Inner beauty health food composition for protecting and repairing damaged skin and regenerating the skin, processed food and health functional food containing the same

Abstract

The present invention relates to an inner beauty health food composition for skin damage defense and repair and skin regeneration that includes, as active ingredients, extracts from Haematococcus, Aloe Vera, red grape, ginger, and star anise, each known to have antioxidant, skin defense, and skin regeneration effects, and arginine and glutamic acid, known to have skin structure repair and cell proliferation and growth effects, and has antioxidant, skin damage defense and repair and skin regeneration effects, processed foods and health functional foods containing the same.

Description

Technology Field

[0001] The present invention relates to an inner beauty health food composition for skin damage defense and repair and skin regeneration that includes, as active ingredients, extracts from Haematococcus, Aloe Vera, red grape, ginger, and star anise, each known to have antioxidant, skin defense, and skin regeneration effects, and arginine and glutamic acid, known to have skin structure repair and cell proliferation and growth effects, and has antioxidant, skin damage defense and repair and skin regeneration effects, processed foods and health functional foods containing the same. Background Technology

[0003] The skin plays a vital role in protecting the body and maintaining homeostasis by regulating and preserving moisture and temperature. Skin aging is a phenomenon resulting from complex biological processes, such as the decline in the regenerative capacity of skin cells, and can be classified into intrinsic aging, which occurs naturally over time, and extrinsic aging, which is caused by exposure to ultraviolet rays.

[0004] Intrinsic aging is known to be caused by factors such as immunosuppression, imbalance in epidermal homeostasis, hormonal changes, increasing age, stress, or individual genetic factors. This intrinsic aging is characterized by decreased elasticity due to a reduction in cell count, the formation of fine wrinkles resulting from structural changes in the stratum corneum caused by moisture loss, and a decrease in the subcutaneous fat layer; however, its impact on the skin is relatively mild.

[0005] On the other hand, extrinsic aging is known to be caused by oxidative stress resulting from stimulation by ultraviolet rays or external substances. In particular, Reactive Oxygen Species (ROS) generated by UV stimulation activate various transcription factors, increasing the production of cytokines associated with inflammation and enzymes that degrade matrix proteins such as collagen and elastin within the dermis, or inhibiting the synthesis of such enzymes. As these ROS lead to a decrease in matrix proteins that maintain skin tension, strength, and elasticity while providing protection, thick and deep wrinkles develop, and the skin becomes dry and loses elasticity. More than 80% of this extrinsic aging is caused by photoaging, which, induced by medium-wave ultraviolet rays (UltraViolet B, UVB), has a devastating impact on the skin, causing wrinkle formation, skin dryness, pigmentation, and peripheral vasodilation.

[0006] In this regard, extensive development and research are being conducted on antioxidants that inhibit oxidation caused by free radicals. Antioxidants are widely distributed in the animal and plant kingdoms, and well-known examples include bioactive components abundant in fruits and vegetables, tocopherol, vitamin C, and selenium. By inhibiting oxidation caused by free radicals, these antioxidants can play a role in defending the skin by preventing damage to matrix proteins that serve as skin protectors.

[0007] When the skin ages due to factors such as ultraviolet rays and stress, or is damaged by wounds, its functions weaken, and the skin regeneration process begins. The skin regeneration process starts with an acute inflammatory response, followed by the proliferation and migration of epidermal cells, and then the contraction of connective tissue through the formation of new blood vessels and collagen synthesis. During this process, the migration and proliferation of keratinocytes, which account for more than 90% of the epidermis, and dermal fibroblasts not only provide wound healing and skin regeneration but also play a crucial role in enhancing skin elasticity and forming the basement membrane by inducing collagen synthesis.

[0008] However, the reality was that naturally occurring antioxidants could not be expected to provide sufficient effects when applied to the skin. Consequently, synthetic antioxidants, which possess excellent antioxidant power and are inexpensive, are widely used; however, their use is restricted due to safety concerns, such as potential side effects on the human body.

[0009] Therefore, there was a need to develop an inner beauty health food composition derived from natural substances that is harmless to the body, possesses excellent antioxidant efficacy, and has the ability to defend against and repair skin damage caused by ultraviolet rays as well as promote skin regeneration. The problem to be solved

[0011] The present invention provides an inner beauty health food composition for skin damage protection, repair, and skin regeneration that is harmless to the body, possesses excellent antioxidant efficacy, and has the efficacy to protect against, repair, and regenerate skin damage caused by ultraviolet rays, as well as processed foods and health functional foods containing the same, in order to solve the problems of the prior art as described above.

[0012] However, the problems that the present invention aims to solve are not limited to those mentioned above, and other unmentioned problems will be clearly understood by those skilled in the art from the description below. means of solving the problem

[0014] One embodiment of the present invention for achieving the above-described purpose provides an inner beauty health food composition for skin damage protection and repair and skin regeneration, comprising extracts extracted from each of Haematococcus, Aloe Vera, red grape, ginger, and star anise as active ingredients.

[0015] The inner beauty health food composition for skin damage protection, repair, and skin regeneration according to one embodiment of the present invention may further include amino acids.

[0016] According to one embodiment of the present invention, the amino acid may comprise one or more selected from arginine, glutamic acid, and combinations thereof.

[0017] One embodiment of the present invention provides a processed food comprising the inner beauty health food composition for skin damage protection, repair, and skin regeneration.

[0018] One embodiment of the present invention provides an inner beauty health functional food for skin damage protection, repair, and skin regeneration comprising the inner beauty health food composition for skin damage protection, repair, and skin regeneration. Effects of the invention

[0020] An inner beauty health food composition for skin damage protection, repair, and skin regeneration according to one embodiment of the present invention may provide an inner beauty health food composition for skin damage protection, repair, and skin regeneration comprising, as active ingredients, extracts extracted from each of Haematococcus, Aloe Vera, Red Grape, Ginger, and Star Anise, which are known to have antioxidant, skin protection, and skin regeneration effects.

[0021] An inner beauty health food composition for skin damage protection, repair, and skin regeneration according to one embodiment of the present invention may provide an inner beauty health food composition for skin damage protection, repair, and skin regeneration comprising, as active ingredients, extracts extracted from each of Haematococcus, Aloe Vera, Red Grape, Ginger, and Star Anise, which are known to have antioxidant, skin protection, and skin regeneration effects, and amino acids.

[0022] An inner beauty health functional food for skin damage protection, repair, and skin regeneration according to one embodiment of the present invention comprises the inner beauty health food composition for skin damage protection, repair, and skin regeneration, thereby providing an inner beauty health functional food for skin damage protection, repair, and skin regeneration that is harmless to the body and possesses excellent antioxidant efficacy, as well as efficacy in protecting, repairing, and regenerating skin damage caused by ultraviolet rays.

[0023] An inner beauty processed food for skin damage protection, repair, and skin regeneration according to one embodiment of the present invention comprises the inner beauty health food composition for skin damage protection, repair, and skin regeneration, thereby being harmless to the body while enhancing the efficacy of protecting, repairing, and regenerating skin damage caused by ultraviolet rays. Brief explanation of the drawing

[0025] Figure 1 shows the toxicity to skin cells of an inner beauty health food composition for skin damage protection, repair, and skin regeneration according to one embodiment of the present invention. Figure 2 shows the protective effect against UV-induced HaCaT cell death of an inner beauty health food composition for skin damage protection, repair, and skin regeneration according to one embodiment of the present invention. Figure 3 shows the effect of an inner beauty health food composition for skin damage protection, repair, and skin regeneration according to one embodiment of the present invention on the expression of a moisturizing factor-related biomarker. Figure 4 shows the effect of an inner beauty health food composition for skin damage protection, repair, and skin regeneration according to one embodiment of the present invention on the expression of substrate-degrading enzyme-related biomarkers. FIG. 5 shows the effect of an inner beauty health food composition for skin damage protection, repair, and skin regeneration according to one embodiment of the present invention on the expression of skin barrier-related biomarkers. Specific details for implementing the invention

[0026] In this specification, when a part is described as "comprising" a certain component, this means that, unless specifically stated otherwise, it does not exclude other components but may include additional components.

[0027] In this specification, "A and / or B" means "A and B, or A or B".

[0028] In this specification, "antioxidant" refers to inhibiting cell oxidation caused by highly reactive free radicals or reactive oxygen species (ROS) due to oxidative stress resulting from intracellular metabolism or the influence of ultraviolet rays, and includes reducing cell damage caused by the removal of free radicals or reactive oxygen species.

[0029] In this specification, "skin regeneration" may encompass the phenomenon of restoring homeostasis through the formation, differentiation, and exfoliation of skin cells, as well as the phenomena and processes of each stage.

[0030] In this specification, “extraction” may mean drawing out an object from a whole. Furthermore, “extract” may mean a component or a part of a raw material drawn from a raw material, and may be a crushed material obtained by grinding the raw material, a chopped material obtained by cutting the raw material, a dried material obtained by drying the raw material, the crushed material, or the chopped material, a pressed material obtained by pressing the raw material, a concentrated material obtained by concentrating the raw material, an extract obtained by extracting a specific component from the raw material using a solvent, or a concentrated material obtained by concentrating the extract.

[0032] The present invention will be described in more detail below.

[0034] One embodiment of the present invention provides an inner beauty health food composition for skin damage protection and repair and skin regeneration, comprising extracts extracted from each of Haematococcus, Aloe Vera, red grape, ginger, and star anise as active ingredients.

[0035] An inner beauty health food composition for skin damage protection, repair, and skin regeneration according to one embodiment of the present invention is derived from natural substances, is harmless to the body, and possesses an excellent antioxidant effect, thereby preventing damage to matrix proteins that play a role in protecting the skin from ultraviolet rays, and protecting against, repairing, and regenerating skin cell damage, and increasing the gene expression of skin moisturizing factors and skin barrier factors, so as to maintain the skin's tension, strength, and elasticity.

[0036] Haematococcus pluvialis is a single-celled green freshwater algae that may be a microalgae inhabiting Arctic snowfields, oceans, lakes, etc. The Haematococcus extract contains astaxanthin and may be in powder form. The astaxanthin is known to have antioxidant and skin defense effects.

[0037] Aloe vera is a succulent plant species of the genus Aloe and an evergreen perennial plant. Although it originated in the Arabian Peninsula, it can grow wild in tropical, subtropical, and arid climates around the world. The aloe vera extract contains aloe sterol and may be in the form of a powder obtained by freeze-drying aloe vera gel. The aloe sterol is known to have antioxidant and skin regenerative effects.

[0038] Grape refers to the general term for plants of the genus Vitis or their fruit. It is a deciduous vine plant of the grape family, and varieties include the grape (V. vinifera), the American grape (V. labrusca), and hybrids. V. vinifera has diversified into cultivated types such as Southern European, Central Asian, and East Asian varieties through the process of propagation, and a total of approximately 150,000 varieties have been created to date. The above red grape extract contains resveratrol and may be in the form of a powder obtained through a concentration process following the pressing of red grapes. The above resveratrol is known to have antioxidant, skin defense, and skin regeneration effects.

[0039] Ginger (zingiber officinale) is a perennial plant belonging to the Zingiberaceae family and Zingiberales order of monocotyledonous plants, also known as Saeang or Saeyang, and is native to Southeast Asia. The ginger extract contains 10-Shogaol, a substance converted from gingerol in dried ginger, and may be in powder form. The 10-Shogaol is known to have antioxidant, skin defense, and skin regeneration effects.

[0040] Star anise is an evergreen plant belonging to the Schisandra family native to China. Its dried fruit is also called Palgak or Palgakhoehyang in China and Korea and is primarily used as a spice. It grows wild in the border regions of the Guangxi Zhuang Autonomous Region in southern China and northern Vietnam, and is widely cultivated in southern China, southern India, and Indochina. The star anise extract contains shikimic acid and may be in powder form. The shikimic acid is known to have antioxidant and skin regenerative effects.

[0041] According to one embodiment of the present invention, the extract may be obtained by extracting Haematococcus, Aloe Vera, red grape, ginger, and star anise, respectively, and then mixing them. When a complex is prepared by mixing the extracts after extracting each raw material, not only can the efficacy of the raw material be maintained, but the superiority of the efficacy can also be enhanced compared to preparing the extract after mixing the raw materials.

[0042] The above extract may be extracted from one or more selected from the group consisting of the whole plant, roots, stems, branches, leaves, seeds, and fruits of Hematococcus, Aloe Vera, red grape, ginger, or star anise. Specifically, the above extract may be derived from all or part of Hematococcus, Aloe Vera, red grape, ginger, or star anise, and may be a ground material, a chopped material, a pressed material, a concentrated material obtained by pressing each of these, a dried material obtained by drying all or part of Hematococcus, Aloe Vera, red grape, ginger, or star anise, the ground material or the chopped material, an extract obtained by extracting a specific component from all or part of Hematococcus, Aloe Vera, red grape, ginger, or star anise using a solvent, or a concentrated material obtained by concentrating the said extract.

[0044] According to one embodiment of the present invention, the inner beauty health food composition for skin damage protection, repair, and skin regeneration may comprise 10 to 60 parts by weight of the ginger extract and 1 to 70 parts by weight of the star anise extract, based on 100 parts by weight of the composition. Specifically, the ginger extract may be included in an amount of 10 to 55 parts by weight, 10 to 50 parts by weight, 10 to 45 parts by weight, 10 to 40 parts by weight, 10 to 35 parts by weight, 10 to 30 parts by weight, 10 to 25 parts by weight, 10 to 20 parts by weight, 11 to 18 parts by weight, 12 to 17 parts by weight, 13 to 16 parts by weight, or 14 to 15 parts by weight, based on 100 parts by weight of the composition. Furthermore, the star anise extract may be included in an amount of 5 to 65 parts by weight, 10 to 60 parts by weight, 10 to 55 parts by weight, 10 to 50 parts by weight, 10 to 45 parts by weight, 10 to 40 parts by weight, 10 to 35 parts by weight, 10 to 30 parts by weight, 10 to 25 parts by weight, 10 to 20 parts by weight, 11 to 18 parts by weight, 12 to 17 parts by weight, 13 to 16 parts by weight, or 14 to 15 parts by weight, based on 100 parts by weight of the composition. By including the ginger extract and the star anise extract in amounts within the above numerical ranges, antioxidant activity, protection and repair of skin damage caused by ultraviolet rays, and skin regeneration efficacy may be exhibited.

[0045] According to one embodiment of the present invention, the inner beauty health food composition for skin damage protection, repair, and skin regeneration may comprise, with respect to 100 parts by weight of the composition, 1 to 15 parts by weight of the Haematococcus extract, 1 to 15 parts by weight of the Aloe Vera extract, 1 to 40 parts by weight of the Red Grape extract, 10 to 60 parts by weight of the Ginger extract, and 1 to 70 parts by weight of the Star Anise extract. Specifically, the Haematococcus extract may be included in an amount of 1 to 14 parts by weight, 1 to 12 parts by weight, 1 to 10 parts by weight, 1 to 8 parts by weight, 1 to 6 parts by weight, 1 to 4 parts by weight, 2 to 4 parts by weight, or 2 to 3 parts by weight, with respect to 100 parts by weight of the composition. Furthermore, the aloe vera extract may be included in an amount of 1 to 14 parts by weight, 1 to 12 parts by weight, 1 to 10 parts by weight, 1 to 8 parts by weight, 1 to 6 parts by weight, 1 to 4 parts by weight, 2 to 4 parts by weight, or 2 to 3 parts by weight, based on 100 parts by weight of the composition. Additionally, the red grape extract may be in an amount of 5 to 35 parts by weight, 10 to 30 parts by weight, 10 to 25 parts by weight, 10 to 20 parts by weight, 11 to 19 parts by weight, 12 to 18 parts by weight, 13 to 17 parts by weight, or 14 to 16 parts by weight. In addition, the ginger extract may be included in an amount of 10 to 55 parts by weight, 10 to 50 parts by weight, 10 to 45 parts by weight, 10 to 40 parts by weight, 10 to 35 parts by weight, 10 to 30 parts by weight, 10 to 25 parts by weight, 10 to 20 parts by weight, 11 to 18 parts by weight, 12 to 17 parts by weight, 13 to 16 parts by weight, or 14 to 15 parts by weight, based on 100 parts by weight of the composition.Furthermore, the star anise extract may be included in an amount of 5 to 65 parts by weight, 10 to 60 parts by weight, 10 to 55 parts by weight, 10 to 50 parts by weight, 10 to 45 parts by weight, 10 to 40 parts by weight, 10 to 35 parts by weight, 10 to 30 parts by weight, 10 to 25 parts by weight, 10 to 20 parts by weight, 11 to 18 parts by weight, 12 to 17 parts by weight, 13 to 16 parts by weight, or 14 to 15 parts by weight, based on 100 parts by weight of the composition. By including the extract in an amount within the above numerical range, the inner beauty health food composition for skin damage protection, repair, and skin regeneration can achieve excellent antioxidant effects, as well as efficacy in protecting against and repairing skin damage caused by ultraviolet rays and skin regeneration.

[0047] According to one embodiment of the present invention, the inner beauty health food composition for skin damage protection, repair, and skin regeneration further comprises an amino acid, and the amino acid may be arginine and glutamic acid. By further including the arginine and glutamic acid, the antioxidant activity and skin protection effect of the inner beauty health food composition for skin damage protection, repair, and skin regeneration are enhanced, thereby protecting against and repairing skin damage caused by ultraviolet rays and exhibiting excellent skin regeneration efficacy.

[0048] Arginine is an α-amino acid used in the biosynthesis of proteins and is known to have antioxidant enzyme activity, repair of skin structures, and efficacy in cell proliferation and growth.

[0049] Glutamic acid is an α-amino acid used in the biosynthesis of proteins and is known to have efficacy in repairing skin structures and promoting cell proliferation and growth.

[0051] According to one embodiment of the present invention, the inner beauty health food composition for skin damage protection, repair, and skin regeneration may contain arginine and glutamic acid in a weight ratio of 2.34:1 to 4:1, specifically, 2.5:1 to 3.7:1, 2.7:1 to 3.5:1, 2.9:1 to 3.3:1, or 2.9:1 to 3.1:1. By including arginine and glutamic acid in the above weight ratios, the efficacy of the inner beauty health food composition for skin damage protection, repair, and skin regeneration in repairing skin structures and in the proliferation and growth of cells may be enhanced.

[0053] According to one embodiment of the present invention, the inner beauty health food composition for skin damage protection, repair, and skin regeneration may include extracts extracted from Haematococcus, Aloe Vera, red grape, ginger, and star anise, respectively, and amino acids in a weight ratio of 0.73:1 to 1.26:1, specifically, 0.80:1 to 1.20:1, 0.90:1 to 1.10:1, or 0.95:1 to 1.00:1. By including the extracts and amino acids in the above weight ratios, excellent antioxidant and skin structure repair effects can be achieved.

[0055] According to one embodiment of the present invention, the inner beauty health food composition for skin damage protection, repair, and skin regeneration may comprise, based on 100 parts by weight of the composition, 1 to 5 parts by weight of Haematococcus extract, 1 to 5 parts by weight of aloe vera extract, 10 to 20 parts by weight of red grape extract, 10 to 20 parts by weight of ginger extract, 10 to 20 parts by weight of star anise extract, 10 to 40 parts by weight of arginine, and 10 to 40 parts by weight of glutamic acid.Specifically, the Haematococcus extract may be included in an amount of 2 to 4 parts by weight or 2 to 3 parts by weight per 100 parts by weight of the composition, the aloe vera extract may be included in an amount of 2 to 4 parts by weight or 2 to 3 parts by weight per 100 parts by weight of the composition, the red grape extract may be included in an amount of 11 to 19 parts by weight, 12 to 18 parts by weight, 12 to 17 parts by weight, 13 to 16 parts by weight, or 14 to 15 parts by weight per 100 parts by weight of the composition, the ginger extract may be included in an amount of 11 to 19 parts by weight, 12 to 18 parts by weight, 12 to 17 parts by weight, 13 to 16 parts by weight, or 14 to 15 parts by weight per 100 parts by weight of the composition, and the star anise extract may be included in an amount of 11 to 19 parts by weight, 12 The composition may be included in an amount of 18 to 18 parts by weight, 12 to 17 parts by weight, 13 to 16 parts by weight, or 14 to 15 parts by weight, and the arginine may be included in an amount of 15 to 40 parts by weight, 20 to 40 parts by weight, 25 to 40 parts by weight, 30 to 40 parts by weight, 35 to 40 parts by weight, 36 to 39 parts by weight, or 37 to 38 parts by weight, based on 100 parts by weight of the composition, and the glutamic acid may be in an amount of 10 to 35 parts by weight, 10 to 30 parts by weight, 10 to 25 parts by weight, 10 to 20 parts by weight, 10 to 15 parts by weight, 11 to 14 parts by weight, or 12 to 13 parts by weight, based on 100 parts by weight of the composition. By including the above extract, arginine, and glutamic acid in the above numerical range, the inner beauty health food composition for skin damage defense, repair, and skin regeneration has an excellent antioxidant effect and can achieve skin damage defense, repair, and skin regeneration effects.

[0057] One embodiment of the present invention provides a processed food comprising the inner beauty health food composition for skin damage protection, repair, and skin regeneration.

[0058] An inner beauty processed food for skin damage protection, repair, and skin regeneration according to one embodiment of the present invention comprises the inner beauty health food composition for skin damage protection, repair, and skin regeneration, thereby being harmless to the body while enhancing the efficacy of protecting, repairing, and regenerating skin damage caused by ultraviolet rays.

[0059] According to one embodiment of the present invention, the content of the inner beauty health food composition for skin damage protection, repair, and skin regeneration in the inner beauty processed food for skin damage protection, repair, and skin regeneration may be 0.0001 to 99 parts by weight per 100 parts by weight of the inner beauty processed food for skin damage protection, repair, and skin regeneration. By controlling the content of the inner beauty health food composition for skin damage protection, repair, and skin regeneration in the inner beauty processed food for skin damage protection, repair, and skin regeneration within the above-described range, the antioxidant efficacy can be enhanced while remaining harmless to the body.

[0060] According to one embodiment of the present invention, the inner beauty processed food for skin damage protection, repair, and skin regeneration may further include collagen. As described above, by further including collagen in the inner beauty processed food for skin damage protection, repair, and skin regeneration, the antioxidant efficacy can be enhanced while remaining harmless to the body.

[0061] According to one embodiment of the present invention, the content of collagen in the inner beauty processed food for skin damage protection, repair, and skin regeneration may be 0.0001 to 99 parts by weight per 100 parts by weight of the inner beauty processed food for skin damage protection, repair, and skin regeneration. By controlling the content of collagen in the inner beauty processed food for skin damage protection, repair, and skin regeneration within the above-described range, the antioxidant efficacy can be enhanced while remaining harmless to the body.

[0062] According to one embodiment of the present invention, the inner beauty processed food for skin damage protection, repair, and skin regeneration may have a formulation selected from the group consisting of powder, granule, tablet, capsule, pill, gel, jelly, suspension, emulsion, syrup, tea bag, infusion tea, gum, candy, and health drink.

[0063] One embodiment of the present invention provides an inner beauty health functional food for skin damage protection, repair, and skin regeneration comprising the inner beauty health food composition for skin damage protection, repair, and skin regeneration.

[0064] An inner beauty health functional food for skin damage protection, repair, and skin regeneration according to one embodiment of the present invention can provide antioxidant, skin damage protection, repair, and skin regeneration effects.

[0065] According to one embodiment of the present invention, in the inner beauty health functional food for skin damage protection, repair, and skin regeneration, the content of the inner beauty health food composition for skin damage protection, repair, and skin regeneration may be 0.0001 to 99 parts by weight per 100 parts by weight of the inner beauty processed food for skin damage protection, repair, and skin regeneration. By controlling the content of the inner beauty health food composition for skin damage protection, repair, and skin regeneration within the above-described range, excellent antioxidant effects and skin wrinkle improvement effects can be achieved.

[0066] According to one embodiment of the present invention, the inner beauty health functional food for skin damage protection, repair, and skin regeneration may further include collagen. As described above, by further including collagen in the inner beauty health functional food for skin damage protection, repair, and skin regeneration, the antioxidant efficacy can be enhanced while remaining harmless to the body.

[0067] According to one embodiment of the present invention, the content of collagen in the inner beauty health functional food for skin damage protection, repair, and skin regeneration may be 0.0001 to 99 parts by weight per 100 parts by weight of the inner beauty health functional food for skin damage protection, repair, and skin regeneration. By controlling the content of collagen in the inner beauty health functional food for skin damage protection, repair, and skin regeneration within the above-described range, excellent antioxidant effects and skin wrinkle improvement effects can be achieved.

[0068] According to one embodiment of the present invention, the inner beauty health functional food for skin damage protection, repair, and skin regeneration may have a formulation selected from the group consisting of powder, granule, tablet, capsule, pill, gel, jelly, suspension, emulsion, syrup, tea bag, infusion tea, gum, candy, and health drink.

[0070] In this specification, "inner beauty" refers to cultivating healthy skin from the inside out and may be a general term for edible cosmetics, and "inner beauty food" may be an example of a health food.

[0071] In this specification, "health food" or "health functional food" may refer to a general term for foods effective for promoting health.

[0072] In one embodiment of the present invention, the composition can be used in various ways, and products that can be manufactured containing the composition include various processed foods, health supplements, health functional foods, etc., and may be included in an amount of 0.0001% to 99.0% by weight relative to the total weight.

[0073] One example of a food containing the composition of the present invention may be a collagen processed food.

[0075] There are no special restrictions on the types of food products mentioned above. Examples of food products to which the above composition may be added include formulations selected from the group consisting of powders, granules, tablets, capsules, pills, gels, jellies, suspensions, emulsions, syrups, tea bags, infused teas, gum, candies, and health drinks.

[0076] The above health drink composition may include various sweeteners, flavorings, or natural carbohydrates as additional ingredients, as in ordinary beverages. The sweetener may be a natural sweetener or a synthetic sweetener. The natural sweetener may be thaumatin or stevia extract, and the synthetic sweetener may be saccharin or aspartame.

[0077] The above natural carbohydrate may be monosaccharide, disaccharide, polysaccharide, xylitol, sorbitol, or erythritol. The above monosaccharide may be glucose or fructose, and the disaccharide may be maltose or sucrose. The polysaccharide may be dextrin or cyclodextrin.

[0078] The above processed food or health functional food may include food-grade acceptable food additives and may include a suitable carrier commonly used in the manufacture of health foods.

[0079] In addition to the above, the composition of the present invention may include various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. Furthermore, the composition of the present invention may include fruit pulp for the production of natural fruit juices, fruit juice beverages, and vegetable beverages. These ingredients may be used independently or in combination.

[0081] Preferred embodiments are presented below to aid in understanding the present invention. However, the following embodiments are provided merely to facilitate a better understanding of the invention and do not limit the scope of the invention.

[0083] <Preparation Example: Component Analysis of Each Extract and Selection of Blending Ratios>

[0084] In order to prepare an inner beauty health food composition for skin damage defense, repair, and skin regeneration containing five types of extracts extracted from Haematococcus, Aloe Vera, red grape, ginger, and star anise as active ingredients, the components of each extract were analyzed and possible formulation ratios were derived.

[0085] In this specification, "mixing ratio" may mean "weight ratio" and may be indicated so that the sum is 1.

[0087] Preparation Example 1. Confirmation of total polyphenol content and total flavonoid content of extracts obtained from Haematococcus, Aloe Vera, red grape, ginger, and star anise, respectively.

[0088] The Total Phenolic Contents (TPC) and Total Flavonoid Contents (TFC) of each extract sample from Haematococcus, Aloe Vera, red grape, ginger, and star anise were determined.

[0089] The total polyphenol content was measured by applying the Folin-Denis method. After preparing gallic acid and each sample, 0.01 mL of sample was mixed with 0.79 mL of tertiary distilled water, followed by the addition and mixing of 0.15 mL of 20% sodium carbonate solution. Then, 0.05 mL of 0.9 N Folin-Ciocalteu was added, and the mixture was reacted in a dark room at room temperature for 30 minutes. Subsequently, 200 μL aliquots were dispensed into microplates, and the absorbance was measured at 750 nm using a microplate reader (INNO-M, LTek, Korea). The average absorbance and mg / mL concentration of each gallic acid were plotted to create a standard curve, and the total polyphenol content of each sample was calculated. The results are shown in Table 1 below.

[0090] After preparing catechin and each extract sample, 50 μL of each sample was dispensed into a microplate, 30 μL of 5% NaNO2 was added and mixed, and the mixture was reacted in the dark for 5 minutes. 60 μL of 2% AlCl3 was additionally added and mixed, and the mixture was reacted in the dark for 6 minutes. Then, 100 μL of 4% NaOH was added and mixed, and the mixture was reacted in the dark for 11 minutes. Once the reaction was complete, the absorbance was measured at 510 nm using a microplate reader (INNO-M, LTek, Korea). The average absorbance and mg / mL concentration of each catechin were plotted to create a standard curve, and the total flavonoid content of each sample was calculated. The results are shown in Table 1 below.

[0091] Haematococcus, aloe vera, and red grape extracts were dissolved at a concentration of 100 mg / mL and ginger and star anise extracts were dissolved at a concentration of 50 mg / mL.

[0092] Sample Total polyphenol content (mg GAE / g) Total flavonoid content (mg CE / g) Haematococcus extract 1.63 ± 0.10 1.12 ± 0.004 Aloe vera extract 0 ± 0 0 ± 0 red grape extract 1.579 ± 0.327 0.34 ± 0.003 ginger extract 18.77 ± 0.47 7.64 ± 0.21 Star anise extract 30.06 ± 0.10 17.18 ± 0.72

[0093] As shown in Table 1 above, it was confirmed that the total polyphenol content and total flavonoid content of ginger extract and star anise extract were higher than those of other extracts. From these results, it can be expected that the ginger extract and star anise extract will have a greater effect on antioxidant activity than other extracts.

[0095] Preparation Example 2. Selection of mixing ratios for five types of extracts extracted from Haematococcus, Aloe Vera, Red Grape, Ginger, and Star Anise, respectively

[0096] The optimal formulation ratio of five types of extracts extracted from Haematococcus, Aloe Vera, red grape, ginger, and star anise, respectively, was designed. Specifically, the appropriate formulation ratio of the five types of extracts was designed using Response Surface Methodology (RSM). Response Surface Methodology is a type of statistical analysis method that predicts results at the level of an arbitrary variable within the entire region of interest and optimizes the variable level to obtain the desired result. In order to set the condition with maximum antioxidant efficacy as the optimal condition, the independent variables for utilizing the Response Surface Methodology were set as Haematococcus extract, Aloe Vera extract, red grape extract, ginger extract, and star anise extract.

[0097] Among the 36 formulations obtained through response surface analysis, six formulations containing all five types of extracts and one formulation in which the ratio of the five types of extracts was appropriately adjusted to contain ginger extract and star anise extract in a certain ratio are shown in Table 2 below, and among these, three formulations expected to have the best antioxidant effect were selected and are shown in Table 3 below.

[0098] Haematococcus extract Aloe vera extract red grape extract ginger extract Star anise extract 1 0.6 0.1 0.1 0.1 0.1 2 0.1 0.6 0.1 0.1 0.1 3 0.1 0.1 0.6 0.1 0.1 4 0.1 0.1 0.1 0.6 0.1 5 0.1 0.1 0.1 0.1 0.6 6 0.2 0.2 0.2 0.2 0.2 7 0.05 0.05 0.3 0.3 0.3

[0099] Haematococcus extract Aloe vera extract red grape extract ginger extract Star anise extract 4 0.1 0.1 0.1 0.6 0.1 5 0.1 0.1 0.1 0.1 0.6 7 0.05 0.05 0.3 0.3 0.3

[0100] To select the optimal formulation among the three formulations in Table 3, the electron donating capacity by ABTS was measured. Specifically, ABTS (2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) radical scavenging activity is a method of measuring the degree to which a blue-green ABTS solution turns colorless by absorbance as cationic radicals generated by the reaction of ABTS with potassium persulfate are scavenged by an antioxidant substance.

[0101] The ABTS reagent was prepared by diluting 7 mM ABTS (2,2'-Azino-bis(3-etl1ylbenzothiazaline-6-sulfonic acid) Diammonium salt) with a 2.45 mM potassium persulfate solution 1:1, storing the solution in the dark for 24 hours, and then using it. The sample was dissolved in distilled water at a concentration of 1 mg / mL. After dispensing 10 μL of the sample into a 96-well plate, 200 μL of ABTS reagent was added and mixed. The reaction was allowed to proceed in the dark for 30 minutes, after which the absorbance of the reaction solution was measured at 414 nm. Ascorbic acid was used as the control. ABTS radical scavenging activity was expressed as AAE (ascorbic acid equivalent) by converting the difference in absorbance between the reaction solution and the control into a percentage, and the standard deviation (SD) is also shown in Table 4 below.

[0102] mg AAE / g SD 4 22.37 1.14 5 20.83 0.10 7 30.79 2.52

[0103] To select the optimal formulation among the three formulations in Table 3, the electron donating capacity was measured by FRAP.

[0104] Specifically, Ferric reducing / antioxidant power (FRAP) activity (reducing power) is mediated by antioxidants at low pH to trivalent iron cations (Fe 3+ ) is a divalent iron cation (Fe 2+This is a method for measuring the sulfation activity of a sample by utilizing the characteristic of being reduced to ).

[0106] The FRAP reagent was prepared by diluting 300 mM acetate buffer (pH 3.6), 10 mM TPTZ in 40 mM HCl, and 20 mM Iron(III) chloride hexahydrate (FeCl3-6H2O) in a ratio of 10:1:1, and the sample was dissolved in DMSO at a concentration of 1 mg / mL. 10 μL of each sample was dispensed into a microplate, followed by the addition of 200 μL of FRAP reagent and mixing. After reacting in a 37 ℃ incubator for 5 minutes, the absorbance was measured at 593 nm using a microplate reader (INNO-M, LTek, Korea). Ascorbic acid was used as the control group. The average absorbance and μg / mL concentration of ascorbic acid were plotted to form a standard curve, and the difference in absorbance between the groups without and with added samples, expressed as mg ascorbic acid (AAE) per 1 g of sample, is shown in Table 5 below.

[0107] mg AAE / g SD 4 15.24 0.90 5 21.99 0.47 7 34.50 1.30

[0108] As shown in Tables 4 and 5 above, it was confirmed that formulation No. 7 had superior antioxidant activity compared to formulations No. 4 and 5.

[0109] In particular, it was confirmed that formulation No. 7 exhibited antioxidant activity similar to or superior to formulations No. 4 and 5, while having a low total content of ginger extract and star anise extract.

[0111] Preparation Example 3. Selection of mixing ratio of 2 types of amino acids and mixing with 5 types of extracts

[0112] To prepare an inner beauty composition for skin damage protection, repair, and regeneration that further includes two types of amino acids, arginine and glutamic acid, in a composition containing five types of extracts at a formulation ratio of 7, the formulation ratio of the two types of amino acids was selected. Specifically, the appropriate formulation ratio of the two types of amino acids was designed using Response Surface Methodology (RSM). In order to set the condition that maximizes the skin damage protection, repair, and regeneration effects as the optimal condition, arginine and glutamic acid were set as the independent variables for utilizing the Response Surface Methodology.

[0113] The specific mixing ratios are shown in Table 6 below.

[0114] Arginine glutamic acid 1 0.25 0.75 2 0.5 0.5 3 0.75 0.25

[0115] The formulation ratios of a composition comprising five types of extracts mixed in formulation ratio 7 and an inner beauty health food composition for skin damage defense, repair, and skin regeneration comprising two types of amino acids mixed in a 1:1 ratio are shown in Table 7 below.

[0116] Haematococcus extract Aloe vera extract red grape extract ginger extract Star anise extract Arginine glutamic acid Example 1 0.025 0.025 0.15 0.15 0.15 0.125 0.375 Example 2 0.025 0.025 0.15 0.15 0.15 0.25 0.25 Example 3 0.025 0.025 0.15 0.15 0.15 0.375 0.125

[0117] <Example>

[0118] Example 1

[0119] An inner beauty health food composition for skin damage defense and repair and skin regeneration was prepared by mixing Haematococcus extract, aloe vera extract, red grape extract, ginger extract, star anise extract, arginine, and glutamic acid in a mixing ratio of 0.025 : 0.025 : 0.15 : 0.15 : 0.15 : 0.125 : 0.375.

[0120] Example 2

[0121] An inner beauty health food composition for skin damage protection, repair, and skin regeneration was prepared in the same manner as in Example 1, except that the mixing ratio in Example 1 was changed to 0.025 : 0.025 : 0.15 : 0.15 : 0.15 : 0.25 : 0.25.

[0122] Example 3

[0123] An inner beauty health food composition for skin damage protection, repair, and skin regeneration was prepared in the same manner as in Example 1, except that the mixing ratio in Example 1 was changed to 0.025 : 0.025 : 0.15 : 0.15 : 0.15 : 0.375 : 0.125.

[0125] <Experimental Example>

[0126] ingredient

[0127] The HaCaT cells used in this experiment were obtained from Amorepacific. For cell culture, Dulbecco's modified Eagle's medium (DMEM), Fetal bovine serum (FBS), penicillin-streptomycin (PS), and phosphate-buffered saline (PBS) were purchased from Welgene (Daegu, Korea). 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was purchased from Sigma-Aldrich (St. Louis, MO, USA). The Mazime RT PreMix Kit was purchased from Gene-All Biotechnology Co. Ltd. (Geneall Bldg, Ogum-dong, Songpa-gu, Seoul, South Korea). Trizol and SYBR Green Master primers were purchased from Thermo Fisher Scientific (USA).

[0129] Experimental Example 1. Cytotoxicity Evaluation

[0130] The presence or absence of cytotoxicity and the effect on cell viability after UV irradiation of the inner beauty health food composition for skin damage defense, repair, and regeneration prepared in the example were measured. Specifically, an MTT assay was performed to confirm the presence or absence of cytotoxicity of the composition. The MTT assay is a cell viability test method that measures the activity of mitochondria within cells using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), a type of tetrazolium salt.

[0131] In this specification, "NOR" refers to a sample treated with distilled water without irradiating with ultraviolet light, and "CON" may refer to a sample treated with distilled water after irradiating with ultraviolet light.

[0132] Human epithelial keratinocyte (HaCaT) cells are cultured in DMEM medium containing 10% FBS and 1% PS, and the cells are maintained by subculture when a cell density of 70% is reached. Skin cells are 1.5 x 10 4 ~ 1.0 x 10 5 Cells were seeded into a 96-well plate at a density of cells / well and cultured for 24 hours. After treating with samples at different concentrations, the cells were cultured again for 24 hours to ensure sufficient reaction. After 24 hours, the medium was replaced with serum-free medium containing MTT reagent (0.5 mg / mL) and incubated at 37°C for 1 hour. After removing the medium, DMSO was added to each well to dissolve MTT formazan, and the absorbance was measured at 550 nm (Spectra Max M3; Molecular Devices, Sunnyvale, CA, USA).

[0133] Figure 1 shows the toxicity to skin cells of an inner beauty health food composition for skin damage protection, repair, and skin regeneration according to one embodiment of the present invention.

[0134] No toxicity to skin cells was observed in any of the compositions of Examples 1 to 3 within the concentration range of 12.5 μg / ml to 800 μg / ml. In Example 3, cell viability of more than 90% was observed at all concentrations compared to the control group (CON) treated only with distilled water, indicating that there was almost no cytotoxicity to skin cells.

[0136] Experimental Example 2. Measurement of cell protective effect upon UV irradiation

[0137] The effect of the inner beauty health food composition for skin damage defense, repair, and regeneration prepared in the examples on UV-induced apoptosis was measured. Specifically, the method involves measuring the cell-protective effect of the composition under conditions where skin cells are killed by UV irradiation.

[0138] 1.0 x 10 skin cells 5 Seeds are dispensed into 6 wells at a density of cells / well and cultured for 24 hours. Subsequently, the samples of Examples 1 to 3 are dissolved in the medium at various concentrations and treated while exchanging the medium; after 2 hours, the medium is removed and replaced with PBS buffer at 30 mJ / cm². 2 UV irradiation was performed at an intensity of 30 to 35 seconds. Afterward, the PBS was replaced with the medium containing the sample, and the cells were cultured for 24 hours. After 24 hours, the cells were harvested and RNA was extracted. The absorbance of the extracted RNA was measured at 550 nm using Molecular Devices (Spectra Max M3; Sunnyvale, CA, USA).

[0140] Figure 2 shows the protective effect against UV-induced HaCaT cell death of an inner beauty health food composition for skin damage protection, repair, and skin regeneration according to one embodiment of the present invention.

[0141] As shown in Figure 2, the inner beauty health food composition for skin damage protection, repair, and regeneration can prevent apoptosis by increasing the survival rate of cells reduced by UV irradiation. Specifically, the cell viability of skin cells in the control group treated with distilled water due to UV irradiation decreased by about 50% compared to the sample treated with distilled water without UV irradiation (NOR), indicating that apoptosis was induced. Under these UV irradiation conditions, it can be confirmed that all three samples of the examples exhibit an effect of inhibiting UV-induced apoptosis as the concentration increases.

[0142] When compared based on a concentration of 400 μg / ml, the cell viability of Example 1 increased by 23.7% compared to the control group, Example 2 by 23.5%, and Example 3 by 50.9%. Among the three formulations of the examples, the cell protection effect against ultraviolet rays in Example 3 was the most superior, and thus the effects on skin damage defense, repair, and skin regeneration according to the concentration of Example 3 were confirmed.

[0144] Experimental Example 3. Measurement of Biomarkers

[0145] HaCat cells were treated with 100 μg / ml, 200 μg / ml, and 400 μg / ml of the inner beauty health food composition for skin damage defense, repair, and skin regeneration according to Example 3, and biomarkers were measured. Specifically, the effects of the composition on biomarkers related to moisturizing factors (collagen, hyaluronic acid), biomarkers related to matrix metalloproteinases (MMPs), and biomarkers related to skin barrier factors (Filaggrin, Loricrin, Involucrin) were analyzed.

[0146] Total RNA was extracted from the recovered cells using the TRIzol reagent according to the provided protocol. After quantifying the total RNA, cDNA was synthesized using the Maxime RT PreMix Kit, which contains 1 µg of reverse transcriptase. The synthesized cDNA was mixed with SYBR Green PCR Master Mix and primers (100 ng / mL) to perform the PCR reaction. The PCR reaction was conducted using the AriaMX Real-Time PCR system (Agilent Technology, Santa Clara, CA USA).

[0147] The primers used in this experiment are shown in Table 8 below.

[0148] gene No. Primer name Primer sequence (5' to 3') Length (bp) Access number MMP1 1 MMP1_F ATGAAGCAGCCCAGATGTGGAG 22 NM_001297436.2 MMP1_R TGGTCCACATCTGCTCTTGGCA 22 　 MMP2 2 983_F TGCTACACGGATACCCCAAG 20 NM_004530 1055_R GCAGCATCGATATGCTTCACAG 22 　 HAS1 3 HAS1_F CTGCGATACTGGGTAGCCTTCA 22 NM_001523.4 HAS1_R CCAGGAACTTCTGGTTGTACCAG 23 　 HYAL1 4 369F GGCCAGGGCTTCCTCAAATA 20 XM_054346414.1 446R CTGTGACAGTGGCTGAGTGT 20 　 FLG 5 FLG_F GCTGAAGGAACTTCTGGAAAAGG 23 NM_002016 FLG_R GTTGTGGTCTATATCCAAGTGATC 24 　 COL1a1 6 COL_F GATTCCCTGGACCTAAAGGTGC 22 NM_000088 COL_R AGCCTCTCCATCTTTGCCAGCA 22 　 involucrin 7 IVL_F CTGCCTCAGCCTTACTGTGA 20 NM_002016 IVL_R GGAGGAACAGTCTTGAGGAG 20 　 loricrin 8 LRC_F GCAAACCTCGGGTAGCATCA 20 NM_002016 LRC_R GCCGTCCAAATAGATCCCCC 20

[0149] FIG. 3 shows the effect of an inner beauty health food composition for skin damage protection, repair, and skin regeneration according to one embodiment of the present invention on the expression of moisturizing factor-related biomarkers. Moisturizing factors may include collagen and hyaluronic acid, and the effect of the inner beauty health food composition for skin damage protection, repair, and skin regeneration on the expression levels of Collagen-1, a collagen-related biomarker; HAS, a hyaluronic acid-related biomarker; and HYAL, a hyaluronic acid degrading enzyme-related biomarker can be confirmed.

[0150] In the case of collagen-related biomarkers (Collagen-1) and hyaluronic acid-related biomarkers (HAS), the expression levels in the control group decreased by 24.8% and 27.3%, respectively, due to UV irradiation, and it was confirmed that the expression levels increased in a concentration-dependent manner when treated with the inner beauty health food composition for skin damage protection, repair, and skin regeneration. From this, it can be confirmed that the inner beauty health food composition for skin damage protection, repair, and skin regeneration of the example can repair and regenerate collagen and hyaluronic acid that have decreased due to skin cell damage caused by UV irradiation.

[0151] In the case of the hyaluronic acid degrading enzyme-related biomarker (HYAL), the expression level in the control group increased compared to NOR due to UV irradiation, and it was confirmed that the expression level decreased in a concentration-dependent manner upon treatment with the inner beauty health food composition for skin damage protection, repair, and regeneration. From this, it can be confirmed that the inner beauty health food composition for skin damage protection, repair, and regeneration of the example can protect against skin damage by reducing the hyaluronic acid degrading enzyme that increased due to skin cell damage caused by UV irradiation.

[0153] Figure 4 shows the effect of an inner beauty health food composition for skin damage protection, repair, and skin regeneration according to one embodiment of the present invention on the expression of substrate-degrading enzyme-related biomarkers. Matrix metalloproteinases (MMPs), which are one of the major factors regulating the inflammatory response of the skin, are known as substrate-degrading enzymes that cause skin aging, such as wrinkles, by hydrolyzing extracellular matrix (ECM) and basement membrane protein components secreted from skin keratinocytes, fibroblasts, etc. In the control group, the expression levels of MMP-1 and MMP-2, which are substrate-degrading enzyme-related biomarkers, significantly increased due to UV irradiation compared to NOR, increasing by 3.2 times and 2.4 times, respectively.

[0154] On the other hand, when the inner beauty health food composition for skin damage protection, repair, and regeneration was treated at 100, 200, and 400 μg / ml, the expression of MMP-1 decreased by 28.3%, 54.63%, and 56.47%, respectively. MMP-2 showed a similar trend, and when treated at 400 μg / ml of the inner beauty health food composition for skin damage protection, repair, and regeneration of the example, it showed a 41% decrease in gene expression. As described above, it can be confirmed that the inner beauty health food composition for skin damage protection, repair, and regeneration of the example has skin cell regenerative efficacy by increasing the motility and proliferation of skin cells, inducing changes in the cell cycle of skin cells, and inhibiting the expression of Matrix Metalloproteinase (MMP) genes involved in the hydrolysis of proteins such as extracellular matrix related to skin aging. In addition, the inner beauty health food composition for skin damage defense, repair, and skin regeneration of the example can be seen as defending against and repairing skin damage by reducing the expression of MMPs that decompose the skin matrix when skin cells are damaged by ultraviolet irradiation.

[0156] FIG. 5 shows the effect of an inner beauty health food composition for skin damage defense, repair, and skin regeneration according to one embodiment of the present invention on the expression of skin barrier-related biomarkers. Skin barrier-related biomarkers may include Filaggrin, Loricrin, and Involucrin, which are core proteins constituting the skin barrier as skin barrier factors, and the effect of the inner beauty health food composition for skin damage defense, repair, and skin regeneration on their gene expression can be confirmed.

[0157] The expression levels of all three types of skin barrier proteins were significantly reduced compared to the NOR when the control group was irradiated with UV rays, and the gene expression of the three types of skin barrier proteins increased in a concentration-dependent manner when treated with the inner beauty health food composition for skin damage protection, repair, and skin regeneration. The gene expression of Filaggrin, Loricrin, and Involucrin increased by 54.7%, 38.5%, and 50.5%, respectively, compared to the control group when treated with 400 μg / ml of the inner beauty health food composition for skin damage protection, repair, and skin regeneration according to the example. From this, it can be confirmed that the inner beauty health food composition for skin damage protection, repair, and skin regeneration according to the example can repair and regenerate the skin barrier, which may be damaged by UV irradiation, through the increase in gene expression of Filaggrin, Loricrin, and Involucrin.

Claims

Claim 1 An inner beauty health food composition for defending against and repairing skin damage caused by ultraviolet rays and for skin regeneration, comprising, as active ingredients, extracts extracted from Haematococcus, Aloe Vera, red grape, ginger, and star anise, respectively, and amino acids, wherein, based on 100 parts by weight of the composition, the composition comprises 2 to 3 parts by weight of Haematococcus extract, 2 to 3 parts by weight of Aloe Vera extract, 11 to 19 parts by weight of red grape extract, 11 to 19 parts by weight of ginger extract, 11 to 19 parts by weight of star anise extract, 35 to 40 parts by weight of arginine, and 10 to 15 parts by weight of glutamic acid, and wherein the extracts and amino acids are included in a weight ratio of 0.90:1 to 1.10:

1. Claim 2 delete Claim 3 delete Claim 4 An inner beauty processed food for protecting against and repairing skin damage caused by ultraviolet rays and for skin regeneration, comprising an inner beauty health food composition for protecting against and repairing skin damage caused by ultraviolet rays and for skin regeneration according to claim 1. Claim 5 In paragraph 4, the inner beauty processed food for protecting against and repairing skin damage caused by ultraviolet rays and for skin regeneration further comprises collagen. Claim 6 In claim 5, the collagen content is 0.0001 to 99.0 parts by weight per 100 parts by weight of the inner beauty processed food for defense against and repair of skin damage caused by ultraviolet rays and skin regeneration. Claim 7 In claim 6, the inner beauty processed food for protecting against and repairing skin damage caused by ultraviolet rays and for skin regeneration has a formulation selected from the group consisting of powders, granules, tablets, capsules, pills, gels, jellies, suspensions, emulsions, syrups, tea bags, infused teas, gum, candies, and health drinks. Claim 8 An inner beauty health functional food for protecting against and repairing skin damage caused by ultraviolet rays and for skin regeneration, comprising an inner beauty health food composition for protecting against and repairing skin damage caused by ultraviolet rays and for skin regeneration according to claim 1. Claim 9 In claim 8, the inner beauty health functional food for protecting against and repairing skin damage caused by ultraviolet rays and for skin regeneration further comprises collagen. Claim 10 In claim 9, the content of the collagen is 0.0001 to 99.0 parts by weight per 100 parts by weight of the inner beauty health functional food for protecting against and repairing skin damage caused by ultraviolet rays and for skin regeneration. Claim 11 In claim 10, the inner beauty health functional food for protecting against and repairing skin damage caused by ultraviolet rays and for skin regeneration has a formulation selected from the group consisting of powders, granules, tablets, capsules, pills, gels, jellies, suspensions, emulsions, syrups, tea bags, infused teas, gum, candies, and health drinks.

Images