Tomato-derived SlJUL gene regulating phloem development and uses thereof

KR103000441B1Active Publication Date: 2026-08-05POSTECH ACADEMY INDUSTRY FOUNDATION
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
KR1020220100433
Authority / Receiving Office
KR · KR
Patent Type
Patents
Current Assignee / Owner
Filing Date
2022-08-11
Publication Date
2026-08-05
Estimated Expiration
2042-08-11

Smart Images

  • Figure 112022084024501-PAT00049_ABST
    Figure 112022084024501-PAT00049_ABST
Patent Text Reader

Abstract

The present invention relates to a composition for enhancing the sink strength of plant sink tissues. The composition provided by the present invention can increase the number of phloem cells and the phloem transport rate by suppressing the expression of the SlJUL protein or the gene encoding the SlJUL protein. Therefore, the present invention can be usefully utilized to increase the productivity and yield of crops.
Need to check novelty before this filing date? Find Prior Art

Description

Technology Field

[0001] The present invention relates to a tomato-derived that regulates phloem development. SlJUL It is about genes and their uses. Background Technology

[0003] Damage caused by global abnormal climate changes resulting from rising atmospheric carbon dioxide concentrations is increasing. Consequently, the 2015 Paris Agreement on carbon dioxide emission regulation, involving 195 countries, demonstrates the critical importance of controlling atmospheric carbon dioxide levels for human survival. The process of converting carbon dioxide into carbon compounds through photosynthesis is a core mechanism constituting the Earth's carbon cycle and serves as a primary production process within the Earth's ecosystem that converts light energy obtained from the sun into organic energy. Furthermore, understanding and applying the fundamental principles of development and growth in plants—autotrophic organisms—is essential not only for the survival of individual humans but for the sustainable survival of humanity as a whole. Accordingly, conventional strategies aimed at increasing carbon assimilation efficiency and crop productivity have involved methods such as enhancing the activity of enzymes involved in photosynthesis or increasing the expression of carrier proteins for photosynthetic products. In addition to these methods, increasing the transport capacity of the phloem, which serves as the pathway for the movement of photosynthetic products, can also be a significant strategy.

[0004] Phloem is a living vessel in vascular plants that plays a crucial role in plant development as a pathway for the transport of macromolecules such as photosynthetic products, hormones, mRNA, and proteins. In particular, it plays a major role in the development and regulation of storage organs that store and utilize photosynthetic products. Phloem differentiation involves irreversible cell reprogramming from dividing cells known as the (pro)cambium. During these changes, the selective degeneration of intracellular organelles, including the nucleus, cell wall reorganization, and vacuolar membrane disruption occur through the regulation of signals for transcriptional cascades. Once the fate of phloem cells is determined, the nuclei of early phloem cells are removed to develop into tetrahedral joints, and these cells fuse to form phloem tubes. As cells lose their transcriptional capacity, post-transcriptional regulatory processes may be required to construct phloem networks in plants. However, the underlying post-transcriptional regulatory mechanisms of phloem differentiation are unknown, and their influence on the formation of provider-receiver relationships has not been clearly elucidated.

[0005] Accordingly, research on phloem differentiation is actively being conducted both domestically and internationally, and knowledge regarding the regulatory mechanisms of phloem differentiation is gradually expanding. More specifically, in 2003, the gene regulating phloem development ALTERED PHLOEM DEVELOPMENT ( APL Research on the mechanism of phloem differentiation began through the discovery of ) (Bonke et al. , 2003), recently APL As a downstream regulatory gene of, a downstream transcription factor NAC45 / 86 Involved in the removal of nuclei occurring during phloem differentiation NEN1-4 It has been identified. In addition, major phloem development regulatory factors such as OCTOPUS, BIN2, CVP2, CVL1, BRX, BAM3, and CLE45 have been identified. However, to date, no genes suitable for humans to artificially control phloem development have been discovered. Accordingly, the present invention aims to propose a method to ultimately increase crop productivity by increasing the nutrient storage capacity of plants into nutrient storage tissues through the use of genes capable of controlling phloem development. The problem to be solved

[0007] One aspect is a composition for enhancing the sink strength of a plant's sink tissue, comprising a SlJUL protein or an expression inhibitor of a gene encoding the SlJUL protein.

[0008] The above expression inhibitor is (a) a VIGS (virus-induced gene silencing) vector comprising a SlJUL protein or a gene encoding the SlJUL protein;

[0009] (b) a vector containing a SlJUL mutant protein or a SlJUL mutant gene; and

[0010] (c) Provides a composition selected from the group consisting of a SlJUL protein or a CRISPR / Cas9 vector that edits a gene encoding a SlJUL protein.

[0011] Another aspect provides a method for enhancing the sink strength of a plant's sink tissue, comprising the step of treating a plant with the above composition.

[0012] Another aspect is to provide a plant body in which the sink strength of the sink tissue is enhanced according to the above method. means of solving the problem

[0014] The present invention relates to a composition for enhancing the sink strength of a plant's sink tissue, comprising a SlJUL protein or an expression inhibitor of a gene encoding the SlJUL protein.

[0015] The above expression inhibitor is (a) a VIGS (virus-induced gene silencing) vector comprising a SlJUL protein or a gene encoding the SlJUL protein;

[0016] (b) a vector containing a SlJUL mutant protein or a SlJUL mutant gene; and

[0017] (c) Provides a composition selected from the group consisting of a SlJUL protein or a CRISPR / Cas9 vector that edits a gene encoding a SlJUL protein.

[0018] In the present invention, when using one or more vectors selected from the group consisting of vector (a), vector (b), and vector (c), the expression of the SlJUL protein or the gene encoding the SlJUL protein is suppressed, thereby enhancing the sink strength of the plant's sink tissue and increasing the productivity and yield of the plant.

[0019] In one embodiment of the present invention, the nutrient storage tissue of the plant may be one or more selected from the group consisting of seeds, fruits, flowers, roots, and tubers, and specifically may be a fruit.

[0020] In one embodiment of the present invention, the SlJUL protein is an orthologue of AtJUL1, which performs the function of a negative regulator of phloem development in Arabidopsis thaliana, SMXL5 ( SUPPRESSOR OF MAX2 1-LIKE5 By binding to the 5'UTR (Untranslated region) of mRNA to form an RNA G quadruplex, the above SMXL5 It can suppress the expression of and can perform a negative regulator function in the development of the tomato's phloem.

[0021] In one embodiment of the present invention, the expression inhibitor of the SlJUL protein or the gene encoding the SlJUL protein performs a negative regulator function in phloem development of a tomato. SlJUL By inhibiting the expression of, the number of phloem cells and phloem transport capacity can be increased. Therefore, the expression inhibitor can enhance the plant's nutrient storage capacity and increase the plant's productivity.

[0022] In one embodiment of the present invention, the expression inhibitor may be a VIGS vector, a vector containing a mutant protein or gene, an RNAi vector, or a CRISPR / Cas9 vector, and specifically may be a VIGS vector.

[0023] In one embodiment of the present invention, the vector (a) includes a SlJUL protein or a gene encoding the SlJUL protein, and can suppress the expression of the SlJUL protein or the gene encoding the SlJUL protein through VIGS (virus-induced gene silencing), and can increase the nutrient storage capacity and productivity of the plant.

[0024] The term "VIGS" refers to a phenomenon in which, when a foreign gene is introduced into a viral vector and inoculated into a plant, the expression of the introduced gene and its homologous endogenous genes is suppressed by a mechanism similar to post-transcriptional gene silencing.

[0025] In one embodiment of the present invention, the virus vector used in the VIGS is TRV ( Tobacco rattle virus ) vector, CMV ( Cucumber mosaic virus ), PVX ( Potato virus X ) may be, and the above vector (a) is TRV to SlJUL Gene introduced TRV-SlJUL It can be a recombination vector.

[0026] The term "vector" above refers to a means of delivering a foreign gene to a target cell for expression, replicating DNA, and capable of being reproduced independently in the host cell.

[0027] In one embodiment of the present invention, the vector is a plasmid, Ti-plasmid, cosmid, artificial chromosome, liposome, binary vector, double-stranded plant virus vector (e.g., CaMV It can be a single-stranded virus vector or an incomplete plant virus vector.

[0028] In one embodiment of the present invention, the (b) vector is a SlJUL mutant protein or SlJUL It may contain a mutant gene. The above (b) vector is a SlJUL mutant protein or SlJUL By expressing the mutant gene, it acts as a dominant-negative of SlJUL, which can increase the number of phloem cells and phloem transport capacity, and increase the plant's nutrient storage capacity and productivity.

[0029] In one embodiment of the present invention, the mutation may occur by insertion, deletion, or substitution of a base, and may be a point mutation or a grid shift mutation.

[0030] In one embodiment of the present invention, the vector (b) is SlJUL R20 / 81 / 151A protein or SlJUL R20 / 81 / 151A It may contain genes.

[0031] In one embodiment of the present invention, the vector (c) may be a CRISPR / Cas9 vector that edits the SlJUL protein or a gene encoding the SlJUL protein. The vector (c) may include a single guide RNA (sgRNA) comprising crRNA (CRISPR RNA) and tracrRNA (transactivating crRNA), a gene encoding the Cas9 (CRISPR associated protein 9) protein or Cas9 protein, and the SlJUL protein or a gene encoding the SlJUL protein.

[0032] In addition, in one embodiment of the present invention, the vector (c) can knock out the SlJUL protein or the gene encoding the SlJUL protein by editing the SlJUL protein or the gene encoding the SlJUL protein.

[0033] In one embodiment of the present invention, the composition is SlAPL , SlSUT1 , SlSUT2 , SlSUT4 and SlSWEET1a It may increase the expression of one or more genes selected from a group consisting of the above. SlAPL The gene is a marker gene of the phloem, and the above SlSUT1 , SlSUT2 , SlSUT4 and SlSWEET1a The gene is a sugar transporter-related gene.

[0034] In one embodiment of the present invention, the composition may increase the fruit yield of a plant. Specifically, the composition may increase the total number of fruits and the total weight of the fruits of the plant.

[0035] In addition, in one embodiment of the present invention, the composition may increase the fruit sugar content of a plant. Specifically, the composition may increase the total sugar content, total glucose content, and total fructose content of the plant.

[0036] In addition, in one embodiment of the present invention, the composition may increase the root growth of a plant. Specifically, the composition may increase the total fresh weight and dry weight of the plant root.

[0037] In one embodiment of the present invention, the plant is a food crop including rice, wheat, barley, corn, soybeans, potatoes, red beans, oats, and sorghum;

[0038] Vegetable crops including Arabidopsis thaliana, napa cabbage, radish, chili pepper, strawberry, tomato, watermelon, cucumber, cabbage, Korean melon, pumpkin, green onion, onion, and carrot;

[0039] Specialty crops including ginseng, tobacco, cotton, sesame, sugarcane, sugar beet, perilla, peanuts, and rapeseed;

[0040] Documents including sweet potatoes, Jerusalem artichokes, cassava, yams, and yacon;

[0041] Fruit trees including apple trees, pear trees, jujube trees, peaches, kiwis, grapes, citrus fruits, persimmons, plums, apricots, and bananas;

[0042] Floriculture plants including roses, gladiolus, gerbera, carnations, chrysanthemums, lilies, and tulips; and

[0043] It may be selected from a group of forage crops including ryegrass, red clover, orchardgrass, alpha-alpha, tall fescue, and perennial ryegrass.

[0044] In one embodiment of the present invention, the plant may be a vegetable crop including Arabidopsis thaliana, Chinese cabbage, radish, chili pepper, strawberry, tomato, watermelon, cucumber, cabbage, Korean melon, pumpkin, green onion, onion, and carrot, and specifically may be a tomato.

[0046] The present invention provides a method for enhancing the sink strength of a plant's sink tissue, comprising the step of treating a plant with the above composition.

[0047] In the present invention, the composition can increase the number of phloem cells and the phloem transport rate by inhibiting the expression of the SlJUL protein or the gene encoding the SlJUL protein. Therefore, through the above method, the nutrient storage capacity of the plant can be enhanced and the productivity of the plant can be increased.

[0048] The above term "plant body" refers to a type of body possessed by a plant and may include plant cells, plant tissues, and plant seeds, etc.

[0049] In one embodiment of the present invention, the "step of treating a plant with the composition" means introducing DNA into a plant or transforming a plant. In the present invention, the transformation may be appropriately selected and utilized by a person skilled in the art according to known methods, such as, for example, the calcium / polyethylene glycol method for known protoplasts, electroporation of protoplasts, microinjection into plant elements, a method using Agrobacterium, particle impaction of various plant elements (DNA or RNA-coated), infection by viruses, etc.

[0051] The present invention provides a plant body in which the sink strength of the plant’s sink tissue is enhanced according to the above method. Effects of the invention

[0053] The composition for enhancing the sink strength of plant sink tissues provided by the present invention can increase the number of phloem cells and the phloem transport rate by inhibiting and suppressing the expression of the SlJUL protein or the gene encoding the SlJUL protein. Therefore, the present invention can be usefully utilized to increase the productivity and yield of crops. Brief explanation of the drawing

[0055] Figure 1 shows the amino acid sequences of SlJUL and AtJUL1. The conserved ZnF domain is underlined, and conserved residues are highlighted in a different color. Conserved arginine is required for RNA binding, and cysteine ​​can stabilize the zinc-finger structure. Figure 2 shows SlJUL and SlJUL confirmed by GFP signal in Arabidopsis protoplasts. R20 / 81 / 151A This is a diagram showing the intracellular location of. Chlorophyll and DAPI were used as indicators for the cytoplasm and nucleus, respectively, and their locations were observed using a confocal laser microscope. Fig. 3a is SlSMXL5 In the 5'UTR GFP Fusion is used to show the GFP signal measured according to the SlJUL concentration. Fig. 3b is SlSMXL5 In the 5'UTR GFP Fusing SlJUL R20 / 81 / 151A Shows the GFP signal measured according to concentration. Fig. 4a is SlSMXL5 Luciferase in the 5'UTR ( LUC After fusing ), SlJUL or SlJUL R20 / 80 / 146A It represents the luciferase activity measured by treatment. Fig. 4b is mSlSMXL5 Luciferase in the 5'UTR ( LUC After fusing ), SlJUL or SlJUL R20 / 80 / 146A It represents the luciferase activity measured by treatment. Figure 5 shows the measurements taken from plant organs by qRT-PCR SlJUL It indicates the expression level of. The expression level is GAPDH It was normalized to the expression level of the reference gene. Figure 6a shows the cross-section of an immature green fruit and the longitudinal section of a red ripe fruit. SlJUL This is a diagram showing the GUS signal by the promoter. Figure 6b is a diagram showing the GUS signal in the vascular bundle structure of a cross-section of an anther. The black arrows indicate xylem. Figure 6c shows the GUS signal in the embryonic root, pedicel, stamen, style, sepals, and fruit of a germinated seed. Figure 7 is a recombination TRV as SlJUL Tomatoes that have been knocked down and 30 days after flowering SlJUL It indicates the expression level of. Fig. 8 is TRV-GFP (Control group) and TRV-SlJUL This represents the cross-section of a plant flower stalk and the number of phloem cells. IP stands for internal phloem, EP for external phloem, C for cambium, and X for xylem. Fig. 9 is TRV-GFP (Control group) and TRV-SlJUL Plant phloem marker genes SlAPL , cambium marker gene SlTDR and vascular marker genes SlIRX3 It indicates the expression level of. Figure 10a shows the use of CRISPR-Cas9 SlJUL This shows a schematic diagram of a binary vector and sgRNA target that can induce gene mutations. Fig. 10b shows the use of CRISPR-Cas9 SlJUL This shows a schematic diagram of a binary vector that can induce gene mutations. Fig. 11a shows WT and sljul-Cas9 Plant flower stalk cross-section and phloem marker genes SlAPL It indicates the expression level of. Fig. 11b shows WT and sljul-d4-Cas9 It shows a cross-section of a plant's flower stalk. Fig. 12 shows WT and sljul-Cas9 Plant cambium marker genes SlTDR and vascular marker genes SlIRX3 It indicates the expression level of. Fig. 13 shows WT and SlJUL R20 / 81 / 151A It shows the cross-section of the flower stalk and the number of phloem cells of the plant. Fig. 14 shows WT and SlJUL R20 / 81 / 151A Plant phloem marker genes SlAPL , cambium marker gene SlTDR and vascular marker genes SlIRX3 It indicates the expression level of. Fig. 15 TRV-GFP , TRV-SlJUL and TRV-SlJUL / TRV-SlSMXL5 It shows the cross-section of the flower stalk and the number of phloem cells of the plant. Fig. 16 is TRV-GFP (Control group) and TRV-SlJUL It represents the number of leaves, leaf area, stem diameter, number of flowers, flower stalk length, flower stalk diameter, photosynthetic efficiency of the leaves, and CO2 assimilation rate of the plant. Fig. 17 shows WT and SlJUL R20 / 81 / 151A It represents the number of leaves, leaf area, stem diameter, number of flowers, flower stalk length, flower stalk diameter, photosynthetic efficiency of the leaves, and CO2 assimilation rate of the plant. Fig. 18 shows WT and sljul-Cas9 It represents the number of leaves, leaf area, stem diameter, number of flowers, flower stalk length, flower stalk diameter, photosynthetic efficiency of the leaves, and CO2 assimilation rate of the plant. Fig. 19a is TRV-GFP (Control group) and TRV-SlJUL This shows a cross-section of a plant leaf stalk. The black arrow indicates the phloem. Fig. 19b shows WT and SlJUL R20 / 81 / 151A This shows a cross-section of a plant leaf stalk. The black arrow indicates the phloem. Fig. 19c shows WT and sljul-Cas9 This shows a cross-section of a plant leaf stalk. The black arrow indicates the phloem. Fig. 20a is TRV-SlJUL This shows the UV fluorescence signal measured 10 minutes after esculin loading in plants. Fig. 20b is SlJUL R20 / 81 / 151A This shows the UV fluorescence signal measured 10 minutes after esculin loading in plants. Fig. 20c is sljul-Cas9 This shows the UV fluorescence signal measured 10 minutes after esculin loading in plants. Fig. 20d sljul-d4-Cas9 This shows the UV fluorescence signal measured 10 minutes after esculin loading in plants. Figure 21a shows a schematic diagram of the experiment to measure pixel intensity changes at the same fixed point within the midrib and the results of esculin transport monitoring per time interval. Pixel intensity was measured within 1 mm at a distance of 1.5 cm along the midrib from the esculin treatment location, and from the monitoring results TRV-SlJUL Plants are the control group TRV-GFP It can be confirmed that compared to plants, faster transport is exhibited in the midrib via a basipetal method. Figure 21b shows UV fluorescence signals measured after 10, 20, 30, 40, and 50 minutes following treatment with 10 μl of an esculin dye (5 mg / ml) solution on abraded leaf laminas on both sides of the midrib. Circles indicate the esculin loading sites, and line bars indicate the esculin measurement ranges. Figure 21c shows the estimated export rate of esculin through medium wheat per unit time. Fig. 22a is TRV-GFP (Control group) and TRV-SlJUL It represents the expression level of the major gene encoding the sucrose transporter in the plant's root leaf. Fig. 22b shows WT and SlJUL R20 / 81 / 151A It represents the expression level of the major gene encoding the sucrose transporter in the plant's root leaf. Fig. 22c shows WT and sljul-Cas9 It represents the expression level of the major gene encoding the sucrose transporter in the plant's root leaf. Fig. 23a is TRV-GFP (Control group) and TRV-SlJUL This shows the longitudinal cross-section of the flower stalk at 30 days (dpa) after the plant blooms. Fig. 23b is TRV-GFP (Control group) and TRV-SlJUL It indicates the length and diameter of the plant sieve tube. Fig. 24 is TRV-GFP (Control group), TRV-SlJUL and TRV-SlSMXL5 / TRV-SlJUL It shows representative images of the plant, the average number of fruits, the average diameter of red ripe fruits, and the total weight of fruits per plant. Fig. 25 is TRV-GFP (Control group) and TRV-SlJUL This shows abortive flowers and fruits on the flower stalks of plants. Green arrows indicate abortive flowers, and yellow arrows indicate flowers that will become fruits. Fig. 26 is TRV-GFP (Control group) and TRV-SlJUL This represents the levels of sugar, glucose, and fructose in the total fruit of the plants. Sugar levels were measured in five representative red ripe fruits of each plant, and separation parameters and sugar quantification were performed using a Dionex Ultimate 3000 series high-performance liquid chromatograph (Thermo Fisher Scientific) equipped with a Sugar-Pak column (Waters) and a Shodex RI-101 detector (Shodex). Fig. 27 is TRV-GFP (Control group) and TRV-SlJUL It shows representative images of the plant and levels of the total fresh weight and dry weight of the roots. Fig. 28 shows WT and SlJUL R20 / 81 / 151A It shows representative images of the plant, the average number of fruits, the average diameter of red ripe fruits, and the total weight of fruits per plant. Fig. 29a shows WT and sljul-Cas9 It shows representative images of the plant, the average number of fruits, the average diameter of red ripe fruits, and the total weight of fruits per plant. Fig. 29b shows WT and sljul-d4-Cas9 It shows a representative image of the plant and the average number of fruits. Figure 30 shows the tradeoff between fruit number and sink strength in terms of fruit size and mass. Two to three months after germination, all but 10 fruits were removed from the vine, and the fruit phenotype was recorded when the fruit was ripe red. Fig. 31 is TRV-GFP (Control group) and TRV-SlJUL Representative images of 10 ripe red fruits of the plant and the average diameter and weight of the fruits are shown. Figure 32a shows a schematic diagram illustrating the correlation between phloem development, phototactic distribution, and productivity. The thickness of the blue line and arrow indicates the phloem transport velocity, and the red arrow indicates the phloem. Fig. 32b is WT, TRV-SlJUL , SlJUL R20 / 81 / 151A and sljul-Cas9 It indicates gene expression, phloem cell count, transport capacity, and fruit yield in plants. Specific details for implementing the invention

[0056] The present invention will be explained in more detail below through examples. However, these examples are intended to illustrate the invention and the scope of the invention is not limited to these examples.

[0058] 실험예 1: 재료 및 방법

[0059] 1-1. 식물 재료 및 성장 조건

[0060] Seeds of the tomato variety Micro-Tom were provided by Professor Do-Il Choi of Seoul National University, South Korea. All seeds were fertilized at 1,200 μmols under long-day conditions (16 hours of light treatment / 8 hours of dark treatment) in a medium (pH 5.7) containing 500 μmols of Vitamin (Duchefa), 3% sucrose (Duchefa), 0.5% 2-(N-morpholino) ethanesulfonic acid (MES, Sigma-Aldrich), and 0.8% Phytoaga (Sigma-Aldrich), along with half-strength Murashige and Skoog salts. -1 m -2 They were treated with light of a certain intensity and germinated at 24°C. Ten days after sowing (DAS), the seedlings were transplanted into pots and grown under long-day conditions. Arabidopsis thaliana grown under short-day conditions (8 hours of light treatment / 16 hours of darkness treatment) Arabidopsis thaliana Ecotype Col-0 was used in protoplast experiments.

[0062] 1-2. 플라스미드 구성 및 토마토 유전자 변형

[0063] For VIGS (Virus-induced gene silencing) analysis, without off-target SlJUL (Solyc08g067180.3.1; 214 bp) and SlSMXL5 The cDNA fragment of (Soly-c07g018070.3.1; 549 bp) (https: / / www.zhaolab.org / pssRNAit / ) was amplified using a cDNA template derived from Micro-Tom tomatoes, and pTRV2 vector( pYL156 It was cloned into Addgeneplasmid (http: / / n2t.net / addgene:148969). For protoplast reporter analysis, SlSMXL5 5'UTR of (336 bp) GFP or LUC It was cloned into a plant expression vector containing ( 35S:SlSMXL5 5'UTR- GFP , 35S:SlSMXL5 5'UTR- LUC and 35S:mSlSMXL5 5'UTR- LUC ), SlJUL The full-length coding sequence (CDS) of (513 bp) was cloned into a plant expression vector containing a hemagglutinin (HA) tag ( 35S:SlJUL::HA ). SlJUL R20 / 81 / 151A for the manufacture of SlJUL point mutations (R20(AGA)(58,59,60)->A(GCA), R81(CGC)(241,241,243)->A(GCC) and R151(AGG)(451,452,453)->A(GCG)) and SISMXL5 Point mutation of the 5'UTR ( mSISMXL5 5'UTR) was prepared using the QuikChange Site-Directed Mutagenesis Kit (Stratagene California).

[0064] SlJUL To analyze the spatial expression pattern of, a 2.0 kbp upstream sequence of the translation start site was amplified from Micro-Tom tomato genomic DNA, and after isolation using the CTAB method pCAMBIA1303 Cloned into ( pSlJUL:GUS-GFP The full-length coding sequence of SlJUL containing point mutations is CaMV35S Includes a promoter (Cauliower mosaic virus) and a GUS fusion sequence pBI121 Introduced into binary vectors 35S:SlJUL R20 / 81 / 151A ::GUS A construct was formed.

[0065] To generate CRISPR knockouts, the CRISPR-P 2.0 tool (Liu et al.sgRNAs were designed using (2017) and used in the construction of CRISPR vectors. All T-DNA structures were Gateway-compatible pEn-C1.1 (HolgerPuchta, Addgene plasmid #61479; http: / / n2t.net / addgene:61479) and pDe-CAS9 It was based on the plasmid (Holger Puchta, Addgene plasmid#61433; http: / / n2t.net / addgene:61433). Destination vector pDe-CAS9 Is PcUbi4-2 Promoter[Parsley( Petroselinum crispum Miller Expressing Cas9 driven by the ubiquitin promoter of ) and peas ( Pisum sativum L. )of RIBULOSE-1,5-BISPHOSPHATE CARBOXYLASE ( RBCS3A , pea3A ) includes a small subunit termination sequence of the gene. The spacer sequence (20 bp) is BbsI It was introduced into an entry vector in the form of annealed oligonucleotides using a classical cloning method that cleaves the sequence using (New England Biolabs). The custom RNA chimera is Arabidopsis U6-26 It is driven by a promoter. SlJUL Two programmed sgRNA cassettes were incorporated into the target vector to simultaneously target two different locations (5'UTR and 3'UTR). The first chimera Bsu36I and MluI It was constructed using (New England Biolabs), and the second chimera was constructed using the Gateway LR reaction (ThermoFischer Scientific) as previously described.

[0066] To generate another CRISPR knockout allele SlJULAn sgRNA targeting the sequence between ZnF motifs 1 and 2 was designed. The T-DNA construct used here is pHAtC It was based on the plasmid (Jinsu Kim, Addgene plasmid #78098; https: / / www.addgene.org / 78098). pHAtC Is 35S The custom RNA chimera expressing Cas9 driven by a promoter Arabidopsis U6-26 It is driven by a promoter. The spacer sequence (20 bp) is AarI It was introduced into a plant transformation vector in the form of annealed oligonucleotides using a classical cloning method that involves cleaving the sequence using a Thermo Fischer Scientific thermometer. The custom RNA chimera is Arabidopsis U6-26 It is driven by a promoter.

[0067] The final binary plasmid is Agrobacterium tumefaciens (EHA105 strain) was introduced into 10-day-old seedlings (tomato variety Micro-Tom) cotyledon explants using mediation transformation. Tomato transformants were selected at BASTA (1 mg / L; Bayer CropScience) or hygromycin (5 mg / L; Duchefa). The transformed 35S:SlJUL R20 / 81 / 151A and sljul-Cas9 The T2 generation of the line was used for further study. All primers used in this study are listed in Table 1 below.

[0068] experiment name Sequence(5'-3') RT-PCR GFP-RT_F GTAAACGGCCACAAGTTCAGCGTG(Sequence No. 1) GFP-RT_R GTGCTGCTTCATGTGGTCGGGG(Sequence No. 2) SlJUL-RT_F ATGAGCAGACCAGGAG(Sequence No. 3) SlJUL-RT_R ATATGAAGACTTGTTACCAGC(Sequence No. 4) qRT-PCR SlJUL-VIGS-qRT_F ATTGTTTTGGCGGAAGGGGA(Sequence No. 5) SlJUL-VIGS-qRT_R TCAAAGCTGCTACCACCACC(Sequence No. 6) SlSMXL5-Sl07g018070-qRT_F AGGCCATGCACAGGTTACTC(Sequence No. 7) SlSMXL5-Sl07g018070-qRT_R AGGAGTGGACCAGGACTTGT (Sequence No. 8) SlSUT1-Sl11g017010-qRT_F GGAAGAAGATCGGTGGTGCT(Sequence No. 9) SlSUT1-Sl11g017010-qRT_R AATACCAAGGGCGGCAAAGA(Sequence No. 10) SlSUT2-Sl05g007190-qRT_F TGAAGCAGCAGGAAGTGGAA(Sequence No. 11) SlSUT2-Sl05g007190-qRT_R CCCATCCAAACTGAACCCCA(Sequence No. 12) SlSUT4-Sl04g076960-qRT_F ACTGCCCTGACATGGATTGG (Sequence No. 13) SlSUT4-Sl04g076960-qRT_R CCCCATTTTCGACAGAGCTTC(Sequence No. 14) SlSWEET1a-Sl04g064610-qRT_F TGGTTTAGGAACAGTGCAAC(Sequence No. 15) SlSWEET1a-Sl04g064610-qRT_R TTGCTTCTCCTCTTGGTGAG(Sequence No. 16) SlAPL-Sl12g017370-qRT_F ACCAGACATTTCAGCTGCCT(Sequence No. 17) SlAPL-Sl12g017370-qRT_R GGCTAGCCCTTTTCTTTCCAAG(Sequence No. 18) SlIRX3-Sl07g005840-qRT_F TTGGAGGTGTATCTGCCCAC(Sequence No. 19) SlIRX3-Sl07g005840-qRT_R GATTCCGGCTACAACCCCAA (Sequence No. 20) SlTDR-Sl03g093330-qRT_F ACATGCCTAACGGTAGCCTG(Sequence No. 21) SlTDR-Sl03g093330-qRT_R CAGATCGCCGTCCAGAAGAA(Sequence No. 22) SlGAPDH-qRT_F CTGCTCTCTCAGTAGCCAACAC(Sequence No. 23) SlGAPDH-qRT_R CTTCCTCCAATAGCAGAGGTTT(Sequence No. 24) GFP-fusion composition SlSMXL5-5'UTR-BamH1_F CGGGATCCAACGGAGTAGTAAATTTTCTTTAG(Sequence No. 25) SlSMXL5-'UTR+ATG-Stu1_R AAGGCCTCATAACTTAGATACAACCCCACC(Sequence No. 26) GUS-Fusion Configuration pSlJUL-BamH1_F CGGGATCCGTAAGCAAATTAAGGGCCC(Sequence No. 27) pSlJUL-Sma1_R TCCCCCGGGTTTTTTTCCTATAATAAAAAATAAAAAAGAAT(Sequence No. 28) point mutation SlJUL-R20A_F CTTTCAAAGGAGAGATTCATGCCAAAG(Sequence No. 29) SlJUL-R20A_R CTTTGGCATGAATCTGCCCTTTGAAAG(Sequence No. 30) SlJUL-R81A_F CATAACTTTGCAAGCCGCTCTAGCTGCTTC(Sequence No. 31) SlJUL-R81A_R GAAGCAGCTAGAGGCGCTTGCAAAGTTATG(Sequence No. 32) SlJUL-R151A_F CAACTTTGCTAGTAGGATGGAGTGTTTC(Sequence No. 33) SlJUL-R151A_R GAAACACTCCATCGCACTAGCAAAGTTG(Sequence No. 34) SISMXL5_5'UTR_SDM_F TTACGGTATTAACAACGAAAAAAAATGTAAAAAAAATAAAATTGTATCTAAGTTCCATG(Sequence No. 35) SISMXL5_5'UTR_SDM_R CATGGAACTTAGATACAATTTTATTTTTTTTACATTTTTTTTCGTTGTTAATACCGTAA (SEQ ID NO: 36) Reporter composition SlSMXL5-5'UTR-Stu1_R AAGGCCTAACTTAGATACAACCCCACC(Sequence No. 37) SlSMXL5-5'UTR-SDMStu1_R AAGGCCTAACTTAGATACAATTTTATT(Sequence No. 38) Effector Configuration SlJUL-Sl08g067180-BamH1_F CGGGATCCATGAGCAGACCAGGAG(Sequence No. 39) SlJUL-Sl08g067180-Stu1_R AAGGCCTATATGAAGACTTGTTACCAGC(Sequence No. 40) Genotype analysis SlJUL-GT_F ACTACTGCAAATAACAACTACCAA(Sequence No. 41) SlJUL-GT_R GTATAATATTTGTGTAATACACGTA (Sequence No. 42) Transgene testing GUS_F AACTGGACAAGGCACTAGC(Sequence No. 43) GUS_R CACCGAAGTTCATGCCAGTC (Sequence No. 44) BlpR_F TCTGCACCATCGTCAACCAC(Sequence No. 45) BlpR_R AAACCCACGTCATGCCAGTT (Sequence No. 46) Transgenic plants SlJUL-VIGS-EcoR1_F GGAATTCCCGGTGACTGGTACTGCAAT(Sequence No. 47) SlJUL-VIGS-Stu1_R AAGGCCTCCAGACTTCCATCCAGAGCG(Sequence No. 48) SlPDS-Sl03g123760-VIGS-EcoR1_F GGAATTCGCTGGTAGCGAATCAATG(Sequence No. 49) SlPDS-Sl03g123760-VIGS-EcoR1_R AAGGCCTAACATCCCTTGCCTCC(Sequence No. 50) SlSMXL5-Sl07g018070-VIGS-EcoR1_F GGAATTCATTGGCTCGAGTGATCGCAA(Sequence No. 51) SlSMXL5-Sl07g018070-VIGS-Sma1_R TCCCCCGGGTCAGTCTTGGCCTCGTGTAC(Sequence No. 52) SlJUL-Guide2-Bbs1_TOP ATTGCTAGCTTGAAACAAGTACAA(Sequence No. 53) SlJUL-Guide2-Bbs1_BOTTOM AAACTTGTACTTGTTTCAAGCTAG(Sequence No. 54) SlJUL-Guide5-Bbs1_TOP ATTGTGATTCAATCAAAATATGAG(Sequence No. 55) SlJUL-Guide5-Bbs1_BOTTOM AAACCTCATATTTTGATTGAATCA(Sequence No. 56) SlJUL-sgRNA2_Aar1_TOP GATTGGATGTGGTGAGCCAAGACA(Sequence No. 57) SlJUL-sgRNA2_Aar1_BOTTOM AAACTGTCTTGGCTCACCACATCC (Sequence No. 58)

[0070] 1-3. Protoplast preparation, transient expression analysis, and immunoblotting

[0071] Fully expanded leaves of 3-4 week old Arabidopsis plants were used for protoplast isolation. Mesophyll protoplasts and plasmid DNA were prepared according to published protocols (Hwang and Sheen, 2001). For reporter analysis, 2 x 10 protoplasts were used. 4 It was diluted to a density of cells / mL, and the reporter ( SlSMXL5 5'UTR- GFP , SlSMXL5 5'UTR- LUC or mSlSMXL5 5'UTR- LUC ), effector( 35S:SlJUL::HA or 35S:SlJUL R20 / 81 / 151A ::HA ) and internal control group (for luciferase analysis) 35S:Renilla Transfected with 20 μg of plasmid DNA composed of a combination of ). Transfected protoplasts were incubated at room temperature for 6 hours. For reporter analysis, the relative activity of each gene was measured using a dual luciferase assay consisting of the firefly luciferase assay system (Promega) and the renilla luciferase assay system (Promega).

[0072] To detect target protein levels, total protein was extracted using a protein extraction buffer (50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 5 mM EDTA, 1 mM dithiothreitol, 1x protease inhibitor cocktail (Roche), and 1% Triton X-100). Subsequently, the extracted proteins were separated by SDS-PAGE on an 8-10% polyacrylamide gel, transferred to a nitrocellulose membrane, and then anti-HA ( SlJUL::HA Immuno-observation was performed using 1:2000 (for detection; Roche) or anti-GFP (1:2000 (for detection of SLSMXL5 5'UTR-GFP; Santa Cruz). Rubisco large subunit (RbcL) levels were used as a control.

[0074] 1-4. Confocal Microscopy Analysis

[0075] SlJUL and SlJUL R20 / 81 / 151A To determine the intracellular location of, their coding sequences 35S Transiently expressed in protoplasts by cloning into a vector containing a promoter 35S:SlJUL-GFP Components and 35S:SlJUL R20 / 81 / 151A -GFP Constructs were prepared. Fluorescent GFP signals were visualized and captured using a confocal laser scanning microscope (LSM 800; Carl Zeiss). Fluorescent signals from nuclei stained with chlorophyll and 4',6-diamidino-2-phenylindole (DAPI) were used to determine the cytoplasmic or nuclear localization of target proteins, respectively. Chlorophyll was excited by a laser with a wavelength of 640 nm, and emission spectra were observed at 650 to 700 nm. For DAPI fluorescence detection in protoplasts, samples were treated with 10 μM of DAPI for 10 minutes, using an excitation wavelength of 405 nm and emission wavelengths of 420 to 470 nm.

[0077] 1-5. Histochemical Staining (GUS)

[0078] Images of tissues and organs stained with GUS were captured using a digital camera mounted on an Axioplan 2 microscope (Carl Zeiss) or a Stemi SV 11 Apo stereoscope (Carl Zeiss).

[0080] 1-6. Histological Embedding, Sectioning, and Imaging

[0081] Peduncle, petiole, and anther samples were fixed and dehydrated in FAA fixative (3.7% formaldehyde, 5% acetic acid, and 50% ethanol) at 4°C for 16 hours and embedded in paraffin wax (Paraplast; Leica Microsystems). The fixed samples were sectioned into 5 μm thin sections using a Leica RM2265 microtome (Leica Biosystems). The sections were mounted on poly-L-lysine-coated slides and stained with 0.1% safranin O. Microscopic images were captured using an Axioplan 2 microscope. Measurements and counting were performed using ImageJ software (NIH; https: / / image.j.nih.gov / ij). Peduncles were sampled at 30 days (dpa) after flowering of the first raceme when vascular bundle development was complete. The leaf stalk corresponds to the basal leaf corresponding to the first raceme.

[0083] 1-7. Virus-induced gene silencing

[0084] pTRV2 derived recombinant constructs A. tumefaciens It was transformed into strain GV3101. A. tumefaciens cast pTRV1 ( pYL192 ; Addgene plasmid # 148968; http: / / n2t.net / addgene:148968) or pTRV2 Incubate overnight at 28°C including the composition (OD 600 =0.6), after harvesting, resuspended in 10 mM MES (pH 5.5). Agrobacterium ( Agrobacterium Virulence was induced by adding 100 μM of acetosyringone to a culture suspension and incubating at room temperature for 3 hours. pTRV1 or pTRV2 Containing A. tumefaciens Cell (OD) 600=1.0) was mixed in a 1:1 ratio and inoculated into 3-week-old tomato leaves. Experiments were conducted based on phenotypic or anatomical characteristics up to 6 weeks (30 dpa) after Agrobacterium inoculation. To exclude the effects of TRV infection, target gene suppressor plants were used as vector controls. pTRV-GFP and pTRV1 It was compared with plants simultaneously inoculated. As a positive control for the VIGS experiment. PHYTOENE DESATURASE ( SlPDS ) gene( pTRV-PDS The inhibitory effect on ) was monitored.

[0086] 1-8. qRT-PCR

[0087] Total RNA from flower stalks or leaves of 60-day-old plants using TRIzol TM Separation was performed using reagents (Thermo Fisher Scientific) according to the manufacturer's instructions. Reverse transcription was performed using 1 μg of total RNA, oligo (dT) primers, and ImProm-II reverse transcriptase (Promega). qRT-PCR was performed according to the instructions provided for the SYBR Premix ExTaq system (Takara Bio) and the StepOnePlus Real-Time PCR system (Thermo Fisher Scientific). GLYCERALDEHYDE PHOSPHATE DEHYDROGENASE ( SlGAPDH The expression value of ) was used to normalize the target gene expression level.

[0089] 1-9. Phloem Transport Analysis

[0090] Phloem transport was evaluated in source leaves supporting the first raceme. A small area (~25 mm) located at an equal distance from the leaf margin and the midrib region. 2 The following) was marked on the abaxial surface of a fully expanded leaf. The epidermal layer was gently rubbed with a scalpel, and 10 μL of esculin solution (5 mg / mL; Alfa Aesar) was dropped onto the surface (De Moliner). et al. , 2018; Knox et al. (2018). UV fluorescence showing esculin transport was recorded at 0 and 10 minutes after esculin treatment using the Davinch-Gel imaging system MC-2000 (Davinch-K) under 306-nm UV light conditions. The degree of esculin transport was quantified in terms of relative pixel intensity using ImageJ software.

[0092] 1-10. Measurement of Chlorophyll Fluorescence

[0093] Photosynthetic efficiency of dark-adapted leaves in plants at 30 dpa was measured using an IMAGING-PAM chlorophyll fluorometer (MAXI version, Walz). Measurements per plant were performed on fully expanded young leaves supporting the first raceme. A region of interest with a diameter of 0.5 cm was randomly selected for data recording.

[0095] 1-11. Leaf CO 2 Measurement of assimilation rate

[0096] Net CO2 assimilation rate of basal leaves (μmols) -1 m -2 The instantaneous values ​​of ) were measured using an LI-6400 infrared gas analyzer (LI-COR). Measurements per plant were performed on fully expanded young leaves supporting the first raceme, and 5 to 6 independent plants were used. The measurement chamber conditions were 500 mols -1 flow rate, 1200 μmols -1 m -2 saturated PAR, 400 μmolmol -1 It was controlled with CO2 and a leaf temperature of 24℃.

[0098] 1-12. Plant Phenotypes

[0099] The length and diameter of flower stalks and stems were manually quantified when more than half of the flowers in the inflorescences were open. The size (diameter) and weight of the fruit were measured when it was red and ripe, and the first raceme from the bottom was used to measure the length of the flower stalk. Diameter was measured using an electronic digital vernier caliper (Mitutoyo), and flower stalk lengths were measured using 30 cm and 60 cm standard rulers. The fresh weight of the fruit was recorded using a digital balance (CAS), and the number of leaves, flowers, and fruits was calculated from different genotypes of the same developmental age. The total fresh weight of the plant roots was measured after removing surrounding soil and debris and drying, and the total dry weight was recorded using a digital balance (CAS) after drying. Quantified individual numbers were indicated for each value.

[0101] Experimental Example 2: Experimental Results

[0102] 2-1. Confirmation that the genetic function of JUL1 is conserved in tomatoes and expressed in vascular tissues

[0103] (1) Confirmation of the orthologue of AtJUL1, SlJUL

[0104] To analyze phloem development in tomatoes, we searched for orthologues of AtJUL1, known as a negative regulator of phloem development. As a result of the search, Arabidopsis We identified the Solyc08g067180.3.1 (SlJUL) gene, which encodes a protein that shares 65% (116 / 178) of the same amino acids as the heterologous and three RanBP2-type Zinc finger (ZnF) domains. Each domain contains conserved arginine residues required for RNA binding (R20, R81, and R151 of ZnF1, ZnF2, and ZnF3, respectively) (see Fig. 1).

[0105] In previous studies, AtJUL1 SUPPRESSOR OF MAX2 1-LIKE 5 ( AtSMXL5 It binds to the G-quadruplex in the 5'UTR region of ). AtSMXL5It has been demonstrated that the biosynthesis of the AtSMXL5 protein is inhibited by preventing the transcript from being translated into translation-active ribosomes, and Solyc07g018070.3.1(SlSMXL5) was identified as a heterolog of AtSMXL5. Subsequently, when calculated using a scoring algorithm that predicts the G-score based on the number of G-tetrads and the length of the G-tetrad linkage loop, the G-tetrad of the AtSMXL5 5'UTR was calculated to be 41 points, while the G-tetrad of the SlSMXL5 5'UTR was calculated to be 39 points. This implies that the 5'UTR of SlSMXL5 can also form a G-tetrad.

[0107] (2) Confirmed that SlJUL inhibits the translation of SlSMXL5

[0108] Upon confirming the intracellular localization of SlJUL, it was discovered that SlJUL is located in both the cytoplasm and the nucleus (see Fig. 2). This implies that SlJUL can bind to RNA and prevent target transcripts from being translated by translation-active ribosomes. To verify this, SlSMXL5 We checked whether the binding of SlJUL to the 5'UTR G-quadruple of affects translation.

[0109] First, protoplasts GFP Reporter fused to the upstream of the gene SlSMXL5 Co-transplantation was performed using the 5'UTR and SlJUL as an effector. After transplantation, GFP signal and mRNA levels were measured. As a result, the GFP signal decreased in a concentration-dependent manner with the addition of the SlJUL effector, but no change was observed in GFP mRNA levels (see Fig. 3a).

[0110] Afterwards, the target SlSMXL5 To demonstrate the RNA binding activity of SlJUL against, conserved arginine in SlJUL was mutated to alanine, and SlJUL R20 / 81 / 151A was manufactured. The protoplast SlJUL R20 / 81 / 151A and SlSMXL5As a result of measuring the GFP signal by co-transfecting with 5'UTR fusion GFP, SlSMXL5 A GFP signal similar to that of protoplasts transfected solely with 5'UTR fusion GFP is SlJUL R20 / 81 / 151A It was measured regardless of the concentration (see Fig. 3b).

[0111] Similar to the results above, SlSMXL5 While protoplasts transfected with a 5'UTR fusion luciferase (LUC) reporter showed a decrease in activity in a SlJUL-dependent manner (see Fig. 4a), SlSMXL5 An effector mutated to prevent the formation of G-quadruples in the 5'UTR ( mSlSMXL5 5'UTR) or SlJUL R20 / 81 / 151A It was confirmed that the effector could not inhibit target translation (see Fig. 4b).

[0112] Through the above experiment, the interaction between SlJUL and the G-quadruple motif of RNA and SlSMXL5 The existence of an intact G-quadruple in the 5'UTR SlSMXL5 It was verified that it is essential for SlJUL-dependent inhibition of translation.

[0114] (3) SlJUL Analysis of spatial patterns of expression

[0115] To further analyze the function of SlJUL, in various institutions ranging from the early to late developmental stages SlJUL The spatial pattern of expression was analyzed.

[0116] Analysis of expression profiles by quantitative RT-PCR revealed that in roots, hypocotyls, cotyledons, leaves, stems, flower buds, and fruits SlJUL It was found that transcripts are universally present, and it was confirmed that transcripts are most abundant in flowers (see Fig. 5).

[0117] Subsequently, transgenic tomato plants expressing the GUS reporter gene under the control of the SlJUL promoter were prepared, and histochemical GUS staining was performed.

[0118] As a result of staining, GUS signals were observed in the vascular bundle structures of immature green fruits, red ripe fruits, and anthers (see Figs. 6a and 6b), and in all organs including the pedicel, stamen, style, sepals, and fruit during the embryonic roots of germinating seeds and later developmental stages (see Fig. 6c).

[0119] Through the above experiment, it was verified that SlJUL is universally observed in various organs of plants.

[0121] 2-2. Confirmation of the negative regulatory effect of SlJUL on tomato phloem differentiation

[0122] (1) SlJUL It was confirmed that inhibiting the expression of increases tomato phloem differentiation.

[0123] To confirm the phloem development-regulating effect of SlJUL, using Virus-induced gene silencing (VIGS) technology SlJUL Knocked down TRV-SlJUL We manufactured and compared the vascular bundle structures of these control tomato plants [ TRV-SlPDS ( PHYTOENE DESATURASE ) and TRV-GFP It was compared with ] (see Fig. 7).

[0124] control group and SlJUL As a result of comparing the cross-sections of the flower stalks of knockdown plants, SlJUL The inhibition of TRV-GFP It was confirmed that the total number of phloem cells increased by approximately 1.77 times compared to plants (see Fig. 8).

[0125] Similarly, the phloem marker gene ALTERED PHLOEM DEVELOPMENT ( SlAPL The expression of ) TRV-SlJUL While it increased by approximately 1.82 times in, cambium marker gene ( TDIF RECEPTOR ( TDR )) and xylem marker genes ( IRREGULAR XYLEM 3 ( IRX3The expression of )) did not change (see Fig. 9).

[0126] Additionally, using the CRISPR-Cas9 system, two stable sljul null mutation line( sljul and sljul-d4 ) was manufactured (see Figs. 10a and 10b). TRV-SlJUL Just like knockdown plants, sljul Transgenic plants containing the null allele, compared to the wild type SlAPL It was confirmed that phloem tissues differentiated dramatically, with marker expression increasing approximately 7.74-fold (see Figures 11a and 11b). In contrast, cambium marker genes TDR and xylem marker genes IRX3 The expression of did not change (see Fig. 12).

[0127] Through the above experiment, it was found that SlJUL is an evolutionarily conserved negative regulator of phloem differentiation in tomatoes, and SlJUL It was verified that differentiation of phloem tissue can be induced through the inhibition of expression.

[0129] (2) It was confirmed that inhibiting the RNA binding activity of SlJUL increased tomato phloem differentiation.

[0130] To determine whether the RNA binding activity of SlJUL is necessary for the induction of phloem development, mutant SlJUL R20 / 81 / 151A (35S:SlJUL R20 / 81 / 151A Tomato plants expressing ) were produced.

[0131] The above SlJUL R20 / 81 / 151A The number of phloem cells of transgenic tomato plants expressing and SlAPL As a result of measuring the expression, the number of phloem cells increased by approximately 1.84 times compared to the wild-type control (see Fig. 13), and SlAPL The expression of increased approximately 3.14-fold, but the cambium marker gene TDR and xylem marker genes IRX3 It was confirmed that the expression of did not change (see Fig. 14). The above experimental results are SlJUL R20 / 81 / 151AThis may mean that it functions as a dominant-negative form of SlJUL and competes with wild-type SlJUL when binding to target G-quadruples in plants.

[0132] additionally, SlJUL Target of SlJUL in phloem development using VIGS in knockdown plants SlSMXL5 Plants with inhibited expression were prepared. As a result of measuring the number of phloem cells of the above plants, TRV-SlJUL It was confirmed that the total number of phloem cells decreased compared to tomatoes, but increased compared to the positive control group (see Fig. 15).

[0133] Through the above experiment, SlJUL SlSMXL5 SlJUL- that controls SlSMXL5 It was verified that the regulatory module controls phloem differentiation in plants.

[0135] 2-3. SlJUL Confirmed that the level of inhibition determines plant growth attributes.

[0136] SlJUL To determine whether anatomical changes in plant vascular bundle structures caused by inhibition determine plant morphology or growth properties, knockdown plants ( TRV-SlJUL ), inhibiting plants(35S:SlJUL R20 / 81 / 151A ) and knockout plants( sljul-Cas9 Various growth parameters were measured in ).

[0137] Measurement results, TRV-SlJUL In the case of , no significant changes were observed in the number of leaves, leaf area, stem diameter, number of flowers, pedicel length, pedicel diameter, leaf photosynthetic efficiency, and CO2 assimilation rate compared to the control plant (see Fig. 16). 35S:SlJUL R20 / 81 / 151AIn the case of, compared to the control plant, no significant changes were observed in the number of leaves, leaf area, stem diameter, number of flowers, pedicel diameter, leaf photosynthetic efficiency, and CO2 assimilation rate; however, pedicel length, a measure of the phloem pathway between the source and the sink, was found to have decreased compared to the control plant (see Fig. 17). In contrast, sljul-Cas9 In the case of, there were no significant changes in pedicel diameter, leaf photosynthetic efficiency, and CO2 assimilation rate compared to the control plant, but the number of leaves, leaf area, stem diameter, number of flowers, and pedicel length decreased significantly compared to the control plant (see Fig. 18). The fact that the CO2 assimilation rate did not change despite the decrease in the number of photosynthetic organs is sljul-Cas9 This means that net carbon assimilation in plants has decreased overall.

[0138] Through the above experiment, plant growth attributes were compared between knockdown plants with optimally increased phloem tissue and knockout plants with a large increase in phloem tissue, and through this, it was confirmed that hyperplasia of the phloem can limit the development of tomatoes.

[0140] 2-4. Confirmation of the effect of improved transport capacity due to increased vascular tissue

[0141] (1) SlJUL Confirmed that esculin transport is increased in knockdown and knockout plants

[0142] To determine whether sieve transport capacity improves when the number of sieve cells increases, SlJUL The transport characteristics of basal leaves supplying photoassimilates to fruit trusses in knockdown and knockout plants were analyzed. For the analysis, transport was observed using the ultraviolet fluorescent dye esculin. As a sucrose analog, esculin SUCROSE TRANSPORTER ( SUT Since it is loaded into the phloem by the ) family, it can be used to track phloem transport.

[0143] As a result, the number of phloem cells in the petioles of the basal leaves of knockdown and knockout tomato plants increased (see Figs. 19a to 19c), and the esculin load in the leaf vascular structure increased compared to the control group (see Figs. 20a to 20d).

[0144] Subsequently, the phloem transport velocity and export rate of esculin were measured in the leaf midrib. As a result of the measurements, esculin TRV-SlJUL It reached the base of the midrib within 10 minutes from the leaf, but TRV-GFP It took about 35 minutes in the leaves (see Figs. 21a and 21b). However, the export rate compared to the control group TRV-SlJUL No significant difference was observed in (see Fig. 21c). This is, TRV-SlJUL This may mean that the increased esculin transport is due to an increase in vascular load occurring within the first 10 minutes.

[0146] (2) SlJUL Confirmed that the expression of sucrose transporter genes is increased in knockdown and knockout plants.

[0147] The loading mechanism of the active phloem involves sugar transporters. Specifically, sugar transporters such as the SUT and SWEET (SUGARS WILL EVENTUALLY BE EXPORTED TRANSPORTERS) families play an important role in releasing carbon fixed by photosynthesis in root leaves and transporting sucrose into the phloem or to storage tissues such as fruits.

[0148] Accordingly, the transcription levels of key genes involved in sucrose transport in root leaves were measured using qRT-PCR.

[0149] Measurement results, TRV-SlJUL In the case of SlSUT1 , SlSUT2 , SlSUT4 and SlSWEET1aThe expression of increased by 1.66-, 1.62-, 1.78-, and 1.36-fold compared to the control group, respectively (see Fig. 22a), and 35S:SlJUL R20 / 81 / 151A In the case of, SUT1 The expression of increased 3.54-fold compared to the control group (see Fig. 22b), and sljul-Cas9 In the case of SUT1 The expression of increased 3.83-fold compared to the control group (see Fig. 22c).

[0150] In addition, since long-distance transport is affected by the length and radius of the sieve element, TRV-SlJUL and TRV-GFP These characteristics were measured in the longitudinal section of the plants, but no measurable difference was found in the sieve tubes of the two plants (see Figs. 23a and 23b).

[0151] Through the above experiments, SlJUL It was verified that increased phloem cell populations in knockdown or knockout plants increase phloem transport capacity.

[0153] 2-5. Confirmed that the phloem threshold determines the fruit storage capacity of tomatoes.

[0154] To determine whether increased phloem flow affects yield, the average number of fruits per plant, fruit size, and fruit weight were measured.

[0155] Measurement results, TRV-SlJUL Knockdown plants are TRV-GFP Compared to, there was no significant difference in fruit size, but the number of fruits increased by about 37%, and due to the increased number of fruits, the total fruit weight increased by about 60% (see Fig. 24).

[0156] Additionally, SlJUL SlSMXL5 In order to determine whether adjusting it increases fruit yield, TRV-SlJUL from plants TRV-SlSMXL5 Using SlSMXL5 Plants that inhibited TRV-SlSMXL5 / TRV-SlJUL After manufacturing, the fruit yield was measured.

[0157] Measurement results, SlSMXL5 Plants that inhibited TRV-SlSMXL5 / TRV-SlJUL The fruit yield is TRV-GFP It was measured at a level similar to that of the control plant (see Fig. 24). As described above TRV-SlJUL The number of fruits in plants TRV-GFP The significant increase compared to plants is TRV-SlJUL This can be attributed to a decrease in the proportion of abortive flowers / fruits in plants (see Fig. 25), and this phenomenon is SlJUL This is interpreted as being due to an increase in the phototactic allocation ratio in the inflorescence storage of knockdown plants.

[0158] also, TRV-SlJUL The total sugar content of the fruit TRV-GFP It was confirmed that it increased by up to 25% compared to the negligence. Specifically, TRV-SlJUL Negligence is TRV-GFP The glucose and fructose content were 28% and 22% higher, respectively, than in fruit (see Fig. 26).

[0159] yes, TRV-SlJUL The total fresh weight and dry weight of plant roots TRV-GFP It was confirmed that it increased significantly compared to the roots (see Fig. 27).

[0160] Meanwhile, 35S:SlJUL R20 / 81 / 151A In the case of the plants, the number of fruits increased by 51% compared to the control group, but the fruit size was smaller, so the total fruit weight did not show a significant difference from the control group (see Fig. 28).

[0161] sljul-Cas9 In the case of the knockout plants, unlike the knockdown plants, plant growth was weakened compared to the control group, the number of flowers decreased, and the number of fruits decreased significantly, but the size of the fruits was observed to be larger (see Figures 29a and 29b). This means that there is a trade-off between the number of fruits and the size of the fruits due to increased storage competition for the cantilevered plants.

[0162] In addition, to determine the degree of energy distribution to the storage area when sufficient resources were provided to tomatoes with increased phloem, tomato plants were pruned to reduce competition and create fruit growth conditions that did not impair fruit growth. TRV-SlJUL Plants and control group TRV-GFP All plants were adjusted to have 10 fruits per plant, and fruit size and weight were measured as indicators of storage biomass (see Fig. 30).

[0163] Measurement results, TRV-SlJUL Fruit size and weight in the plants increased significantly by up to 24% and 66%, respectively, compared to the control group fruits (see Fig. 31). This indicates that the remaining fruit after pruning TRV-SlJUL negligence or sljul-Cas9 This means that the scarcity of fruit can accumulate more biomass.

[0164] Through the above experiment, SlJUL It was confirmed that inhibiting expression increases the phloem cell population, thereby improving the storage capacity of tomatoes, and that there is a correlation between the increase in phloem and the increase in transport capacity. In addition, it was verified that fruit is more limited by resource supply than by storage capacity.

[0165] Knockdown plant confirmed through the above examples ( TRV-SlJUL ), dominant-negative function plants (35S:SlJUL R20 / 81 / 151A ) and knockout plants( sljul-Cas9 As a result of summarizing the comprehensive comparison results regarding phloem cell count, phloem marker gene expression, transport capacity, and fruit yield in ), TRV-SlJUL It was confirmed that the plant exhibited the highest fruit yield (see Fig. 32). Therefore, SlJUL Gene knockdown plant TRV-SlJUL It can be usefully utilized as a tomato variety with increased fruit yield.

Claims

Claim 1 A composition for enhancing the sink strength of a plant's sink tissue, comprising an expression inhibitor of a SlJUL protein or a gene encoding a SlJUL protein, wherein the expression inhibitor is a vector comprising a SlJUL mutant protein or a SlJUL mutant gene with inhibited RNA binding activity, and wherein the SlJUL mutant is a SlJUL R20A / R81A / R151A The above-mentioned plant is a tomato, and the above-mentioned composition is a composition that increases the expression of one or more genes selected from the group consisting of SlSUT1, SlSUT2, SlSUT4, and SlSWEET1a. Claim 2 delete Claim 3 delete Claim 4 In claim 1, the SlJUL protein SlSMXL5 ( SUPPRESSOR OF MAX2 1-LIKE5 ) binds to the 5'UTR (Untranslated region) of mRNA and the above SlSMXL5 A composition that inhibits the expression of Claim 5 In claim 4, the SlJUL protein is the SlSMXL5 A composition that binds to the 5'UTR of mRNA to form an RNA G-quadruplex. Claim 6 A composition according to claim 1, wherein the composition increases the number of phloem cells of a plant. Claim 7 In claim 1, the composition is SlAPL A composition that increases gene expression. Claim 8 A composition according to claim 1, wherein the composition increases the phloem transport rate of a plant. Claim 9 delete Claim 10 A composition according to claim 1, wherein the composition increases the fruit yield of a plant. Claim 11 A composition according to claim 1, wherein the composition increases the sugar content of the fruit of a plant. Claim 12 A composition according to claim 1, wherein the composition increases the total fresh weight and dry weight of the plant root. Claim 13 delete Claim 14 A method for enhancing the sink strength of a plant's sink tissue, comprising the step of treating a plant body with the composition of claim 1. Claim 15 A plant body in which the sink strength of the plant’s sink tissue is enhanced according to the method of claim 14.