins (e.g., loricrin, filaggrin, involucrin, etc.). In a specific embodiment of the present invention, the extracellular polysaccharide derived from the fermentation product using the Lacticase Bacillus rhamnosus IR06 strain of the present invention was found to effectively suppress skin damage induced by UV-B treatment in experiments using a three-dimensional (3D) human skin reconstruction model, and to promote the recovery of expression levels for all of loricrin, filaggrin, and involucrin. Through this, it was confirmed that the present invention can prevent, improve, and treat skin barrier damage by promoting the expression of skin barrier components and protecting and restoring the epidermal structure damaged by ultraviolet rays.

[0048] In the present invention, the skin photoaging inhibitory activity generally refers to an activity that protects the skin from photoaging (e.g., wrinkle formation, loss of elasticity, pigmentation, etc.) by inhibiting oxidative stress, inflammation, structural degradation (e.g., collagen degradation, etc.) caused by ultraviolet rays. Non-limiting examples of the skin photoaging inhibitory activity may include the ability to inhibit the MAPK signaling pathway (e.g., inhibition of phosphorylation of ERK, JNK, p38, etc.) and the ability to reduce the expression of MMPs (e.g., MMP-1, MMP-3, MMP-9, etc.). In a specific embodiment of the present invention, it was confirmed that the extracellular polysaccharide derived from the fermentation product using the Lacticase Bacillus rhamnosus IR06 strain of the present invention effectively reduced the phosphorylation of the MAPK series (ERK, JNK, p38) and the gene expression of MMPs (MMP3 and MMP9) increased by UV-B treatment, and through this, it was confirmed that the present invention can prevent, improve, and treat photoaging by effectively blocking various complex photoaging pathways caused by ultraviolet rays.

[0050] In another specific embodiment, the present invention provides a health functional food composition comprising one or more active ingredients selected from the group consisting of the Lacticase Bacillus rhamnosus IR06 strain, a culture of the strain, a fermented product, and a metabolite.

[0051] In another specific embodiment, the present invention provides a cosmetic composition comprising one or more active ingredients selected from the group consisting of the Lacticase Bacillus rhamnosus IR06 strain, a culture of the strain, a fermented product, and a metabolite.

[0052] In another specific embodiment, the present invention provides a pharmaceutical composition comprising one or more active ingredients selected from the group consisting of the Lacticase Bacillus rhamnosus IR06 strain, a culture of the strain, a fermented product, and a metabolite, and having a preventive or therapeutic use for one or more diseases selected from the group consisting of skin aging, skin inflammation, skin barrier damage, and skin photoaging.

[0053] In the present invention, "included as an active ingredient" means that the corresponding ingredient is included in an amount necessary or sufficient to realize the desired biological effect. In actual application, the amount included as an active ingredient is determined as an amount for treating the target disease, taking into account factors that do not cause other toxicities, and may vary depending on various factors such as the disease or condition being treated, the form of the administered composition, the size of the subject, or the severity of the disease or condition. A person skilled in the art to which the present invention pertains can empirically determine the effective amount of individual compositions without resorting to excessive experimentation.

[0054] In the health functional food composition, cosmetic composition, or pharmaceutical composition of the present invention, the effective content of the Lacticase Bacillus rhamnosus IR06 strain, the culture, fermentation product, or metabolite of the strain is not particularly limited and may be included in an amount of 0.00001% to 99.99% by weight with respect to the total weight of the health functional food composition, cosmetic composition, or pharmaceutical composition, or may also be included as the total content.

[0055] In the present invention, the term "health functional food" may encompass all foods that are processed to efficiently exhibit bio-regulatory functions and possess high medical and / or medical effects. Generally, "health functional food" refers to a food manufactured (including processed) using raw materials or ingredients that possess functional properties useful to the human body, in accordance with the "Act on Health Functional Foods." "Functionality" refers to obtaining effects useful for health purposes, such as regulating nutrients or physiological actions regarding the structure and function of the human body. Furthermore, "health food" generally refers to a food that possesses active health maintenance or promotion effects compared to general food, and "health supplementary food" generally refers to a food intended for health support purposes. In some cases, "health functional food" may be used interchangeably with terms such as food for special health use (FOSHU), functional food, health food, and health supplementary food.

[0056] In the present invention, the health functional food composition may be manufactured by a method commonly used in the relevant technical field or a similar field, and during such manufacturing, raw materials or ingredients commonly added in the relevant technical field or a similar field may be added. As a non-limiting specific example, the health functional food composition may additionally include a physiologically acceptable carrier, and the type of said carrier is not particularly limited and any carrier commonly used in the relevant technical field may be used.

[0057] In addition, the above-mentioned health functional food composition may include conventional food additives such as preservatives, disinfectants, antioxidants, coloring agents, color-developing agents, bleaching agents, seasonings, sweeteners, flavorings, leavening agents, reinforcing agents, emulsifiers, thickeners, coating agents, gum bases, antifoaming agents, solvents, modifiers, etc. The above-mentioned additives may be selected according to the type of food and used in appropriate amounts. Non-limiting examples of the above-mentioned food additives include chemically synthesized compounds such as ketones, glycine, potassium citrate, nicotinic acid, and cinnamon acid; natural additives such as persimmon dye, licorice extract, crystalline cellulose, sorghum dye, and guar gum; and mixed preparations such as L-sodium glutamate preparations, alkaline noodle additives, preservative preparations, and tar dye preparations.

[0058] The above-described health functional food composition of the present invention can be used in various ways in foods and beverages, etc., for example, in various food products, beverages, chewing gum, tea, vitamin complexes, health functional supplements, food additives, etc. In addition, the above-described health functional food composition can be manufactured and processed into formulations such as tablets, granules, powders, capsules, liquid solutions, pills, etc. For example, the above-described health functional food in tablet form can be manufactured by granulating a mixture of the above-described compound, excipients, binders, disintegrants, and other additives by a conventional method, and then adding a lubricant, etc., and compression molding, or by directly compression molding the mixture. In addition, the above-described health functional food in tablet form may be coated with a suitable coating agent as needed. Among the above-mentioned capsule-type health functional foods, hard capsules may be manufactured by filling a conventional hard capsule with a mixture of the above-mentioned compound and additives such as excipients, or the granular form thereof, or a coated granular form thereof, and soft capsules may be manufactured by filling a mixture of the above-mentioned compound and additives such as excipients into a capsule base such as gelatin. The above-mentioned soft capsules may contain plasticizers such as glycerin or sorbitol, coloring agents, preservatives, etc., as needed. The above-mentioned pill-type health functional food may be prepared by molding a mixture of the above-mentioned compound, excipients, binders, disintegrants, etc., by a suitable method, and may be coated with sucrose or other suitable coating agents as needed, or may be coated with starch, talc, or a suitable substance. The above-mentioned granular-type health functional food may be manufactured into a granular form by a suitable method using a mixture of the above-mentioned compound, excipients, binders, disintegrants, etc., and may contain flavoring agents, stimulating agents, etc., as needed. In addition, the definitions of terms for the above excipients, binders, disintegrants, lubricants, synergists, flavoring agents, etc. may include those described in literature known in the relevant technical field or similar fields, and may include those with identical or similar functions.

[0059] Unlike general pharmaceuticals, the above-described health functional food composition of the present invention uses food as a raw material, has the advantage of not having side effects that may occur with long-term use of pharmaceuticals, and is highly portable, so it can be consumed as an adjuvant for preventing or improving diseases.

[0060] The cosmetic composition of the present invention may be prepared in a formulation selected from the group consisting of a solution, an external ointment, a cream, a foam, a nourishing lotion, a softening lotion, a pack, a softening water, a lotion, a makeup base, an essence, a soap, a liquid cleanser, a bath additive, a sunscreen cream, a sun oil, a suspension, an emulsion, a paste, a gel, a lotion, a powder, a soap, a surfactant-containing cleansing product, an oil, a powder foundation, an emulsion foundation, a wax foundation, a patch, and a spray, but is not limited thereto.

[0061] The cosmetic composition of the present invention may additionally include one or more cosmetically acceptable carriers that are incorporated into general skin cosmetics. Ordinary ingredients, such as oils, water, surfactants, moisturizers, lower alcohols, thickeners, chelating agents, colorants, preservatives, fragrances, etc., may be appropriately incorporated, but are not limited thereto. The cosmetically acceptable carriers that can be included in the cosmetic composition of the present invention vary depending on the formulation of the cosmetic composition. For example, when the formulation of the present invention is an ointment, paste, cream, or gel, animal oil, vegetable oil, wax, paraffin, starch, tracanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide, etc., may be used as carrier components, but are not limited thereto. These may be used alone or in a mixture of two or more. When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, polyamide powder, etc. may be used as a carrier component, and in particular, in the case of a spray, a propellant such as chlorofluorohydrocarbon, propane / butane, or dimethyl ether may be additionally included, but is not limited thereto. These may be used alone or in a mixture of two or more. When the formulation of the present invention is a solution or an emulsion, a solvent, a solubilizing agent, or an emulsifying agent may be used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, etc. may be used, and in particular, cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil and sesame oil, glycerol aliphatic ester, polyethylene glycol, or fatty acid ester of sorbitan may be used, but is not limited thereto. These can be used individually or in combination of two or more types.When the formulation of the present invention is a suspension, liquid diluents such as water, ethanol, or propylene glycol, suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, or tracant may be used as carrier components, but are not limited thereto. These may be used alone or in a mixture of two or more. When the formulation of the present invention is a soap, alkali metal salts of fatty acids, fatty acid hemiester salts, fatty acid protein hydrolyzates, isethionates, lanolin derivatives, aliphatic alcohols, vegetable oils, glycerol, sugars, etc. may be used as carrier components, but are not limited thereto. These may be used alone or in a mixture of two or more.

[0062] In the present invention, the pharmaceutical composition may further comprise a pharmaceutically acceptable carrier and may be formulated together with said carrier and provided as food, medicine, etc. In the present invention, said pharmaceutically acceptable carrier generally refers to a carrier or diluent that does not stimulate living organisms and does not impair the biological activity and properties of the administered compound. The types of said carriers usable in the present invention are not particularly limited, and any carrier that is commonly used in the relevant technical field or similar fields and is pharmaceutically acceptable may be used. Non-limiting examples of said carriers include saline solution, sterile water, Ringer's solution, buffered saline solution, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, etc. These may be used alone or in a mixture of two or more. In addition, if necessary, other conventional additives such as antioxidants, buffers and / or bacteriostatic agents may be added, and diluents, dispersants, surfactants, binders and / or lubricants may be additionally added to formulate the product into injectable formulations such as aqueous solutions, suspensions, and emulsions, as well as pills, capsules, granules, or tablets.

[0063] The method of administration of the pharmaceutical composition of the present invention is not particularly limited and may follow methods commonly used in the relevant technical field or similar fields. As a non-limiting example of the method of administration, the composition may be administered orally or parenterally.

[0064] The pharmaceutical composition of the present invention may be prepared in various formulations depending on the intended mode of administration. Non-limiting examples of formulations for oral administration include troches, lozenges, tablets, water-soluble suspensions, oily suspensions, prepared powders, granules, emulsions, hard capsules, soft capsules, syrups, or elixirs. In order to formulate the pharmaceutical composition of the present invention into an oral administration formulation such as a tablet or capsule, a binder such as lactose, saccharose, sorbitol, mannitol, starch, amylopectin, cellulose, or gelatin; an excipient such as dicalcium phosphate; and a disintegrant such as corn starch or sweet potato starch; It may include lubricants such as magnesium stearate, calcium stearate, sodium stearyl fumarate, or polyethylene glycol wax. Furthermore, in the case of capsule formulations, in addition to the aforementioned substances, it may additionally contain liquid carriers such as fatty oils.

[0065] Methods for parenterally administering the pharmaceutical composition of the present invention may include, for example, intravenous administration, intraperitoneal administration, intramuscular administration, subcutaneous administration, or local administration, and methods of applying or spraying the composition to a diseased area may also be used, but are not limited thereto. Formulations for parenteral administration may include, for example, injectable forms such as subcutaneous injection, intravenous injection, or intramuscular injection; suppository administration; or formulations for sprays such as aerosols that allow inhalation through the respiratory tract, but are not limited thereto. To formulate the composition of the present invention into an injectable form, the composition of the present invention may be mixed with a stabilizer or buffer in water to prepare a solution or suspension, and this may be formulated for unit administration in ampoules or vials. When formulating for a spray such as an aerosol, a propellant or the like may be combined with an additive to disperse the water-dispersed concentrate or wet powder.

[0066] The suitable dosage of the pharmaceutical composition of the present invention may vary depending on factors such as the method of formulation, method of administration, time of administration and / or route of administration, as well as the age, weight, gender, severity of disease symptoms, food consumed, and excretion rate of the subject to administration, and a person skilled in the art can easily determine and prescribe a dosage effective for the intended treatment.

[0067] The pharmaceutical composition of the present invention may be administered in a pharmaceutically effective amount. In the present invention, "pharmaceuticalally effective amount" refers to an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level may be determined based on factors including the type and severity of the patient's disease, drug activity, sensitivity to the drug, time of administration, route of administration and elimination rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field. The pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered as a single or multiple doses. It is important to administer an amount that obtains maximum effect with a minimum amount without side effects by considering all of the above factors, and this can be easily determined by a person skilled in the art. Specifically, the effective amount of the pharmaceutical composition of the present invention may vary depending on the patient's age, gender, condition, body weight, absorption rate, inactivation rate, and elimination rate of the active ingredient in the body, type of disease, and concurrently used drugs.

[0069] Terms not otherwise defined in the present invention shall be interpreted as having the meanings commonly used in the relevant technical field. Additionally, the expression "or" as used in the present invention may be interpreted as a concept including "and" unless otherwise noted.

[0070] The scope of the present invention is not limited by the specific descriptions disclosed herein, and each description and embodiment disclosed herein may be applied to each other description and embodiment. That is, all possible combinations of the various elements disclosed herein are to be interpreted as falling within the scope of the present invention. Furthermore, a person skilled in the art may recognize or identify a number of equivalents to specific embodiments of the present invention through ordinary experimentation, and such equivalents are to be interpreted as falling within the scope of the present invention. Effects of the invention

[0071] The present invention relates to a novel Lacticase Bacillus rhamnosus having excellent antioxidant activity, inhibition of skin inflammation, inhibition of skin damage, protection of the skin barrier, and inhibition of skin photoaging ( Lacticaseibacillus rhamnosus This invention relates to the IR06 strain (accession number KFCC12014P). It also relates to a health functional food composition, a cosmetic composition, and a pharmaceutical composition using the said strain, its culture, fermented product, and metabolite.

[0072] The present invention has excellent antioxidant activity, such as ABTS radical scavenging activity, reactive oxygen species (ROS) inhibition activity, and antioxidant activity-promoting activity of regulatory factors, and has the advantage of exhibiting excellent efficacy in protecting against skin damage by inhibiting skin damage-related enzymes including collagenase, elastase, tyrosinase, and hyaluronidase.

[0073] In addition, the present invention has the advantage of effectively suppressing skin inflammation by inhibiting excessive activation of MAPK and NF-κB signaling pathways and reducing the expression of skin damage and inflammation-related factors such as MMPs, COX-2, and iNOS.

[0074] In addition, the present invention has the advantage of exhibiting skin barrier protective activity by suppressing epidermal damage caused by ultraviolet irradiation in a three-dimensional human skin reconstruction model and restoring the expression of skin barrier-related genes such as loricrin, filaggrin, and involucrin.

[0075] Accordingly, the present invention has the advantage of being widely utilized as a health functional food, cosmetic, and pharmaceutical composition with excellent functionality and efficacy by effectively exhibiting antioxidant activity, skin damage-related enzyme inhibitory activity, skin inflammation inhibitory activity, skin barrier protective activity, and skin photoaging inhibitory activity, while having a low risk of side effects as a natural product-based material, particularly a probiotic. Brief explanation of the drawing

[0076] FIG. 1 shows a novel lactic acid bacteria strain, Lacticase Bacillus rhamnosus, isolated from infant feces in one embodiment of the present invention ( Lacticaseibacillus rhamnosus This is a simplified diagram illustrating the process of preparing a fermented product and isolating extracellular polysaccharides using the IR06 strain (accession number KFCC12014P). FIG. 2 shows a novel lactic acid bacteria strain, Lacticase Bacillus rhamnosus, isolated from infant feces in one embodiment of the present invention ( Lacticaseibacillus rhamnosus This shows the results of evaluating the antioxidant activity (reduction in the production of reactive oxygen species) of extracellular polysaccharides derived from fermentation using the IR06 strain (accession number KFCC12014P). FIG. 3 shows a novel lactic acid bacteria strain, Lacticase Bacillus rhamnosus, isolated from infant feces in one embodiment of the present invention ( Lacticaseibacillus rhamnosus Figure 3A shows the experimental results confirming the chemical characteristics and microstructure of extracellular polysaccharides (EPS-IR06) derived from fermentation products using the IR06 strain (accession number KFCC12014P). Figure 3B shows the monosaccharide composition, Figure 3C shows the molecular weight distribution, Figure 3D shows the structural analysis results at 1,000x magnification, and Figure 3D shows the results at 2,000x magnification. FIG. 4 shows a novel lactic acid bacteria strain, Lacticase Bacillus rhamnosus, isolated from infant feces in one embodiment of the present invention ( Lacticaseibacillus rhamnosus This shows the results of NMR and FT-IR analysis of extracellular polysaccharides (EPS-IR06) derived from fermentation products using the IR06 strain (accession number KFCC12014P). Figure 4A is 1 1H NMR, Fig. 4B is 13 Figure 4C shows the 3D NMR, Figure 4D shows the 2D NMR, and Figure 4D shows the FT-IR analysis results. FIG. 5 shows a novel lactic acid bacteria strain, Lacticase Bacillus rhamnosus, isolated from infant feces in one embodiment of the present invention ( Lacticaseibacillus rhamnosus This is a simplified diagram illustrating the process of performing a functional evaluation based on a photoaging-induced cell model using extracellular polysaccharides (EPS-IR06) derived from the fermentation product of the IR06 strain (accession number KFCC12014P). FIG. 6 shows a novel lactic acid bacteria strain, Lacticase Bacillus rhamnosus, isolated from infant feces in one embodiment of the present invention ( Lacticaseibacillus rhamnosus Figures 6A and 6B show the results of evaluating the photoaging protective efficacy and anti-inflammatory activity of the supernatant (FP-IR06) of a fermented product using the IR06 strain (accession number KFCC12014P) and the extracellular polysaccharide (EPS-IR06) derived from the fermented product. Figures 6C, 6D, and 6E show the results of measuring the expression levels of collagenase and inflammatory factors, respectively. FIG. 7 shows a novel lactic acid bacteria strain, Lacticase Bacillus rhamnosus, isolated from infant feces in one embodiment of the present invention ( Lacticaseibacillus rhamnosus This shows the results of evaluating the antioxidant activity (reduction in the production of reactive oxygen species) of extracellular polysaccharides (EPS-IR06) derived from fermentation using the IR06 strain (accession number KFCC12014P). FIG. 8 shows a novel lactic acid bacteria strain, Lacticase Bacillus rhamnosus, isolated from infant feces in one embodiment of the present invention ( Lacticaseibacillus rhamnosusThis shows the results of evaluating the antioxidant activity (increase in factors related to antioxidant activity) of extracellular polysaccharides (EPS-IR06) derived from fermentation using the IR06 strain (accession number KFCC12014P). FIG. 9 shows a novel lactic acid bacteria strain, Lacticase Bacillus rhamnosus, isolated from infant feces in one embodiment of the present invention ( Lacticaseibacillus rhamnosus This shows the results of evaluating the collagenase inhibitory activity (reduction in MAPK signaling pathway protein expression) of extracellular polysaccharides (EPS-IR06) derived from fermentation using the IR06 strain (accession number KFCC12014P). FIG. 10 shows a novel lactic acid bacteria strain, Lacticase Bacillus rhamnosus, isolated from infant feces in one embodiment of the present invention ( Lacticaseibacillus rhamnosus This shows the results of evaluating the collagenase inhibitory activity (reduction of MMPs gene expression) of extracellular polysaccharides (EPS-IR06) derived from fermentation using the IR06 strain (accession number KFCC12014P). FIG. 11 shows a novel lactic acid bacteria strain, Lacticase Bacillus rhamnosus, isolated from infant feces in one embodiment of the present invention ( Lacticaseibacillus rhamnosus This shows the results of evaluating the skin inflammation inhibitory activity (reduction in NF-κB signaling pathway protein expression) of extracellular polysaccharides (EPS-IR06) derived from the fermentation product using the IR06 strain (accession number KFCC12014P). FIG. 12 shows a novel lactic acid bacteria strain, Lacticase Bacillus rhamnosus, isolated from infant feces in one embodiment of the present invention ( Lacticaseibacillus rhamnosus This shows the results of evaluating the skin inflammation-inhibiting activity (reduction in inflammatory cytokine gene expression) of extracellular polysaccharides (EPS-IR06) derived from the fermentation product using the IR06 strain (accession number KFCC12014P). FIG. 13 shows a novel lactic acid bacteria strain, Lacticase Bacillus rhamnosus, isolated from infant feces in one embodiment of the present invention ( Lacticaseibacillus rhamnosusFigures 13A and 13B show the results of evaluating the protective activity against UV-induced skin damage of extracellular polysaccharides (EPS-IR06) derived from fermentation using the IR06 strain (accession number KFCC12014P). Figures 13A and 13B show the results of histological analysis using a three-dimensional human skin reconstruction model, and Figure 13C shows the results confirming increased gene expression of proteins involved in skin barrier formation. Specific details for implementing the invention

[0077] The present invention will be described in more detail below through specific embodiments. However, these embodiments are merely examples for explaining the present invention and should not be interpreted as limiting the scope of the present invention in any way.

[0079] [Experimental Example 1] Preparation of fermented product using lactic acid bacteria and selection of excellent extracellular polysaccharides derived from the fermented product

[0080] 1-1. Preparation of fermented product and method for isolating extracellular polysaccharides

[0081] Six strains of lactic acid bacteria were isolated from the feces of infants and toddlers by the following method. Specifically, 5 g of newborn feces and 45 mL of peptone water were placed in a piping bag and homogenized, and then 10 [units of volume] was added to sterile physiological saline. 6 The solution was diluted to the dilution factor. Next, 1 mL of the diluted solution was dispensed onto MRS and Logosa agar plates, and the pour plate method was performed. The selective media and culture conditions are shown in Table 1 below. After incubation, colonies appearing on the selective media that differed in morphology or size were selected for pure isolation, and then cultured in MRS liquid medium (broth) for 18 hours at 37°C under aerobic conditions. The isolated strains were dispensed into stock vials containing 500 μL of MRS liquid medium and 5 μL of 40% glycerol, respectively, and stored in an ultra-low temperature freezer. The isolated strains were identified at the species level through 16S rRNA sequencing analysis.

[0082] origin Selective medium Incubation time Culture conditions temperature person MRS agar 48 hours exhalation conditions 37℃ Rogosa agar 48 hours exhalation conditions 37℃

[0084] A fermented product was prepared using the six lactic acid bacteria strains derived from infant feces isolated above and skim milk powder in the following manner. Specifically, 60 g of skim milk powder, 2.1 g of peptone, 2.1 g of yeast extract, and 12 g of glucose were added to 600 mL of triple-distilled water and homogenized. The mixture was then sterilized in a 90°C water bath for 10 minutes, followed by cooling sufficiently at room temperature for 20 minutes. The candidate strains were subcultured three times for 18–24 hours each in MRS liquid medium at 37°C. After three subcultures, the lactic acid bacteria strains were washed three times with phosphate buffered saline (PBS), inoculated at 3% in the previously prepared skim milk powder medium, and cultured at 37°C for 24 hours. The above process is briefly illustrated in Fig. 1, and the strains used are shown in Table 2 below. Afterward, the fermented product was cooled at 4°C for 16 hours after the fermentation was completed.

[0085] Next, to isolate exopolysaccharides (EPS), each fermented product obtained above was heated in a 90°C constant temperature water bath for 45 minutes, then centrifuged (6,500 rpm, 20 min, 4°C) and the supernatant was collected. Next, to remove proteins, 80% TCA (Trichloroacetic acid) was added to a final concentration of 10% and reacted at 4°C for 2 hours, then centrifuged (6,500 rpm, 20 min, 4°C) and the supernatant was collected. Next, to precipitate the polysaccharides, twice the volume of cold ethanol was added and reacted at 4°C for 48 hours, after which the precipitate was dissolved again in triple distilled water and dialyzed in triple distilled water at 4°C for 48 hours using a 10–12 kDA dialysis membrane. Afterwards, the extracellular polysaccharides isolated from each fermentation product were freeze-dried and used in experiments. The above process is briefly illustrated in Figure 1.

[0086] division Extracellular polysaccharides strain name Sympathy results Same as above (%) Example 1 EPS-IR06 IR06 Lacticaseibacillus rhamnosus IR06 99.86 Comparative Example 1 EPS-IM18 IM18 Lacticaseibacillus rhamnosus IM18 99.86 Comparative Example 2 EPS-IM19 IM19 Lacticaseibacillus rhamnosus IM19 100.00 Comparative Example 3 EPS-IM13 IM13 Lactobacillus gasseri IM13 99.86 Comparative Example 4 EPS-IR13 IR13 Lactobacillus gasseri IR13 100.00 Comparative Example 5 EPS-IM07 IM07 Lactobacillus gasseri IM07 99.86

[0088] In Table 2 above, Example 1 refers to an extracellular polysaccharide isolated from a fermented product using strain IR06, and Comparative Examples 1 to 5 refer to extracellular polysaccharides isolated from fermented products using strains IM18, IM19, IM13, IR13, and IM07, respectively.

[0090] 1-2. Evaluation of Antioxidant Activity of Extracellular Polysaccharides Derived from Fermented Products

[0091] In order to confirm the functionality of the extracellular polysaccharides produced from each strain in Experimental Example 1 above, the following antioxidant activity evaluation was conducted. Specifically, the antioxidant activity of Example 1 and Comparative Examples 1 to 5 was evaluated through ABTS radical scavenging ability and reactive oxygen species generation analysis.

[0093] (1) ABTS radical scavenging ability measurement

[0094] The radical scavenging activity of the sample was measured by reacting the sample with the ABTS (2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)) radical. The ABTS reagent was prepared by mixing 7 mM ABTS and 2.45 mM potassium persulfate in a ratio of 5.8:1. 20 μL of the sample and 180 μL of the ABTS reagent were placed in a 96-well plate and reacted in the dark at room temperature for 6 minutes. Afterward, the absorbance was measured at a wavelength of 734 nm using a spectrophotometer. The ABTS radical scavenging activity (%) was calculated using Equation 1 below, and the results are shown in Table 3 below.

[0095] [Equation 1]

[0096] ABTS radical scavenging activity (%) = [1 - {Sample (Abs 734 nm) / Control (Abs 734 nm)}] × 100

[0097] * Control group: Group with secondary distilled water added instead of the sample

[0099] division Comparative Example 1 Comparative Example 2 Example 1 Comparative Example 3 Comparative Example 4 Comparative Example 5 ABTS Radical Scavenging Activity (%) 10.20 9.88 12.78 9.66 8.00 8.84

[0101] As a result of the experiment, it was confirmed that the sample of Example 1 had significantly higher ABTS radical scavenging ability compared to the samples of Comparative Examples 1 to 5 (p<0.05).

[0103] (2) Measurement of active oxygen production

[0104] The amount of intracellular reactive oxygen species produced was determined by treating human epidermal keratinocytes (HaCaT) irradiated with UV light with the sample. Specifically, HaCaT cells were placed in a 96-well plate at 1.0 x 10 4 Cells were seeded into wells and cultured for 24 hours. Subsequently, the medium was replaced with serum-free medium to induce starvation for 24 hours. Then, 10 µg / mL of extracellular polysaccharides isolated from each strain were added and incubated for 1 hour, followed by treatment with ultraviolet B (25 mJ / cm²). 2 HaCaT cells were irradiated with ) . Then, after treating the cells with a medium containing 20 μM H2DCFHDA (2',7'-dicholorodihydrofluorescein diacetate) for 30 minutes, the HaCaT cells were washed twice with PBS, and the DCF fluorescence intensity was checked using a 1420 Multilabel counter Victor3 (Perkin Elmer, MA, USA). The control group was a group without UVB irradiation and extracellular polysaccharide treatment (CON), and the negative control group was a group without UVB irradiation and extracellular polysaccharide treatment (NC, UVB).

[0105] As a result of the experiment, as shown in Figure 2 and Table 4 below, it was confirmed that the amount of reactive oxygen species generated increased in the negative control group (NC, indicated as 'UVB' in Figure 2) compared to the control group (CON). However, it was confirmed that the amount of reactive oxygen species generated significantly decreased when the samples of Example 1 and Comparative Examples 1 to 5 were treated. In particular, Example 1 was confirmed to significantly inhibit the generation of reactive oxygen species compared to the other samples (p<0.05).

[0106] division control group Negative control group Comparative Example 1 Comparative Example 2 Example 1 Comparative Example 3 Comparative Example 4 Comparative Example 5 ROS generation amount (%) 100.00 128.13 113.24 119.74 93.97 103.31 107.62 107.88

[0108] 1-3. Evaluation of the Inhibitory Activity of Extracellular Polysaccharides Derived from Fermented Products on Skin Damage-Related Enzymes

[0109] In order to confirm the skin protective effect of the extracellular polysaccharides produced from each strain in Experimental Example 1 above, the collagenase, elastase, tyrosinase, and hyaluronidase inhibitory activities of Example 1 and Comparative Examples 1 to 5 were evaluated.

[0111] (1) Evaluation of collagenase inhibitory activity

[0112] The collagenase inhibitory activity of extracellular polysaccharides was measured according to the method of Shirzad et al. Specifically, 20 μL of 50 mM Tris-HCl buffer solution (pH 7.5) containing 0.36 mM calcium chloride, 20 μL of collagenase (1 mg / mL), and 20 μL of the sample (1 mg / mL) were dispensed into a 96-well plate, and the reaction was performed in the dark at room temperature for 20 minutes. Subsequently, 40 μL of 2 mM FALGPA (N-[3-(2-Furyl)acryloyl]-Leu-Gly-Pro-Ala) was dispensed, and the reaction was carried out at 37°C for 30 minutes. After the reaction was complete, the absorbance was measured at 335 nm using a spectrophotometer. The collagenase inhibitory activity (%) was calculated using Equation 2 below, and the results are shown in Table 5 below.

[0113] [Equation 2]

[0114] Collagenase inhibitory activity (%) = [1 - {Control (Abs 335 nm) - Sample (Abs 335 nm) / Control (Abs 335 nm) - Negative control (Abs 335 nm)}] × 100

[0115] * Control group: Group without added collagenase and sample

[0116] ** Negative control group: Group without added sample

[0118] (2) Evaluation of elastase inhibitory activity

[0119] The elastase inhibitory activity of extracellular polysaccharides was measured according to the method of Shirzad et al. 50 μL of 2 mM Tris-HCl buffer (pH 8.0), 25 μL of the sample (1 mg / mL), and 25 μL of elastase (1 mg / mL) were dispensed into a 96-well plate, and the reaction was performed in the dark at room temperature for 15 minutes. Subsequently, 6.4 mM AAAPVN (N-succinyl-Ala-Ala-Ala- p 12.5 μL of (-nitroanilide) was added, and the reaction was carried out in the dark at room temperature for 20 minutes. After the reaction was complete, the absorbance was measured at 410 nm using a spectrophotometer. The elastase inhibitory activity (%) was calculated using Equation 3 below, and the results are shown in Table 5 below.

[0120] [Equation 3]

[0121] Elastase inhibitory activity (%) = [1 - {Sample (Abs 410 nm) / Control (Abs 410 nm)}] × 100

[0122] * Control group: Group without added sample

[0124] (3) Evaluation of tyrosinase inhibitory activity

[0125] The tyrosinase inhibitory activity of extracellular polysaccharides was measured according to the method of Jiratchayamaethasakul et al. 100 μL of 100 mM sodium phosphate buffer (pH 8.0), 20 μL of the sample (1 mg / mL), 10 μL of tyrosinase (2,000 units / mL), and 20 μL of 1.5 mM L-tyrosine were dispensed into a 96-well plate, and the reaction was carried out in the dark at room temperature for 20 minutes. Subsequently, the absorbance was measured at 490 nm using a spectrophotometer. The tyrosinase inhibitory activity (%) was calculated using Equation 4 below, and the results are shown in Table 5 below.

[0126] [Equation 4]

[0127] Tyrosinase inhibitory activity (%) = [1 - {Sample (Abs 490 nm) / Control (Abs 490 nm)}] × 100

[0128] * Control group: Group without added sample

[0130] (4) Evaluation of hyaluronidase inhibitory activity

[0131] The hyaluronidase inhibitory activity of extracellular polysaccharides was measured according to the method of Jiratchayamaethasakul et al. The test was conducted in a 100 mM acetate buffer solution (pH 3.6). First, 10 μL of hyaluronidase (8 mg / mL) and 20 μL of the sample (1 mg / mL) were mixed, and the reaction was carried out at 37°C for 20 minutes. Subsequently, 20 μL of 12.5 mM calcium chloride was added, and the reaction was carried out again at 37°C for 20 minutes. Next, 50 μL of hyaluronic acid (2.4 mg / mL) was added, and the reaction was carried out at 37°C for 40 minutes. 2 μL of 0.4 N sodium hydroxide and 20 μL of 0.4 M potassium tetraborate tetrahydrate were added, and the reaction was carried out at 100°C for 3 minutes. Finally, after the reaction was finished and the mixture was sufficiently cooled, 600 μL of DMAB reagent was added, and the reaction was carried out at 37°C for 20 minutes. After the reaction was finished, the absorbance was measured at 600 nm using a spectrophotometer. The hyaluronidase inhibitory activity (%) was calculated using Equation 5 below, and the results are shown in Table 5 below.

[0132] [Equation 5]

[0133] Hyaluronidase inhibitory activity (%) = [1 - {Sample (Abs 600 nm) / Control (Abs 600 nm)}] × 100

[0134] * Control group: Group without added sample

[0136] division Comparative Example 1 Comparative Example 2 Example 1 Comparative Example 3 Comparative Example 4 Comparative Example 5 Collagenase Inhibitory Activity (%) 20.45 19.18 42.45 25.87 19.19 15.86 Elastase inhibitory activity (%) 12.59 33.92 64.72 61.81 56.50 65.24 Tyrosinase inhibitory activity (%) 10.20 13.84 14.40 13.84 13.35 11.04 Hyaluronidase inhibitory activity (%) 11.05 9.47 17.90 1.58 8.42 -1.05

[0138] As a result of the experiment, regarding collagenase inhibitory activity, Example 1 showed significantly higher inhibitory activity compared to the samples of Comparative Examples 1 to 5. Regarding elastase inhibitory activity, Example 1 and Comparative Example 5 showed excellent inhibitory activity, regarding tyrosinase inhibitory activity, Example 1 showed relatively high inhibitory activity, and regarding hyaluronidase inhibitory activity, Example 1 showed superior inhibitory activity compared to the other samples. Overall, it was confirmed that Example 1 showed superior inhibitory activity in the evaluation of all enzyme inhibitory activities.

[0139] Based on the comprehensive results of the above experiments, it was confirmed that Example 1 exhibited the highest efficacy in the evaluation of antioxidant and skin damage-related enzyme inhibition activities. Accordingly, an extracellular polysaccharide (EPS-IR06) derived from a fermented product using the lactic acid bacteria strain IR06 was used in an experiment to confirm the effects of preventing and improving skin aging and skin protection.

[0141] [Experimental Example 2] Analysis of Chemical and Structural Characteristics of Extracellular Polysaccharides

[0142] Novel lactic acid bacteria strain Lacticase Bacillus rhamnosus isolated from infant feces of Example 1 above ( Lacticaseibacillus rhamnosus To analyze the structural characteristics of extracellular polysaccharides (EPS-IR06) derived from fermentation products using the IR06 strain, monosaccharide and molecular weight analysis, as well as NMR (Nuclear magnetic resonance), FT-IR (Fourier transform infrared spectroscopy), and SEM (Scanning electron microscope) analysis were performed.

[0144] 2-1. Confirmation of Chemical Properties and Microstructure of Extracellular Polysaccharides

[0145] The constituent monosaccharides and molecular weight of the extracellular polysaccharide (EPS-IR06) were analyzed by HPLC-ELSD and HPLC-MALS, and the microstructure was confirmed using a MIRA 3 LMH In-Beam Detector.

[0146] As a result of the experiment, as shown in Fig. 3, the extracellular polysaccharide (EPS-IR06) is composed of 41.1% mannose, 34.3% galactose, and 24.6% glucose (Fig. 3A), and its molecular weight is 5.8 x 10⁻⁶. 5 Da (65.6%), 3.0X10 5 Da (23.6%), 3.9X10 4 It was confirmed that it was distributed in the ratios of Da (8.3%) and 400 Da (2.5%) (Fig. 3B). In addition, the structure of the extracellular polysaccharide (EPS-IR06) was mixed, with a reticular layer and flake structure composed of irregularly intertwined fibrous filaments observed at 1,000x magnification (Fig. 3C), and branched and tubular structures confirmed at 2,000x magnification (Fig. 3D).

[0148] 2-2. Confirmation of Structural Characteristics of Extracellular Polysaccharides

[0149] To confirm the structural characteristics of the extracellular polysaccharide (EPS-IR06), NMR and FT-IR analyses were performed.

[0150] As a result of the experiment, as shown in Figure 4, 1 H NMR and 13 3C NMR analysis results (Figs. 4A and 4B) showed that the extracellular polysaccharide (EPS-IR06) is α-D-Man p , α-D-Gal p , β-D-Glc p The major signal of was confirmed, and some unidentified peaks were also observed. In addition, through 2D NMR analysis, α-D-Man p , α-D-Gal p , β-D-Glc p The coupling relationship between them was identified (Fig. 4C). In FT-IR analysis, 3,302 cm⁻¹ -1 At OH stretching vibration, 2,916 cm -1 CH stretching vibrations were observed at 1,643 cm -1At C=O, stretching vibration, 1,024 cm -1 COC binding characteristics were observed (Fig. 4D). This confirmed that the corresponding extracellular polysaccharide (EPS-IR06) has a chemical binding structure characteristic of polysaccharides.

[0152] [Experimental Example 3] Functional evaluation of extracellular polysaccharides based on a photoaging-induced cell model

[0154] 3-1. Method

[0155] The functional evaluation of the extracellular polysaccharide (EPS-IR06) based on a photoaging-induced cell model was performed according to the method shown in Figure 5. Specifically, the experimental groups were divided into three categories: a general control group (CON), a negative control group (NC), and an extracellular polysaccharide (EPS-IR06) treatment group (EPS). The CON group consisted of HaCaT cells cultured sequentially in culture medium for 24 hours and in serum-free medium for 25 hours, followed by an additional 24 hours without UV treatment; the NC group consisted of HaCaT cells cultured sequentially in culture medium for 24 hours and in serum-free medium for 25 hours, followed by UVB (UVB 25 mJ / cm²). 2 After treatment with ), the cells were cultured for an additional 24 hours. For the EPS group, HaCaT cells were cultured sequentially in culture medium for 24 hours and in serum-free medium for 24 hours; then, extracellular polysaccharide (EPS-IR06) was added to the serum-free medium and cultured for an additional hour, followed by ultraviolet B (UVB 25 mJ / cm²). 2 After treatment, it was cultured for another 24 hours.

[0157] 3-2. Evaluation of Photoaging Protective Efficacy and Anti-inflammatory Activity of Fermented Product Supernatant

[0158] To verify the potential of extracellular polysaccharides (EPS-IR06) derived from fermented products using the lactic acid bacteria strain IR06 as physiologically active substances, fermented products (FP) and isolated and purified extracellular polysaccharides were treated to a photoaging-induced cell model at various concentrations (identical to the EPS group treatment method described in 3-1 above), and the photoaging protective effect (collagen-degrading enzyme promotion) and anti-inflammatory activity were evaluated.

[0159] Specifically, to compare the collagenase-promoting effects and the preventive and mitigating effects on inflammation induced by UV irradiation of the supernatant of the fermentation product (FP-IR06) and extracellular polysaccharides (EPS-IR06) using the lactic acid bacteria strain IR06, real-time polymerase chain reaction (qRT-PCR) was used. Total RNA was isolated from HaCaT cells by treating them with Trizol according to the manufacturer's instructions. The isolated RNA was synthesized into cDNA using Takara's 5X Reverse Transcription Pre-Mix, and experiments were conducted using Promega's SYBR Green on a QuantStudio™ 3 Real-Time PCR System (Applied Biosystems, Carlsbad, CA, USA). The primers used in the experiment are shown in Table 6 below.

[0160] Gene Forward Primer Reverse Primer MMP1 AGTGACTGGGAAACCAGATGCTGA (Sequence No. 2) GCTCTTGGCAAATCTGGCCTGTAA (Sequence No. 3) MMP3 ATTCCATGGAGCCAGGCTTTC (Sequence No. 4) CATTTGGGTCAAACTCCAACTGTG (Sequence No. 5) TNF-α TACTCCCAGGTCCTCTTCAAGG (Sequence No. 6) TTGATGGCAGAGAGGAGGTTG (Sequence No. 7) IL-1β AGCTACGAATCTCCGACCAC (Sequence No. 8) CGTTATCCCATGTGTCGAAGAA (Sequence No. 9) IL-6 ATGAGGAGACTTGCCTGGTG (Sequence No. 10) GGCATTTGTGGTTGGGTCAG (Sequence No. 11) GAPDH ACCCACTCCTCCACCTTTGA (Sequence No. 12) AAAGTGGTCGTTGAGGGCAA (Sequence No. 13)

[0162] As shown in Figure 6, the experimental results confirmed that the expression levels of collagen-degrading enzymes and inflammatory factors significantly increased in the NC group (indicated as 'UVB' in Figure 6) due to ultraviolet B irradiation (p<0.001), whereas the expression levels of collagen-degrading enzymes and inflammatory factors significantly decreased in both the fermented product supernatant (FP-IR06) treatment group and the extracellular polysaccharide (EPS-IR06) treatment group. In particular, in the case of the extracellular polysaccharide (EPS-IR06) treatment group, despite being treated at a concentration approximately 1,000 times lower than that of the fermented product supernatant (FP-IR06) treatment group, the expression levels of collagen-degrading enzymes and inflammation-related factors were found to be significantly reduced to a level similar to that of the fermented product supernatant (FP-IR06) treatment group (p<0.05, p<0.01, p<0.001).

[0164] 3-3. Evaluation of Antioxidant Activity Functionality

[0165] To confirm the oxidative stress alleviation effect of UV irradiation on skin cells, changes in intracellular reactive oxygen species production and the expression levels of antioxidant enzyme factors were examined.

[0167] (1) Measurement of active oxygen production

[0168] As in (2) of Experimental Example 1-2 above, the amount of active oxygen produced in the cell was confirmed by measuring the DCF fluorescence intensity.

[0169] As shown in Figure 7, the experimental results confirmed that the amount of reactive oxygen species significantly increased due to ultraviolet B in the NC group (indicated as 'UVB' in Figure 7) (p<0.05), whereas the amount of reactive oxygen species produced significantly decreased in the EPS-IR06 group (p<0.05, p<0.001).

[0171] (2) Confirmation of increased factors related to antioxidant activity

[0172] Changes in gene expression of Nrf2 and CAT were confirmed using qRT-PCR as in Experimental Example 3-2. The primers used in the experiment are shown in Table 7 below.

[0173] Gene Forward Primer Reverse Primer Nrf2 CCAGCCGTTCTACTTCCAC (Sequence No. 14) GGAAGCACTCCAGTGGACTA (Sequence No. 15) CAT CCTTCGACCCAAGCAA (Sequence No. 16) CGATGGCGGTGAGTGT (Sequence No. 17) GAPDH ACCCACTCCTCCACCTTTGA (Sequence No. 12) AAAGTGGTCGTTGAGGGCAA (Sequence No. 13)

[0175] As shown in Figure 8, the experimental results confirmed that the expression level of antioxidant activity-related factors was significantly reduced by ultraviolet B in the NC group (indicated as 'UVB' in Figure 8) (p<0.01, p<0.001), whereas the expression level of antioxidant activity-related factors was significantly restored in the EPS-IR06 group (p<0.05).

[0177] 3-4. Confirmation of collagen-degrading enzyme inhibition

[0178] To confirm the preventive and corrective effects on photoaging and the promotion of collagen-degrading enzyme expression caused by UV irradiation, changes in the expression levels of MAPK (mitogen activated protein kinase) signaling pathway proteins and MMPs (metalloproteinases) genes were examined.

[0180] (1) Confirmation of changes in MAPK signaling pathway protein expression levels

[0181] Changes in the expression levels of MAPK signaling pathway proteins were confirmed by Western blotting, which examined changes in the phosphorylation levels of ERK, JNK, and p38 proteins, which are central pathways of photoaging.

[0182] Specifically, cells were lysed in a lysis buffer (Cat#89900, Thermo Fisher Scientific, USA) containing a protease inhibitor cocktail (Cat#535142, Sigma-Aldrich, USA) and a phosphatase inhibitor cocktail (Cat#4906837001, Roche, Switzerland), followed by sonication. Subsequently, the supernatant was collected by microcentrifugation at 12,000 g for 15 minutes and boiled in SDS (sodium dodecyl sulfate) sample buffer for 5 minutes. Then, a conventional Western blot method was performed. Specifically, after performing SDS-PAGE (SDS-polyacrylamide gel) electrophoresis, the separated proteins were transferred to a polyvinylidene fluoride (PVDF) membrane. The primary antibodies used were p-ERK, ERK, p-JNK, JNK, p-p38, and p38 from Cell Signaling Technology (USA) and MMP1 from Santacruz (USA), and the secondary antibodies used were conjugated anti-rabbit IgG (Cat#7074S, Cell Signaling Technology, USA) and goat anti-mouse IgG (Cat#GTX213111-01, GeneTex, USA).

[0183] As shown in Figure 9, the experimental results confirmed that the photoaging improvement efficacy was exhibited, as the degree of protein phosphorylation of ERK (p<0.001), JNK (p<0.001), and p38 (p<0.01) was significantly increased in the NC group (indicated as 'UVB' in Figure 9) due to ultraviolet B, whereas the degree of phosphorylation of ERK, JNK, and p38 was significantly decreased in the EPS-IR06 group (p<0.01).

[0185] (2) Confirmation of changes in MMP gene expression levels

[0186] Changes in gene expression of MMP3 and MMP9 were confirmed using qRT-PCR as in Experimental Example 3-2. The primers used in the experiment are shown in Table 8 below.

[0187] Gene Forward Primer Reverse Primer MMP3 ATTCCATGGAGCCAGGCTTTC (Sequence No. 4) CATTTGGGTCAAACTCCAACTGTG (Sequence No. 5) MMP9 CTGCCAGGACCGCTTCTACT (Sequence No. 18) TTGGTCCCAGTGGGGATTTAC (Sequence No. 19) GAPDH ACTCCACTCACGGCAAATTCA (Sequence No. 12) CGCTCCTGGAAGATGGTGAT (Sequence No. 13)

[0189] As shown in Figure 10, the experimental results confirmed that the gene expression of MMP3 and MMP9 in the NC group (indicated as 'UVB' in Figure 10) was significantly increased by ultraviolet B (p<0.001), whereas the expression of collagen degradation factors in the EPS-IR06 group was significantly decreased (p<0.001).

[0191] 3-5. Confirmation of anti-inflammatory activity

[0192] To confirm the preventive and aggravating effects on skin inflammation caused by ultraviolet irradiation, changes in the expression levels of NF-κB (nuclear factor kappa B) signaling pathway proteins and inflammatory cytokine genes were examined.

[0194] (1) Confirmation of changes in NF-κB signaling pathway protein expression levels

[0195] As in (1) of Experimental Example 3-4, changes in the phosphorylation levels of IκB and p65 proteins, which are the central pathways of the inflammatory response, were confirmed using Western blot. The primary antibodies used were p-IκB, IκB, p-p65, and p65 from Cell Signaling Technology (USA) and iNOS and COX-2 from Invitrogen (USA), and the secondary antibodies used were conjugated anti-rabbit IgG (Cat#7074S, Cell Signaling Technology, USA) and goat anti-mouse IgG (Cat#GTX213111-01, GeneTex, USA).

[0196] As shown in Figure 11, the experimental results confirmed that the degree of protein phosphorylation of IκB (p<0.001) and p65 (p<0.01) in the NC group (indicated as 'UVB' in Figure 11) was significantly increased by ultraviolet B, and the protein expression levels of COX-2 and iNOS were also significantly increased (p<0.01). On the other hand, in the EPS-IR06 group, the degree of phosphorylation of IκB (p<0.01) and p65 (p<0.001) was significantly decreased, and the protein expression levels of COX-2 and iNOS were also significantly decreased (p<0.01), confirming that they are effectively involved in suppressing inflammation.

[0198] (2) Confirmation of changes in inflammatory cytokine gene expression levels

[0199] Changes in the gene expression levels of TNF-α, IL-1β, and IL-6 were confirmed using qRT-PCR as in Experimental Example 3-2. The primers used in the experiment are shown in Table 9 below.

[0200] Gene Forward Primer Reverse Primer TNF-α TACTCCCAGGTCCTCTTCAAGG (Sequence No. 6) TTGATGGCAGAGAGGAGGTTG (Sequence No. 7) IL-1β AGCTACGAATCTCCGACCAC (Sequence No. 8) CGTTATCCCATGTGTCGAAGAA (Sequence No. 9) IL-6 ATGAGGAGACTTGCCTGGTG (Sequence No. 10) GGCATTTGTGGTTGGGTCAG (Sequence No. 11) GAPDH ACTCCACTCACGGCAAATTCA (Sequence No. 12) CGCTCCTGGAAGATGGTGAT (Sequence No. 13)

[0202] As shown in Figure 12, the experimental results confirmed that the gene expression of all inflammatory cytokines was significantly increased by ultraviolet B in the NC group (indicated as 'UVB' in Figure 12) (p<0.001), whereas the expression of all inflammatory cytokine factors was significantly decreased in the EPS-IR06 group (p<0.01).

[0204] [Experimental Example 4] Functional evaluation of extracellular polysaccharides based on a 3D human skin reconstruction model

[0205] A 3D skin cell model was constructed using normal human epidermal keratinocytes (NHEK) and human dermal fibroblasts (HDF). Specifically, dermal structures were formed by mixing HDF with 5 mg / mL of collagen; NHEK was then cultured on these structures and incubated under air-liquid surface conditions for 10 days to induce epidermal differentiation. Subsequently, the cells were treated with extracellular polysaccharide (EPS-IR06) (10 μg / mL) followed by UV-B irradiation (30 mJ / cm²). 2 The above extracellular polysaccharide treatment and UV irradiation were carried out at 2-day intervals for a total of 8 days. As the control group, a group without UVB irradiation and no extracellular polysaccharide treatment (CON) was used, and as the negative control group, a group without UVB irradiation and no extracellular polysaccharide treatment (NC, UVB) was used.

[0207] 4-1. Histological Analysis of a 3D Human Skin Reconstruction Model

[0208] Damage to a 3D human skin reconstruction model caused by ultraviolet B and the protective effect of extracellular polysaccharides (EPS-IR06) were histologically analyzed using H&E (hematoxylin & eosin) staining.

[0210] 4-2. Confirmation of changes in skin barrier function gene expression levels

[0211] Changes in gene expression levels of loricrin, filaggrin, and involucrin were confirmed using qRT-PCR as in Experimental Example 3-2. The primers used in the experiment are shown in Table 10 below.

[0212] Gene Forward Primer Reverse Primer Loricrin GTGGGAGCGTCAAGTACTCC (Sequence No. 20) GAGACGCCTCCGTAGCTCTG (Sequence No. 21) Filaggrin TGAAGCCTATGACACCACTGA (Sequence No. 22) TCCCCTACGCTTTCTTGTCCT (Sequence No. 23) Involucrin ACAAGGGAAGAGAGAGCCACTG (Sequence No. 24) TGTAGAGGGACAGAGTCAAGTTCA (Sequence No. 25) GAPDH ACTCCACTCACGGCAAATTCA (Sequence No. 12) CGCTCCTGGAAGATGGTGAT (Sequence No. 13)

[0214] As a result of the experiment, as shown in Fig. 13, distinct damage to the epidermal layer was confirmed in the NC group (indicated as 'UVB' in Fig. 13) due to ultraviolet B, whereas damage to the epidermal layer was effectively inhibited in the EPS-IR06 treatment group (Figs. 13A and 13B). In addition, it was confirmed that the expression of all skin barrier function genes was significantly decreased in the NC group due to ultraviolet irradiation, whereas the expression of all skin barrier function genes was significantly increased in the EPS-IR06 treatment group (Fig. 13C).

[0216] Based on the above experimental results, Lacticasebacillus rhamnosus IR06, a lactic acid bacteria strain isolated from infant feces according to the present invention ( Lacticaseibacillus rhamnosusThe fermented product prepared using the IR06 strain and the extracellular polysaccharide (EPS-IR06) derived therefrom demonstrated excellent efficacy in protecting against skin damage by exhibiting antioxidant activity at the cellular level, an inhibitory effect on the production of reactive oxygen species (ROS), and inhibitory activities on collagenase, elastase, tyrosinase, and hyaluronidase. In addition, through molecular biological analysis, it was confirmed that the extracellular polysaccharide (EPS-IR06) of the present invention inhibits the excessive activation of MAPK and NF-κB signaling pathways and reduces the expression of skin damage and inflammation-related factors such as MMPs, COX-2, and iNOS. Furthermore, in a three-dimensional human skin reconstruction model, the extracellular polysaccharide (EPS-IR06) of the present invention was shown to inhibit epidermal damage caused by UV irradiation and contribute to maintaining skin barrier function by restoring the expression of skin barrier-related genes such as loricrin, filaggrin, and involucrin. Accordingly, it was confirmed that the extracellular polysaccharide (EPS-IR06) of the present invention is a high-functional extracellular polysaccharide capable of preventing and improving photoaging caused by UV rays by comprehensively exhibiting excellent antioxidant activity, inhibition of skin damage, inhibition of collagenase, and anti-inflammatory effects.

[0218] This specification omits detailed descriptions of matters that can be sufficiently recognized and inferred by those skilled in the art, and various modifications are possible within the scope of not altering the technical concept or essential configurations of the invention, in addition to the specific examples described herein. Accordingly, the invention may be implemented in a manner different from that specifically described and exemplified in this specification, and this is a matter that can be understood by those skilled in the art.

[0219] Depository Name: Korean Culture Collection Center (KCCM) Trustee Number: KFCC12014P Date of Deposit: 2024-09-20

Claims

Claim 1 Lacticaseibacillus rhamnosus, deposited under accession number KFCC12014P ( Lacticaseibacillus rhamnosus ) IR06 strain. Claim 2 A fermented product obtained by treating the above-mentioned Lacticase Bacillus rhamnosus IR06 strain of claim 1 with a fermentation substrate. Claim 3 In paragraph 2, the fermented product comprises exopolysaccharides (EPS). Claim 4 The fermented product according to claim 2 is characterized in that it has one or more activities selected from the group consisting of antioxidant activity, skin damage-related enzyme inhibitory activity, skin inflammation inhibitory activity, skin barrier protective activity, and skin photoaging inhibitory activity, and the skin damage-related enzyme is one or more selected from the group consisting of collagenase, elastase, tyrosinase, and hyaluronidase. Claim 5 A fermented product according to claim 4, wherein the antioxidant activity is one or more selected from the group consisting of ABTS radical scavenging activity, reactive oxygen species (ROS) inhibitory activity, and activity promoting the expression of an antioxidant activity regulator, and the antioxidant activity regulator is Nrf2 or CAT (Catalase). Claim 6 delete Claim 7 delete Claim 8 In claim 4, the skin inflammation-inhibiting activity is an activity that inhibits the expression of NF-κB signaling pathway proteins or inflammatory cytokines, and the inflammatory cytokines are one or more selected from the group consisting of TNF-α, IL-1β, and IL-6, a fermented product. Claim 9 In claim 4, the skin barrier protective activity is an activity that promotes the expression of one or more skin barrier-forming proteins selected from the group consisting of loricrin, filaggrin, and involucrin. Claim 10 In paragraph 4, the above-mentioned skin photoaging inhibitory activity is an activity that inhibits skin aging or skin damage caused by skin exposure to ultraviolet (UV) rays, a fermented product. Claim 11 A health functional food composition for skin improvement comprising the fermented product of any one of claims 2 to 5 and claims 8 to 10 as an active ingredient, and having one or more efficacy selected from the group consisting of antioxidant, inhibition of skin damage, inhibition of skin inflammation, protection of the skin barrier, and inhibition of skin photoaging. Claim 12 A cosmetic composition for improving skin, comprising the fermented product of any one of claims 2 to 5 and claims 8 to 10 as an active ingredient, and having one or more efficacy selected from the group consisting of antioxidant, inhibition of skin damage, inhibition of skin inflammation, protection of the skin barrier, and inhibition of skin photoaging. Claim 13 A pharmaceutical composition for the prevention or treatment of skin inflammation or skin photoaging induced by ultraviolet rays, comprising the fermented product of any one of claims 2 to 5 and claims 8 to 10 as an active ingredient.

Images