Cosmetic composition comprising centella asiatica extract containing high content of mineral

Abstract

The present invention relates to a cosmetic composition containing a Centella asiatica extract containing a high content of minerals. Specifically, the invention relates to a technology for producing a Centella asiatica extract containing a high content of minerals by applying an ultrasonic extraction method after acid hydrolysis pretreatment, and utilizing this as a cosmetic for skin barrier strengthening, skin regeneration, and skin moisturization.

Description

Technology Field

[0001] The present invention relates to a cosmetic composition containing a Centella asiatica extract containing a high content of minerals. Specifically, the invention relates to a technology for producing a Centella asiatica extract containing a high content of minerals by applying an ultrasonic extraction method after acid hydrolysis pretreatment, and utilizing this as a cosmetic for skin barrier strengthening, skin regeneration, and skin moisturization. Background Technology

[0002] In the modern dermatology and cosmetics industries, there is a rapidly increasing demand for functional ingredients that protect the skin from harmful external environments and promote the recovery of damaged skin. In particular, damage to the lipid and protein layers that constitute the skin barrier leads to increased moisture evaporation and the penetration of pathogens, causing various skin conditions such as dry skin, atopic dermatitis, and rosacea.

[0003] Centella asiatica is a plant native to India, Southeast Asia, and Korea, and has been used since ancient times as a medicinal plant for its wound-healing and anti-inflammatory effects. Its major active ingredients include madecassoside, asiaticoside, madecassic acid, and asiatic acid, which are well known. Furthermore, the utilization of Centella asiatica has focused on these components. In contrast, systematic research on the extraction and functional applications of mineral components present in Centella asiatica, such as calcium, magnesium, zinc, and potassium, is currently lacking.

[0004] Studies have reported that mineral components can also have a positive effect on skin health. In particular, minerals such as magnesium (Mg), calcium (Ca), zinc (Zn), and selenium (Se) have been found to contribute to skin moisture retention, intercellular lipid formation, antioxidant defense systems, and strengthening of skin barrier function (Int. J. Mol. Sci. 2022, 23(11), 6267).

[0005] Existing Centella asiatica extraction processes rely primarily on hot water or organic solvent extraction methods, so there is no verification regarding the extraction of inorganic ions such as minerals. Furthermore, even if extraction is successful, there are disadvantages such as low efficiency and unsuitability for mass production.

[0006] Accordingly, the inventors investigated a method for efficiently extracting and utilizing minerals present in Centella asiatica. As a result, they confirmed that when Centella asiatica is extracted while irradiating with ultrasound following acid hydrolysis treatment under specific conditions, a Centella asiatica extract containing a high amount of minerals can be obtained, exhibiting excellent skin barrier strengthening, skin regeneration promotion, and skin moisturizing activity, thereby completing the present invention. Prior art literature

[0007] (001) Republic of Korea Published Patent No. 10-2025-0106860 (2025.07.11)(002) Republic of Korea Registered Patent No. 10-2744420 (2024.12.13)(003) Republic of Korea Published Patent No. 10-2024-0165728 (2024.11.25) The problem to be solved

[0008] The present invention aims to provide a cosmetic composition containing Centella asiatica extract, which contains a high amount of minerals and exhibits excellent skin barrier strengthening, skin regeneration promotion, and skin moisturizing activity.

[0009] In addition, the present invention has another objective of providing a method for preparing the above-mentioned Centella asiatica extract. means of solving the problem

[0010] To achieve the above objective, according to the present invention, a cosmetic composition containing Centella asiatica extract prepared by ultrasonic extraction after acid hydrolysis pretreatment is provided.

[0011] Preferably, the acid hydrolysis pretreatment is characterized by adding 0.4 to 0.6 M HCl to Centella asiatica and hydrolyzing it for 2 to 3 hours.

[0012] Preferably, the ultrasonic extraction is characterized by being performed for 2 to 3 hours while irradiating with ultrasonic waves of 20 to 30 KHz.

[0013] The above Centella asiatica extract as an active ingredient is characterized by being contained in an amount of 0.01 to 20% by weight relative to the total weight of the composition.

[0014] The above cosmetic composition is characterized by being for strengthening the skin barrier, regenerating the skin, or moisturizing.

[0015] In order to achieve the above other objectives, according to the present invention

[0016] (A) A step of adding 0.4~0.6M HCl to washed and dried Centella asiatica and hydrolyzing for 2~3 hours;

[0017] (B) A step of neutralizing to pH 7.0 by adding 0.5M NaOH;

[0018] (C) Step of concentrating under reduced pressure; and

[0019] (D) A method for preparing Centella asiatica extract is provided, comprising the step of adding an extraction solvent and extracting for 2 to 3 hours while irradiating with ultrasound of 20 to 30 KHz.

[0020] As the above extraction solvent, at least one selected from the group consisting of purified water, anhydrous or hydrated alcohol having 1 to 4 carbon atoms, propylene glycol, butylene glycol, and glycerin is used. Effects of the invention

[0021] The Centella asiatica extract produced according to the present invention contains a high amount of minerals and exhibits excellent skin barrier improvement, skin regeneration, and skin moisturizing effects, so it can be usefully used as a skin-improving cosmetic. Brief explanation of the drawing

[0022] Figure 1 is a graph showing the results of a cytotoxicity test of Centella asiatica extract according to an embodiment of the present invention. Figure 2 is a graph showing the skin barrier-related gene expression efficacy of Centella asiatica extract according to an embodiment of the present invention. Figure 3 is a photograph showing the cell regeneration efficacy of Centella asiatica extract according to an embodiment of the present invention. Figure 4 is a graph showing the skin moisturizing-related gene expression efficacy of Centella asiatica extract according to an embodiment of the present invention. Specific details for implementing the invention

[0023] The present invention will be described in more detail below.

[0024] The present invention is characterized by the technical feature that when Centella asiatica is pretreated by acid hydrolysis under specific conditions and then subjected to ultrasonic extraction, a Centella asiatica extract containing a high amount of minerals and exhibiting excellent skin barrier improvement, skin regeneration promotion, and skin moisturizing effects can be produced.

[0025] Centella asiatica (L.) Urban, also known as "tiger grass," is a plant belonging to the Apiaceae family and is referred to by names such as Indian pennywort or Gotu Kola. This plant is widely distributed in India, China, Indonesia, Malaysia, Sri Lanka, and Madagascar, and is known to grow wild in some parts of Korea. For over 2,000 years, Centella asiatica has been utilized in traditional medicine to treat skin diseases, wounds, burns, and eczema. Due to its diverse efficacy—including anti-inflammatory, antipyretic, diuretic, antibacterial, antiviral, anticancer, sedative, and cognitive function improvement effects—it has been called a "cure-all." Centella asiatica contains various phytochemical components. Major components include flavonoids (catechin, epicatechin, kaempferol, quercetin, apigenin, etc.). The most important active ingredients are madecassoside, asiaticoside, madecassic acid, and asiatic acid. In particular, madecassoside and asiaticoside exhibit excellent efficacy, such as anti-inflammatory effects, promotion of wound healing, and promotion of skin regeneration.

[0026] Generally, the most widely used method for extracting active ingredients from natural products is hot water extraction. While this method offers the advantages of a simple process and low initial equipment costs, it has disadvantages, such as being limited to the selective extraction of soluble components, having low overall extraction efficiency, and the potential for denaturation or destruction of heat-sensitive bioactive substances due to high-temperature treatment. Functional components such as flavonoids, vitamins, and antioxidants may experience reduced stability under these high-temperature conditions.

[0027] Accordingly, various physical and chemical extraction technologies have been developed to improve the extraction efficiency of natural products. For example, methods such as microwave extraction, ultrasonic extraction, and supercritical and subcritical fluid extraction are known to overcome the limitations of conventional hot water extraction and enable faster and more precise extraction. However, these technologies face limitations in their application to industrial mass production processes due to high initial equipment costs and limited extraction yields per unit of time.

[0028] According to the present invention, a cosmetic composition containing Centella asiatica extract prepared by ultrasonic extraction after acid hydrolysis pretreatment is provided.

[0029] Acid hydrolysis is a simple yet effective treatment method capable of increasing physiological activity by inducing structural transformation of active ingredients, such as flavonoids. In this invention, active ingredients present within Centella asiatica cells, particularly minerals, can be efficiently extracted by applying an ultrasonic extraction process following acid hydrolysis under specific conditions. Ultrasound physically ruptures cell walls through cavitation, thereby improving the extraction efficiency of various water-soluble and inorganic components, such as minerals, organic acids, polysaccharides, and amino acids.

[0030] At this time, preferably, the acid hydrolysis treatment is performed by adding 0.4 to 0.6 M HCl to Centella asiatica and hydrolyzing for 2 to 3 hours, and the ultrasonic extraction is performed by extracting for 2 to 3 hours while irradiating with ultrasound of 20 to 30 KHz.

[0031] According to a preferred embodiment of the present invention, the Centella asiatica extract is prepared in the following manner.

[0032] A Centella asiatica extract is prepared by a method comprising the steps of: (A) adding 0.4~0.6M HCl to washed and dried Centella asiatica and hydrolyzing for 2~3 hours; (B) adding 0.5M NaOH to neutralize to pH 7.0; (C) concentrating under reduced pressure; and (D) adding an extraction solvent and extracting for 2~3 hours while irradiating with ultrasound at 20~30KHz.

[0033] 0.4 to 0.6 M HCl is added to washed and dried Centella asiatica, more preferably 0.5 M HCl, and hydrolyzed for 2 to 3 hours. Then, NaOH is added to neutralize it, and the neutralized extract is concentrated under reduced pressure to remove the solvent. An extraction solvent is added again to the Centella asiatica pretreated in this way, and the extract is produced by extracting for 2 to 3 hours while irradiating with ultrasound at 20 to 30 KHz.

[0034] As the extraction solvent, at least one selected from the group consisting of purified water, anhydrous or hydrated alcohol having 1 to 4 carbon atoms, propylene glycol, butylene glycol, and glycerin is used, more preferably a mixed solvent of water and ethanol.

[0035] Centella asiatica extract produced by this method showed a high yield and a higher mineral content than that produced by other extraction methods (Test Example 1). In addition, it showed excellent skin barrier improvement effects (Test Example 3), skin regeneration promotion effects (Test Example 4), and skin moisturizing effects (Test Example 5).

[0036] The Centella asiatica extract as an active ingredient is contained in an amount of 0.01 to 20% by weight based on the total weight of the composition.

[0037] The cosmetic composition of the present invention can be prepared in any formulation that is commonly manufactured, examples of which include lotion, cream, essence, cleansing foam, cleansing water, pack, body lotion, body oil, body gel, shampoo, rinse, hair conditioner, hair gel, foundation, lipstick, mascara, makeup base, etc.

[0038] [Example]

[0039] Hereinafter, specific examples such as embodiments and test examples will be described to specifically explain the present invention. However, the embodiments or test examples according to the present invention may be modified in various different forms, and the scope of the present invention should not be interpreted as being limited to the examples described below. Since the embodiments and test examples according to the present invention are merely provided to more completely explain the present invention to those with average knowledge in the art, it should be understood that various equivalents and modifications that can replace them may exist at the time of filing this application.

[0040] Example 1: Preparation of Centella Asiatica Extract

[0041] 0.5 M HCl (80% ethanol) was added to washed and dried Centella asiatica, and hydrolysis was performed at 75°C for 2 hours. The pH was neutralized to 7.0 using 0.5 M NaOH (80% ethanol). The solvent was removed by concentrating the neutralized extract under reduced pressure. Subsequently, 10 times the weight of water was added, the mixture was placed in an ultrasonic device, extracted using ultrasound at 20 KHz for 2 hours, and filtered to prepare the Centella asiatica extract.

[0042] Comparative Example 1: Preparation of Centella Asiatica Extract

[0043] 0.5 M HCl (80% ethanol) was added to washed and dried Centella asiatica and hydrolyzed at 75°C for 2 hours. The pH was neutralized to 7.0 using 0.5 M NaOH (80% ethanol). The solvent was removed by concentrating the neutralized extract under reduced pressure. Subsequently, 10 times the weight of water was added, extracted at 95°C for 2 hours, and filtered to prepare the Centella asiatica extract.

[0044] Comparative Example 3: Preparation of Centella Asiatica Extract

[0045] 0.1 M HCl (80% ethanol) was added to washed and dried Centella asiatica, and hydrolysis was performed at 75°C for 2 hours. The pH was neutralized to 7.0 using 0.5 M NaOH (80% ethanol). The solvent was removed by concentrating the neutralized extract under reduced pressure. Subsequently, 10 times the weight of water was added, the mixture was placed in an ultrasonic device, extracted using ultrasound at 20 KHz for 2 hours, and filtered to prepare the Centella asiatica extract.

[0046] Comparative Example 4: Preparation of Centella Asiatica Extract

[0047] 1 M HCl (80% ethanol) was added to washed and dried Centella asiatica, and hydrolysis was performed at 75°C for 2 hours. The pH was neutralized to 7.0 using 0.5 M NaOH (80% ethanol). The solvent was removed by concentrating the neutralized extract under reduced pressure. Subsequently, 10 times the weight of water was added, the mixture was placed in an ultrasonic device, extracted using ultrasound at 20 KHz for 2 hours, and filtered to prepare the Centella asiatica extract.

[0048] Comparative Example 5: Preparation of Centella Asiatica Extract

[0049] 20 g of ground Centella asiatica, after washing and drying, was mixed with 200 mL of distilled water and placed in an ultrasonic device. The mixture was then extracted for 2 hours using ultrasound at 20 KHz and filtered to prepare Centella asiatica extract.

[0050] The yield is shown in Table 1 below.

[0051] Sample transference number Example 1 18% Comparative Example 1 11% Comparative Example 3 12% Comparative Example 4 11.1% Comparative Example 5 13.5%

[0052] Test Example 1: Measurement of Mineral Content

[0053] Mineral content was measured using the high-frequency plasma method. Specifically, approximately 0.2 g of Centella asiatica extract was placed in a Tetron container, and 7 mL of nitric acid (HNO₃) was added. The container was operated using a microwave digestion (Microwave 5000, Anton Paar) device at a maximum temperature of 180°C for approximately 20 minutes to digest the sample. The final digestion product was transferred to a 50 mL volumetric flask, and distilled water was added. This was prepared as a test solution and measured using ICP (Agilent, 5800 ICP-OES). Separately, 7 mL of nitric acid was prepared in the same manner as the test solution to serve as a blank solution.

[0054] The results are shown in Table 2 below.

[0055] element name Detected content (ppm) Example 1 Comparative Example 1 Comparative Example 3 Comparative Example 4 Comparative Example 5 Ca 69.47 19.6 21.12 11.98 15.54 Fe 2.6 0.62 0.11 1.21 0.85 K 720.15 0 156.21 98.11 201.97 Mg 74.17 13.38 15.32 17.58 9.02 Mn 12.08 0.04 0.10 0.45 0.32 P 6.18 0.08 2.21 3.14 1.21 S 39.98 2.25 9.24 12.24 15.2 Zn 1.29 3.93 0.12 0.21 0.31

[0056] As confirmed in Table 2 above, the Centella asiatica extract of Example 1, prepared by acid hydrolysis pretreatment with 0.5 M HCl followed by ultrasonic extraction, showed a significantly higher mineral (Ca, Fe, K, Mg, Mn, P, S, Zn) content compared to the extracts of the comparative example prepared by other extraction methods.

[0057] Test Example 2: Cytotoxicity Test

[0058] To confirm the cytotoxicity of the extracts corresponding to Example 1 and the Comparative Example, 5x10 HaCat cells were used. 3 Cells were dispensed into 96-well plates at a concentration of cells / ml and stabilized for 24 hours. Samples were cultured at different concentrations in a CO2 incubator for 24 hours. After treatment with WST-1 reagent and incubation for 2 hours, absorbance was measured at a wavelength of 450 nm using a microreader. The results are shown in Figure 1.

[0059] As confirmed in Figure 1, it was confirmed that there was no cytotoxicity in all extract samples.

[0060] Test Example 3: Confirmation of Skin Barrier Gene Expression

[0061] HaCaT 5x10 5Cells / mL were seeded into 6-well plates and stabilized for 24 hours. After treating with samples at different concentrations, the cells were cultured in a CO2 incubator for 24 hours. After culture, each set of cells was taken and processed using RNeasy. ® Experiments were conducted according to the instructions provided by the Plus Mini Kit (QIAGEN, Germany). After synthesizing cDNA from the obtained RNA using the iScript™ cDNA Synthesis Kit (BIO-RAD, USA), RT-PCR was performed according to the instructions provided by the AccuPower Multiplex PCR PreMix (BIONEER, South Korea), and the results were analyzed using the Gel documentation system and Image J program.

[0062] Gene Sequence DSC1 F CAACACGTTCAGCAGATCCA R CAGCCTTTGAGTGAGGAGTG FLG F TCCTGAAGAATCCAGATGAC R CCATGACTGGCTCTGTCTTC IVL F TCCTCCAGTCAATACCCATCAG R CAGCAGTCATGTGCTTTTCCT GAPDH F TGAAGGTCGGTGTGAACGGA R CATGTAGGCCATGAGGTCCA

[0063] To confirm the efficacy of Centella asiatica extract on skin barrier-related gene expression, mRNA expression levels of FLG (filaggrin), IVL (involucrin), and DSC1 (desmocollin-1) genes were measured using RT-PCR. Cells were treated with the extract at concentrations of 0.5%, 1%, and 2%, respectively, and RNA was isolated after 24 hours to quantify gene expression levels.

[0064] The results are shown in Figure 2. As confirmed in Figure 2, the Centella asiatica extract sample of Example 1 showed superior FLG, IVL, and DSC1 expression rates compared to the extract of the comparative example.

[0065] Test Example 4: Skin regenerative activity test

[0066] HaCaT 2.5x10 5Cells were seeded into 12-well plates at a concentration of cells / mL and cultured for 24 hours. After replacing the medium with FBS-free medium, the solution was changed to PBS, and a 200 µL yellow tip was used to create a scratch. Samples were then treated at different concentrations and incubated in a CO2 incubator for 48 hours. Cell migration was observed under a microscope and photographed. Epidermal growth factor (EGF) was used as the positive control. The results are shown in Figure 3.

[0067] As confirmed in Figure 3, the Centella asiatica extract sample of Example 1 showed excellent cell regeneration efficacy compared to the extract of the comparative example.

[0068] Test Example 5: Confirmation of Skin Moisturization Gene Expression

[0069] To confirm the efficacy of Centella asiatica extract on skin moisturizing-related gene expression, the mRNA expression levels of hyaluronic acid synthesis-related genes HAS2 and HAS3, and water transport-related protein AQP3 were measured using RT-PCR.

[0070] HaCaT 5x10 5 Cells / mL were seeded into 6-well plates and stabilized for 24 hours. After treating with samples at different concentrations, the cells were cultured in a CO2 incubator for 24 hours. After culture, each set of cells was taken and processed using RNeasy. ® Experiments were conducted according to the instructions provided by the Plus Mini Kit (QIAGEN, Germany). After synthesizing cDNA from the obtained RNA using the iScript™ cDNA Synthesis Kit (BIO-RAD, USA), RT-PCR was performed according to the instructions provided by the AccuPower Multiplex PCR PreMix (BIONEER, South Korea), and analysis was performed using the Gel documentation system and Image J program.

[0071] Gene Sequence AQP3 F TGAGCATCCACTGCATGTCC R TCCCTTGCCCTGAATATCTG HAS3 F AAGCACTACCTGTCCTTCGG R CACACGGTCCATGCCCT HAS2 F GTCCCGGTGAGACAGATGAG R CGGAAGTAGGACTTGCTCCA GAPDH F TGAAGGTCGGTGTGAACGGA R CATGTAGGCCATGAGGTCCA

[0072] The genes used for evaluation were hyaluronic acid synthesis-related genes (HAS2, HAS3) and water transport-related protein (AQP3). The results are shown in Figure 4.

[0073] As confirmed in Figure 4, HAS2 did not show an effect compared to the control group, but the Centella asiatica extract sample of Example 1 showed very high expression rates of HAS3 and AQP3 compared to the extract of the comparative example.

[0074] These results suggest that an ultrasonic extraction process following acid hydrolysis pretreatment under specific conditions can maximize the extraction of moisturizing active ingredients derived from Centella asiatica, thereby contributing to skin moisture retention and enhanced moisturizing functions. In particular, the significant increase in the expression of HAS3 and AQP3 genes serves as biomolecular-level evidence proving that the extracts of the above examples can be utilized as functional moisturizing materials.

[0075] Example 2: Preparation of a cream containing Centella asiatica extract

[0076] A cream containing the Centella asiatica extract of Example 1 above was prepared according to a conventional method with the composition and content of Table 5 below.

[0077] raw material Content (weight%) Example 2 Centella asiatica extract (Example 1) 2.0 Sodium hyaluronate 0.030 Sorbitan isostearate 0.033 Polysorbate 60 0.033 Ammonium Acryloyl Dimethyl Taurate / VP Copolymer 0.300 Stearic acid 0.500 Panthenol 0.500 Hydroxyethyl acrylate / sodium acryloyldimethyl taurate copolymer 0.510 Dimethicon 1.000 Shea butter 1.000 cetearyl alcohol 1.000 Trehalos 1.000 1,2-hexanediol 2.000 Polyglyceryl-3-methylglucose distearate 3.000 propanediol 3.000 glycerin 3.000 C13-15 alkanes 3.000 Jojoba seed oil 4.000 Caprylic / Capric Triglyceride 6.000 purified water To 100

Claims

Claim 1 A cosmetic composition containing Centella asiatica extract prepared by a method comprising: (A) adding 0.4~0.6M HCl to washed and dried Centella asiatica and hydrolyzing for 2~3 hours; (B) adding 0.5M NaOH to neutralize to pH 7.0; (C) concentrating under reduced pressure; and (D) adding an extraction solvent and extracting for 2~3 hours while irradiating with ultrasound at 20~30KHz. Claim 2 delete Claim 3 delete Claim 4 A cosmetic composition according to claim 1, characterized in that the Centella asiatica extract is contained in an amount of 0.01 to 20% by weight based on the total weight of the composition. Claim 5 A cosmetic composition according to claim 1, characterized in that the cosmetic composition is for strengthening the skin barrier, for skin regeneration, or for moisturizing. Claim 6 A method for preparing Centella asiatica extract comprising: (A) adding 0.4~0.6M HCl to washed and dried Centella asiatica and hydrolyzing for 2~3 hours; (B) adding 0.5M NaOH to neutralize to pH 7.0; (C) concentrating under reduced pressure; and (D) adding an extraction solvent and extracting for 2~3 hours while irradiating with ultrasound at 20~30KHz. Claim 7 A method for preparing Centella asiatica extract according to claim 6, characterized in that the extraction solvent is at least one selected from the group consisting of purified water, anhydrous or hydrated alcohol having 1 to 4 carbon atoms, propylene glycol, butylene glycol, and glycerin.

Images