Angiopoietin-like 3(angptl3) irna compostions and methods of use thereof

KR103000620B1Active Publication Date: 2026-08-05알닐람파마슈티칼스인코포레이티드
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
KR · KR
Patent Type
Patents
Current Assignee / Owner
알닐람파마슈티칼스인코포레이티드
Filing Date
2012-06-20
Publication Date
2026-08-05

Smart Images

  • Figure 112023075000742-PAT00058_ABST
    Figure 112023075000742-PAT00058_ABST
Patent Text Reader

Abstract

The present invention provides an iRNA composition that causes RNA-induced silencing complex (RISC)-mediated cleavage of the RNA transcript of the ANGPL3 gene to occur. The ANGPL3 gene may be present in cells, e.g., within a subject such as a human. Furthermore, the present invention provides a method of using the iRNA composition of the present invention to treat a subject who suffers from or is prone to lipid metabolism disorders, such as a subject who suffers from or is prone to hyperlipidemia or hypertriglyceridemia, by suppressing the expression of the ANGPL3 gene and / or benefiting from the suppression or reduction of the expression of the ANGPL3 gene.
Need to check novelty before this filing date? Find Prior Art

Description

Technology Field

[0001] This application claims priority to U.S. Provisional Application No. 61 / 499,620 filed June 21, 2011 and U.S. Provisional Application No. 61 / 638,288 filed April 25, 2012, the full contents of each of which are incorporated herein by reference.

[0002] [Ranking List]

[0003] The application is submitted via EFS-Web in ASCII format and includes a list of sequences, the entirety of which is incorporated herein by reference. The name of the above ASCII copy, created on July 11, 2012, is 12130100.txt, and its size is 444,346 bytes. Background Technology

[0004] Angiopoietin-like 3 (ANGPTL3) is a component of the angiopoietin-like family of secreted factors that regulates lipid metabolism and is dominantly expressed in the liver (Koishi, R. et al., (2002) Nat. Genet. 30(2):151-157). ANGPTL3 bilaterally inhibits the catalytic activity of lipoprotein lipase (LPL), which catalyzes the hydrolysis of triglycerides, and the catalytic activity of endothelial lipase (EL), which hydrolyzes high-density lipoprotein (HDL) phospholipids. In KK / Snk mice that are obese despite hypolipidemia, a decrease in ANGPTL3 expression has a protective effect against hyperlipidemia and atherosclerosis by promoting triglyceride clearance (Ando etc. , (2003) J. Lipid Res. , 44:1216-1223). Human ANGPTL3 plasma concentration is positively correlated with plasma HDL cholesterol and HDL phospholipid levels (Shimamura et al., (2007) Arterioscler. Thromb. Vasc. Biol. , 27:366-372).

[0005] Lipid metabolic disorders can lead to elevated serum lipid levels, such as triglycerides and / or cholesterol. Elevated serum lipids are strongly associated with hypertension, cardiovascular disease, diabetes, and other pathological conditions. Hypertriglyceridemia is an example of a lipid metabolic disorder characterized by high blood levels of triglycerides. Hypertriglyceridemia is associated with atherosclerosis even in the absence of high cholesterol levels (hypercholesterolemia). When triglyceride concentrations are excessive (e.g., exceeding 100 mg / dl or 12 mmol / l), hypertriglyceridemia can lead to pancreatitis. Hyperlipidemia is another example of a lipid metabolic disorder characterized by elevated levels of any one or all lipids and / or lipoproteins in the blood. Current treatments for lipid metabolic disorders, including diet, exercise, and therapy with statins and other medications, are not always effective. Therefore, there is a need in the industry for alternative treatments for patients with lipid metabolic disorders. The problem to be solved

[0006] The present invention provides an iRNA composition that causes RNA-induced silencing complex (RISC)-mediated cleavage of the RNA transcript of the ANGPL3 gene to occur. The ANGPL3 gene may be present in cells, e.g., within a subject such as a human. Furthermore, the present invention provides a method of using the iRNA composition of the present invention to treat a subject who suffers from or is prone to lipid metabolism disorders, such as a subject who suffers from or is prone to hyperlipidemia or hypertriglyceridemia, by suppressing the expression of the ANGPL3 gene and / or benefiting from the suppression or reduction of the expression of the ANGPL3 gene. means of solving the problem

[0007] Accordingly, in one embodiment, the present invention provides double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of ANGPTL3. The dsRNA comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO:1 by 3 nucleotides or less, and the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO:5 by 3 nucleotides or less.

[0008] In another aspect, the present invention provides double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of ANGPTL3. The dsRNA comprises a sense strand and an antisense strand, wherein the antisense strand comprises a complementary region comprising at least 15 consecutive nucleotides that differ from any one of the antisense strands listed in Tables 2, 3, 7, 8, 9 and 10 by 3 nucleotides or fewer.

[0009] In one embodiment, the sense and antisense strands comprise sequences selected from the group consisting of AD-53063.1, AD-53001.1, AD-53015.1, AD-52986.1, AD-52981.1, AD-52953.1, AD-53024.1, AD-53033.1, AD-53030.1, AD-53080.1, AD-53073.1, AD-53132.1, AD-52983.1, AD-52954.1, AD-52961.1, AD-52994.1, AD-52970.1, AD-53075.1, AD-53147.1, and AD-53077.1 of Tables 7 and 8.

[0010] In specific embodiments of the present invention, the dsRNA comprises at least one modified nucleotide. In one embodiment, at least one of the modified nucleotides is selected from the group consisting of a 2'-O-methyl modified nucleotide, a nucleotide containing a 5'-phosphorothioate group and a cholesteryl derivative or a terminal nucleotide connected to a dodecanoic acid bisdecylamide group. In another embodiment, the modified nucleotide is selected from the group consisting of a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, and a non-natural base including a nucleotide.

[0011] The complementary region of the above dsRNAs may be at least 17 nucleotides long, 19 to 21 nucleotides long, or 19 nucleotides long.

[0012] In one embodiment, each strand of dsRNA has a length of 30 nucleotides or less.

[0013] At least one strand of dsRNA may include at least one nucleotide or a 3' overhang of at least two nucleotides.

[0014] In certain embodiments, the dsRNA further comprises a ligand. In one embodiment, the ligand is conjugated to the 3' end of the sense strand of the dsRNA.

[0015] In some embodiments, the ligand is one or more N-acetylgalactosamines (GalNAc) attached via a divalent or trivalent branched linker. In certain embodiments, the ligand is

[0016] am.

[0017] In some embodiments, the RNAi agonist is conjugated to the ligand as shown in the following reaction scheme.

[0018] .

[0019] In some embodiments, the RNAi agent further comprises at least one phosphorothioate or methylphosphonate internucleotide bond. In some embodiments, the phosphorothioate or methylphosphonate internucleotide bond is at the 3' end of one strand. In some embodiments, the strand is the antisense strand. In other embodiments, the strand is the sense strand.

[0020] In one embodiment, the complementary region of the dsRNA is composed of one of the antisense sequences of Tables 2, 3, 7, 8, 9 and 10.

[0021] In another embodiment, the dsRNA comprises a sense strand consisting of a sense strand sequence selected from the sequences of Tables 2, 3, 7, 8, 9 and 10, and an antisense strand consisting of an antisense sequence selected from the sequences of Tables 2, 3, 7, 8, 9 and 10.

[0022] In another aspect, the present invention provides a cell, e.g., a liver cell, comprising the dsRNA of the present invention.

[0023] In another aspect, the present invention provides a vector encoding at least one strand of dsRNA, wherein the dsRNA comprises a region of complementarity to at least a portion of mRNA encoding ANGPTL3, the dsRNA has a length of 30 base pairs or less, and the dsRNA provides a vector that targets mRNA for cleavage. The region of complementarity may have a length of at least 15 nucleotides or a length of 19 to 21 nucleotides.

[0024] In another embodiment, the present invention provides a cell comprising a vector encoding at least one strand of dsRNA, wherein the dsRNA comprises a region of complementarity to at least a portion of mRNA encoding ANGPTL3, the dsRNA has a length of 30 base pairs or less, and the dsRNA comprises a vector targeting mRNA for cleavage.

[0025] In one embodiment, the present invention provides a pharmaceutical composition for inhibiting the expression of the ANGPTL 3 gene comprising the dsRNA or vector of the present invention.

[0026] In one embodiment, the pharmaceutical composition comprises a lipid formulation such as MC3, SNALP, or XTC formulation.

[0027] In another aspect, the present invention provides a method for inhibiting ANGPTL3 expression in a cell. The method comprises the steps of contacting the cell with the dsRNA or vector of the present invention, and maintaining the generated cell for a time sufficient to obtain degradation of the mRNA transcript of the ANGPTL3 gene, thereby inhibiting the expression of the ANGPTL3 gene in the cell.

[0028] The above cells may be present in a human subject, for example, a human subject suffering from a lipid metabolism disorder, such as hyperlipidemia or hypertriglyceridemia.

[0029] In one embodiment of the method of the present invention, ANGPTL3 expression is inhibited by at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0030] In another aspect, the present invention provides a method for treating a subject having a lipid metabolism disorder, such as hyperlipidemia or hypertriglyceridemia, which benefits from a reduction in ANGPTL3 expression. The method comprises the step of treating the subject by administering a therapeutically effective amount of the dsRNA or vector of the present invention to the subject.

[0031] The above disease may be a lipid metabolism disorder such as hyperlipidemia or hypertriglyceridemia.

[0032] In one embodiment, administration of the dsRNA to the subject results in a reduction in the levels of serum lipids, triglycerides, cholesterol, and / or free fatty acids; and / or a reduction in the accumulation of ANGPTL3 protein. In one embodiment, administration of the dsRNA to the subject results in a reduction in the levels of LDL-C, HDL-C, VLDL-C, IDL-C, and / or total cholesterol.

[0033] In one embodiment, the dsRNA is about 0.01 mg / kg to about 10 mg / kg, e.g., about 0.05 mg / kg to about 5 mg / kg, about 0.05 mg / kg to about 10 mg / kg, about 0.1 mg / kg to about 5 mg / kg, about 0.1 mg / kg to about 10 mg / kg, about 0.2 mg / kg to about 5 mg / kg, about 0.2 mg / kg to about 10 mg / kg, about 0.3 mg / kg to about 5 mg / kg, about 0.3 mg / kg to about 10 mg / kg, about 0.4 mg / kg to about 5 mg / kg, about 0.4 mg / kg to about 10 mg / kg, about 0.5 mg / kg to about 5 mg / kg, about 0.5 mg / kg to about 10 mg / kg, about 1 mg / kg to about 5 mg / kg, about 1 mg / kg to about 10 mg / kg, about 1.5 mg / kg to about 5 mg / kg, about 1.5 mg / kg to about 10 mg / kg, about 2 mg / kg to about 2.5 mg / kg, about 2 mg / kg to about 10 mg / kg, about 3 mg / kg to about 5 mg / kg, about 3 mg / kg to about 10 mg / kg, about 3.5 mg / kg to about 5 mg / kg, about 4 mg / kg to about 5 mg / kg, about 4.5 mg / kg to about 5 mg / kg, about 4 mg / kg to about 10 mg / kg, about 4.5 mg / kg to about 10 mg / kg, about 5 mg / kg to about 10 mg / kg, about 5.5 mg / kg to about 10 mg / kg, about 6 mg / kg to about 10 mg / kg, about 6.5 mg / kg to about 10 It is administered at doses of mg / kg, about 7 mg / kg to about 10 mg / kg, about 7.5 mg / kg to about 10 mg / kg, about 8 mg / kg to about 10 mg / kg, about 8.5 mg / kg to about 10 mg / kg, about 9 mg / kg to about 10 mg / kg, or about 9.5 mg / kg to about 10 mg / kg.Intermediate values ​​and ranges of the cited values ​​are also intended as part of the present invention.

[0034] For example, the above dsRNA is approximately 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8. 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8. 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8. 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8. 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8. 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8. It may be administered at a dose of 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or about 10 mg / kg. Intermediate values ​​and ranges to the cited values ​​are also intended as part of the invention.

[0035] In another embodiment, the dsRNA is about 0.5 to about 50 mg / kg, about 0.75 to about 50 mg / kg, about 1 to about 50 mg / mg, about 1.5 to about 50 mg / kb, about 2 to about 50 mg / kg, about 2.5 to about 50 mg / kg, about 3 to about 50 mg / kg, about 3.5 to about 50 mg / kg, about 4 to about 50 mg / kg, about 4.5 to about 50 mg / kg, about 5 to about 50 mg / kg, about 7.5 to about 50 mg / kg, about 10 to about 50 mg / kg, about 15 to about 50 mg / kg, about 20 to about 50 mg / kg, about 20 to about 50 mg / kg, about 25 to about 50 mg / kg, about 25 to about 50 mg / kg, about 30 to about 50 mg / kg, about 35 to about 50 mg / kg, about 40 to about 50 mg / kg, about 45 to about 50 mg / kg, about 0.5 to about 45 mg / kg, about 0.75 to about 45 mg / kg, about 1 to about 45 mg / mg, about 1.5 to about 45 mg / kb, about 2 to about 45 mg / kg, about 2.5 to about 45 mg / kg, about 3 to about 45 mg / kg, about 3.5 to about 45 mg / kg, about 4 to about 45 mg / kg, about 4.5 to about 45 mg / kg, about 5 to about 45 mg / kg, about 7.5 to about 45 mg / kg, about 10 to about 45 mg / kg, about 15 to about 45 mg / kg, about 20 to about 45 mg / kg, about 20 to about 45 mg / kg, about 25 to about 45 mg / kg, about 25 to about 45 mg / kg, about 30 to about 45 mg / kg, about 35 to about 45 mg / kg, about 40 to about 45 mg / kg, about 0.5 to about 40 mg / kg, about 0.75 to about 40 mg / kg, about 1 to about 40 mg / mg, about 1.5 to about 40 mg / kb, about 2 to about 40 mg / kg, about 2.5 to about 40 mg / kg, about 3 to about 40 mg / kg, about 3.5 to about 40 mg / kg, about 4 to about 40 mg / kg, about 4.5 to about 40 mg / kg, about 5 to about 40 mg / kg, about 7.5 to about 40 mg / kg, about 10 to about 40 mg / kg, about 15 to about 40 mg / kg, about 20 to about 40 mg / kg, about 20 to about 40 mg / kg, about 25 to about 40 mg / kg, about 25 to about 40 mg / kg, about 30 to about 40 mg / kg, about 35 to about 40 mg / kg, about 0.5 to about 30 mg / kg, about 0.75 to about 30 mg / kg, about 1 to about 30 mg / mg, about 1.5 to about 30 mg / kb, about 2 to about 30 mg / kg, about 2.5 to about 30 mg / kg, about 3 to about 30 mg / kg, about 3.5 to about 30 mg / kg, about 4 to about 30 mg / kg, about 4.5 to about 30 mg / kg, about 5 to about 30 mg / kg, about 7.5 to about 30 mg / kg, about 10 to about 30 mg / kg, about 15 to about 30 mg / kg, about 20 to about 30 mg / kg, about 20 to about 30 mg / kg, about 25 to about 30 mg / kg, about 0.5 to about 20 mg / kg, about 0.75 to about 20 mg / kg, about 1 to about 20 mg / mg, about 1.5 to about 20 mg / kb, about 2 to about 20 mg / kg, about It is administered at doses of 2.5 to about 20 mg / kg, about 3 to about 20 mg / kg, about 3.5 to about 20 mg / kg, about 4 to about 20 mg / kg, about 4.5 to about 20 mg / kg, about 5 to about 20 mg / kg, about 7.5 to about 20 mg / kg, about 10 to about 20 mg / kg, or about 15 to about 20 mg / kg. Intermediate values ​​and ranges to the cited values ​​are also intended as part of the present invention.

[0036] For example, the subject receives a therapeutic dose of iRNA, e.g., about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8. 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8. 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8. 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8. 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8. 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8. It may be administered at 9.9, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or at about 50 mg / kg. Intermediate values ​​and ranges of the cited values ​​are also intended as part of the present invention.

[0037] In another aspect, the present invention provides a method for suppressing ANGPTL3 expression in a subject. The method comprises the step of administering a therapeutically effective amount of the dsRNA or vector of the present invention to the subject to suppress the expression of ANGPTL3 in the subject.

[0038] In another aspect, the present invention provides a kit for carrying out the method of the present invention. In one aspect, the present invention provides a kit for carrying out a method of inhibiting the expression of the ANGPTL3 gene in said cell by contacting said cell with a double-stranded RNAi agonist in an amount effective for inhibiting the expression of ANGPTL3 in said cell. The kit comprises an RNAi agonist, instructions for use, and optionally, means for administering said RNAi agonist to a subject. Brief explanation of the drawing

[0039] Figure 1 is a schematic diagram of the experimental procedure used for the in vivo test described in Example 2. Figure 2, Panel A is a graph showing the measured levels of ANGPTL3 protein in WT mice or controls after treatment with the indicated iRNA. Figure 2, Panel B is a graph showing the measured levels of ANGPTL3 protein in ob / ob mice or controls after treatment with the indicated iRNA. Figure 3, Panel A is a graph showing the measured levels of LDL-c in WT mice or controls after treatment with the indicated iRNA. Figure 3, Panel B is a graph showing the measured levels of LDL-c in ob / ob mice or controls after treatment with the indicated iRNA. Figure 4, Panel A is a graph showing the measured levels of triglycerides in WT mice or controls after treatment with the indicated iRNA. Figure 4, Panel B is a graph showing the measured levels of triglycerides in ob / ob mice or controls after treatment with the indicated iRNA. Figure 5, Panel A is a graph showing the measured levels of total cholesterol (TC) in WT mice or control groups after treatment with the indicated iRNA. Figure 5, Panel B is a graph showing the measured levels of total cholesterol (TC) in ob / ob mice or control groups after treatment with the indicated iRNA. Figure 6, Panel A is a graph showing the measured levels of HDL-c in WT mice or controls after treatment with the indicated iRNA. Figure 6, Panel B is a graph showing the measured levels of HDL-c in ob / ob mice or controls after treatment with the indicated iRNA. Figure 7 is a graph showing the measured levels of ANGPTL3 protein in human PCS transgenic mice or controls after treatment with a single dose of the indicated iRNA. Specific details for implementing the invention

[0040] The present invention provides an iRNA composition that causes RNA-induced silencing complex (RISC)-mediated cleavage of the RNA transcript of the ANGPTL3 gene to occur. The ANGPTL3 gene may be present in cells, e.g., within a subject such as a human. Furthermore, the present invention provides a method of using the iRNA composition of the present invention to suppress the expression of the ANGPTL3 gene and / or to treat a subject with a lipid metabolism disorder, e.g., hyperlipidemia or hypertriglyceridemia, which benefits from the suppression or reduction of the expression of the ANGPTL3 gene.

[0041] The iRNA of the present invention has a length of about 30 nucleotides or less, for example, a length of 15 to 30, 15 to 29, 15 to 28, 15 to 27, 15 to 26, 15 to 25, 15 to 24, 15 to 23, 15 to 22, 15 to 21, 15 to 20, 15 to 19, 15 to 18, 15 to 17, 18 to 30, 18 to 29, 18 to 28, 18 to 27, 18 to 26, 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 18 to 20, 19 to 30, 19 to 29, 19 to 28, 19 to It comprises an RNA strand (antisense strand) having a region which is 27, 19 to 26, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 19 to 20, 20 to 30, 20 to 29, 20 to 28, 20 to 27, 20 to 26, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 21 to 30, 21 to 29, 21 to 28, 21 to 27, 21 to 26, 21 to 25, 21 to 24, 21 to 23, or 21 to 22 nucleotides, wherein the region is substantially in at least a portion of the mRNA transcript of the ANGPTL3 gene They are complementary. The use of these iRNAs enables the targeted degradation of mRNA of the ANGPTL3 gene in mammals. In particular, very low doses of ANGPTL3 iRNA can significantly suppress the expression of the ANGPTL3 gene by specifically and efficiently mediating RNA interference (RNAi). Using cell-based analysis methods, the inventors have demonstrated that iRNA targeting ANGPTL3 can significantly suppress the expression of the ANGPTL3 gene by mediating RNAi.Therefore, methods and compositions containing this iRNA are useful for treating subjects who benefit from a decrease in the level and / or activity of ANGPTL3 protein, such as subjects with lipid metabolism disorders like hyperlipidemia or hypertriglyceridemia.

[0042] The following detailed description discloses compositions and methods for treating subjects with diseases and conditions who benefit from the suppression and / or reduction of ANGPTL3 gene expression, as well as methods for preparing and using compositions containing iRNA that suppresses ANGPTL3 gene expression.

[0043] I. Definition

[0044] To facilitate a better understanding of the present invention, specific terms are defined first. Additionally, it should be noted that whenever a parameter value or range of values ​​is cited, intermediate values ​​and ranges to the cited value are also intended to be part of the present invention.

[0045] The articles “a” and “an” are used herein to refer to one or more than one (e.g., at least one) of the grammatical objects of the article. For example, “one component” means one component or more than one component, such as multiple components.

[0046] The term “including” is used herein to mean the phrase “including but not limited thereto,” and is used interchangeably with said phrase. The term “or” is used herein to mean the term “and / or,” and is used interchangeably with said term, unless the context clearly indicates otherwise.

[0047] Unless otherwise specified, the term “ANGPTL3” refers to an angiopoietin-like 3 protein having an amino acid sequence derived from any vertebrate or mammalian source, including but not limited to humans, cattle, chickens, rodents, mice, rats, pigs, sheep, primates, monkeys, and guinea pigs. The term also refers to fragments and variants of natural ANGPTL3 that retain at least one in vivo or in vitro activity of natural ANGPTL3. The term includes the mature form derived from post-translational cleavage of a signal peptide and the form derived from proteolysis of the fibrinogen-like domain, as well as the full-length untreated precursor form of ANGPTL3. The sequence of the human ANGPTL3 mRNA transcript can be found, for example, in Gene Bank Approval No. GI: ​​41327750 (NM_ 014495.2; SEQ ID NO: 1). The predicted sequence of the rhesus ANGPTL3 mRNA is, for example, in Gene Bank Approval No. The sequence of mouse ANGPTL3 mRNA can be found at GI: 297278846 (XM_001086114.2; SEQ ID NO:2). For example, the sequence of mouse ANGPTL3 mRNA can be found at gene bank approval number GI:142388354 (NM_ 013913.3; SEQ ID NO:3). The sequence of mouse ANGPTL3 mRNA can be found at gene bank approval number GI: 68163568 (NM_001025065.1; SEQ ID NO:4).

[0048] As used herein, the term “ANGPTL3” also refers to specific polypeptides expressed within cells by naturally occurring DNA sequence variants of the ANGPTL3 gene, such as single nucleotide polymorphisms. Numerous SNPs within the ANGPTL3 gene have been identified and can be found, for example, in NCBI dbSNP (see, e.g., www.ncbi.nlm.nih.gov / snp). Non-limiting examples of SNPs within the ANGPTL3 gene are NCBI dbSNP approval numbers rs193064039; rs192778191; rs192764027; rs192528948; rs191931953; rs191293319; rs191171206; rs191145608; rs191086880; It can be found in rs191012841; or rs190255403.

[0049] As used herein, the “target sequence” refers to a continuous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of the ANGPTL3 gene, including mRNA which is the product of RNA processing of the primary transcription product. In one embodiment, the target portion of said sequence will be at least long enough to serve as a substrate for iRNA-directed cleavage in or near the portion of the nucleotide sequence of the mRNA molecule formed during the transcription of the ANGPTL3 gene.

[0050] The target sequence may have a length of about 9 to 36 nucleotides, for example, a length of about 15 to 30 nucleotides. For example, the target sequence has a length of about 15 to 30 nucleotides, 15 to 29, 15 to 28, 15 to 27, 15 to 26, 15 to 25, 15 to 24, 15 to 23, 15 to 22, 15 to 21, 15 to 20, 15 to 19, 15 to 18, 15 to 17, 18 to 30, 18 to 29, 18 to 28, 18 to 27, 18 to 26, 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 18 to 20, 19 to 30, 19 to 29, 19 to 28, 19 to 27, 19 It may be up to 26, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 19 to 20, 20 to 30, 20 to 29, 20 to 28, 20 to 27, 20 to 26, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 21 to 30, 21 to 29, 21 to 28, 21 to 27, 21 to 26, 21 to 25, 21 to 24, 21 to 23, or 21 to 22 nucleotides. Intermediate ranges and lengths to the above-mentioned ranges and lengths are also considered as part of the present invention.

[0051] The term “strand containing a sequence” as used herein refers to an oligonucleotide containing a chain of nucleotides described by a sequence designated using standard nucleotide nomenclature.

[0052] "G," "C," "A," "T," and "U" each generally represent nucleotides containing guanine, cytosine, adenine, thymidine, and uracil, respectively, as bases. However, it will be understood that the terms “ribonucleotide” or “nucleotide” may also refer to modified nucleotides or surrogate replacement moiety, as further elaborated below. Those skilled in the art will be fully aware that guanine, cytosine, adenine, and uracil may be replaced by other moiety without substantially altering the base-pairing properties of the oligonucleotide, including nucleotides possessing these replacement moiety. For example, without limitation, a nucleotide containing inosine as a base may base-pair with a nucleotide containing adenine, cytosine, or uracil. Accordingly, nucleotides containing uracil, guanine, or adenine may be replaced, for example, by nucleotides containing inosine within the nucleotide sequence of the dsRNA characterized in the present invention. In other embodiments, adenine and cytosine somewhere within the oligonucleotide may be replaced by guanine and uracil, respectively, to form a GU wobble base pairing with the target mRNA. Sequences containing such replacement moiety are suitable for the compositions and methods characterized in the present invention.

[0053] The terms “iRNA,” “RNAi agonist,” “iRNA agonist,” and “RNA interferer” as used interchangeably herein refer to agonists comprising RNA as defined herein and mediating the targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. iRNA directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). iRNA regulates, for example, inhibits the expression of ANGPTL3 in cells within subjects, such as mammalian subjects.

[0054] In one embodiment, the RNAi agonist of the present invention comprises a single-stranded RNA that interacts with a target RNA sequence, e.g., an ANGPTL3 target mRNA sequence, which directs the cleavage of the target RNA. Without being bound by theory, long double-stranded RNA introduced into a cell is degraded into siRNA by a type III endonuclease known as Dicer (Sharp et al., Genes Dev. 2001, 15:485). Dicer, a ribonuclease-III-like enzyme, treats dsRNA with 19 to 23 base pairs of single interfering RNA having characteristic two base 3' overhangs (Bernstein et al., (2001) Nature 409:363). Subsequently, the siRNA is incorporated into an RNA-induced silencing complex (RISC), wherein one or more helicases unwind the siRNA duplex so that the complementary antisense strand can guide target recognition (Nykanen et al., (2001) Cell 107:309). Upon binding to a suitable target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir et al., (2001) Genes Dev.15:188). Accordingly, in one embodiment, the present invention relates to a single-stranded RNA (siRNA) that occurs within a cell and promotes the formation of a RISC complex that causes silencing of a target gene, namely the ANGPTL3 gene. Accordingly, the term “siRNA” is used herein to refer to the RNA described above.

[0055] In another embodiment, the RNAi agent is a single-stranded antisense RNA molecule. The antisense RNA molecule is complementary to the sequence within the target mRNA. The antisense RNA can inhibit translation in a stoichiometric manner by base pairing with the mRNA and physically blocking the translation process, Dias, N. et al. (2002) Mol. Cancer Ther.See 1:347-355. A single-stranded antisense RNA molecule may have a length of about 13 to about 30 nucleotides and may have a sequence complementary to a target sequence. For example, a single-stranded antisense RNA molecule may comprise a sequence of at least about 13, 14, 15, 16, 17, 18, 19, 20 or more consecutive nucleotides from one of the antisense sequences in Tables 2, 3, 7, 8, 9 and 10.

[0056] In other embodiments, the “iRNA” used in the compositions and methods of the present invention is double-stranded RNA, referred herein as “double-stranded RNAi agonist,” “double-stranded RNA (dsRNA) molecule,” “dsRNA agonist,” or “dsRNA.” The term “dsRNA” refers to a complex of ribonucleic acid molecules having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations toward the target RNA, namely the ANGPTL3 gene. In some embodiments of the present invention, the double-stranded RNA (dsRNA) triggers the degradation of the target RNA, e.g., mRNA, through a post-translational gene-silencing mechanism referred herein as RNA interference or RNAi.

[0057] The duplex region may be of any length allowing specific degradation of the desired target RNA via the RISC pathway, and may be about 9 to 36 base pairs long, e.g., about 15 to 30 base pairs long, e.g., about 15 to 30, 15 to 29, 15 to 28, 15 to 27, 15 to 26, 15 to 25, 15 to 24, 15 to 23, 15 to 22, 15 to 21, 15 to 20, 15 to 19, 15 to 18, 15 to 17, 18 to 30, 18 to 29, 18 to 28, 18 to 27, 18 to 26, 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 18 to 20, 19 to 30, 19 to 29, 19 to 28, 19 to 27, 19 to 26, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 19 to 20, 20 to 30, 20 to 29, 20 to 28, 20 to 27, 20 to 26, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 21 to 30, 21 to 29, 21 to 28, 21 to 27, 21 to 26, 21 to 25, 21 to 24, 21 to 23, or 21 to As with 22 base pairs, the length may reach approximately 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs. Intermediate ranges and lengths to the above-mentioned ranges and lengths are also considered part of the present invention.

[0058] The two strands forming the duplex structure may be different parts of one larger RNA molecule or individual RNA molecules. When the two strands are parts of one larger molecule and are thus connected by an uninterrupted chain of nucleotides between the 3'-end of one strand forming the duplex structure and the 5'-end of each other strand, the connected RNA chain is referred to as a “hairpin loop.” The hairpin loop may contain at least one non-paired nucleotide. In some embodiments, the hairpin loop may contain at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more non-paired nucleotides.

[0059] When the two substantially complementary strands of dsRNA are contained within individual RNA molecules, these molecules may be covalently linked, though not necessarily. When the two strands are covalently linked by means other than an uninterrupted chain of nucleotides between the 3'-end of one strand and the 5'-end of each other strand to form a duplex structure, the linkage structure is referred to as a “linker.” The RNA strands may have the same or different number of nucleotides. The maximum number of base pairs is the number of nucleotides present on the shortest strand of dsRNA minus any overhangs present in the duplex. In addition to the duplex structure, RNAi may contain one or more nucleotide overhangs.

[0060] As used herein, the term “nucleotide overhang” refers to at least one unpaired nucleotide protruding from the duplex structure of iRNA, e.g., dsRNA. For example, there is a nucleotide overhang where the 3’-end of one strand of dsRNA extends beyond the 5’-end of the other strand, or vice versa. The dsRNA may contain at least one nucleotide overhang; alternatively, the overhang may contain at least two nucleotides, at least three nucleotides, at least four nucleotides, or at least five or more nucleotides. The nucleotide overhang may include deoxynucleotides / nucleosides, or may include or consist of nucleotide / nucleoside analogs. The overhang(s) may be on the sense strand, the antisense strand, or any combination thereof. Additionally, the nucleotide(s) of the overhang may be present on the 5'-terminus, 3'-terminus, or both ends of the antisense or sense strand of the dsRNA.

[0061] In one embodiment, the antisense strand of the dsRNA has 1 to 10 nucleotides that are overhangs at the 3'-terminus and / or 5'-terminus, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In one embodiment, the sense strand of the dsRNA has 1 to 10 nucleotides that are overhangs at the 3'-terminus and / or 5'-terminus, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In another embodiment, one or more of the nucleotides in the overhangs are replaced with nucleoside thiophosphate.

[0062] As used herein with respect to dsRNA, the terms “smooth” or “smooth-terminated” mean that there are no unpaired nucleotides or nucleotide analogs at a given terminal end of the dsRNA, that is, there are no nucleotide overhangs. One or both ends of the dsRNA may be smooth. If both ends of the dsRNA are smooth, the dsRNA is referred to as a smooth-terminated dsRNA. Clearly, a “smooth-terminated” dsRNA is a dsRNA that is smooth at both ends, that is, there are no nucleotide overhangs at either end of the molecule. Most commonly, such a molecule will be double-stranded throughout its entire length.

[0063] The terms “antisense strand” or “guide strand” refer to a strand of iRNA, e.g., dsRNA, containing a region substantially complementary to a target sequence, e.g., ANGPTL3 mRNA. As used herein, the term “region of complementarity” refers to a region on the antisense strand that is substantially complementary to a sequence, e.g., as defined herein, to a target sequence, e.g., ANGPTL3 nucleotide sequence. Where the region of complementarity is not fully complementary to the target sequence, mismatches may be located within the molecule or within the terminal region. Generally, the most tolerant mismatches are located within the terminal region, e.g., within 5, 4, 3, or 2 nucleotides of the 5’- and / or 3’-terminal of the iRNA.

[0064] As used herein, the terms “sense strand” or “passenger strand” refer to a strand of iRNA containing a region substantially complementary to the region of the antisense strand as defined herein.

[0065] Unless otherwise indicated herein, the term “complementary” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence refers, as understood by those skilled in the art, to the ability of an oligonucleotide or polynucleotide containing said second nucleotide sequence to form a duplex structure by hybridizing said oligonucleotide or polynucleotide containing said second nucleotide sequence under certain conditions. Such conditions may be, for example, harsh conditions, which may include washing after 12 to 16 hours at 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, and 50°C or 70°C (see, for example, “Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press”). Other conditions, such as physiologically appropriate conditions that may be encountered within an organism, may apply. A person skilled in the art can determine the most appropriate set of conditions for testing the complementarity of two sequences following the final application of hybridized nucleotides.

[0066] The complementary sequences in iRNA, e.g., dsRNA as described herein, comprise a base-pairing of an oligonucleotide or polynucleotide containing a first nucleotide sequence to an oligonucleotide or polynucleotide containing a second nucleotide sequence over the entire length of one or both nucleotide sequences. These sequences may be referred to herein as “fully complementary” to each other. However, where the first sequence is referred to herein as “substantially complementary” to the second sequence, the two sequences may be fully complementary, or they may form one or more, but generally five, four, three, or two or fewer mismatched base pairs for a duplex of up to 30 base pairs upon hybridization, while maintaining the ability to hybridize under conditions most appropriate for their final application, e.g., repression of gene expression via the RISC pathway. However, if two oligonucleotides are designed to form one or more single-strand overhangs upon hybridization, such overhangs are not considered a mismatch for the determination of complementarity. For example, a dsRNA comprising one oligonucleotide of length 21 nucleotides and another oligonucleotide of length 23 nucleotides, characterized in that the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, may also be referred to as “fully complementary” for the purposes described herein.

[0067] The “complementary” sequences used herein may include non-Watson-Crick base pairs and / or base pairs formed from non-natural and modified nucleotides, or may be formed entirely from them, provided that the above requirements regarding the ability to hybridize are satisfied. These non-Watson-Crick base pairs include, but are not limited to, G:U wobble or Hoogstein base pairings.

[0068] In this document, the terms “complementary,” “completely complementary,” and “substantially complementary” may be used for base matching between the sense strand and the antisense strand of dsRNA, or between the antisense strand and the target sequence of an iRNA agonist, as understood in the context of their use.

[0069] As used herein, a polynucleotide “substantially complementary to at least a portion of” messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a continuous portion of the mRNA of interest (e.g., mRNA encoding ANGPTL3). For example, if the sequence is substantially complementary to a non-interrupted portion of the mRNA encoding ANGPTL3, the polynucleotide is complementary to at least a portion of the ANGPTL3 mRNA.

[0070] Generally, most of the nucleotides of each strand are ribonucleotides, but as described in detail herein, each strand or both strands may contain one or more non-ribonucleotides, such as deoxyribonucleotides and / or modified nucleotides. Additionally, “iRNA” may contain ribonucleotides having chemical modifications. Such modifications may include all types of modifications disclosed herein or known in the industry. Any such modifications, as utilized in iRNA molecules, are included in “iRNA” for the purposes of this specification and claims.

[0071] As used herein, the term “inhibiting” is used interchangeably with “reducing,” “silencing,” “downregulating,” “inhibiting,” and other similar terms, and includes any level of inhibition.

[0072] The phrase “repressing the expression of ANGPTL3” as used herein includes the repression of the expression of any ANGPTL3 gene (such as mouse ANGPTL3 gene, mouse ANGPTL3 gene, monkey ANGPTL3 gene, or human ANGPTL3 gene) as well as variants or mutants of the ANGPTL3 gene encoding the ANGPTL3 protein.

[0073] “Repressing the expression of the ANGPTL3 gene” includes at least partial inhibition of the expression of the ANGPTL3 gene, such as inhibition of any level of the ANGPTL3 gene, e.g., at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0074] The expression of the ANGPTL3 gene may be evaluated based on the levels of any variable associated with ANGPTL3 gene expression, e.g., ANGPTL3 mRNA levels or ANGPTL3 protein levels. The expression of ANGPTL3 may also be evaluated indirectly based on levels of serum lipids, triglycerides, cholesterol (including LDL-C, HDL-C, VLDL-C, IDL-C, and total cholesterol), or free fatty acids. Inhibition may be evaluated by a decrease in the absolute or relative levels of one or more of these variables compared to control levels. Control levels may be any form of control level available in the industry, e.g., pre-dose baseline levels, or levels determined from similar subjects, cells, or specimens treated or untreated as controls (e.g., buffer-only controls or inactivator-only controls).

[0075] In one embodiment, at least partial inhibition of the expression of the ANGPTL3 gene is evaluated by a reduction in the amount of ANGPTL3 mRNA detectable in the first cell or group of cells that is separated from or within the first cell or group of cells treated to transcribe the ANGPTL3 gene and inhibit the expression of the ANGPTL3 gene, compared to a second cell or group of cells that is substantially identical to the first cell or group of cells (control cells) but not so treated. The degree of inhibition may be expressed by the following formula:

[0076]

[0077] As with dsRNA used herein, the phrase “step of contacting a cell with an RNAi agent” includes a step of contacting a cell by any possible means. The step of contacting a cell with an RNAi agent includes a step of contacting a cell in vitro with said iRNA or a step of contacting a cell in vivo with said iRNA. The contacting step may be performed directly or indirectly. Thus, for example, the RNAi agent may be physically contacted with a cell by the person performing the method, or alternatively, the RNAi agent may be placed in a situation that causes or induces contact with the cell thereafter.

[0078] The step of contacting cells in vitro can be performed, for example, by culturing the cells with an RNAi agent. The step of contacting cells in vivo can be performed, for example, by injecting the RNAi agent into or near the tissue where the cells are located, or by injecting the RNAi agent into another area, e.g., the bloodstream or subcutaneous space, so that the agent reaches the tissue where the cells to be contacted are located. For example, the RNAi agent may contain and / or be bound to a ligand, e.g., GalNAc3, which directs the RNAi agent toward the site of interest, e.g., the liver. A combination of in vitro and in vivo contact methods is also possible. For example, cells may be contacted with the RNAi agent in vitro and subsequently transplanted into a subject.

[0079] In one embodiment, the step of contacting cells with iRNA comprises a “step of introduction” or a “step of delivering iRNA to cells” by facilitating or enabling uptake or absorption into the cells. The absorption or uptake of iRNA may occur via an unassisted diffusive or active cell process or by means of an auxiliary agent or device. The step of introducing iRNA into cells may be in vitro and / or in vivo. For example, for in vivo introduction, iRNA may be injected into a tissue site or administered systemically. In vivo delivery may be carried out by a beta-glucan delivery system, as described in U.S. Patent Nos. 5,032,401 and 5,607,677 and U.S. Patent Application Publication No. 2005 / 0281781, the entire contents of which are incorporated herein by reference. In vitro introduction into cells includes methods known in the industry, such as electroporation and lipofection. Other approaches are described below and / or known in the industry.

[0080] The term “SNALP” refers to a suitable nucleic acid-lipid particle. A SNALP is a lipid vesicle that coats a reduced aqueous interior containing a nucleic acid, such as iRNA or a plasmid from which the iRNA is transcribed. SNALPs are described, for example, in U.S. Patent Applications No. 20060240093 and No. 20070135372 and International Application No. WO 2009082817, the entire contents of which are incorporated herein by reference. Examples of “SNALP” formulations are described below.

[0081] As used herein, the “subject” is an animal such as a mammal or bird (e.g., a duck or a goose), including primates (e.g., humans and non-human primates such as monkeys and chimpanzees), non-primates (e.g., cattle, pigs, camels, llamas, horses, goats, rabbits, sheep, hamsters, guinea pigs, cats, dogs, mice, mice, horses and whales). In one embodiment, the subject is a human being treated or evaluated for a disease, condition, or state that benefits from a reduction in ANGPTL3 expression as described herein; a human being at risk for a disease, condition, or state that benefits from a reduction in ANGPTL3 expression; a human being having a disease, condition, or state that benefits from a reduction in ANGPTL3 expression; and / or a human being treated for a disease, condition, or state that benefits from a reduction in ANGPTL3 expression. As used herein, the terms “treating” or “treatment” refer to beneficial or desired outcomes, including, such as lowering triglyceride levels in the subject. The terms “treating” or “treatment” may include, but are not limited to, the alleviation or remission of one or more symptoms of lipid metabolism disorders, such as, for example, a reduction in the size of xanthomas. “Treatment” may also mean extending survival compared to survival expected in the absence of treatment.

[0082] In the context of disease markers or symptoms, “reducing” means a statistically significant reduction from such levels. The reduction may be, for example, at least 10%, at least 20%, at least 30%, or at least 40%, and preferably lowered to an acceptable level, such as within the normal level of an individual without such disease. As used herein, “preventing” or “preventing” refers to a reduction in the likelihood of a subject developing symptoms associated with such disease, disease, or condition, e.g., high triglyceride levels or xanthomas, when used in reference to the disease, disease, or condition that benefits from a reduction in the expression of the ANGPTL3 gene. The likelihood of developing high triglyceride levels or xanthomas is reduced, for example, when an individual with one or more risk factors for high triglyceride levels or xanthomas does not develop high triglyceride levels or xanthomas, or develops high triglyceride levels or xanthomas with lower severity compared to a population with the same risk factors that has not been treated as described herein. The failure to cause a disease, condition, or state, or a reduction in the occurrence of symptoms associated with such disease, condition, or state (e.g., at least about 10% on a clinically acceptable scale for the disease or condition), or the delayed appearance of symptoms (e.g., on a daily, weekly, monthly, or yearly basis) is considered effective prevention.

[0083] As used herein, the term “serum lipids” refers to any major lipids present in the blood. Serum lipids may be present in the blood in a free form or as part of a protein complex, e.g., a lipoprotein complex. Non-limiting examples of serum lipids may include triglycerides and cholesterol, such as total cholesterol (TG), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), very low-density lipoprotein cholesterol (VLDL-C), and intermediate-density lipoprotein cholesterol (IDL-C).

[0084] As used herein, “lipid metabolism disease” refers to any disease associated with or caused by a disorder of lipid metabolism. For example, this term includes hyperlipidemia, or any disease, condition, or state that may lead to a condition characterized by an abnormal elevation of any or all lipids and / or lipoproteins in the blood. This term refers to hereditary diseases, such as familial hypertriglyceridemia, or acquired diseases, such as diseases acquired as a result of diet or the intake of certain drugs. Exemplary diseases of lipid metabolism include, but are not limited to, atheromatous arteriosclerosis, dyslipidemia, hypertriglyceridemia (including drug-induced hypertriglyceridemia, diuretic-induced hypertriglyceridemia, alcohol-induced hypertriglyceridemia, β-adrenergic blocker-induced hypertriglyceridemia, estrogen-induced hypertriglyceridemia, glucocorticoid-induced hypertriglyceridemia, retinoid-induced hypertriglyceridemia, cimetidine-induced hypertriglyceridemia, and familial hypertriglyceridemia), acute pancreatitis associated with hypertriglyceridemia, chylomicron syndrome, familial chylomicronemia, apo-E deficiency or tolerance, LPL deficiency or hypoactivity, hyperlipidemia (including familial combined hyperlipidemia), gout associated with hypercholesterolemia, and xanthomatosis (subcutaneous cholesterol accumulation).

[0085] Cardiovascular diseases associated with lipid metabolism disorders are also considered “lipid metabolism disorders” as defined herein. These diseases may include coronary artery disease (also called ischemic heart disease), inflammation associated with coronary artery disease, restenosis, peripheral vascular disease, and stroke.

[0086] Weight-related conditions are also considered “lipid metabolic diseases” as defined herein. Such conditions may include obesity, metabolic syndrome including independent components of metabolic syndrome (e.g., central obesity, FBG / pre-diabetes / diabetes, hypercholesterolemia, hypertriglyceridemia, and hypertension), thyroid dysfunction, uremia, and other conditions associated with weight gain (including rapid weight gain), weight loss, maintenance of weight loss, or risk of weight gain after weight loss.

[0087] Blood glucose disorders are also considered “lipid metabolism disorders” as defined herein. Such disorders may include diabetes mellitus, hypertension, and polycystic ovary syndrome associated with insulin resistance. Other exemplary disorders of lipid metabolism may include kidney transplantation, nephrotic syndrome, Cushing’s syndrome, acromegaly, systemic lupus erythematosus, dysglobulinemia, lipodystrophy, glycogenosis type I, and Addison’s disease.

[0088] The “therapeutic effective dose” as used herein is intended to include an amount of RNAi agonist sufficient to bring about treatment of the disease (e.g., by reducing, alleviating, and maintaining one or more symptoms of the existing disease or the disease) when administered to a subject with a lipid metabolism disorder. The “therapeutic effective dose” may vary depending on the RNAi agonist, the method of administration of the agonist, the disease and its severity and medical history, age, body weight, family history, genetic composition, the type of prior or incidental treatment, and other personal characteristics of the subject being treated.

[0089] The “prophylactic effective dose” as used herein is intended to include an amount of iRNA sufficient to prevent or alleviate the disease or one or more symptoms of the disease when administered to subjects with lipid metabolism disorders. Alleviation of the disease includes delaying the course of the disease or reducing the severity of subsequent disease development. The “prophylactic effective dose” may vary depending on RNAi, the method of administration of the agent, the risk and history of the disease, age, weight, family history, genetic composition, the type of prior or adjunctive treatment, and other personal characteristics of the patient being treated.

[0090] “Therapeutic effective dose” or “preventive effective dose” includes an amount of RNAi agonist that produces some desired local or systemic effect at a reasonable benefit / risk ratio applicable to any treatment. The iRNA employed in the method of the present invention may be administered in an amount sufficient to produce a reasonable benefit / risk ratio applicable to such treatment.

[0091] The phrase “pharmacologically acceptable” is used herein to refer to such compounds, substances, compositions, and / or formulations suitable for use in contact with tissues of human and animal subjects, corresponding to a reasonable benefit / risk ratio without excessive toxicity, irritation, allergic reaction, or other problems or complications, within the scope of sound medical judgment.

[0092] As used herein, the phrase “pharmaceuticalally acceptable carrier” means a pharmaceutically acceptable substance, composition, or carrier, such as liquid or solid fillers, diluents, excipients, manufacturing aids (e.g., lubricants, talc, magnesium, calcium or zinc stearate, or stearic acid), or solvent-encapsulated materials, that is involved in delivering or transporting the subject compound from one organ or part of the body to another organ or part of the body. Each carrier must be “acceptable” in the sense that it is compatible with other components of the formulation and poses no harm to the subject being treated. Some examples of substances that may serve as pharmaceutically acceptable carriers include (1) sugars such as lactose, glucose, and sucrose; (2) starches such as corn starch and potato starch; (3) cellulose, and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; (4) powdered tragacanths; (5) Malt; (6) Gelatin; (7) Lubricants such as magnesium (magnesium state), sodium lauryl sulfate, and talc; (8) Excipients such as cocoa butter and suppository wax; (9) Oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; (10) Glycols such as propylene glycol; (11) Polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol; (12) Esters such as ethyl oleate and ethyl laurate; (13) Agar; (14) Buffers such as magnesium hydroxide and aluminum hydroxide; (15) Alginic acid; (16) Pyremic solution; (17) Isotonic saline solution; (18) Ringer's solution; (19) Ethyl alcohol; (20) pH buffer solution; (21) polyesters, polycarbonates and / or polyanhydrides; (22) volume modifiers such as polypeptides and amino acids such as serum albumin, HDL and LDL (23) serum components; and (22) other non-toxic compatible materials employed in pharmaceutical formulations.

[0093] As used herein, the term “specimen” includes fluids, cells, or tissues present within a subject, as well as sets of similar fluids, cells, or tissues separated from the subject. Examples of biological fluids include blood, serum and serosal fluids, plasma, cerebrospinal fluid, ocular fluids, lymph, urine, saliva, etc. Tissue specimens may include specimens from tissues, organs, or localized areas. For example, specimens may be derived from a specific organ, a part of an organ, or fluids or cells within such organ. In certain embodiments, specimens may be derived from the liver (e.g., whole liver or a specific segment of the liver, or a specific type of cell within the liver, such as hepatocytes). In some embodiments, “specimen derived from a subject” refers to blood or plasma drawn from the subject.

[0094] II. The iRNA of the Invention

[0095] An iRNA that inhibits the expression of the ANGPTL3 gene is described herein. In one embodiment, the iRNA agonist comprises a double-stranded ribonucleic acid (dsRNA) molecule for inhibiting the expression of the ANGPTL3 gene within a cell, such as in a subject, e.g., a mammal with a lipid metabolism disorder such as familial hyperlipidemia. The dsRNA comprises an antisense strand having a complementary region that is complementary to at least a portion of the mRNA formed from the expression of the ANGPTL3 gene. The complementary region is about 30 nucleotides or less in length (e.g., about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, or 18 nucleotides or less in length). When iRNA comes into contact with cells expressing the ANGPTL3 gene, it inhibits the expression of the ANGPTL3 gene (e.g., human, primate, non-primate, or avian ANGPTL3 gene) by at least about 10%, as analyzed, for example, by immunofluorescence analysis using Western blotting or flow cytometry techniques, or by PCR or branched-chain DNA (bDNA) or protein-based methods.

[0096] dsRNA comprises two RNA strands that are complementary and hybridize under conditions in which the dsRNA is utilized to form a duplex structure. One strand of the dsRNA (the antisense strand) is substantially complementary to the target sequence and generally comprises a region of complementarity that is entirely complementary. The target sequence may be derived from the sequence of mRNA formed during the expression of the ANGPTL3 gene. The remaining strand (the sense strand) comprises a region complementary to the antisense strand so that the two strands hybridize and form a duplex structure when combined under appropriate conditions. As described elsewhere in this invention and known in the industry, the complementary sequence of the dsRNA may also be included as a self-complementary region of a single nucleic acid molecule, as opposed to one on an individual oligonucleotide.

[0097] Generally, the duplex structure has a length of 15 to 30 base pairs, e.g., lengths of 15 to 29, 15 to 28, 15 to 27, 15 to 26, 15 to 25, 15 to 24, 15 to 23, 15 to 22, 15 to 21, 15 to 20, 15 to 19, 15 to 18, 15 to 17, 18 to 30, 18 to 29, 18 to 28, 18 to 27, 18 to 26, 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 18 to 20, 19 to 30, 19 to 29, 19 to 28, 19 to 27, Base pairs between 19 to 26, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 19 to 20, 20 to 30, 20 to 29, 20 to 28, 20 to 27, 20 to 26, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 21 to 30, 21 to 29, 21 to 28, 21 to 27, 21 to 26, 21 to 25, 21 to 24, 21 to 23, or 21 to 22. Intermediate ranges and lengths to the above-mentioned ranges and lengths are also considered as part of the present invention.

[0098] Similarly, the region of complementarity to the target sequence is between 15 and 30 nucleotides in length, e.g., lengths 15 to 29, 15 to 28, 15 to 27, 15 to 26, 15 to 25, 15 to 24, 15 to 23, 15 to 22, 15 to 21, 15 to 20, 15 to 19, 15 to 18, 15 to 17, 18 to 30, 18 to 29, 18 to 28, 18 to 27, 18 to 26, 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 18 to 20, 19 to 30, 19 to 29, 19 to 28, It is between 19 to 27, 19 to 26, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 19 to 20, 20 to 30, 20 to 29, 20 to 28, 20 to 27, 20 to 26, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 21 to 30, 21 to 29, 21 to 28, 21 to 27, 21 to 26, 21 to 25, 21 to 24, 21 to 23, or 21 to 22 nucleotides. Intermediate ranges and lengths to the above-mentioned ranges and lengths are also considered as part of the present invention.

[0099] In some embodiments, the dsRNA is between about 15 and about 20 nucleotides in length, or between about 25 and about 30 nucleotides in length. Generally, the dsRNA is long enough to serve as a record for the Dicer enzyme. For example, it is known that dsRNA longer than about 21 to 23 nucleotides can serve as a record for Dicer. As will be recognized by those skilled in the art, the region of RNA targeted for cleavage will most commonly be a longer RNA molecule, often a part of an mRNA molecule. Where appropriate, the “part” of the mRNA target is a continuous sequence of mRNA target of sufficient length to make the mRNA target a record for RNAi-directed cleavage (i.e., cleavage via the RISC pathway).

[0100] In addition, those skilled in the art may know that the duplex region is a first functional portion of dsRNA, e.g., about 9 to 36 base pairs, e.g., about 10 to 36, 11 to 36, 12 to 36, 13 to 36, 14 to 36, 15 to 36, 9 to 35, 10 to 35, 11 to 35, 12 to 35, 13 to 35, 14 to 35, 15 to 35, 9 to 34, 10 to 34, 11 to 34, 12 to 34, 13 to 34, 14 to 34, 15 to 34, 9 to 33, 10 to 33, 11 to 33, 12 to 33, 13 to 33, 14 to 33, 15 to 33, 9 to 32, 10 to 32, 11 to 32, 12 to 32, 13 to 32, 14 to 32, 15 to 32, 9 to 31, 10 to 31, 11 to 31, 12 to 31, 13 to 32, 14 to 31, 15 to 31, 15 to 30, 15 to 29, 15 to 28, 15 to 27, 15 to 26, 15 to 25, 15 to 24, 15 to 23, 15 to 22, 15 to 21, 15 to 20, 15 to 19, 15 to 18, 15 to 17, 18 to 30, 18 to 29, 18 to 28, 18 to 27, 18 to 26, 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 18 to 20, 19 to 30, 19 to 29, 19 to 28, 19 to 27, 19 to 26, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 19 to 20, 20 to 30, 20 to 29, 20 to 28, 20 to 27, 20 to 26, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 21 to 30, 21 to 29, 21 to 28, 21 to 27, 21 to 26, 21 to 25, 21 to 24,It will be recognized that it is a duplex region of 21 to 23, or 21 to 22 base pairs. Accordingly, in one embodiment, an RNA molecule or a complex of RNA molecules having a duplex region exceeding 30 base pairs, to the extent that it is processed into a functional duplex of, for example, 15 to 30 base pairs, which targets the RNA desired for cleavage, is dsRNA. Accordingly, those skilled in the art will recognize that in one embodiment, miRNA is dsRNA. In another embodiment, dsRNA is not naturally occurring miRNA. In another embodiment, an iRNA agonist useful for targeting ANGPTL3 expression is not generated in the target cell by the cleavage of a larger dsRNA.

[0101] The dsRNA described herein may further comprise one or more single-stranded nucleotide overhangs, e.g., 1, 2, 3, or 4 nucleotides. dsRNA having at least one nucleotide overhang may have unexpectedly excellent repressive properties with respect to the counterpart, which is its smooth end. The nucleotide overhang may comprise or be composed of a nucleotide / nucleoside analog, such as a deoxynucleotide / nucleoside. The overhang(s) may be on the sense strand, the antisense strand, or any combination thereof. Additionally, the nucleotide(s) of the overhang may be on the 5'-end, 3'-end, or both ends of the antisense or sense strand of the dsRNA.

[0102] dsRNA can be synthesized by standard methods known in the industry, such as by using an automated DNA synthesizer, as described further below, for example, as commercially available from Biosearch, Applied Biosystems, Inc.

[0103] The iRNA compounds of the present invention can be prepared using a two-step process. First, the individual strands of a double-stranded RNA molecule are prepared separately. Subsequently, the component strands are annealed. The individual strands of the siRNA compounds can be prepared using solution-phase or solid-phase organic synthesis, or both. Organic synthesis offers the advantage that oligonucleotide strands containing non-natural or modified nucleotides can be easily prepared. The single-stranded oligonucleotides of the present invention can be prepared using solution-phase or solid-phase organic synthesis, or both.

[0104] In one embodiment, the dsRNA of the present invention comprises at least two nucleotide sequences, a sense sequence and an anti-sense sequence. The sense strand is selected from the group of sequences provided in Tables 2, 3, 7, 8, 9 and 10, and the antisense strand corresponding to the sense strand is selected from the group of sequences in Tables 2, 3, 7, 8, 9 and 10. In this embodiment, one of the two sequences is complementary to the other of the two sequences, and one of the sequences is substantially complementary to the sequence of the mRNA produced in the expression of the ANGPTL3 gene. Thus, in this embodiment, the dsRNA comprises two oligonucleotides, wherein one oligonucleotide is described as the sense strand in Tables 2, 3, 7, 8, 9 and 10, and the second oligonucleotide is described as the antisense strand corresponding to the sense strand in Tables 2, 3, 7, 8, 9 and 10. In one embodiment, substantially complementary sequences of dsRNA are included on individual oligonucleotides. In another embodiment, substantially complementary sequences of dsRNA are included on a single oligonucleotide.

[0105] Those skilled in the art are fully aware that dsRNA having a duplex structure of about 20 to 23 base pairs, e.g. 21 base pairs, is recognized as particularly effective in inducing RNA interference (Elbashir et al., (2001) EMBO J. , 20:6877-6888). However, others found that shorter or longer dsRNA duplex structures can also be effective (Chu and Rana (2007) RNA 14:1714-1719; Kim etc. (2005) Nat Biotech 23:222-226). In the embodiments described above, by utilizing the properties of the oligonucleotide sequences provided in Tables 2, 3, 7, 8, 9 and 10, the dsRNA described herein may comprise at least one strand having a length of at least 20 nucleotides. It can be reasonably expected that shorter duplexes having sequences obtained by subtracting only some nucleotides on one or both ends from one of the sequences in Tables 2, 3, 7, 8, 9 and 10 may be similarly effective compared to the dsRNA described above. Accordingly, a dsRNA having a sequence of at least 15, 16, 17, 18, 19, or 20 consecutive nucleotides derived from one of the sequences of Tables 2, 3, 7, 8, 9, and 10, and differing from the dsRNA containing the entire sequence in its ability to inhibit the expression of the ANGPTL3 gene by an inhibition degree of about 5, 10, 15, 20, 25, or 30% or less is considered to be within the scope of the present invention.

[0106] Additionally, the RNAs provided in Tables 2, 3, 7, 8, 9, and 10 identify site(s) in the ANGPTL3 transcript that are susceptible to RISC-mediated cleavage. As such, the present invention also features an iRNA that targets within one of these sites. As used herein, the iRNA is said to target within a specific site of the RNA transcript if the iRNA promotes the cleavage of the transcript somewhere within that specific site. Such an iRNA will generally comprise at least about 15 consecutive nucleotides from one of the sequences provided in Tables 2, 3, 7, 8, 9, and 10, which are combined with additional nucleotide sequences taken from a region continuous with a selected sequence in the ANGPTL3 gene.

[0107] While target sequences are generally about 15 to 30 nucleotides in length, there is wide variation in the suitability of specific sequences within this range to direct the cleavage of any given target RNA. Although the various software packages and guidelines organized herein provide guidance for the identification of optimal target sequences for any given gene target, an experimental approach may also be taken in which a “window” or “mask” of a given size (as an unspecified example, 21 nucleotides) is placed literally or figuratively (e.g., in silico) on the target RNA sequence to identify sequences within a size range that can serve as target sequences. By progressively shifting the “window” sequence one nucleotide upstream or downstream of the initial target sequence location, the next potential target sequence can be identified until a complete set of possible sequences is identified for any selected given target size. This process of identifying such sequences, optimally performed in combination with the systematic synthesis and testing of identified sequences (using analytical methods described herein or known in the industry), can identify such RNA sequences that mediate the maximum repression of target gene expression when targeted by iRNA agonists. Thus, while the sequences identified in Tables 2, 3, 7, 8, 9, and 10 represent effective target sequences, it is considered that further optimization of repression efficiency can be achieved by progressively “walking the window” upstream or downstream of the given sequences by one nucleotide to identify sequences having the same or better repressive features.

[0108] Additionally, it is considered that for any sequence identified, for example in Tables 2, 3, 7, 8, 9, and 10, further optimization may be achieved by systematically adding or removing nucleotides to generate longer or shorter sequences and testing such sequences by walking a window of longer or shorter size up or down the target RNA from that point. Furthermore, combining this approach with generating new candidate targets to test the efficacy of iRNA based on such target sequences in inhibition assays known in the industry and / or described herein may lead to further improvements in inhibition efficiency. In addition, such optimized sequences may be adjusted by further optimizing the molecule as an expression inhibitor through the introduction of modified nucleotides as described herein or known in the industry, addition or alteration of overhangs, or other modifications as known in the industry and / or described herein (e.g., by increasing serum stability or cycling half-life, increasing thermal stability, improving transmembrane delivery, targeting specific sites or cell types, increasing interactions with silencing pathway enzymes, and increasing release from endosomes).

[0109] The iRNA described herein may contain one or more mismatches for a target sequence. In one embodiment, the iRNA described herein contains three or fewer mismatches. If the antisense strand of the iRNA contains mismatches for a target sequence, it is preferable that the region of the mismatch is not located at the center of the complementary region. If the antisense strand of the iRNA contains mismatches for a target sequence, it is preferable that the mismatch is limited within the last five nucleotides from the 5'- or 3'-terminus of the complementary region. For example, for a 23-nucleotide iRNA agonist, the strand complementary to the region of the ANGPTL3 gene generally does not contain any mismatch within the central 13 nucleotides. The method described herein or a method known in the industry may be used to determine whether an iRNA containing a mismatch for a target sequence is effective in inhibiting the expression of the ANGPTL3 gene. Considering the efficacy of iRNAs with mismatches in inhibiting the expression of the ANGPTL3 gene is particularly important if a specific complementary region of the ANGPTL3 gene is known to have polymorphic sequence variations within the population.

[0110] III. Modified iRNA of the present invention

[0111] In one embodiment, the RNA of the iRNA of the present invention, e.g., dsRNA, is chemically modified to improve stability or other beneficial features. The nucleic acid characterized in the present invention may be synthesized and / or modified by methods established in the industry, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, SL et al. (Editors), John Wiley & Sons, Inc., New York, NY, USA, incorporated herein by reference. Modifications include, for example, end modifications, e.g., 5'-end modifications (phosphorylation, conjugation, inverted bonding) or 3'-end modifications (conjugation, DNA nucleotide, inverted bonding, etc.); base modifications, e.g., replacement with a stabilizing base, an destabilizing base, or a base paired with an expanded repertoire of partners, removal of bases (baseless nucleotides), or conjugated bases; sugar modifications (e.g., at the 2'-position or 4'-position) or replacement of a sugar; It includes backbone modifications including modification or replacement of phosphodiester bonds. Specific examples of iRNA compounds useful in the embodiments described herein include, but are not limited to, RNAs having a modified backbone or non-natural internucleoside bonds. RNAs having a modified backbone include, among other RNAs, those that do not have a phosphate atom in the backbone. For the purposes of this specification, and as is sometimes referenced in the industry, a modified RNA that does not have a phosphate atom in its internucleoside backbone may also be considered an oligonucleoside. In some embodiments, the modified iRNA will have a phosphate atom in its internucleoside backbone.

[0112] The modified RNA backbone comprises, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoamidates including 3'-aminophosphoamidate and aminoalkylphosphoamidate, thionophosphoamidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having ordinary 3'-5' linkages, their 2'-5' linked analogs, and those having inverted polarity, wherein adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts, and free acid forms are also included.

[0113] Representative U.S. patents teaching formulations of the above-mentioned phosphorus-containing linkage are U.S. Patent Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821, the entire contents of which are incorporated herein by reference; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209; 6, 239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and U.S. Patent RE39464, including but not limited thereto.

[0114] Modified RNA backbones that do not contain phosphorus atoms therein have backbones formed by short-chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short-chain heteroatom or heterocyclic internucleoside linkages. These include morpholino linkages (partially formed from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide, and sulfone backbones; formacetyl and thioformacetyl backbones; methyleneformacetyl and thioformacetyl backbones; alkene-containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S, and CH2 component portions.

[0115] Representative U.S. patents teaching formulations of the above-mentioned oligonucleoside are U.S. Patent Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704, the entire contents of which are incorporated herein by reference; Includes, but not limited to, number 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439.

[0116] In other embodiments, suitable RNA mimics are considered for use in iRNA in which the sugars of nucleotide units and internucleoside linkages, i.e., the backbone, are replaced with novel groups. The base units are retained to hybridize with suitable nucleic acid target compounds. One such oligomeric compound, a dsRNA mimic found to have excellent hybridization properties, is referred to as peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of RNA is replaced with an amide comprising a backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to the aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents teaching formulations of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of which are incorporated herein by reference. Additional PNA compounds suitable for use in the iRNA of the present invention are, for example, Nielsen et al. Science It is described in , 1991, 254, 1497-1500.

[0117] Some embodiments characterized in the present invention include dsRNA having a phosphorothioate backbone and a heteroatom backbone, and in particular, --CH2--NH--CH2-- of the referenced U.S. Patent No. 5,489,677, --CH2--N(CH3)--O--CH2--, --CH2--O--N(CH3)--CH2--, --CH2--N(CH3)--N(CH3)--CH2-- and --N(CH3)--CH2--CH2-- [wherein the native phosphodiester backbone is denoted as --O--P--O--CH2--] and oligonucleosides having an amide backbone of the referenced U.S. Patent No. 5,602,240. In some embodiments, the RNA characterized herein has the morpholino skeleton structure of the above-referenced U.S. Patent No. 5,034,506.

[0118] Modified RNA may comprise one or more substituted sugar moiety. The iRNA characterized herein, e.g., dsRNA, may comprise one of the following at the 2'-position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl, and alkynyl are substituted or unsubstituted C1 to C 10 alkyl or C2 to C 10 It can be alkenyl and alkynyl. An exemplary suitable variation is O[(CH2) n O] m CH3, O(CH2) n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2, and O(CH2) n ON[(CH2) nIt comprises CH3)]2, wherein n and m are 1 to about 10. In other embodiments, the dsRNA comprises one of the following at the 2' position: C1 to C 10 Lower alkyl, substituted lower alkyl, alkalil, aralkyl, O-alkhalyl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkhalyl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleaving group, indicator, intercalator, group for improving the pharmacokinetic properties of iRNA or group for improving the pharmacodynamic properties of iRNA and other substituents having similar properties. In some embodiments, the modification is 2'-methoxyethoxy (2'-O-(2-methoxyethyl) or 2'-O--CH2CH2OCH3, also known as 2'-MOE) (Martin et al., Helv. Chim. Acta (1995, 78, 486-504) that is, it includes an alkoxy-alkoxy group. Other exemplary variations are 2'-dimethylaminooxyethoxy, i.e., an O(CH2)2ON(CH3)2 group also known as 2'-DMAOE, as described herein in the following examples, and 2'-dimethylaminoethoxyethoxy (also known in the industry as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O--CH2--O--CH2--N(CH2)2.

[0119] Other modifications include 2'-methoxy(2'-OCH3), 2'-aminopropoxy(2'-OCH2CH2CH2NH2), and 2'-fluoro(2'-F). Similar modifications may also be made at other positions on the RNA of the iRNA, particularly on the 3' terminal nucleotide or at the 3' position of the sugar and the 5' position of the 5' terminal nucleotide in 2'-5' linked dsRNA. The iRNA may have sugar mimics, such as cyclobutyl moiety, instead of the pentofuranosyl sugar. Representative U.S. patents describing formulations of such modified sugar structures are U.S. Patent Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; and 5,446,137, some of which are shared with the present application. Includes, but not limited to, Patents 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920. The entire contents of each of the above patents are incorporated herein by reference.

[0120] iRNA may include modifications or substitutions of nucleobases (often simply referred to as “bases” in the industry). As used herein, “unmodified” or “natural” nucleobases include the purine-based adenine (A) and guanine (G) and the myrimidine-based thymine (T), cytosine (C), and uracil (U). Modified nucleobases include 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothimine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenine and guanine, 5-halo, particularly, 5-bromo, 5-trifluoromethyl and others This includes other synthetic and natural nucleobases such as 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azadenine, 7-diazaguanine and 7-diazaadenine, and 3-diazaguanine and 3-diazaadenine. Other nucleobases are those disclosed in U.S. Patent No. 3,687,808, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; The Concise Encyclopedia of Polymer Science and Engineering, pages 858-859, Kroschwitz, J. L, ed. The ones disclosed in John Wiley & Sons, 1990; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; and Sanghvi, Y. S.Includes those disclosed in , Chapter 15, DsRNA Research and Applications, pages 289-302, Crooke, ST and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomer compounds characterized in the present invention. These include 5-substituted pyrimidine, 6-azamirimidine, and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. It has been found that 5-methylcytosine substitution increases nucleic acid duplex stability by about 0.6°C to 1.2°C (Sanghvi, YS, Crooke, ST and Lebleu, B., Eds., DsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278), and even more particularly, 5-methylcytosine substitution is an exemplary base substitution when combined with 2'-O-methoxyethyl sugar conversion.

[0121] Representative U.S. patents teaching formulations of some of the aforementioned modified nucleobases as well as other modified nucleobases are incorporated herein by reference in their entirety as U.S. Patent Nos. 3,687,808, 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121; 5,596,091; 5,614,617; 5,681,941; Includes, but not limited to, numbers 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088.

[0122] The RNA of iRNA may be modified to include one or more lock nucleic acids (LNAs). A lock nucleic acid is a nucleotide having a modified ribose moiety, said ribose moiety containing an extra bridge connecting the 2' and 4' carbons. This structure effectively “locks” ribose in the 3'-endo conformation. It has been shown that the addition of lock nucleic acids to siRNA increases siRNA stability in serum and reduces off-target effects (Elmen, J. et al., (2005)). Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193).

[0123] Representative U.S. patents teaching formulations of lock nucleic acid nucleotides include, but are not limited to, the following: U.S. Patent Nos. 6,268,490; 6,670,461; 6,794,499; 6,998,484; 7,053,207; 7,084,125; and 7,399,845, each of which is incorporated herein by reference in its entirety.

[0124] Potentially stabilizing modifications at the ends of RNA molecules may include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-0-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3"-phosphate, inverted base dT (idT), etc. A disclosure of this modification can be found in PCT publication number WO 2011 / 005861.

[0125] IV. iRNA conjugated to a ligand

[0126] Another modification of the RNA of the iRNA of the present invention includes the step of chemically attaching one or more ligands, moietyes, or conjugates to the RNA to enhance the activity, cell distribution, or cell uptake of the iRNA. Such moiety is a cholesterol moiety (Letsinger et al., (1989) Proc. Natl. Acid. Sci. USA, 86: 6553-6556), cholic acid (Manoharan et al., (1994) Biorg. Med. Chem. Let., 4:1053-1060), thioethers, e.g., beryl-S-tritylthiol (Manoharan et al., (1992) Ann. NY Acad. Sci., 660:306-309; Manoharan et al., (1993) Biorg. Med. Chem. Let., 3:2765-2770), thiocholesterol (Oberhauser et al., (1992) Nucl. Acids Res., 20:533-538), aliphatic chains, e.g., dodecanediol or undecyl residues (Saison-Behmoaras et al. (1991) EMBO J, 10:1111-1118; Kabanov et al., (1990) FEBS Lett., 259:327-330; Svinarchuk et al., (1993) Biochimie, 75:49-54), phospholipids, e.g., di-hexadecyl-lac(rac)-glycerol or triethyl-ammonium 1,2-di-o-hexadecyl-lac-glycero-3-phosphonate (Manoharan et al., (1995) Tetrahedron Lett., 36:3651-3654; Shea et al., (1990) Nucl. Acids Res., 18:3777-3783), polyamines or polyethylene glycol chains (Manoharan et al., (1995) Nucleosides & Nucleotides, 14:969-973), or adamantane acetic acid (Manoharan et al., (1995) Tetrahedron Lett., 36:3651-3654), palmityl moiety (Mishra et al., (1995) Biochim. Biophys.Lipid moiety including, but not limited to, Acta, 1264:229-237), or octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., (1996) J. Pharmacol. Exp. Ther., 277:923-937).

[0127] In one embodiment, the ligand alters the distribution, targeting, or lifetime of the iRNA agonist containing the ligand. In preferred embodiments, the ligand provides enhanced affinity for a selected target, e.g., a molecule, cell or cell type, a compartment, e.g., a cell or organ compartment, a tissue, organ, or region of the body, compared to, for example, an absent species such as the ligand. The preferred ligand will not participate in duplex coupling within the duplexed nucleic acid.

[0128] The ligand may include proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactosamine, or hyaluronic acid); or naturally occurring substances such as lipids. The ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid. Examples of polyamino acids include polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide copolymer, or polyphosphazine. Examples of polyamines include: polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or alpha-helical peptides.

[0129] The ligand may include a target group, e.g., a cell or tissue targeting agent, e.g., a lectin, a glycoprotein, a lipid, or a protein, or an antibody that binds to a specific cell type, e.g., a kidney cell. The target group may be thyroid-stimulating hormone, melanotropin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, polylactose, polygalactose, N-acetyl-galactosamine, N-acetyl-glucosamine polymannose, polyfucose, glycosylated polyamino acid, polygalactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, lipid, cholesterol, steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or RGD peptide or RGD peptide mimic.

[0130] Other examples of ligands are dyes, interstitial agents (e.g., acridine), and crosslinking agents (e.g., Porralene, Mitomycin C), porphyrins (TPPC4, Texapyrin, Saphirin), polycyclic aromatic hydrocarbons (e.g. , Phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules, e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)litocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., Antenepedia peptide, Tat peptide), alkylating agents, phosphates, aminos, mercaptos, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyaminos, alkyls, substituted alkyls, radiolabeled markers, enzymes, haptens (e.g., Includes biotin), transport / absorption promoters (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole cluster, acridine-imidazole conjugate, Eu3+ complex of tetraazamacrocycle), dinitrophenyl, HRP, or AP.

[0131] The ligand may be a protein, e.g., a glycoprotein, or a peptide, e.g., a molecule having a specific affinity for the co-ligand, or an antibody, e.g., an antibody that binds to a specific cell type, such as a hepatocyte. The ligand may also include hormones and hormone receptors. These may include non-peptide species such as lipids, lectins, carbohydrates, vitamins, common factors, polylactose, polygalactose, N-acetyl-galactosamine, N-acetyl-glucosamine polymannose, or polyfucose. The ligand may be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-κB.

[0132] The ligand may be a substance such as a drug that can increase the uptake of an iRNA agonist into the cell by, for example, by rupturing the cell's cytoskeleton by rupturing the cell's microtubules, microfilaments, and / or intermediate filaments. The drug may be, for example, taxone, vincristine, vinblastine, cytocalacin, nocodazole, japlaquinolide, latrunculin A, phalloidin, swinholide A, indanosine, or myocerbin.

[0133] In some embodiments, the ligand attached to the iRNA described herein acts as a pharmacokinetic modulator (PK modulator). PK modulators include lipophils, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEGs, vitamins, etc. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, etc. Since oligonucleotides containing numerous phosphothioate linkages are known to bind to serum proteins, short oligonucleotides, for example, oligonucleotides of about 5, 10, 15, or 20 bases containing multiple phosphothioate linkages within their backbone, are used as ligands (e.g., as PK regulatory ligands) according to the present invention. In addition, aptamers that bind to serum components (e.g., serum proteins) are also suitable for use as PK regulatory ligands in the embodiments described herein.

[0134] The ligand-conjugated oligonucleotide of the present invention can be synthesized by using an oligonucleotide having pendant reactive functionality, such as one derived by attaching a linking molecule to the oligonucleotide (described below). This reactive oligonucleotide can react directly with a commercially available ligand, a synthetic ligand having any one of various protecting groups, or a ligand having a linking moiety attached thereto.

[0135] The oligonucleotides used in the conjugates of the present invention can be easily and conventionally prepared through well-known techniques of solid-phase synthesis. Equipment for such synthesis is sold by several sales companies, including, for example, Applied Biosystems (Foster City, California). Any other means for such synthesis known in the industry may be employed additionally or alternatively. It is also known that similar techniques are used to prepare other oligonucleotides, such as phosphorothioates and alkylated derivatives.

[0136] In the ligand-conjugated oligonucleotide and ligand-molecule-bearing sequence-specific linked nucleoside of the present invention, said oligonucleotide and oligonucleotide may be assembled on a suitable DNA synthesizer utilizing a standard nucleotide or nucleoside precursor or a nucleotide or nucleoside conjugated precursor already possessing a linking moiety, a ligand-nucleotide or nucleoside-conjugated precursor already possessing a ligand molecule or a non-nucleoside ligand-bearing building block.

[0137] When using a nucleotide-conjugate precursor that already possesses a linking moiety, the synthesis of a sequence-specifically linked nucleoside is typically completed, and a ligand molecule subsequently reacts with the linking moiety to form a ligand-conjugate oligonucleotide. In some embodiments, the oligonucleotide or linked nucleoside of the present invention is synthesized by an automated synthesizer that utilizes a phosphoramidite derived from a ligand-nucleoside conjugate in addition to standard and non-standard phosphoramidites that are commercially available and commonly used for oligonucleotide synthesis.

[0138] A. Geological conjugate

[0139] In one embodiment, the ligand or conjugate is a lipid or lipid-based molecule. Such lipid or lipid-based molecule preferably binds to a serum protein, e.g., human serum albumin (HSA). The HSA-binding ligand enables the distribution of the conjugate to a target tissue, e.g., a non-renal target tissue of the body. For example, the target tissue may be the liver, including parenchymal cells of the liver. Other molecules capable of binding to HSA may also be used as ligands. For example, neproxin or aspirin may be used. The lipid or lipid-based ligand may be used to (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport to a target cell or cell membrane and / or (c) modulate binding to a serum protein, e.g., HSA.

[0140] Lipid-based ligands can be used to inhibit, for example, the binding of the conjugate to target tissues. For example, lipids or lipid-based ligands that bind more strongly to HSA are less likely to be targeted by the kidneys and therefore less likely to be removed from the body. Lipids or lipid-based ligands that bind less strongly to HSA can be used to target the conjugate to the kidneys.

[0141] In a preferred embodiment, a lipid-based ligand binds to HSA. Preferably, the conjugate binds to HSA with sufficient affinity so that it is preferably distributed to non-elongated tissues. However, it is preferable that the affinity is not so strong that the HSA-ligand binding cannot be reversed.

[0142] In another preferred embodiment, the lipid-based ligand weakly binds to or does not bind to HSA at all so that the conjugate is preferably distributed to the kidney. Other moietyes targeting kidney cells may be used instead of or in addition to the lipid-based ligand.

[0143] In another embodiment, the ligand is a vitamin taken up by a moiety, e.g., a target cell, e.g., a proliferating cell. These are particularly useful for treating diseases characterized by unwanted cell proliferation, e.g., malignant or non-malignant forms, e.g., cancer cells. Exemplary vitamins include vitamins A, E, and K. Other exemplary vitamins include B vitamins, e.g., folic acid, B12, riboflavin, biotin, pyridoxal, or vitamins and nutrients taken up by target cells such as liver cells. HSA and low-density lipoprotein (LDL) are also included.

[0144] B. Cell Penetration Agent

[0145] In another embodiment, the ligand is a cell-penetrating agent, preferably a helical cell-penetrating agent. Preferably, the agent is amphiphilic. An exemplary agent is a peptide such as tat or antenopedia. If the agent is a peptide, it may be modified, including by the use of peptidylmimetic, invertomer, non-peptide or pseudo-peptide linkages and D-amino acids. The helical agent is preferably an alpha-helical agent having lipophilic and oleophoretic phases.

[0146] The ligand may be a peptide or a peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule that can fold into a defined three-dimensional structure similar to a neutral peptide. When peptides and peptidomimetics are attached to an iRNA agonist, they may affect the pharmacokinetic distribution of the iRNA, such as by enhancing cell recognition and uptake. The peptide or peptidomimetic moiety may be about 5 to 50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids.

[0147] The peptide or peptidomimetic may be, for example, a cell-penetrating peptide, a cationic peptide, an amphiphilic peptide, or a hydrophobic peptide (e.g., composed mainly of Tyr, Trp, or Phe). The peptide moiety may be a dendrimer peptide, a binding peptide, or a crosslinking peptide. Alternatively, the peptide moiety may include a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS-containing peptide is an RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 13). An RFGF analog containing a hydrophobic MTS (e.g., the amino acid sequence AALLPVLLAAP (SEQ ID NO: 10)) may be a target moiety. The peptide moiety may be a “transport” peptide capable of carrying larger polar molecules, including peptides, oligonucleotides, and proteins, across the cell membrane. For example, it has been found that sequences derived from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO:11)) and the Drosophila antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO:12)) can function as transfer peptides. Peptides or peptidomimes can be encoded by arbitrary sequences of DNA, such as peptides identified from phage-labeled libraries or one-bead-one (OBOC) compound combination libraries (Lam et al., Nature, 354:82-84, 1991). An example of a peptide or peptidomimeme bound to a dsRNA agonist via a monomeric unit included for cell targeting purposes is the arginine-glycine-aspartate (RGD)-peptide or RGD mimic. The peptide moiety can range in length from about 5 amino acids to about 40 amino acids. Peptide moiety may have structural modifications, such as increasing stability or indicating conformational characteristics. Any one of the structural modifications described below may be utilized.

[0148] The RGD peptide used in the compositions and methods of the present invention may be linear or cyclic and may be modified, for example, glycosylated or methylated, to facilitate targeting to specific tissue(s). The RGD-containing peptides and peptidomimetic may include synthetic RGD mimics as well as D-amino acids. In addition to RGD, other moietyes targeting integrin ligands may be used. A preferred conjugate of this ligand targets PECAM-1 or VEGF.

[0149] “Cell-penetrating peptides” can penetrate cells, such as microbial cells like bacterial or fungal cells, or mammalian cells like human cells. Microbial cell-penetrating peptides may be, for example, α-helical linear peptides (e.g., LL-37 or Seropin P1), disulfide-containing peptides (e.g., α-defensin, β-defensin, or bacternessin), or peptides containing only one or two dominant amino acids (e.g., PR-39 or indoricidin). Cell-penetrating peptides may also contain nuclear localization signals (NLS). For example, cell-penetrating peptides may be bipartite amphipathic peptides such as MPG derived from the fusion peptide domains of the NLS of HIV-1 gp41 and SV40 large T antigens (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).

[0150] C. Carbohydrate conjugate

[0151] In some embodiments of the compositions and methods of the present invention, the iRNA oligonucleotide further comprises a carbohydrate. Carbohydrate-conjugated iRNA is advantageous for the in vivo delivery of nucleic acids as well as for compositions suitable for in vivo therapeutic use as described herein. As used herein, “carbohydrate” refers to a carbohydrate itself, consisting of one or more monosaccharide units having at least six carbon atoms (which may be linear, branched, or cyclic) with oxygen, nitrogen, or sulfur atoms bonded to each carbon atom, or a compound having, as part thereof, a carbohydrate moiety consisting of one or more monosaccharide units having at least six carbon atoms (which may be linear, branched, or cyclic) with oxygen, nitrogen, or sulfur atoms bonded to each carbon atom. Representative carbohydrates include sugars (monosaccharides, disaccharides, trisaccharides, and oligosaccharides comprising about 4, 5, 6, 7, 8, or 9 monosaccharide units) and polysaccharides such as starch, glycogen, cellulose, and polysaccharide gums. Specific monosaccharides include C5 and higher (e.g., C5, C6, C7, or C8) sugars; disaccharides and trisaccharides include sugars having 2 or 3 monosaccharide units (e.g., C5, C6, C7, or C8).

[0152] In one embodiment, the carbohydrate conjugate for use in the composition and method of the present invention is a monosaccharide. In one embodiment, the monosaccharide is N-acetylgalactosamine as follows.

[0153] Chemical Formula II

[0154]

[0155] In another embodiment, the carbohydrate conjugate for use in the composition and method of the present invention is selected from the group consisting of the following:

[0156] Chemical Formula II

[0157]

[0158] Chemical Formula III

[0159] ,

[0160] Chemical Formula IV

[0161] ,

[0162] Chemical formula V

[0163] ,

[0164] Chemical Formula VI

[0165] ,

[0166] Chemical Formula VII

[0167] ,

[0168] Chemical Formula VIII

[0169] ,

[0170] Chemical Formula IX

[0171] ,

[0172] Chemical formula X

[0173] ,

[0174] Chemical formula XI

[0175] ,

[0176] Chemical Formula XII

[0177] ,

[0178] Chemical Formula XIII

[0179] ,

[0180] Chemical formula XIV

[0181] ,

[0182] Chemical formula XV

[0183] ,

[0184] Chemical formula XVI

[0185] ,

[0186] Chemical Formula XVII

[0187] ,

[0188] Chemical Formula XVIII

[0189] ,

[0190] Chemical formula XIX

[0192] * ,

[0193] Chemical formula XX

[0194] ,

[0195] Chemical formula XXI

[0196] , and

[0197] Chemical formula XXII

[0198] .

[0199] Other representative carbohydrate conjugates for use in the embodiments described herein include, but are not limited to, the following:

[0200] (Chemical Formula XXIII)

[0201] ,

[0202] If either X or Y is an oligonucleotide, the other is hydrogen.

[0203] In some embodiments, the carbohydrate conjugate further comprises one or more additional ligands as described above, such as the PK modulator and / or cell penetration peptide, which are the same but not limited thereto.

[0204] D. Linker

[0205] In some embodiments, the conjugate or ligand described herein may be attached to an iRNA oligonucleotide with various linkers that may or may not be cleaved.

[0206] The term “linker” or “connector” refers to an organic moiety that connects two parts of a compound, for example, by covalently attaching two parts of a compound. The linker is typically NR8, C(O), C(O)NH, SO, SO2, SO2NH, or, for example, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, Alkylheteroarylkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylheterocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkenylheteroaryl, alkenylheterocyclylalkynyl, alkenylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkenylheteroaryl, alkenylheteroaryl, one or more methylenes are O, S, S(O), SO2, N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic may be interrupted or terminated; R8 comprises a direct bond or an atom such as oxygen or sulfur, which is a unit like a chain of atoms that are hydrogen, acyl, aliphatic or substituted aliphatic, but not limited thereto.In one embodiment, the linker is between about 1 to 24 atoms, 2 to 24, 3 to 24, 4 to 24, 5 to 24, 6 to 24, 6 to 18, 7 to 18, 8 to 18 atoms, 7 to 17, 8 to 17, 6 to 16, 7 to 17, or 8 to 16 atoms.

[0207] The cleavable linker is sufficiently stable outside the cell, but upon entering the target cell, it is cleaved to release the two parts joined together by the linker. In a preferred embodiment, the cleavable linker is cleaved at least about 10, 20, 30, 40, 50, 60, 70, 80, 90 times or more, or at least about 100 times faster in the target cell or under a first reference condition (which may be selected to mimic or represent intracellular conditions) than in the subject's blood or under a second reference condition (which may be selected to mimic or represent conditions found in blood or serum, e.g.).

[0208] Cleavable linkers are sensitive to the presence of cleavage agents, e.g., pH, redox potential, or degradation molecules. Generally, cleavage agents are found in higher levels or with greater activity within cells than in serum or blood. Examples of such degradation agents include: redox agents selected for specific substrates or lacking substrate specificity, including oxidizing or reducing enzymes or reducing agents such as mercaptans present within cells that can degrade redox cleavable linkers by reduction; esterases; endosomes or agents capable of generating an acidic environment, e.g., endosomes or agents that generate a pH of 5 or lower; enzymes capable of hybridizing or degrading acid cleavable linkers by acting as general acids, including peptidases and phosphatases (which may be substrate-specific).

[0209] Cleatable linkers, such as disulfide bonds, can be sensitive to pH. The pH of human serum is 7.4, whereas the average intracellular pH is slightly lower, reaching about 7.1 to 7.3. Endosomes have a more acidic pH ranging from 5.5 to 6.0, and lysosomes have a slightly more acidic pH near 5.0. Some linkers have cleavable linkers that cleave at a desired pH, thereby releasing cationic lipids from ligands inside the cell or into a desired compartment of the cell.

[0210] The linker may include a cleavable linker that can be cleaved by a specific enzyme. The type of cleavable linker included in the linker may vary depending on the target cell. For example, a liver-targeted ligand may be linked to a cationic lipid via a linker containing an ester group. Liver cells are rich in esterases; therefore, the linker will be cleaved more efficiently in liver cells than in cell types that are not rich in esterases. Other cell types rich in esterases include cells of the lungs, renal cortex, and testes.

[0211] Linkers containing peptide bonds can be used when targeting peptidase-rich cell types, such as liver cells and synovial cells.

[0212] Generally, the suitability of a cleavable linker candidate can be evaluated by testing the ability of a degradation agent (or condition) to cleave the candidate linker. Additionally, it would be desirable to test the cleavable linker candidate's ability to resist cleavage when in contact with blood or other non-target tissues. Thus, the relative sensitivity to cleavage can be determined between a first condition selected to exhibit cleavage within target cells and a second condition selected to exhibit cleavage within other tissues or biological fluids, such as blood or serum. Evaluations may be performed in cell-free systems, intracellularly, in cell cultures, in organ or tissue cultures, or in whole animals. It may be useful to conduct an initial evaluation in cell-free or culture conditions and confirm it with a subsequent evaluation in whole animals. In preferred embodiments, the useful candidate compound is cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in a cell (or under in vitro conditions selected to mimic intracellular conditions) compared to in blood or serum (or under in vitro conditions selected to mimic extracellular conditions).

[0214] i. Redox cutting capable connector

[0215] In one embodiment, the cleavable linker is a redox cleavable linker that is cleaved upon oxidation or reduction. An example of a reductively cleavable linker is a disulfide linker (-SS-). To determine whether a candidate cleavable linker is a suitable “reductively cleavable linker” or, for example, suitable for use with a specific dsRNA moiety and a specific target agent, the methods described herein may be examined. For example, the candidate may be evaluated by culture using other reducing agents with reagents known in the industry, or dithiothreitol (DTT), which mimic the cleavage rate that may be observed in cells, e.g., target cells. The candidate may also be evaluated under conditions selected to mimic blood or serum conditions. In one embodiment, the candidate compound is cleaved by up to about 10% in blood. In other embodiments, the useful candidate compound is degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) compared to in blood (or under in vitro conditions selected to mimic extracellular conditions). The cleavage rate of the candidate compound can be determined using standard enzyme kinetics assays under conditions selected to mimic the intracellular medium and compared with conditions selected to mimic the extracellular medium.

[0216] ii. Phosphate-based cuttable connectorIn another embodiment, the cleavable linker comprises a phosphate-based cleavable linker. The phosphate-based cleavable linker is cleaved by an agent that decomposes or hybridizes the phosphate group. An example of an agent that cleaves the phosphate group within a cell is an enzyme such as phosphatase within the cell. Examples of phosphate-based couplers are -OP(O)(ORk)-O-, -OP(S)(ORk)-O-, -OP(S)(SRk)-O-, -SP(O)(ORk)-O-, -OP(O)(ORk)-S-, -SP(O)(ORk)-S-, -OP(S)(ORk)-S-, -SP(S)(ORk)-O-, -OP(O)(Rk)-O-, -OP(S)(Rk)-O-, -SP(O)(Rk)-O-, -SP(S)(Rk)-O-, -SP(O)(Rk)-S-, and -OP(S)(Rk)-S. Preferred embodiments are -OP(O)(OH)-O-, -OP(S)(OH)-O-, -OP(S)(SH)-O-, -SP(O)(OH)-O-, -OP(O)(OH)-S-, -SP(O)(OH)-S-, -OP(S)(OH)-S-, -SP(S)(OH)-O-, -OP(O)(H)-O-, -OP(S)(H)-O-, -SP(O)(H)-O-, -SP(S)(H)-O-, -SP(O)(H)-S-, and -OP(S)(H)-S-. One preferred embodiment is -OP(O)(OH)-O-. These candidates can be evaluated using a method similar to the one described above.

[0217] iii. Mountain-cutting connector

[0218] In another embodiment, the cleavable linker comprises an acid-cleavable linker. The acid-cleavable linker is a linker that is cleaved under acidic conditions. In preferred embodiments, the acid-cleavable linker is cleaved in an acidic environment having a pH of about 6.5 or less (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0 or less) or by an agent such as an enzyme that can act as a general acid. Within a cell, specific low pH organelles, such as endosomes and lysosomes, may provide a cleavage environment for the acid-cleavable linker. Examples of acid-cleavable linkers include, but are not limited to, hydrazones, esters, and esters of amino acids. The acid-cleavable group may have the general formula -C=NN-, C(O)O, or -OC(O). A preferred embodiment is when the carbon attached to the oxygen of the ester (alkoxy group) is an aryl group, a substituted alkyl group, or a tertiary alkyl group such as dimethylpentyl or t-butyl. These candidates can be evaluated using a method similar to the one described above.

[0219] iv. Ester-based linkers In another embodiment, the cleavable linker comprises an ester-based cleavable linker. The ester-based cleavable linker is cleaved within the cell by enzymes such as esterase and amidases. Examples of ester-based cleavable linkers include, but are not limited to, esters of alkylene, alkenylene, and alkynylene groups. The ester-cleavable group has the general formula -C(O)O- or -OC(O)-. These candidates can be evaluated using a method similar to the one described above.

[0220] v. Peptide cutter

[0221] In another embodiment, the cleavable linker comprises a peptide-based cleavable linker. The peptide-based cleavable linker is cleaved by enzymes such as peptidases and proteases within the cell. The peptidases-based cleavable linker is a peptide bond formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides, etc.) and polypeptides. The peptide-based cleavable group does not contain an amide group (-C(O)NH-). The amide group may be formed between any alkylene, alkenylene, or alkynylene. A peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins. The peptide-based cleavable linker is generally limited to a peptide bond (i.e., an amide bond) formed between amino acids to yield peptides and proteins and does not contain an entire amide functional group. The peptide-based cleavable linker has the general formula -NHCHRAC(O)NHCHRBC(O)-, where RA and RB are the R groups of two adjacent amino acids. These candidates can be evaluated using a method similar to the one described above.

[0222] In one embodiment, the iRNA of the present invention is conjugated to a carbohydrate through a linker. Non-limiting examples of iRNA carbohydrate conjugation with a linker of the composition and method of the present invention include, but are not limited to, the following.

[0223] (Chemical formula XXIV)

[0224] ,

[0225] (Chemical formula XXV)

[0226] ,

[0227] (Chemical formula XXVI)

[0228] ,

[0229] (Chemical formula XXVII)

[0230] ,

[0231] (Chemical formula XXVIII)

[0232] ,

[0233] (Chemical Formula XXIX)

[0234] , and

[0235] (Chemical formula XXX)

[0236] ,

[0237] If either X or Y is an oligonucleotide, the other is hydrogen.

[0238] In specific embodiments of the composition and method of the present invention, the ligand is one or more GalNAc (N-acetylgalactosamine) derivatives attached through a divalent or trivalent branched linker.

[0239] In one embodiment, the dsRNA of the present invention is conjugated to a divalent or trivalent branched linker selected from the group consisting of structures shown in any one of formulas (XXXI) to (XXXIV):

[0240] Chemical formula XXXI Chemical formula XXXII

[0241] , or ;

[0242] Chemical Formula XXXIII Chemical Formula XXXIV

[0243] Here: q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B, and q5C independently represent 0 to 20 in each case, and the repeating units may be the same or different;

[0245] P 2A , P 2B , P 3A , P 3B , P 4A , P 4B , P 5A , P5B , P 5C , T 2A , T 2B , T 3A , T 3B , T 4A , T 4B , T 4A , T 5B , T 5C are independently none, CO, NH, O, S, OC(O), NHC(O), CH2, CH2NH, or CH2O in each respective case;

[0246] Q 2A , Q 2B , Q 3A , Q 3B , Q 4A , Q 4B , Q 5A , Q 5B , Q 5C are independently none, alkylene, or substituted alkylene in each case, and one or more methylenes are O, S, S(O), SO2, N(R N It may be interrupted or terminated by one or more of ), C(R')=C(R"), C≡C, or C(O);

[0247] R 2A , R 2B , R 3A , R 3B , R 4A , R 4B , R 5A , R 5B , R 5C are independently in each case none, NH, O, S, CH2, C(O)O, C(O)NH, NHCH(R a )C(O), -C(O)-CH(R a )-NH-, CO, CH=NO, , , , , or heterocyclil;

[0248] L 2A , L 2B , L 3A , L3B , L 4A , L 4B , L 5A , L 5B and L 5C is a ligand; that is, each independently represents a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide in each case (such as GalNAc); and R a is an H or amino acid side chain. Trivalent conjugated GalNAc derivatives are particularly useful for use with RNAi agents to inhibit the expression of target genes, such as those of formula (XXXV):

[0249] Chemical formula XXXV

[0250] ,

[0251] Here, L 5A , L 5B and L 5C represents a monosaccharide such as a GalNAc derivative.

[0252] Examples of suitable divalent and trivalent branched linker groups conjugating GalNAc derivatives include, but are not limited to, the structures cited above as Formulas II_VII, XI, X, and XIII.

[0253] Representative U.S. patents teaching formulations of RNA conjugates are U.S. Patent Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735, each the entire contents of which are incorporated herein by reference; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941; 6,294,664; 6,320,017; 6,576,752; 6,783,931; 6,900,297; Includes 7,037,646; 8,106,022 numbers, but is not limited thereto.

[0254] It is not necessary for all positions within a given compound to be uniformly modified, and in fact, modifications exceeding one of the aforementioned modifications may be included in a single nucleoside within a single compound or even within an iRNA. The present invention also includes iRNA compounds that are chimeric compounds.

[0255] In the context of the present invention, a “chimeric” iRNA compound or “chimera” is an iRNA compound, preferably dsRNA, each comprising at least one monomer unit, that is, in the case of a dsRNA compound, two or more chemically distinct regions composed of nucleotides. Such iRNA typically comprises at least one region, and the RNA is modified to confer on the iRNA increased resistance to nuclease degradation, increased cellular uptake, and / or increased binding affinity to target nucleic acids. Additional regions of the iRNA may serve as substrates for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. For example, RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. Therefore, activation of RNase H leads to the cleavage of the RNA target, significantly enhancing the efficiency of iRNA repression of gene expression. Consequently, compared to phosphothioate deoxy dsRNA that hybridizes to the same target region, comparable results can often be obtained with shorter iRNA when chimeric dsRNA is used. The cleavage of the RNA target can typically be detected by gel electrophoresis and, if necessary, by associated nucleic acid hybridization techniques known in the industry.

[0256] In specific cases, the RNA of iRNA can be modified by non-ligand groups. Numerous non-ligand molecules have been conjugated to iRNA to enhance its activity, cellular distribution, or cellular uptake, and procedures for performing such conjugation are available in the scientific literature. Such non-ligand moiety is cholesterol (Kubo, T. et al. ,Biochem. Biophys. Res. Comm., 2007, 365(1): 54-61; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), thioethers, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), aliphatic chains, e.g., dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), phospholipids, e.g., di-hexadecyl-lac-glycerol or triethylammonium 1,2-di-o-hexadecyl-lac-glycero-3-H-phosphonate (Manoharan et al. , Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), polyamine or polyethylene glycol chains (Manoharan et al. ,These include lipid moiety types such as Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Representative U.S. patents disclosing formulations of such RNA conjugates are listed above. A conventional conjugation protocol involves the synthesis of RNA possessing aminolinkers at one or more positions in the sequence. The amino groups are then reacted with the molecule to be conjugated using a suitable coupling agent or activator. The conjugation reaction can be performed by dsRNA still bound to a solid support of RNA in the solution phase or by subsequent cleavage of RNA in the solution phase. Purification of dsRNA conjugates by HPLC can typically provide pure conjugates.

[0257] IV. Delivery of iRNA of the present invention

[0258] Delivery of the iRNA of the present invention into cells, for example, into subjects such as human subjects (e.g., subjects requiring this, such as subjects with lipid metabolism disorders), can be achieved in numerous different ways. For example, delivery may be performed by bringing cells into contact with the iRNA of the present invention in vitro or in vivo. In vivo delivery may be performed directly by administering a composition containing iRNA, e.g., dsRNA, to a subject. Alternatively, in vivo delivery may be performed indirectly by administering one or more vectors encoding and directing the expression of the iRNA. Such alternatives are further discussed below.

[0259] In general, any method of delivering nucleic acid molecules (in vitro or in vivo) can be made suitable for use with the iRNA of the present invention (e.g., Akhtar S. and Julian RL., (1992), the whole of which is incorporated herein by reference) Trends Cell. Biol. See 2(5):139-144 and WO94 / 02595). For in vivo delivery, factors considered for delivering iRNA molecules include, for example, the biological stability of the delivered molecule, the prevention of non-specific effects, and the accumulation of the delivered molecule within the target tissue. Non-specific effects of iRNA can be minimized by local administration, for example, through indirect injection or implantation into tissue or by administering the agent topically. Local administration to the treatment site maximizes the local concentration of the agent, otherwise limits exposure of the agent to systemic tissues that may be harmed or degraded by the agent, and allows for the administration of a lower total dose of the iRNA molecule. Several studies have shown successful knockdown of gene products when iRNA is administered topically. For example, intravitreal injection into cynomolgus monkeys (Tolentino, MJ. et al., (2004) Retina 24:132-138) and subretinal injection in mice (Reich, SJ. et al. . (2003) Mol. Vis. Intraocular delivery of VEGF dsRNA by (9:210-216) was found to prevent neovascularization in both experimental models of age-related vision loss. In addition, direct intratumoral injection of dsRNA into mice reduced tumor volume (Pille, J. et al. (2005) Mol. Ther.1 1:267-274), can extend the survival of tumor-carrying mice (Kim, WJ. et al., (2006) Mol. Ther.1 4:343-350; Li, S. et al., (2007) Mol. Ther.15:515-523). RNA interference to the CNS by direct injection (Dorn, G. et al. , (2004) Nucleic Acids 32:e49; Tan, PH. et al., (2005) Gene Ther.1 2:59-66; Makimura, H. et al. (2002) BMC Neurosci. 3:18; Shishkina, G.T., etc. (2004) Neuroscience 129:521-528; Thakker, E.R., et al. (2004) Proc. Natl. Acad. Sci. USA1 01:17270-17275; Akaneya, Y., et al. (2005) J. Neurophysiol. 93:594-602) and to the lungs by intranasal administration (Howard, KA. et al., (2006) Mol. Ther.1 4:476-484; Zhang, X. et al., (2004) J. Biol. Chem. 279:10677-10684; Bitko, V. et al., (2005) Nat. Med.1 1:50-55) Successful local delivery has also been demonstrated. To administer iRNA systemically for the treatment of disease, RNA can be modified or alternatively delivered using drug delivery systems; both methods serve to prevent the rapid degradation of dsRNA by endonucleases and exonucleases in vivo. Modification of the RNA or pharmaceutical carrier may also allow the iRNA composition to be targeted to target tissues and avoid undesirable off-target effects. Since iRNA molecules are lipophilic, such as cholesterol, they can be modified by chemical conjugation to enhance cellular uptake and prevent degradation. For example, iRNA directed against ApoB conjugated to a lipophilic cholesterol moiety was injected systemically into mice, causing knockdown of apoB mRNA in the liver and jejunum (Soutschek, J. et al., (2004) Nature432:173-178). Conjugation of iRNA into aptamers was found to inhibit tumor growth and modulate tumor regression in a mouse model of prostate cancer (McNamara, JO. et al., (2006) Nat. Biotechnol. 24:1005-1015). In an alternative embodiment, iRNA may be delivered using a drug delivery system such as nanoparticles, dendrimers, polymers, liposomes, or cationic delivery systems. Positively charged cationic delivery systems facilitate the binding of iRNA molecules (negatively charged) and enhance interactions at negatively charged cell membranes, thereby enabling efficient uptake of iRNA by the cell. Cationic lipids, dendrimers, or polymers may bind to or be induced to the iRNA to form vesicles or micelles surrounding the iRNA (e.g., Kim SH. et al., (2008) Journal of Controlled Release See 129(2):107-116). The formation of vesicles or micelles further prevents the degradation of iRNA when iRNA is administered systemically. Methods for preparing and administering cationic iRNA complexes are fully within the capabilities of those skilled in the art (e.g., Sorensen, DR., et al. (2003), the entirety of which is incorporated herein by reference) J. Mol. Biol 327:761-766; Verma, UN. etc. , (2003) Clin. Cancer Res. 9:1291-1300; Arnold, AS et al., (2007) J. Hypertens. See 25:197-205). Some non-limiting examples of drug delivery systems useful for the systemic delivery of iRNA are DOTAP (Sorensen, DR., et al. (2003), cited above; Verma, UN. etc. , (2003), cit.), oligofectamine, "solid nucleic acid lipid particles" (Zimmermann, TS. et al. , (2006) Nature 441:111-114), cardiolipin(Chien, PY. etc. , (2005) Cancer Gene Ther.12:321-328; Pal, A. etc. , (2005) Int J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet ME. et al., (2008) Pharm. Res. Aug 16 Epub ahead of print; Aigner, A. (2006). J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptide (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamine (Tomalia, DA. etc. , (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H. etc. , (1999) Pharm. Res.1 Includes 6:1799-1804). In some embodiments, the iRNA forms a complex with cyclodextrin for systemic administration. Methods of administering iRNA and cyclodextrin and pharmaceutical compositions can be found in U.S. Patent No. 7,427,605, the whole of which is incorporated herein by reference.

[0260] A. Vector-encoded iRNA of the present invention

[0261] iRNA targeting the ANGPTL3 gene is expressed from a transcription unit inserted into a DNA or RNA vector (e.g., Couture, A, et al. TIG. (1996), 12:5-10; see Skillern, A., et al., International Patent Application Publication No. WO 00 / 22113, Conrad, International Patent Application Publication No. WO 00 / 22114, and Conrad, U.S. Patent No. 6,054,299). Expression may be transient (in the order of hours to weeks) or persistent (weeks or months or more) depending on the specific construct used and the target tissue or cell type. Such transplanted genes may be introduced as linear constructs, circular plasmids, or viral vectors, which may be integrating or non-integrating vectors. Transplanted genes may also be configured to be inheritable as extrachromosomal plasmids (Gassmann et al., (1995) Proc. Natl. Acad. Sci. USA 92:1292).

[0262] Individual strands or strands of iRNA can be transcribed from a promoter on an expression vector. If two individual strands are expressed to generate, for example, dsRNA, the two individual expression vectors can be co-introduced into target cells (e.g., by transfer infection or infection). Alternatively, each individual strand of dsRNA can be transcribed by promoters located on the same expression plasmid. In one embodiment, the dsRNA is expressed as a polynucleotide with an inverted repeat joined by a linker polynucleotide sequence, so that the dsRNA has a stem and loop structure.

[0263] iRNA expression vectors are generally DNA plasmids or viral vectors. Expression vectors compatible with eukaryotic cells, preferably compatible with vertebrate cells, can be used to generate recombinant constructs for iRNA expression as described herein. Eukaryotic expression vectors are well known in the industry and are available from numerous commercial sources. Typically, such vectors are provided that include simple restriction sites for the insertion of desired nucleic acid segments. Delivery of the iRNA expressing the vector may be systemic, such as by intravenous or intramuscular administration, or by other means such as administering to target cells extracted from the patient and subsequently reintroducing them to the patient or introducing them into the desired target cells.

[0264] The iRNA expression plasmid is a cationic lipid carrier (e.g., oligofectamine) or a non-cationic lipid-based carrier (e.g., Transit-TKO TM It can be delivered to target cells as a complex with ). Multiple lipid delivery infections for iRNA-mediated knockdowns targeting different regions of target RNA over a period of more than one week are also considered by the present invention. The successful introduction of a vector into host cells can be monitored using various known methods. For example, transient delivery infection can be indicated by a reporter, such as a fluorescent marker, such as green fluorescent protein (GFP). Appropriate delivery infection of ex vivo cells can be ensured using a marker that provides delivered cells resistant to specific environmental factors (e.g., antibiotics and drugs), such as hygromycin B resistance.

[0265] Viral vector systems that can be utilized using the methods and compositions described herein include: (a) adenovirus vectors; (b) retrovirus vectors, including but not limited to lentivirus vectors, Molony murine leukemia virus, etc.; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyomavirus vectors; (g) papillomavirus vectors; (h) picornavirus vectors; (i) varicella virus vectors such as orthopox, e.g., cowpox virus vectors, or avian pox, e.g., canary varicella or fowlpox; and (j) helper-dependent or gutless adenoviruses, including but not limited to. Replication-deficient viruses may also be advantageous. Different vectors may or may not be included in the cell genome. If desired, the construct may include viral sequences for transmission infection. Alternatively, the construct may be included in a vector capable of replicating the episome, such as EPV and EBV vectors. Constructs for the recombinant expression of iRNA will generally require regulatory elements, such as promoters and enhancers, to ensure the expression of iRNA within target cells. Other aspects considered for the vector and construct are further described below.

[0266] Vectors useful for iRNA delivery will contain regulatory elements (promoters, enhancers, etc.) sufficient for iRNA expression within the desired target cells or tissues. By selecting these regulatory elements, constitutive or regulated / inducible expression can be provided.

[0267] The expression of iRNA can be precisely regulated, for example, by using inducible regulatory sequences sensitive to specific physiological regulators, such as circulating glucose levels or hormones (Docherty et al., 1994, FASEB J. 8:20-24). Such inducible expression systems suitable for the regulation of dsRNA expression in cells or mammals include, for example, regulation by ecdysone, estrogen, progesterone, tetracycline, chemical derivatives of dimerization, and isopropyl-beta-D1-thiogalactopyranoside (IPTG). Those skilled in the art can select appropriate regulatory / promoter sequences based on the intended use of the iRNA transplant gene.

[0268] Viral vectors containing nucleic acid sequences encoding iRNA can be used. For example, retroviral vectors can be used (Miller et al., (1993) Meth. Enzymol. (See 217:581-599). These retroviral vectors contain the components necessary for the proper packaging of the viral genome and its integration into host cell DNA. Nucleic acid sequences encoding iRNA are cloned into one or more vectors to facilitate the delivery of the nucleic acid to the patient. Further details regarding retroviral vectors can be found, for example, in Boesen et al., Biotherapy 6:291-302 (1994), which describes the use of retroviral vectors to deliver the mdr1 gene to hematopoietic stem cells to make them more resistant to chemotherapy. Other references exemplifying the use of retroviral vectors in gene therapy include: Clowes et al., (1994). J. Clin. Invest. 93:644-651; Kiem et al., (1994) Blood 83:1467-1473; Salmons and Gunzberg, (1993) Human Gene Therapy 4:129-141; and Grossman and Wilson, (1993) Curr. Opin. in Genetics and Development.3:110-114. Lentiviral vectors for use include, for example, HIV-based vectors described in U.S. Patent Nos. 6,143,520; 5,665,557; and 5,981,276 incorporated herein by reference.

[0269] Adenoviruses are also considered for use in the delivery of the iRNA of the present invention. Adenoviruses are particularly attractive carriers for, for example, in delivering genes to respiratory epithelium. Adenoviruses naturally infect respiratory epithelium, where they cause mild disease. Other targets for the adenoviral delivery system are the liver, central nervous system, vascular endothelial cells, and muscle. Adenoviruses have the advantage of being able to infect non-dividing cells. Kozarsky and Wilson, (1993) Current Opinion in Genetics and Development 3:499-503 presents a review of adenoviral gene therapy. Bout et al., (1994) Human Gene Therapy 5:3-10 demonstrated the use of an adenovirus vector to deliver genes to the respiratory epithelium of rhesus monkeys. Another case of the use of adenoviruses in gene therapy is Rosenfeld et al. (1991). Science 252:431-434; Rosenfeld et al., (1992) Cell 68:143-155; Mastrangeli et al., (1993) J. Clin. Invest. 91:225-234; PCT application publication number WO94 / 12649; and Wang et al., (1995) Gene Therapy A suitable AV vector for expressing iRNA characterized by the present invention, a method for constructing a recombinant AV vector, and a method for delivering the vector to target cells can be found in Xia H et al. (2002). Nat. Biotech . 20 It is described in :1006-1010.

[0270] Adeno-associated virus (AAV) vectors may also be used to deliver the iRNA of the present invention (Walsh et al., (1993) Proc. Soc. Exp. Biol. Med. 204:289-300; U.S. Patent No. 5,436,146). In one embodiment, the iRNA may be expressed as two separate complementary single-stranded RNA molecules derived from a recombinant AAV vector having, for example, a U6 or H1 RNA promoter, or a cytomegalovirus (CMV) promoter. An AAV vector suitable for expressing the dsRNA characterized in the present invention, a method for constructing a recombinant AV vector, and a method for delivering the vector to a target cell are, in their entirety, incorporated herein by reference: Samulski R et al. (1987), J. Virol. 61: 3096-3101; Fisher KJ et al. (1996), J. Virol. 70: 520-532; Samulski R et al. (1989), J. Virol. 63: 3822-3826; U.S. Patent No. 5,252,479; It is described in U.S. Patent No. 5,139,941; International Patent Application No. WO 94 / 13788; and International Patent Application No. WO 93 / 24641.

[0271] Other viral vectors suitable for iRNA delivery of the present invention are varicella viruses such as cowpox virus, for example, modified virus Ankara (MVA) or NYVAC, attenuated cowpox, fowlpox, or canary pox.

[0272] The tropism of a viral vector can be modified by pseudotyping the vector with envelope proteins or other surface antigens derived from other viruses, or by appropriately substituting different viral capsid proteins. For example, a lentiviral vector can be pseudotyped with surface proteins derived from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, etc. AAV vectors can be engineered to target different cells by expressing different capsid protein serotypes; for example, Rabinowitz J.E. et al. (2002), the entire initiation of which is incorporated herein by reference, J Virol See 76:791-801.

[0273] A pharmaceutical formulation of a vector may contain the vector in an acceptable diluent or may contain a sustained-release matrix in which a gene delivery carrier is embedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells, e.g., a retroviral vector, the pharmaceutical formulation may contain one or more cells that produce a gene delivery system.

[0274] V. Pharmaceutical composition of the present invention

[0275] The present invention also includes pharmaceutical compositions and formulations comprising the iRNA of the present invention. In one embodiment, a pharmaceutical composition comprising an iRNA and a pharmaceutically acceptable carrier is provided herein as described. A pharmaceutical composition comprising the iRNA is useful for treating a disease or disorder associated with the expression or activity of the ANGPTL3 gene, such as lipid metabolism disorders like hypertriglyceridemia.

[0276] Such pharmaceutical compositions are formulated based on the mode of delivery. One example is a composition formulated for systemic administration via parenteral delivery, e.g., intravenous (IV), or subcutaneous delivery. Another example is a composition formulated for indirect delivery to the liver, e.g., by infusion to the liver, such as by continuous pump infusion.

[0277] The pharmaceutical composition of the present invention may be administered at a sufficient dose to inhibit the expression of the ANGPTL3 gene. Generally, suitable doses of the iRNA of the present invention are in the range of about 0.001 to about 200.0 milligrams per kg of the recipient's body weight per day, and generally will be in the range of about 1 to 50 mg per kg of body weight per day. For example, dsRNA may be administered at a single dose of about 0.01 mg / kg, about 0.05 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 1.5 mg / kg, about 2 mg / kg, about 3 mg / kg, about 10 mg / kg, about 20 mg / kg, about 30 mg / kg, about 40 mg / kg, or about 50 mg / kg.

[0278] For example, dsRNA is approximately 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8.1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8. 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8. 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8. 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8. 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8. 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8. 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8. 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8. It may be administered at a dose of 9.9, or about 10 mg / kg. Intermediate values ​​and ranges to the cited values ​​are also intended as part of the invention.

[0279] In another embodiment, the dsRNA is about 0.1 to about 50 mg / kg, about 0.25 to about 50 mg / kg, about 0.5 to about 50 mg / kg, about 0.75 to about 50 mg / kg, about 1 to about 50 mg / mg, about 1.5 to about 50 mg / kb, about 2 to about 50 mg / kg, about 2.5 to about 50 mg / kg, about 3 to about 50 mg / kg, about 3.5 to about 50 mg / kg, about 4 to about 50 mg / kg, about 4.5 to about 50 mg / kg, about 5 to about 50 mg / kg, about 7.5 to about 50 mg / kg, about 10 to about 50 mg / kg, about 15 to about 50 mg / kg, about 20 to about 50 mg / kg, about 20 to about 50 mg / kg, about 25 to about 50 mg / kg, about 25 to about 50 mg / kg, about 30 to about 50 mg / kg, about 35 to about 50 mg / kg, about 40 to about 50 mg / kg, about 45 to about 50 mg / kg, about 0.1 to about 45 mg / kg, about 0.25 to about 45 mg / kg, about 0.5 to about 45 mg / kg, about 0.75 to about 45 mg / kg, about 1 to about 45 mg / mg, about 1.5 to about 45 mg / kb, about 2 to about 45 mg / kg, about 2.5 to about 45 mg / kg, about 3 to about 45 mg / kg, about 3.5 to about 45 mg / kg, about 4 to about 45 mg / kg, about 4.5 to about 45 mg / kg, about 5 to about 45 mg / kg, about 7.5 to about 45 mg / kg, about 10 to about 45 mg / kg, about 15 to about 45 mg / kg, about 20 to about 45 mg / kg, about 20 to about 45 mg / kg, about 25 to about 45 mg / kg, about 25 to about 45 mg / kg, about 30 to about 45 mg / kg, about 35 to about 45 mg / kg, about 40 to about 45 mg / kg, about 0.1 to about 40 mg / kg, about 0.25 to about 40 mg / kg, about 0.5 to about 40 mg / kg, about 0.75 to about 40 mg / kg, about 1 to about 40 mg / mg, about 1.5 to about 40 mg / kb, about 2 to about 40 mg / kg, about 2.5 to about 40 mg / kg, about 3 to about 40 mg / kg, about 3.5 to about 40 mg / kg, about 4 to about 40 mg / kg, about 4.5 to about 40 mg / kg, about 5 to about 40 mg / kg, about 7.5 to about 40 mg / kg, about 10 to about 40 mg / kg, about 15 to about 40 mg / kg, about 20 to about 40 mg / kg, about 20 to about 40 mg / kg, about 25 to about 40 mg / kg, about 25 to about 40 mg / kg, about 30 to about 40 mg / kg, about 35 to about 40 mg / kg, about 0.1 to about 30 mg / kg, about 0.25 to about 30 mg / kg, about 0.5 to about 30 mg / kg, about 0.75 to about 30 mg / kg, about 1 to about 30 mg / mg, about 1.5 to about 30 mg / kb, about 2 to about 30 mg / kg, about 2.5 to about 30 mg / kg, about 3 to about 30 mg / kg, about 3.5 to about 30 mg / kg, about 4 to about 30 mg / kg, about 4.5 to about 30 mg / kg, about 5 to about 30 mg / kg, about 7.5 to about 30 mg / kg, about 10 to about 30 mg / kg, about 15 to about 30 mg / kg, about 20 to about 30 mg / kg, about 20 to about 30 mg / kg, about 25 to about 30 mg / kg, about 0.1 to about 20 mg / kg, about 0.25 to about 20 mg / kg, about 0.5 to about 20 mg / kg, about 0.75 to about 20 mg / kg, about 1 to about 20 mg / mg, about 1.5 to about 20 mg / kb, about 2 to about 20 mg / kg, about 2.5 to about 20 mg / kg, about 3 to about 20 mg / kg, about 3.It is administered at doses of 5 to about 20 mg / kg, about 4 to about 20 mg / kg, about 4.5 to about 20 mg / kg, about 5 to about 20 mg / kg, about 7.5 to about 20 mg / kg, about 10 to about 20 mg / kg, or about 15 to about 20 mg / kg. Intermediate values ​​and ranges to the cited values ​​are also intended as part of the invention.

[0280] For example, dsRNA is approximately 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7. 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8.1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8. 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8. 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8. 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8. 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8. 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8. 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8. It may be administered at doses of 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or about 10 mg / kg. Intermediate values ​​and ranges to the cited values ​​are also intended as part of the invention.

[0281] In another embodiment, the dsRNA is about 0.5 to about 50 mg / kg, about 0.75 to about 50 mg / kg, about 1 to about 50 mg / mg, about 1.5 to about 50 mg / kb, about 2 to about 50 mg / kg, about 2.5 to about 50 mg / kg, about 3 to about 50 mg / kg, about 3.5 to about 50 mg / kg, about 4 to about 50 mg / kg, about 4.5 to about 50 mg / kg, about 5 to about 50 mg / kg, about 7.5 to about 50 mg / kg, about 10 to about 50 mg / kg, about 15 to about 50 mg / kg, about 20 to about 50 mg / kg, about 20 to about 50 mg / kg, about 25 to about 50 mg / kg, about 25 to about 50 mg / kg, about 30 to about 50 mg / kg, about 35 to about 50 mg / kg, about 40 to about 50 mg / kg, about 45 to about 50 mg / kg, about 0.5 to about 45 mg / kg, about 0.75 to about 45 mg / kg, about 1 to about 45 mg / mg, about 1.5 to about 45 mg / kb, about 2 to about 45 mg / kg, about 2.5 to about 45 mg / kg, about 3 to about 45 mg / kg, about 3.5 to about 45 mg / kg, about 4 to about 45 mg / kg, about 4.5 to about 45 mg / kg, about 5 to about 45 mg / kg, about 7.5 to about 45 mg / kg, about 10 to about 45 mg / kg, about 15 to about 45 mg / kg, about 20 to about 45 mg / kg, about 20 to about 45 mg / kg, about 25 to about 45 mg / kg, about 25 to about 45 mg / kg, about 30 to about 45 mg / kg, about 35 to about 45 mg / kg, about 40 to about 45 mg / kg, about 0.5 to about 40 mg / kg, about 0.75 to about 40 mg / kg, about 1 to about 40 mg / mg, about 1.5 to about 40 mg / kb, about 2 to about 40 mg / kg, about 2.5 to about 40 mg / kg, about 3 to about 40 mg / kg, about 3.5 to about 40 mg / kg, about 4 to about 40 mg / kg, about 4.5 to about 40 mg / kg, about 5 to about 40 mg / kg, about 7.5 to about 40 mg / kg, about 10 to about 40 mg / kg, about 15 to about 40 mg / kg, about 20 to about 40 mg / kg, about 20 to about 40 mg / kg, about 25 to about 40 mg / kg, about 25 to about 40 mg / kg, about 30 to about 40 mg / kg, about 35 to about 40 mg / kg, about 0.5 to about 30 mg / kg, about 0.75 to about 30 mg / kg, about 1 to about 30 mg / mg, about 1.5 to about 30 mg / kb, about 2 to about 30 mg / kg, about 2.5 to about 30 mg / kg, about 3 to about 30 mg / kg, about 3.5 to about 30 mg / kg, about 4 to about 30 mg / kg, about 4.5 to about 30 mg / kg, about 5 to about 30 mg / kg, about 7.5 to about 30 mg / kg, about 10 to about 30 mg / kg, about 15 to about 30 mg / kg, about 20 to about 30 mg / kg, about 20 to about 30 mg / kg, about 25 to about 30 mg / kg, about 0.5 to about 20 mg / kg, about 0.75 to about 20 mg / kg, about 1 to about 20 mg / mg, about 1.5 to about 20 mg / kb, about 2 to about 20 mg / kg, about It is administered at doses of 2.5 to about 20 mg / kg, about 3 to about 20 mg / kg, about 3.5 to about 20 mg / kg, about 4 to about 20 mg / kg, about 4.5 to about 20 mg / kg, about 5 to about 20 mg / kg, about 7.5 to about 20 mg / kg, about 10 to about 20 mg / kg, or about 15 to about 20 mg / kg. Intermediate values ​​and ranges to the cited values ​​are also intended as part of the present invention.

[0282] For example, the subject receives therapeutic doses of iRNA, e.g., about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8. 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8. 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8. 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8. 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8. 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8. 9.9, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg / kg may be administered. Intermediate values ​​and ranges of the cited values ​​are also intended as part of the present invention.

[0283] The pharmaceutical composition may be administered once daily, or the iRNA may be administered over the course of the day at appropriate intervals in two, three, or more subdoses, or even via continuous infusion or delivery using a controlled-release formulation. In such cases, the iRNA contained in each subdose must be correspondingly smaller to achieve the total daily dose. Dose units may be compounded to be delivered over several days, for example, using a conventional sustained-release formulation that provides sustained release of dsRNA over a period of several days. Sustained-release formulations are well known in the industry and are particularly useful for the delivery of the agent to a specific site, as they can be used with the agent of the present invention. In this embodiment, the dose unit comprises a corresponding multiple of the daily dose.

[0284] The effect of a single dose on ANGPTL3 levels persists over the long term, so subsequent doses are administered at intervals of 3, 4, or 5 days or less, or at intervals of 1, 2, 3, or 4 weeks or less.

[0285] Those skilled in the art will understand that certain factors, including but not limited to the severity of the disease or condition, prior treatment, the subject's general health and / or age, and other current conditions, may affect the dosage and timing required to effectively treat the subject. Additionally, treating the subject with a therapeutically effective amount of the composition may involve a single treatment or a series of treatments. The evaluation of the effective dosage and in vivo half-life for the individual iRNAs included in the present invention may be based on in vivo testing using appropriate animal models or by utilizing conventional methodologies as described elsewhere in this invention.

[0286] Advances in mouse genetics have led to the creation of numerous mouse models for the study of various human diseases, such as lipid metabolism disorders that benefit from reduced ANGPTL3 expression. Such models can be used for the determination of therapeutically effective doses as well as for in vivo testing of iRNA. Suitable mouse models are known in the industry, for example, obese (ob / ob) mice containing mutations in the obesity (ob) gene (Wiegman et al., (2003) Diabetes , 52:1081-1089); mouse with homozygous knockout of LDL receptor (LDLR - / - mouse; Ishibashi et al., (1993) J Clin Invest 92(2):883-893); diet-induced atheromatous arteriosclerosis mouse model (Ishida et al., (1991) J. Lipid. Res. Includes a heterozygous lipoprotein lipase knockout mouse model (Weistock et al., (1995) J. Clin. Invest. 96(6):2555-2568).

[0287] The pharmaceutical composition of the present invention may be administered in numerous ways depending on whether local or systemic treatment is required and the site to be treated. Administration may be by local (e.g., by a transdermal patch), pulmonary, e.g., by a nebulizer, and by inhalation or insufflation of a powder or aerosol; by tracheal intubation, intranasal, epidermal and transdermal, oral, or parenteral. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subcutaneously, e.g., through an implanted device; or intracranial, e.g., within the brain parenchyma, spinal canal, or ventricle.

[0288] iRNA can be delivered in a way that targets specific tissues, such as the liver (e.g., hepatocytes).

[0289] Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders. Conventional pharmaceutical carriers, water-soluble powders or oily bases, thickeners, etc. may be necessary or desirable. Coated condoms, gloves, etc. may also be useful. Suitable topical formulations include those in which the dsRNA characterized in the present invention is mixed with topical delivery agents such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents, and surfactants. Suitable lipids and liposomes include neutral (e.g., dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidylcholine DMPC, distearoylphosphatidylcholine), negative (e.g., dipyristoylphosphatidylglycerol DMPG), and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidylethanolamine DOTMA). The iRNA characterized in the present invention may be encapsulated within liposomes or may form a complex therein, particularly in cationic liposomes. Alternatively, the iRNA may be complexed with lipids, particularly cationic lipids. Suitable fatty acids and esters are arachidonic acid, oleic acid, eicosanic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecyl azacycloheptan-2-one, acylcarnitine, acylcholine, or C 1-20 Alkyl esters (e.g., It includes, but is not limited to, isopropyl myristate (IPM), monoglycerides, diglycerides, or pharmaceutically acceptable salts thereof. Topical formulations are described in detail in U.S. Patent No. 6,747,014, which is incorporated herein by reference.

[0290] A. iRNA formulation containing membrane molecule assembly

[0291] The iRNA used in the compositions and methods of the present invention may be formulated for delivery within membrane molecular assemblies, such as liposomes or micelles. As used herein, the term “liposome” refers to a vesicle composed of amphiphilic lipids arranged within at least one bilayer, such as one bilayer or multiple bilayers. A liposome comprises a monolayered or multilayered vesicle having a membrane formed from a lipophilic material and a water-soluble interior. The water-soluble portion contains the iRNA composition. The lipophilic material separates the water-soluble interior from the water-soluble exterior, which typically does not contain the iRNA composition, although it may be present in some examples. Liposomes are useful for transporting and delivering active ingredients to a site of action. Because the liposome membrane is structurally similar to a biological membrane, when the liposome is applied to a tissue, the liposome bilayer fuses with the bilayer of the cell membrane. As the fusion of the liposome and the cell proceeds, the internal water-soluble contents containing the iRNA are delivered to the cell, where the iRNA can specifically bind to the target RNA and mediate RNAi. In some cases, liposomes are also specifically targeted, for example, by directing iRNA to a specific cell type.

[0292] Liposomes containing RNAi agents can be prepared by various methods. In one example, the lipid component of the liposome is dissolved in a detergent so that micelles are formed from the lipid component. For example, the lipid component may be an amphiphilic cationic lipid or a lipid conjugate. The detergent may have a high critical micelle concentration and may be nonionic. Exemplary detergents include cholates, CHAPS, octylglucosides, deoxycholates, and lauroyl sarcosine. Subsequently, an RNAi agent formulation is added to the micelles containing the lipid component. The cations on the lipid interact with the RNA agent and condense around the RNAi agent to form a liposome. After condensation, the detergent is removed, for example, by dialysis, yielding a liposomal formulation of the RNAi agent.

[0293] If necessary, a carrier compound that assists in condensation may be added during the condensation reaction, for example, by controlled addition. For example, the carrier compound may be a polymer other than a nucleic acid (e.g., spermine or spermidine). In addition, the pH may be controlled to facilitate condensation.

[0294] A method for producing a stable polynucleotide delivery carrier comprising a polynucleotide / cationic lipid complex as a structural component of the delivery carrier is further described, for example, in WO 96 / 37194, the entire contents of which are incorporated herein by reference. Liposome formation is Felgner, PL et al., (1987) Proc. Natl. Acad. Sci. USA 8:7413-7417; U.S. Patent No. 4,897,355; U.S. Patent No. 5,171,678; Bangham et al. , (1965) M. Mol. Biol. 23:238; Olson et al., (1979) Biochim. Biophys. Acta 557:9; Szoka et al., (1978) Proc. Natl. Acad. Sci. 75: 4194; Mayhew et al., (1984) Biochim. Biophys. Acta 775:169; Kim et al., (1983) Biochim. Biophys. Acta 728:339; and Fukunaga etc. , (1984) Endocrinol.1 It may include one or more embodiments of the exemplary method described in 15:757. Commonly used techniques for producing lipid aggregates of a suitable size to be used as delivery carriers include sonication and freeze-thaw plus extrusion (e.g., Mayer et al., (1986)). Biochim. Biophys. Acta (See 858:161). Microfluidization can be used when consistently small (50 to 200 nm) and relatively uniform aggregates are desired (Mayhew et al., (1984) Biochim. Biophys. Acta 775:169). This method is easily modified to package RNAi agonist formulations into liposomes.

[0295] Liposomes belong to two broad categories. Cationic liposomes are positively charged liposomes that interact with negatively charged nucleic acid molecules to form a stable complex. The positively charged nucleic acid / liposome complex binds to the negatively charged cell surface and becomes embedded in the endosome. Due to the acidic pH within the endosome, the liposomes rupture and release their contents into the cytoplasm (Wang et al., (1987) Biochem. Biophys. Res. Commun., 147, 980-985).

[0296] pH-sensitive or negatively charged liposomes trap nucleic acids rather than complex with them. Because nucleic acids and lipids are similarly charged, repulsion occurs rather than complex formation. Nevertheless, some nucleic acids are trapped within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver nucleic acids encoding thymidine kinase genes into monolayers of cultured cells. Expression of exogenous genes was detected in target cells (Zhou et al. (1992) Journal of Controlled Release, 19, 269-274).

[0297] One important type of liposomal composition includes phospholipids other than naturally derived phosphatidylcholine. Neutral liposomal compositions can be formed, for example, from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposomal compositions are generally formed from dimyristoyl phosphatidylglycerol, whereas anionic fusogenic liposomes are primarily formed from dioleoyl phosphatidylethanolamine (DOPE). Other types of liposomal compositions are formed from phosphatidylcholine (PC), such as soybean PC and egg PC. Other types are formed from a mixture of phospholipids and / or phosphatidylcholine and / or cholesterol.

[0298] Examples of other methods for introducing liposomes into cells in vitro and in vivo are U.S. Patent No. 5,283,185; U.S. Patent No. 5,171,678; WO 94 / 00569; WO 93 / 24640; WO 91 / 16024; Felgner, (1994) J. Biol. Chem. 269:2550; Nabel, (1993) Proc. Natl. Acad. Sci. 90:11307; Nabel, (1992) Human Gene Ther. 3:649; Gershon, (1993) Biochem . 32:7143; and Strauss, (1992) EMBO J. Includes 11:417.

[0299] Nonionic liposome systems, in particular, systems containing nonionic surfactants and cholesterol were also investigated to determine their usefulness in drug delivery to the skin. Novasome TM I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and Novasome TM Cyclosporine-A was delivered to the epidermis of mouse skin using a nonionic liposomal formulation containing II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether). According to the results, such a nonionic liposomal system was effective in promoting the deposition of cyclosporine-A into different layers of the skin (Hu et al., (1994) STP Pharma. Sci., 6, 466).

[0300] Liposomes also include “stereostabilized” liposomes, the term as used herein referring to liposomes containing one or more specialized lipids that, when one or more specialized lipids are included in the liposomes, result in an improved cycle life compared to liposomes lacking such specialized lipids. An example of a stereostabilized liposome is that a portion of the vesicle-forming lipid portion (A) of the liposomes is monosialoganglioside G M1(B) contains one or more glycolipids such as polyethylene glycol (PEG) moiety, or is derivatized with one or more hydrophilic polymers such as polyethylene glycol (PEG) moiety. Without being bound by any particular theory, for sterically stabilized liposomes containing at least gangliosides, sphingomyelins, or PEG-derivated lipids, the enhanced circulating half-life of these sterically stabilized liposomes is considered in the industry to be derived from reduced uptake by cells of the reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765).

[0301] Various liposomes containing one or more glycolipids are known in the industry. Papahadjopoulos et al. (Ann. NY Acad. Sci., (1987), 507, 64) described monosialoganglioside G M1 , galactocerebroside sulfate and phosphatidylinositol have reported the ability to improve the blood half-life of liposomes. These findings were described in detail by Gabizon et al. (Proc. Natl. Acad. Sci. USA, 1988, 85, 6949). U.S. Patent No. 4,837,028 and International Patent Application No. WO 88 / 04924, both belonging to Allen et al., describe liposomes (1) containing sphingomyelin and ganglioside G M1 Alternatively, a liposome (2) comprising a galactocerebroside sulfate ester is disclosed. U.S. Patent No. 5,543,152 (Webb et al.) discloses a liposome comprising sphingomyelin. A liposome comprising 1,2-sn-dimyristoylphosphatidylcholine is disclosed in International Patent Application WO No. 97 / 13499 (Lim et al.).

[0302] In one embodiment, cationic liposomes are used. Cationic liposomes have the advantage of being able to fuse with a cell membrane. Although non-cationic liposomes cannot efficiently fuse with a plasma membrane, they can be ingested by macrophages in vivo and used to deliver RNAi agents to macrophages.

[0303] Other advantages of liposomes include: liposomes derived from natural phospholipids are biocompatible and biodegradable; liposomes can contain a wide range of water- and lipid-soluble drugs; and liposomes can protect encapsulated RNAi agonists within their internal chambers from metabolism and degradation (Rosoff, in “Pharmaceutical Dosage Forms,” Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important considerations for formulations of liposomal forms are the lipid surface charge, vesicle size, and aqueous volume of the liposomes.

[0304] By using N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), a positively charged synthetic cationic lipid, small liposomes that spontaneously interact with nucleic acids are formed to create lipid-nucleic acid complexes capable of fusing with negatively charged lipids of the cell membranes of tissue cultured cells, thereby enabling the delivery of RNAi agents (e.g., Felgner, PL etc. , (1987) Proc. Natl. Acad. Sci. USA (See 8:7413-7417, and U.S. Patent No. 4,897,355 for the description of DOTMA and its use with DNA).

[0305] DNA-complex vesicles can be formed by using the DOTMA analog 1,2-bis(oleoyloxy)-3-(trimethylammonium)propane (DOTAP) in combination with phospholipids. Lipofectin TMBethesda Research Laboratories (Gaithersburg, Md.) is an effective agent for forming complexes by delivering highly anionic nucleic acids to living tissue culture cells containing positively charged DOTMA liposomes that spontaneously interact with negatively charged polynucleotides. When sufficiently positively charged liposomes are used, the net charge on the resulting complex is also positive. Positively charged complexes prepared in this way spontaneously attach to negatively charged cell surfaces, fuse with the plasma membrane, and efficiently deliver functional nucleic acids, for example, to tissue culture cells. Another commercially acceptable cationic lipid, 1,2-bis(oleoyloxy)-3,3-(trimethylammonium)propane (“DOTAP”) (Boehringer Mannheim, Indianapolis, Indiana), differs from DOTMA in that its oleoyl moiety is linked by esters rather than ethers.

[0306] Other reported cationic lipid compounds include those conjugated to one of two types of lipids, for example, those conjugated to various moietyes containing carboxyspermin, such as compounds including 5-carboxyspermylglycine dioctaoleylamide (“DOGS”) (Transfectam™, Promega, Madison, Wisconsin) and dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide (“DPPES”) (see, e.g., U.S. Patent No. 5,171,678).

[0307] Other cationic lipid conjugates include the derivatization of cholesterol (“DC-Chol”) and lipids in combination with DOPE to form liposomes (“DC-Chol”) (Gao, X. and Huang, L., (1991) Biochim. Biophys. Res. Commun.1See 79:280). Lipopolylysine prepared by conjugating polylysine to DOPE has been reported to be effective against transmission in the presence of serum (Zhou, X. et al., (1991) Biochim. Biophys. Acta 1065:8). For certain cell lines, these liposomes containing conjugated cationic lipids are reported to exhibit lower toxicity than DOTMA-containing compositions and provide more efficient delivery of infection. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, California) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, Maryland). Other cationic lipids suitable for the delivery of oligonucleotides are described in WO 98 / 39359 and WO 96 / 37194.

[0308] Liposomal formulations are particularly suitable for topical administration, and liposomes offer several advantages over other formulations. Such advantages include reduced side effects regarding high systemic absorption of the administered drug, increased accumulation of the drug at the desired target, and the ability to deliver RNAi agonists to the skin. In some embodiments, liposomes are used to deliver RNAi agonists to epithelial cells and also to enhance the penetration of RNAi agonists into skin tissue, e.g., the skin. For example, liposomes can be applied topically. Topical delivery of drugs formulated in liposomes to the skin has been documented (e.g., Weiner et al., (1992) Journal of Drug Targeting , vol. 2,405-410 and du Plessis et al., (1992) Antiviral Research , 18:259-265; Mannino, R.J. and Fould-Fogerite, S., (1998) Biotechniques 6:682-690; Itani, T. et al., (1987) Gene56:267-276; Nicolau, C. et al. (1987) Meth. Enzymol.1 49:157-176; Straubinger, R. M. and Papahadjopoulos, D. (1983) Meth. Enzymol.1 01:512-527; Wang, C.Y. and Huang, L., (1987) Proc. Natl. Acad. Sci. USA See 84:7851-7855).

[0309] Nonionic liposomal systems, in particular, systems containing nonionic surfactants and cholesterol were also investigated to determine their usefulness in drug delivery to the skin. Drugs were delivered to the epidermis of mouse skin using nonionic liposomal formulations containing Novasome I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and Novasome II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether). Such formulations with RNAi agonists are useful for treating skin diseases.

[0310] Liposomes containing iRNA can be made highly deformable. Such deformability allows liposomes to pass through pores smaller than the average radius of the liposomes. For example, transferosomes are a type of deformable liposomes. Transferosomes can be prepared by adding a surface activator, typically a surfactant, to a standard liposomal composition. Transferosomes containing RNAi agents can be delivered subcutaneously, for example, by infection to deliver RNAi agents to keratin-producing cells within the skin. To cross the intact, uninjured mammalian skin, lipid vesicles must pass through a series of micropores, each with a diameter of less than 50 nm, under the influence of a suitable transdermal gradient. Furthermore, due to their lipid properties, these transferosomes can self-optimize (adapt to the shape of the pores, e.g., within the skin), self-repair, often reach their targets without fragmentation, and frequently self-load.

[0311] Other formulations conforming to the present invention are described in U.S. provisional application series number 61 / 018,616 filed January 2, 2008; 61 / 018,611 filed January 2, 2008; 61 / 039,748 filed March 26, 2008; 61 / 047,087 filed April 22, 2008; and 61 / 051,528 filed May 8, 2008. PCT application number PCT / US2007 / 080331 filed October 3, 2007 also describes a formulation conforming to the present invention.

[0312] Transfersomes are another type of liposome and are highly deformable lipid aggregates that are attractive candidates for drug delivery carriers. Transfersomes can be described as lipid droplets that are highly deformable and can easily penetrate pores smaller than microdroplets. Transfersomes can adapt to the environment in which they are used; for example, they self-optimize (adapting to the shape of pores within the skin), self-repair, reach their targets often without fragmentation, and frequently self-load. To construct transfersomes, it is possible to add surface-activating agents, typically surfactants, to standard liposome compositions. Transfersomes have been used to deliver serum albumin to the skin. Transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.

[0313] Surfactants find a wide range of applications in formulations such as emulsions (including microemulsions) and liposomes. The most common method for classifying and grading the properties of many different types of active agents, both natural and synthetic, is by utilizing hydrophilic / lipophilic balance (HLB). The characteristics of the hydrophilic group (also known as the “head”) provide the most useful means of categorizing the different surfactants used in formulations (from Rieger, Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285).

[0314] If surfactant molecules are not ionized, they are classified as nonionic surfactants. Nonionic surfactants find widespread applications in pharmaceutical and cosmetic products and can be used across a wide range of pH values. Generally, their HLB values ​​range from 2 to about 18, depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers, such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated / propoxylated block polymers, are also included in this classification. Polyoxyethylene surfactants are the most popular component of the nonionic surfactant class.

[0315] If surfactant molecules retain a negative charge when dissolved or dispersed in water, the surfactant is classified as nonionic. Anionic surfactants include carbroxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acids such as alkyl sulfates and alkoxylated alkyl sulfates, sulfons such as alkyl benzene sulfons, acyl isethionates, acyl taurates, sulfosuccinates, and phosphates. The most important elements of the anionic surfactant class are alkyl sulfates and soaps.

[0316] If a surfactant molecule retains a positive charge when dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. Quaternary ammonium salts are the most widely used elements in this class.

[0317] If a surfactant molecule has the ability to hold a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkyl betaines, and phosphatides.

[0318] The use of surfactants in drug products, formulations, and emulsions was reviewed (in Rieger, Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285).

[0319] The iRNA used in the method of the present invention may be provided in a micelle formulation. A “micelle” is defined herein as a specific type of molecular assembly in which amphiphilic molecules are arranged in a spherical structure such that all hydrophobic parts of the molecule face inward and hydrophilic parts come into contact with the surrounding aqueous phase. If the environment is hydrophobic, the opposite arrangement exists.

[0320] A mixed micelle formulation suitable for delivery through the transdermal membrane is a siRNA composition, alkali metal C8 to C 22 It can be prepared by mixing an aqueous solution of an alkyl sulfate and a micellar-forming compound. Exemplary micellar-forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleate, monolaurate, borage oil, evening primrose oil, menthol, trihydroxyoxocolanyl glycine and pharmaceutically acceptable salts thereof, glycerin, polyglycerin, lysine, polylysine, triolein, polyoxyethylene ether and analogs thereof, polydocanol alkyl ether and analogs thereof, chenodeoxycholate, deoxycholate, and mixtures thereof. The micellar-forming compound may be added simultaneously with or after the addition of the alkali metal alkyl sulfate. The mixed micelles will be formed by mixing with substantially any component to provide smaller micelles, but through vigorous mixing.

[0321] In one method, a first micelle composition comprising a siRNA composition and at least an alkali metal alkyl sulfate is prepared. The first micelle composition is then mixed with at least three micelle-forming mixtures to form a mixed micelle composition. In another method, the micelle composition is prepared by mixing at least one of the siRNA composition, an alkali metal alkyl sulfate, and micelle-forming compounds, and then adding the remaining micelle-forming compounds while vigorously mixing.

[0322] Phenol and / or m-cresol can be added to the mixed micelle composition to stabilize the formulation and provide protection against bacterial growth. Alternatively, phenol and / or m-cresol can be added along with the micelle-forming components. Isotonic agents such as glycerin may also be added after the mixed micelle composition has been formed.

[0323] To deliver a micelle formulation via spray, the formulation may enter an aerosol dispenser, which is filled with a propellant. Under pressure, the propellant is in liquid form within the dispenser. The ratio of the components is adjusted so that the aqueous and propellant phases become one, that is, so that only one phase exists. If two phases exist, for example, the dispenser needs to be shaken before dispensing a portion of the contents through a metering valve. The dispensed volume of the pharmaceutical formulation is propelled from the metering valve of a fine spray.

[0324] The propellant may include hydrogen-containing chlorofluorocarbons, hydrogen-containing fluorocarbons, dimethyl ethers, and diethyl ethers. In certain embodiments, HFA 134a (1,1,1,2 tetrafluoroethane) may be used.

[0325] Specific concentrations of essential components can be measured by a relatively simple experiment. For oral absorption, it is often desirable to increase the dosage via injection or administration via the gastrointestinal tract by, for example, at least two or three times.

[0326] B. Nucleic acid lipid particles

[0327] iRNA, e.g., dsRNA of the present invention, may be completely encapsulated within a lipid formulation to form, e.g., SPLP, pSPLP, SNALP, or other nucleic acid-lipid particles. As used herein, the term “SNALP” refers to a stable nucleic acid-lipid particle, including SPLP. As used herein, the term “SPLP” refers to a nucleic acid-lipid particle comprising plasmid DNA encapsulated within a lipid vesicle. SNALP and SPLP typically comprise cationic lipids, nonionic lipids, and lipids that prevent particle aggregation (e.g., PEG-lipid conjugate). SNALP and SPLP are extremely useful for systemic applications because they exhibit an extended circulating lifetime after intravenous (iv) injection and accumulate in peripheral sites (e.g., sites physically separated from the site of administration). SPLP includes “pSPLP,” which comprises an encapsulated condenser-nucleic acid complex as described in International Patent Application Publication No. WO 00 / 03683. The particles of the present invention typically have an average diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, and most typically about 70 nm to about 90 nm, and are substantially non-toxic. In addition, when nucleic acid is present in the nucleic acid-lipid particles of the present invention, the nucleic acid is resistant to degradation by nuclease in an aqueous solution. Nucleic acid-lipid particles and methods for manufacturing the same are disclosed, for example, in U.S. Patent Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432 and International Patent Application Publication No. WO 96 / 40964.

[0328] In one embodiment, the lipid-to-drug ratio (mass / mass ratio) (e.g., lipid-to-dsRNA ratio) will be in the range of about 1:1 to about 50:1, about 1:1 to about 25:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1. Intermediate ranges to the above-mentioned ranges are also considered as part of the invention.

[0329] Cationic lipids are, for example, N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(I-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2-dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-Dilinoleoxy-3-(Dimethylamino)acetoxypropane (DLin-DAC), 1,2-Dilinoleoxy-3-morpholinopropane (DLin-MA), 1,2-Dilinoleoyl-3-Dimethylaminopropane (DLinDAP), 1,2-Dilinoleylthio-3-Dimethylaminopropane (DLin-S-DMA), 1-Linoleoyl-2-Linoleyloxy-3-Dimethylaminopropane (DLin-2-DMAP), 1,2-Dilinoleyloxy-3-Trimethylaminopropane Chloride Salt (DLin-TMA.Cl), 1,2-Dilinoleoyl-3-Trimethylaminopropane Chloride Salt (DLin-TAP.Cl), 1,2-dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N,N-dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-dioleylamino)-1,2-propanedio (DOAP), 1,2-dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), l,2-dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or analogs thereof, (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (MC3), 1,1'-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazine-1-yl)ethylazanediyl)dododecane-2-ol (C12-200 or Tech G1), or a mixture thereof. The cationic lipids may comprise about 20 mol% to about 50 mol% or about 40 mol% of the total lipids present in the particle.

[0330] In another embodiment, lipid-siRNA nanoparticles can be prepared using the compound 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane. The synthesis of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane is described in U.S. Provisional Patent Application No. 61 / 107,998, filed October 23, 2008, incorporated herein by reference.

[0331] In one embodiment, the lipid-siRNA particle comprises 40% 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane: 10% DSPC: 40% cholesterol: 10% PEG-C-DOMG (molar percent) having a particle size of 63.0 ± 20 nm and a siRNA / lipid ratio of 0.027.

[0332] Ionizable / non-cationic lipids include distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-l-carboxylate (DOPE-Mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, and 18-1-trans It may be anionic lipids or neutral lipids comprising, but not limited to, PE, 1-stearoyl-2-oleoyl-phosphatidiethanolamine (SOPE), cholesterol, or mixtures thereof. If cholesterol is included, the non-cationic lipids may be about 5 mol% to about 90 mol%, about 10 mol%, or about 58 mol% of the total lipids present in the particle.

[0333] The conjugated lipids that inhibit particle aggregation may be polyethylene glycol (PEG) lipids, including but not limited to, for example, PEG-diacylglycerol (DAG), PEG-dialkyloxypropyl (DAA), PEG-phospholipids, PEG-ceramide (Cer), or mixtures thereof. The PEG-DAA conjugate may be, for example, PEG-dilauryloxypropyl (Ci2), PEG-dimyristyloxypropyl (Ci4), PEG-dipalmityloxypropyl (Ci6), or PEG-distearyloxypropyl (C 18 ) may be. The conjugated lipid that prevents particle aggregation may be 0 mol% to about 20 mol% or about 2 mol% of the total lipid present in the particle.

[0334] In some embodiments, the nucleic acid-lipid particles further contain cholesterol in an amount of, for example, about 10 mol% to about 60 mol% or about 48 mol% of the total lipids present in the particles.

[0335] In one embodiment, lipid-siRNA nanoparticles (i.e., LNP01 particles) can be prepared using lipidoid ND98·4HCl (molecular weight 1487) (see U.S. Patent Application No. 12 / 056,230 filed March 26, 2008, incorporated herein by reference), cholesterol (Sigma-Aldrich), and PEG-ceramide C16 (avanti polar lipid). Stock solutions of each dissolved in ethanol can be prepared as follows: ND98, 133 mg / ml; cholesterol, 25 mg / ml; PEG-ceramide C16, 100 mg / ml. The ND98, cholesterol, and PEG-ceramide C16 stock solutions can then be combined, for example, in a molar ratio of 42:48:10. The combined lipid solution can be mixed with water-soluble dsRNA (e.g., pH 5 in sodium acetate) such that the final ethanol concentration is about 35 to 45% and the final sodium acetate concentration is about 100 to 300 mM. Lipid-dsRNA nanoparticles are typically formed spontaneously upon mixing. Depending on the desired particle size distribution, the resulting nanoparticle mixture can be extruded through a polycarbonate membrane (e.g., 100 nm cut-off) using a thermobarrel extruder, such as the Lipex Extruder (Northern Lipids, Inc). In some cases, the extrusion step may be omitted. Ethanol removal and simultaneous buffer exchange can be achieved, for example, by dialysis or tangential flow filtration. The buffer solution can be exchanged, for example, with phosphate buffered saline (PBS) at about pH 7, e.g., about pH 6.9, about pH 7.0, about pH 7.1, about pH 7.2, about pH 7.3, or about pH 7.4.

[0336] Chemical formula 1

[0337]

[0338] The LNP01 formulation is described, for example, in International Application Publication No. WO 2008 / 042973 incorporated herein by reference.

[0339] Additional exemplary lipid-dsRNA formulations are described in the table below.

[0340]

[0341]

[0342]

[0343] DSPC: Distearoylphosphatidylcholine

[0344] DPPC: Dipalmitoylphosphatidylcholine

[0345] PEG-DMG: PEG-Didimyristoyl glycerol (C14-PEG, or PEG-C14) (average 2000 molar wt of PEG)

[0346] PEG-DMG: PEG-distyryl glycerol (C18-PEG, or PEG-C18) (average 2000 molar wt of PEG)

[0347] PEG-cDMA: PEG-carbamoyl-1,2-dimyristyloxypropylamine (average 2000 molar wt of PEG)

[0348] SNALP (l,2-dilinolenicoxy-N,N-dimethylaminopropane (DLinDMA)) comprising the formulation is described in International Publication No. WO2009 / 127060 filed on April 15, 2009, which is incorporated herein by reference.

[0349] XTCs comprising formulations are described, for example, in U.S. provisional application series no. 61 / 148,366 filed January 29, 2009; U.S. provisional application series no. 61 / 156,851 filed March 2, 2009; U.S. provisional application series no. 61 / 156,851 filed June 10, 2009; U.S. provisional application series no. 61 / 228,373 filed June 24, 2009; U.S. provisional application series no. 61 / 239,686 filed September 3, 2009 and international patent application no. PCT / US2010 / 022614 filed January 29, 2010, which are incorporated herein by reference.

[0350] MC3, which includes a formulation, is described, for example, in U.S. Patent Publication No. 2010 / 0324120 filed June 10, 2010, the entire contents of which are incorporated herein by reference.

[0351] ALNY-100, comprising a formulation, is described, for example, in international patent application number PCT / US09 / 63933 filed on November 10, 2009, which is incorporated herein by reference.

[0352] C12-200, which includes the formulation, is described in U.S. provisional application series number 61 / 175,770 filed May 5, 2009 and international application number PCT / US10 / 33777 filed May 5, 2010, which are incorporated herein by reference.

[0353] Synthesis of ionizable / cationic lipids

[0354] Any one of the compounds used in the nucleic acid-lipid particles of the present invention, such as cationic lipids, may be prepared by known organic synthesis techniques including methods described in more detail in the Examples. All substituents are as defined below unless otherwise indicated.

[0355] “Alkyl” refers to a saturated aliphatic hydrocarbon containing 1 to 24 carbon atoms, which is straight-chain or branched-chain, acyclic or cyclic. Representative saturated straight-chain alkyls include methyl, ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl, etc., while saturated branched-chain alkyls include isopropyl, sec-butyl, isobutyl, tert-butyl, isopentyl, etc. Representative saturated cyclic alkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc., while unsaturated cyclic alkyls include cyclopentenyl and cyclohexenyl, etc.

[0356] “Alkenyl” means an alkyl group comprising at least one double bond between adjacent carbon atoms as defined above. Alkenyls include both cis and trans isomers. Representative straight-chain and branched-chain alkenyls include ethylenyl, propylenyl, 1-butenyl, 2-butenyl, isobutylenyl, 1-pentenyl, 2-pentenyl, 3-methyl-1-butenyl, 2-methyl-2-butenyl, 2,3-dimethyl-2-butenyl, etc.

[0357] “Alkynyl” means any alkyl or alkenyl that additionally comprises at least one triple bond between adjacent carbons as defined above. Representative straight-chain and branched-chain alkynoyls include acetylenyl, propynyl, 1-butynyl, 2-butynyl, 1-pentynyl, 2-pentynyl, 3-methyl-1-butynyl, etc.

[0358] “Acyl” means any alkyl, alkenyl, or alkynyl group, wherein the carbon at the attachment site is substituted with an oxo group as defined below. For example, -C(=O)alkyl, -C(=O)alkenyl, and -C(=O)alkynyl are acyl groups.

[0359] “Heterocycle” means a 5- to 7-membered monocyclic or 7- to 10-membered bicyclic heterocyclic ring that is saturated, unsaturated, or aromatic and contains one or two heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein any one of the heterocycles comprises a bicyclic ring that fuses into a benzene ring, the nitrogen and sulfur heteroatoms may be optionally oxidized, and the nitrogen heteroatom may be optionally quaternized. The heterocycle may be attached through any heteroatom or carbon atom. The heterocycle comprises a heteroaryl as defined below. Heterocycles include morpholine-yl, pyrrolidinone-yl, pyrrolidine-yl, piperidine-yl, piperizine-yl, hydantoin-yl, valerolactam-yl, oxiran-yl, oxetane-yl, tetrahydrofuran-yl, tetrahydropyran-yl, tetrahydropyridine-yl, tetrahydropyrimidine-yl, tetrahydrothiophenyl, tetrahydrothiopyran-yl, tetrahydropyrimidine-yl, tetrahydrothiophenyl, tetrahydrothiopyran-yl, etc.

[0360] The terms “optionally substituted alkyl,” “optionally substituted alkenyl,” “optionally substituted alkynyl,” “optionally substituted acyl,” and “optionally substituted heterocycle” imply that, when substituted, at least one hydrogen atom is replaced by a substituent. In the case of an oxo substituent (=O), two hydrogen atoms are replaced. In this regard, the substituents include oxo, halogen, heterocycle, -CN, -ORx, -NRxRy, -NRxC(=O)Ry, -NRxSO2Ry, -C(=O)Rx, -C(=O)ORx, -C(=O)NRxRy, SonRx, and -SonNRxRy, where n is 0, 1, or 2, and Rx and Ry are the same or different and independently hydrogen, alkyl, or heterocycle, and each of the alkyl and heterocycle substituents is oxo, halogen, -OH, -CN, alkyl, One or more of -ORx, heterocycle, -NRxRy, -NRxC(=O)Ry, -NRxSO2Ry, -C(=O)Rx, -C(=O)ORx, -C(=O)NRxRy, -SOnRx and 뻊onNRxRy may be further substituted.

[0361] “Halogen” means fluoro, chloro, bromo, and iodine.

[0362] In some embodiments, the method of the present invention may require the use of a protector. The protector methodology is known to those skilled in the art (see, for example, Protective Groups in Organic Synthesis, Green, TW et al., Wiley-Interscience, New York City, 1999). In short, within the context of the present invention, a protector is any group that reduces or eliminates the unwanted reactivity of a functional group. A protector may be added to a functional group to mask its reactivity during a specific reaction, and then removed to reveal the original functional group. In some embodiments, an “alcohol protector” is used. An “alcohol protector” is any group that reduces or eliminates the unwanted reactivity of an alcohol functional group. The protector may be added and removed using techniques known in the industry.

[0363] Synthesis of Chemical Formula A

[0364] In some embodiments, the nucleic acid-lipid particles of the present invention are formulated using a cationic lipid of formula A:

[0365]

[0366] Here, R1 and R2 are independently alkyl, alkenyl, or alkynyl, each of which may be optionally substituted, and R3 and R4 are independently lower alkyls, or R3 and R4 may be taken together to form an optionally substituted heterocyclic ring. In some embodiments, the cationic lipid is XTC (2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane). Generally, the lipid of Formula A may be prepared by the following Reaction Scheme 1 or 2, in which all substituents are as defined above, unless otherwise indicated.

[0367] Reaction Equation 1

[0368]

[0369] Lipid A, in which R1 and R2 are independently alkyl, alkenyl, or alkynyl and each may be optionally substituted, and R3 and R4 are independently lower alkyls or R3 and R4 may be taken together to form an optionally substituted heterocyclic ring, can be prepared according to Reaction Scheme 1. Ketone 1 and bromide 2 may be purchased or prepared according to methods known to those skilled in the art. The reaction of 1 and 2 yields ketal 3. Treatment of ketal 3 with amine 4 yields the lipid of formula A. The lipid of formula A can be converted into a corresponding ammonium salt having an organic salt of formula 5, where X is an anionic counterion selected from halogens, hydroxides, phosphates, sulfates, etc.

[0370] Reaction Equation 2

[0371]

[0372] Alternatively, the ketone 1 starting material can be prepared according to Reaction Scheme 2. Grignard reagent 6 and cyanide 7 can be purchased or prepared according to methods known to those skilled in the art. The reaction of 6 and 7 yields ketone 1. The conversion of ketone 1 to the corresponding lipid of formula A is as described in Reaction Scheme 1.

[0373] MC3 synthesis

[0374] The preparation of DLin-M-C3-DMA (i.e., (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraene-19-yl-4-(dimethylamino)butanoate) is as follows. A solution of (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraene-19-ol (0.53 g), 4-N,N-dimethylaminobutyric acid hydrochloride (0.51 g), 4-N,N-dimethylaminopyridine (0.61 g), and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (0.53 g) dissolved in dichloromethane (5 mL) was stirred overnight at room temperature. The solution was washed with dilute hydrochloric acid and dilute water-soluble sodium bicarbonate. The organic fraction was dried over anhydrous magnesium sulfate, filtered, and the solvent removed over a rota-vapor. The residue was passed through a silica gel column (20 g) using a 1 to 5% methanol / dichloromethane elution gradient. The fraction containing the purified product was combined and the solvent removed to yield a colorless oil (0.54 g).

[0375] Synthesis of ALNY-100

[0376] The synthesis of ketal 519[ALNY-100] was carried out using the following reaction scheme 3:

[0377]

[0378] Synthesis of 515

[0379] A solution of 514 (10 g, 0.04926 mol) dissolved in 70 mL of THF was slowly added to a stirred suspension of LiAlH4 (3.74 g, 0.09852 mol) in 200 mL of anhydrous THF in a 2-neck RBF (1 L) under a nitrogen atmosphere at 0°C. After complete addition, the reaction mixture was heated to room temperature and refluxed for 4 hours. The progress of the reaction was monitored by TLC. After the reaction was complete (by TLC), the mixture was cooled to 0°C and quenched by carefully adding a saturated Na2SO4 solution. The reaction mixture was stirred at room temperature for 4 hours and filtered. The residue was thoroughly washed with THF. The filtrate and wash were mixed and diluted with 400 mL of dioxane and 26 mL of concentrated HCl, and stirred at room temperature for 20 minutes. Volatile components were removed under vacuum to produce the hydrochloride of 515 as a white solid. Yield: 7.12 g 1 H-NMR (DMSO, 400 MHz): δ= 9.34 (broad, 2H), 5.68 (s, 2H), 3.74 (m, 1H), 2.66-2.60 (m, 2H), 2.50-2.45 (m, 5H).

[0380] Synthesis of 516

[0381] NET3 (37.2 mL, 0.2669 mol) was added to a stirred solution in which compound 515 was dissolved in 100 mL of dry DCM in a 250 mL 2-neck RBF, and the mixture was cooled to 0°C under a nitrogen atmosphere. After slowly adding N-(benzyloxy-carbonyloxy)-succinimide (20 g, 0.08007 mol) to 50 mL of dry DCM, the reaction mixture was heated to room temperature (2 to 3 hours by TLC). After the reaction was complete, the mixture was washed sequentially with 1 N HCl solution (1 x 100 mL) and saturated NaHCO3 solution (1 x 50 mL). Subsequently, the organic layer was dried over anhydrous Na2SO4 and the solvent was evaporated to produce an unpurified material, which was purified by silica gel column chromatography to obtain 516 as a sticky mass. Yield: 11 g (89%). 1H-NMR (CDCl3, 400MHz): δ = 7.36-7.27(m, 5H), 5.69 (s, 2H), 5.12 (s, 2H), 4.96 (br., 1H) 2.74 (s, 3H), 2.60(m, 2H), 2.30-2.25(m, 2H). LC-MS [M+H] -232.3 (96.94%).

[0382] Synthesis of 517A and 517B

[0383] Cyclopentene 516 (5 g, 0.02164 mol) was dissolved in 220 mL of a solution of acetone and water (10:1) in a single 500 mL RBF, N-methylmorpholine-N-oxide (7.6 g, 0.06492 mol) was added to this, and 4.2 mL of a 7.6% solution of OsO4 (0.275 g, 0.00108 mol) dissolved in tert-butanol at room temperature was added. After the reaction (~3 hours) was completed, the mixture was quenched by adding solid Na2SO3, and the resulting mixture was stirred at room temperature for 1.5 hours. The reaction mixture was diluted with DCM (300 mL) and washed with water (2 x 100 mL), then washed with a saturated NaHCO3 (1 x 50 mL) solution and water (1 x 30 mL), and finally washed with saline solution (1 x 50 mL). The organic phase was dried on the Na2SO4 phase, and the solvent was removed under vacuum. Purification of the crude material by silica gel column chromatography produced a mixture of diastereomers, which were separated by preliminary high-performance liquid chromatography. Yield: - 6 g crude

[0384] 517A - Peak-1 (white solid), 5.13 g (96%). 1H-NMR (DMSO, 400 MHz): δ = 7.39-7.31 (m, 5H), 5.04 (s, 2H), 4.78-4.73 (m, 1H), 4.48-4.47 (d, 2H), 3.94-3.93 (m, 2H), 2.71 (s, 3H), 1.72-1.67 (m, 4H). LC-MS - [M+H]-266.3, [M+NH4+]-283.5 present, HPLC - 97.86%. Stereochemistry was confirmed by X-ray.

[0385] Synthesis of 518

[0386] Compound 518 (1.2 g, 41%) was obtained as a colorless oil using a procedure similar to the procedure described for the synthesis of compound 505. 1H-NMR (CDCl3, 400MHz): δ= 7.35-7.33(m, 4H), 7.30-7.27(m, 1H), 5.37-5.27(m, 8H), 5.12(s, 2H), 4.75(m,1H), 4.58-4.57(m,2H), 2.78-2.74(m,7H), 2.06-2.00(m,8H), 1.96-1.91(m, 2H), 1.62(m, 4H), 1.48(m, 2H), 1.37-1.25(br m, 36H), 0.87(m, 6H). HPLC-98.65%.

[0387] General procedure for the synthesis of compound 519

[0388] A solution of compound 518 (1 equivalent) dissolved in hexane (15 mL) was added dropwise to a cooled solution of LAH dissolved in THF (1 M, 2 equivalents). After complete addition, the mixture was heated at 40°C for 0.5 hours and then cooled over ice. The mixture was carefully hydrolyzed with saturated water-soluble Na2SO4, filtered through Celite, and converted into an oil. Column chromatography yielded pure 519 (1.3 g, 68%), and pure 519 was obtained as a colorless oil. 13 130.2, 130.1 (x2), 127.9 (x3), 112.3, 79.3, 64.4, 44.7, 38.3, 35.4, 31.5, 29.9 (x2), 29.7, 29.6 (x2), 29.5 (x3), 29.3 (x2), 27.2 (x3), 25.6, 24.5, 23.3, 226, 14.1; Electrospray MS (+ve): C 44 H 80 Molecular weight for NO2(M + H) + Calculated value: 654.6, Actual value: 654.6.

[0389] Formulations prepared by standard or extrusion-free methods may be characterized in a similar manner. For example, formulations are typically characterized by visual inspection. They should be slightly white, translucent solutions free of aggregates or precipitates. The particle size and particle size distribution of lipid-nanoparticles can be measured by light scattering, for example, using the Malvern Zetasezer Nano ZS (Melvern, USA). The particles should be approximately 20 to 300 nm in size, such as 40 to 100 nm. The particle size distribution should be unimodal. The total siRNA concentration within the formulation, as well as the trapped fraction, is estimated using a stain exclusion assay. Samples of the formulation's siRNA may be incubated with an RNA-binding stain, such as Ribogreen (molecular probe), in the presence or absence of a surfactant rupturing the formulation, such as 0.5% Triton-X100. The total siRNA in the formulation can be determined by the signal from a sample containing a surfactant against a standard curve. The entrapped fraction is determined by subtracting the “free” dsRNA content from the total dsRNA content (as measured by the signal in the absence of a surfactant). The percentage of entrapped dsRNA typically exceeds 85%. For the SNALP formulation, the particle size is at least 30 nm, at least 40 nm, at least 50 nm, at least 60 nm, at least 70 nm, at least 80 nm, at least 90 nm, at least 100 nm, at least 110 nm, and at least 120 nm. Suitable ranges are typically about at least 50 nm to about at least 110 nm, about at least 60 nm to about at least 100 nm, or about at least 80 nm to about at least 90 nm.

[0390] Compositions and formulations for oral administration include powders or granules, microparticles, nanoparticles, suspensions or solutions in water or an aqueous medium, capsules, gel capsules, sachets, tablets, or mini-tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersion aids, or binders may be preferred. In some embodiments, the oral formulation is an oral formulation in which the dsRNA characterized in the present invention is administered together with one or more penetration-enhancing surfactants and chelating agents. Suitable surfactants include fatty acids and / or their esters or salts, and their bile acids and / or salts. Suitable bile acids / salts include kenodeoxycholic acid (CDCA) and ursodeoxykenodeoxycholic acid (UDCA), cholic acid, dihydrocholic acid, deoxycholic acid, glucholic acid, glycolic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate and sodium glycodihydrofusidate. Suitable fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecyl azacycloheptan-2-one, acylcarnitine, acylcholine, or monoglycerides, diglycerides, or pharmaceutically acceptable salts thereof (e.g., sodium). In some embodiments, combinations of penetration enhancers, such as fatty acids / salts combined with bile acids / salts, are used. An exemplary combination is lauric acid, capric acid, and the sodium salt of UDCA. Other penetration enhancers include polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether. The dsRNA characterized in the present invention may be delivered orally in the form of granules, including sprayed dry particles, or compounded to form micro or nanoparticles.dsRNA complexing agents include polyamino acids; polyimines; polyacrylates; polyalkyl acrylates, polyoxetanes, polyalkyl cyanoacrylates; cationic gelatin, albumin, starch, acrylates, polyethylene glycol (PEG), and starch; polyalkyl cyanoacrylates; DEAE-derived polyimines, pullulan, cellulose, and starch. Suitable complexing agents include chitosan, N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermine, protamine, polyvinylpyridine, polythiodiethylaminomethylene P(TDAE), and polyaminostyrene (e.g., It includes p-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate), poly(butylcyanoacrylate), poly(isobutylcyanoacrylate), poly(isohexylcyanoacrylate), DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethylacrylate, polyhexylacrylate, poly(D,L-lactic acid), poly(DL-lactic-co-glycolic acid (PLGA), alginate, and polyethylene glycol (PEG). Oral formulations for dsRNA and their preparations are described in detail in U.S. Patent No. 6,887,906, U.S. Patent Publication No. 20030027780 and U.S. Patent No. 6,747,014, each of which is incorporated herein by reference.

[0391] Compositions and formulations for parenteral, intraparenchymal, intraventricular, or hepatic administration may comprise a sterile aqueous solution that may also contain other suitable additives, such as but not limited to buffers, diluents, and penetration enhancers, carrier compounds, and other pharmaceutically acceptable carriers or excipients.

[0392] The pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be produced from various components including, but not limited to, pre-formed liquids, self-emulsifying solids, and self-emulsifying semi-solids. When treating liver diseases such as hepatic carcinoma, formulations targeting the liver are particularly preferred.

[0393] The pharmaceutical formulation of the present invention, which can be conveniently presented as a unit formulation, may be manufactured according to conventional techniques known in the pharmaceutical industry. Such techniques include the step of associating an active ingredient with a pharmaceutical carrier(s) or excipient(s). Generally, the formulation is manufactured by uniformly and closely associating the active ingredient with a liquid carrier or a finely divided solid carrier, or both, and then, if necessary, shaping the product.

[0394] The composition of the present invention may be formulated into any one of numerous possible formulations, such as but not limited to tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The composition of the present invention may also be formulated as a suspension in a water-soluble, water-insoluble, or mixed medium. A water-soluble suspension may further comprise a substance that increases the viscosity of the suspension, for example, sodium carboxymethylcellulose, sorbitol, and / or dextran. The suspension may also comprise a stabilizer.

[0395] C. Additional formulations

[0396] i. Emulsion

[0397] The composition of the present invention can be prepared and formulated as an emulsion. An emulsion is a heterogeneous system in which one liquid is dispersed in another liquid in the form of droplets, typically with a diameter exceeding 0.1 μm (e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; in Idson, Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 199; in Rosoff, Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 245; in Block, Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), (See Marcel Dekker, Inc., New York, NY, 1988, volume 2, p. 335; and Higuchi et al., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 301). An emulsion is often a two-phase system comprising two immiscible liquid phases that are closely mixed and dispersed from each other. Generally, emulsions can be of the water-in-oil (w / o) or oil-in-water (o / w) type. When the aqueous phase is finely divided into larger oil phases and dispersed into fine particles, the resulting composition is called a water-in-oil (w / o) emulsion.Alternatively, when the oil phase is finely divided into a larger aqueous phase and dispersed into fine droplets, the resulting composition is called an oil-in-water (o / w) emulsion. The emulsion may contain additional components in addition to the active drug, which may exist as a solution of the dispersed phase and the aqueous or oil phase, or as a separated phase. Pharmaceutical excipients, such as emulsifiers, stabilizers, dyes, and antioxidants, may be present in the emulsion if necessary. A pharmaceutical emulsion may be a multi-phase emulsion composed of more than two phases, for example, as in the case of oil-in-water-in-oil (o / w / o) and oil-in-water-in-water (w / o / w) emulsions. Such complex formulations often provide specific advantages that simple two-phase emulsions do not offer. Multiple emulsions in which individual oil droplets of an o / w emulsion surround small water droplets constitute a w / o / w emulsion. Likewise, a system of oil droplets surrounded by water spherules stabilized within an oily continuous phase provides an o / w / o emulsion.

[0398] Emulsions are characterized by having little to no thermodynamic stability. Often, the dispersed or discontinuous phase of an emulsion is well dispersed into an external or continuous phase and is maintained in this form through the use of emulsifiers or the viscosity of the formulation. Either of the phases of an emulsion may be semi-solid or solid, as in the case of emulsion-style ointment bases and creams. Other means of stabilizing an emulsion involve the use of emulsifiers that may be included in any phase of the emulsion. Emulsifiers can be broadly classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorbent bases, and finely dispersed solids (see, e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 199).

[0399] Synthetic surfactants, also known as surface-active agents, have been reviewed in the literature for their broad applicability in emulsion formulations (e.g., see Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rieger, Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 285; and Idson, Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, NY, 1988, volume 1, p. 199). Surfactants are typically amphiphilic and contain hydrophilic and hydrophobic portions. The ratio of hydrophilicity to hydrophobicity of a surfactant is referred to as the hydrophilic-lipophilic balance (HLB) and is a valuable tool for classifying and selecting surfactants in the manufacture of formulations. Surfactants can be classified into different classes based on the properties of their hydrophilic groups: nonionic, anionic, cationic, and amphoteric (e.g., see Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rieger, Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 285).

[0400] Natural emulsifiers used in emulsion formulations include lanolin, beeswax, phospholipids, lecithin, and acacia. Absorbent bases possess hydrophilicity, allowing them to absorb water to form w / o emulsions, while maintaining their semi-solid consistency, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids are also used as good emulsifiers, particularly in combination with surfactants and in viscous formulations. These include polar inorganic solids such as heavy metal hydroxides, non-swelling clays such as bentonite, atapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate, and colloidal magnesium aluminum silicate, pigments, and non-polar solids such as carbon or glyceryl tristearate.

[0401] A wide variety of non-emulsifying substances are also included in emulsion formulations and contribute to the properties of the emulsion. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives, and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 199).

[0402] Hydrophilic colloids or aqueous colloids include naturally occurring gums and synthetic polymers such as polysaccharides (e.g., acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (e.g., carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (e.g., carbomers, cellulose ethers, and carboxyvinyl polymers). These form colloidal solutions that stabilize the emulsion by dispersing or expanding in water to form a strong interfacial film around the droplets of the dispersed phase and increasing the viscosity of the outer phase.

[0403] Because emulsions often contain many components such as carbohydrates, proteins, sterols, and phospholipids that can facilitate microbial growth, these formulations often contain preservatives. Commonly used preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent the deterioration of the formulation. The antioxidants used may be free radical scavengers such as tocopherol, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.

[0404] Applications of emulsion formulations via descutaneous, oral, and parenteral routes and their preparation methods have been described in the literature (e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; see also Idson, Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 199). Oral delivery emulsion formulations have been widely used due to their ease of formulation as well as their efficacy in terms of absorption and bioavailability (see, e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 245; Idson, Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 199). Mineral oil-based laxatives, oil-soluble vitamins, and high-fat nutritional preparations are substances commonly administered orally as o / w emulsions.

[0405] ii. Microemulsion

[0406] In one embodiment of the present invention, the composition of iRNA and nucleic acid is formulated as a microemulsion. A microemulsion can be defined as a system of water, oil, and an amphiphilic substance that is a single optically isotropic and thermodynamically stable liquid solution (e.g., see Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 245). Typically, a microemulsion is a system prepared by first dispersing the oil in a water-soluble surfactant solution and then adding a sufficient amount of a fourth component, generally a medium-chain-length alcohol, to form a clear system. Therefore, microemulsions have been described as thermodynamically stable and isotropically clear dispersions of two immiscible liquids stabilized by an interfacial film of surface-active molecules (Leung and Shah, in Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215). Microemulsions are commonly prepared through a combination of three to five components, including oil, water, a surfactant, a co-surfactant, and an electrolyte.Whether a microemulsion is of the water-in-oil (w / o) or oil-in-water (o / w) type depends on the properties of the oil and surfactant used, and on the structure and geometric packing of the polar head and hydrocarbon tail of the surfactant molecule (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271).

[0407] Phenomenological approaches utilizing phase diagrams have been extensively studied and have provided those skilled in the art with broad knowledge of methods for formulating microemulsions (see, e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 245; Block, Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 335). Compared to conventional emulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs in spontaneously formed thermodynamically stable droplet formulations.

[0408] Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, nonionic surfactants, Brij 96, polyoxyethylene oleyl ether, polyglycerol fatty acid ester, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), and decaglycerol decaoleate (DAO750), either alone or in combination with co-surfactants. Co-surfactants, which are primarily short-chain alcohols such as ethanol, 1-propanol, and 1-butanol, play a role in increasing interfacial fluidity by penetrating into the surfactant film due to the voids created between surfactant molecules, thereby forming a disordered film. However, microemulsions can be prepared without the use of co-surfactants and alcohol-free self-emulsifying microemulsion systems known in the industry. The aqueous phase may typically be, but is not limited to, water, an aqueous solution of a drug, glycerol, PEG300, PEG400, polyglycerol, propylene glycol, and derivatives of ethylene glycol. The oil phase includes, but is not limited to, substances such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium-chain (C8-C12) mono, di, and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolated glycerides, saturated polyglycolated C8-C10 glycerides, vegetable oils, and silicone oils.

[0409] Microemulsions are of particular interest in terms of drug solubilization and enhanced drug absorption. Lipid-based microemulsions (o / w and w / o) have been proposed to improve the oral bioavailability of drugs containing peptides (e.g., U.S. Patents No. 6,191,105; 7,063,860; 7,070,802; 7,157,099; see Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13, 205). Microemulsions provide the advantages of improved drug solubility, protection of the drug from enzymatic hydrolysis, possible improvement in drug absorption due to surfactant-induced changes in membrane fluidity and permeability, ease of manufacture, ease of oral administration compared to solid formulations, improved clinical potency, and reduced toxicity (e.g., U.S. Patents 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Often, microemulsions can be formed spontaneously when their components are introduced together at ambient temperature. This can be particularly advantageous when formulating unstable drugs, peptides, or iRNAs. Microemulsions are also effective for the transdermal delivery of active ingredients in cosmetic and pharmaceutical applications. The microemulsion compositions and formulations of the present invention are expected to not only improve local cellular uptake of iRNA and nucleic acids but also promote increased systemic absorption of iRNA and nucleic acids from the gastrointestinal tract.

[0410] The microemulsion of the present invention may also contain additional components and additives, such as sorbitan monostearate (Grill 3), labrazol, and penetration enhancers, to improve the characteristics of the formulation and enhance the absorption of the iRNA and nucleic acids of the present invention. The penetration enhancers used in the microemulsion of the present invention may be classified into one of five broad categories—surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed above.

[0411] iii. Fine particles

[0412] The RNAi agent of the present invention may be included as particles, e.g., microparticles. Microparticles may be produced by spray-drying, but may also be produced by other methods including freeze-drying, evaporation, fluidized bed drying, vacuum drying, or a combination of these techniques.

[0413] iv. Penetration enhancers

[0414] In one embodiment, the present invention employs various penetration enhancers to efficiently deliver nucleic acids, particularly iRNA, to the skin of animals. Most drugs exist in solution in both ionized and non-ionized forms. However, primarily lipid-soluble or lipophilic drugs easily penetrate cell membranes. It has been found that even non-lipophilic drugs can penetrate cell membranes when the membrane to be penetrated is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs through the cell membrane, penetration enhancers also improve the penetration of lipophilic drugs.

[0415] Penetration enhancers can be classified into one of five broad categories: surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; see Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of the aforementioned classes of penetration enhancers is described in more detail below.

[0416] Surfactants (or “surface-active agents”) are chemical entities that, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, thereby enhancing the absorption of iRNA through the mucous membrane. In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether, and polyoxyethylene-20-cetyl ether (e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; see Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92); and emulsions of compounds in which hydrogen is substituted with fluorine, such as FC-43 (Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).

[0417] Various fatty acids and their derivatives acting as penetration enhancers are, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-lac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecyl azacycloheptan-2-one, acylcarnitine, acylcholine, and its C 1-20 Alkyl esters (e.g., Includes methyl, isopropyl, and t-butyl), and their monoglycerides and diglycerides (i.e., oleates, laurates, caprates, myristates, palmitates, stearates, linoleates, etc.) (e.g., Touitou, E., et al.). . Enhancement in Drug Delivery, CRC Press, Danvers, MA, 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654).

[0418] The physiological roles of bile include the promotion of dispersion and absorption of lipids and fat-soluble vitamins (e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; see Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al., McGraw-Hill, New York, 1996, pp. 934-935). Various natural bile salts and their synthetic derivatives act as penetration enhancers. Therefore, the term “bile salt” includes any of the synthetic derivatives of bile as well as any of the naturally occurring components of bile. Suitable bile salts are, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dihydrocholic acid (sodium dihydrocholate), deoxycholic acid (sodium deoxycholate), glutocolic acid (sodium glucose), glycolic acid (sodium glycolate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate, and polyoxyethylene-9-lauryl ether (POE) (e.g., Malmsten, M.Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee 등, Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18 판, Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto 등, J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita 등, J. Pharm. Sci., 1990, 79, 579-583 참조)를 포함한다.

[0419] The chelating agent used in connection with the present invention can be defined as a compound that enhances the absorption of iRNA through the mucous membrane by removing metal ions from the solution through the formation of a complex with metal ions. Regarding its use as a penetration enhancer in the present invention, the chelating agent has the additional advantage of also acting as a DNase inhibitor, as most characteristic DNA nucleases require divalent metal ions for catalytic action and are therefore inhibited by the chelating agent (Jarrett, J. Chromatogr., 1993, 618, 315-339). Suitable chelating agents include, but are not limited to, disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate, and homovanillate), N-acyl derivatives of collagen, N-aminoacyl derivatives of laureth-9 and beta-diketone (enamines) (e.g., Katdare, A. et al., Excipient development for pharmaceutical, biotechnology, and drug delivery, CRC Press, Danvers, MA, 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51).

[0420] As used herein, non-chelating non-surfactant penetration-enhancing compounds can be defined as compounds that exhibit no significant activity as chelating agents or surfactants, but nevertheless enhance the absorption of iRNA through alimentary mucosa (see, e.g., Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). Penetration-enhancing compounds of this class include, for example, unsaturated cyclic ureas, 1-alkyl- and 1-alkenyl azacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory drugs such as diclofenac sodium, indomethacin, and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626).

[0421] Agents that enhance the uptake of iRNA at the cellular level may be added to the pharmaceutical compositions and other compositions of the present invention. For example, cationic lipids such as lipopectin (Junichi et al., U.S. Patent No. 5,705,188), cationic glycerol derivatives, and polycationic molecules such as polylysine (Lollo et al., PCT Application WO 97 / 30731) are known to enhance the cellular uptake of dsRNA. Examples of commercially available delivery infection reagents include, among others, Lipofectamine™ (Invitrogen; Carlsbad, CA), Lipofectamine 2000™ (Invitrogen; Carlsbad, CA), 293fectin™ (Invitrogen; Carlsbad, CA), Cellfectin™ (Invitrogen; Carlsbad, CA), DMRIE-C™ (Invitrogen; Carlsbad, CA), FreeStyle™ MAX (Invitrogen; Carlsbad, CA), Lipofectamine™ 2000 CD (Invitrogen; Carlsbad, CA), Lipofectamine™ (Invitrogen; Carlsbad, CA), RNAiMAX (Invitrogen; Carlsbad, CA), Oligofectamine™ (Invitrogen; Carlsbad, CA), Optifect™ (Invitrogen; Carlsbad, CA), X-tremeGENE Q2 delivery infection reagent (Roche; Grenzacherstrasse, Switzerland), and DOTAP liposomal delivery infection Reagent (Grenzacherstrasse, Switzerland), DOSPER Liposome Delivery Infection Reagent (Grenzacherstrasse, Switzerland), or Fugene (Grenzacherstrasse, Switzerland), Transfectam Reagent (Promega; Madison, WI), TransFast™ Delivery Reagent (Promega; Madison, WI), Tfx™-20 Reagent (Promega; Madison, WI), Tfx™-50 Reagent (Promega; Madison, WI), DreamFect™ (OZ Biosciences; Marseille, France), EcoTransfect (OZ Biosciences; Marseille, France), TransPass™ D1 Delivery Reagent (New England Biolabs; Ipswich, MA, USA), LyoVec™ / LipoGen™ (Invitrogen; San Diego, CA, USA), PerFectin Delivery Reagent (Genlantis; San Diego, CA, USA), NeuroPORTER Delivery Reagent (Genlantis; San Diego, CA, USA), GenePORTER Delivery Reagent (Genlantis; San Diego, CA, USA), GenePORTER 2 Delivery Reagent (Genlantis; San Diego, CA, USA), Cytofectin Delivery Reagent (Genlantis; Includes San Diego, CA, USA), BaculoPORTER delivery infection reagent (Genlantis; San Diego, CA, USA), TroganPORTER™ delivery infection reagent (Genlantis; San Diego, CA, USA), RiboFect (Bioline; Taunton, MA, USA), PlasFect (Bioline; Taunton, MA, USA), UniFECTOR (B-Bridge International; Mountain View, CA, USA), SureFECTOR (B-Bridge International; Mountain View, CA, USA), or HiFect™ (B-Bridge International, Mountain View, CA, USA).

[0422] Other agents, including glycols such as ethylene glycol and propylene glycol, pyrrole such as 2-pyrrole, and terpenes such as azon, limonene, and menthone, can be used to enhance the penetration of administered nucleic acids.

[0423] v. carrier

[0424] Certain compositions of the present invention also include a carrier compound in the formulation. As used herein, “carrier compound” or “carrier” may refer to a nucleic acid or an analog thereof that is inactive (i.e., does not possess biological activity itself) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a biologically active nucleic acid, for example, by degrading the biologically active nucleic acid or promoting its removal from circulation. Co-administration of a nucleic acid and a carrier compound, in which the carrier compound is typically in excess, may lead to a substantial reduction in the amount of nucleic acid recovered in the liver, kidney, or other special extracirculatory reservoirs, possibly due to competition between the carrier compound and the nucleic acid for a common receptor. For example, partial recovery of phosphothioate dsRNA in liver tissue may be reduced when co-administered with polyinosinic acid, dextran sulfate, polysitized acid, or 4-acetamido-4'isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et al., DsRNA Res. Dev., 1995, 5, 115-121; Takakura et al., DsRNA & Nucl. Acid Drug Dev., 1996, 6, 177-183).

[0425] vi. Excipients

[0426] Unlike carrier compounds, a “pharmaceutical carrier” or “excipient” is a pharmaceutically acceptable solvent, suspension, or any other pharmacologically inactive carrier for delivering one or more nucleic acids to an animal. Excipients may be liquid or solid and provide the desired bulk, consistency, etc., when combined with the nucleic acid and other components of a given pharmaceutical composition in a selected and intended manner of administration. Typical pharmaceutical carriers are conjugates (e.g., pre-gelatinized corn starch, polyvinylpyrrolidone, or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylate, or calcium hydrogen phosphate, etc.); Lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearate, hydrogenated vegetable oil, corn starch, polyethylene glycol, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium sulfate lauryl, etc.), but are not limited thereto.

[0427] The composition of the present invention may also be formulated using pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration that do not react adversely with nucleic acids. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, silica, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone, etc.

[0428] Formulations of nucleic acid for topical administration may include sterile and non-sterile aqueous solutions, non-aqueous solutions of conventional solvents such as alcohol, or solutions of nucleic acid on a liquid or solid base. The solutions may also include buffers, diluents, and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration that do not react adversely with nucleic acid may be used.

[0429] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohols, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, silica, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone, etc.

[0430] vii. Other components

[0431] The composition of the present invention may additionally include other additional components conventionally found in pharmaceutical compositions at established levels of use in the industry. Thus, for example, the composition may include additional fusionable pharmaceutically active substances such as antipruritics, astringents, local anesthetics, or anti-inflammatory agents, or may include additional substances useful for physically formulating various formulations of the composition of the present invention, such as dyes, flavorings, preservatives, antioxidants, opacifiers, thickeners, and stabilizers. However, when such substances are added, they must not excessively interfere with the biological activity of the components of the composition of the present invention. The formulation may be sterilized and, if desired, may be mixed with adjuvants that do not react adversely with the nucleic acid(s) of the formulation, such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts to affect osmotic pressure, buffers, colorings, flavors and / or aromatic substances.

[0432] The water-soluble suspension may include a substance that increases the viscosity of the suspension, for example, sodium carboxymethylcellulose, sorbitol, and / or dextran. The suspension may also include a stabilizer.

[0433] In some embodiments, the pharmaceutical compositions characterized in the present invention comprise (a) one or more iRNA compounds and (b) one or more agents that function by a non-RNAi mechanism and are useful for treating lipid metabolism disorders. Examples of such agents include, but are not limited to, anti-inflammatory agents, anti-steatogenic agents, antiviral agents and / or anti-fibrotic agents. Additionally, other substances commonly used to protect the liver, such as silymarin, may be used in conjunction with the iRNA described herein. Other agents useful for treating liver disease include protease inhibitors such as telbivudine, entecavir, and telaprevir, and, for example, Tung et al., U.S. Application Publications Nos. 2005 / 0148548, 2004 / 0167116, and 2003 / 0144217; and other agents described in Hale et al., U.S. Application Publication No. 2004 / 0127488.

[0434] The toxicity and therapeutic efficacy of such compounds are, for example, LD 50 (lethal dose to up to 50% of the population) and ED 50 To determine the therapeutically effective dose (in 50% of the population), it can be determined by standard pharmaceutical procedures in cell cultures or experimental animals. The dose ratio between toxicity and therapeutic effect is the therapeutic index, which can be expressed as the ratio of LD50 / ED50. Compounds exhibiting a high therapeutic index are preferred.

[0435] Data obtained from cell culture assays and animal studies can be used to formulate dosage ranges for human use. The dosage of the composition characterized in the present invention is generally ED that is virtually non-toxic or non-toxic. 50It is within the range of circulating concentrations including. The dosage may vary within this range depending on the formulation employed and the route of administration utilized. For any compound used in the method characterized in the present invention, the therapeutically effective dose may be initially estimated from a cell culture assay. The dose is the circulating plasma concentration range of said compound, or, where appropriate, as determined from the IC50 as in cell culture. 50 It can be formulated in an animal model to achieve a range of circulating plasma concentrations of a polypeptide product of a target sequence (i.e., the concentration of the test compound that achieves half-maximum inhibition of symptoms) (e.g., achieving reduced concentrations of polypeptide). Such information can be used to more accurately determine a useful dose in humans. Plasma levels can be measured, for example, by high-performance liquid chromatography.

[0436] As discussed above, in addition to its administration, the iRNA characterized in the present invention may be administered in combination with other known agents effective in treating pathological processes mediated by ANGPTL3 expression. In any case, the administering physician may adjust the amount and timing of iRNA administration based on observed results using standard measures of efficacy known in the industry or described herein.

[0437] VI. Method of the present invention

[0438] The present invention also provides a method of using the iRNA of the present invention and / or a composition comprising the iRNA of the present invention to reduce and / or inhibit ANGPTL3 expression within a cell. The method comprises the steps of contacting a cell with the dsRNA of the present invention and maintaining the cell for a time sufficient to obtain degradation of the mRNA transcript of the ANGPTL3 gene, thereby inhibiting the expression of the ANGPTL3 gene within the cell. The reduction in gene expression may be evaluated by any method known in the art. For example, the reduction in ANGPTL3 expression may be determined by methods conventional to those skilled in the art, such as determining the mRNA expression level of ANGPTL3 using Northern blotting or qRT-PCR, or by determining the protein level of ANGPTL3 using methods conventional to those skilled in the art, such as Western blotting or immunological techniques. The reduction in ANGPTL3 expression may also be evaluated indirectly by measuring a reduction in the biological activity of ANGPTL3, such as a reduction in serum lipids, triglycerides, cholesterol, and / or free fatty acids.

[0439] In the method of the present invention, the cell may be in contact with the body in a test tube or in vivo, that is, the cell may be inside the subject.

[0440] Cells suitable for treatment using the method of the present invention may be any cells expressing the ANGPTL3 gene. Cells suitable for use in the method of the present invention may be mammalian cells, e.g., primate cells (such as human cells or non-human primate cells, e.g., monkey cells or chimpanzee cells), non-primate cells (such as cow cells, pig cells, camel cells, llama cells, horse cells, goat cells, rabbit cells, sheep cells, hamster cells, guinea pig cells, cat cells, dog cells, mouse cells, mouse cells, lion cells, tiger cells, bear cells or buffalo cells), avian cells (e.g., duck cells or goose cells), or whale cells. In one embodiment, the cells are human cells, e.g., human liver cells.

[0441] ANGPTL3 expression in cells is at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or is suppressed by about 100%.

[0442] The in vivo method of the present invention may include the step of administering a composition comprising iRNA to a subject, wherein the iRNA comprises a nucleotide sequence complementary to at least a portion of the RNA transcript of the ANGPTL3 gene of the mammal being treated. If the organism being treated is a mammal such as a human, the composition may be administered by any means known in the industry, including but not limited to oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intracerebral parenchyma, and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and local administration (including cheek and sublingual). In certain embodiments, the composition is administered by intravenous infusion or injection. In certain embodiments, the composition is administered by subcutaneous injection.

[0443] In some embodiments, administration is via a depot injection. A depot injection can release iRNA in a consistent manner over a long period of time. Therefore, a depot injection can reduce the number of dose administrations required to achieve the desired effect, e.g., the desired inhibition of ANGPTL3 or a therapeutic or prophylactic effect. A depot injection may also provide more consistent serum concentrations. A depot injection may include a subcutaneous injection or an intramuscular injection. In preferred embodiments, the depot injection is a subcutaneous injection.

[0444] In some embodiments, administration is via a pump. The pump may be an external pump or a surgically implanted pump. In certain embodiments, the pump is a subcutaneously implanted osmotic pump. In other embodiments, the pump is an infusion pump. The infusion pump may be used for intravenous, subcutaneous, arterial, or epidural infusion. In preferred embodiments, the infusion pump is a subcutaneous infusion pump. In other embodiments, the pump is a surgically implanted pump that delivers iRNA to the liver.

[0445] The mode of administration can be selected based on whether local or systemic treatment is desired and based on the area being treated. The route and site of administration can be selected to enhance targeting.

[0446] In one embodiment, the present invention also provides a method for suppressing the expression of the ANGPTL3 gene in mammals. The method comprises the steps of administering to a mammal a composition comprising dsRNA targeting the ANGPTL3 gene within the mammalian cells, and maintaining the mammal for a time sufficient to obtain degradation of the mRNA transcript of the ANGPTL3 gene, thereby suppressing the expression of the ANGPTL3 gene within the cells. The reduction in gene expression may be evaluated by any method known in the industry and the method described herein, e.g., qRT-PCR. The reduction in protein production may be evaluated by any method known in the industry and the method described herein, e.g., ELISA. In one embodiment, a puncture liver biopsy specimen serves as a tissue material for monitoring the reduction in ANGPTL3 gene and / or protein expression.

[0447] The present invention further provides a treatment method for a subject who requires this. The treatment method of the present invention comprises the step of administering the iRNA of the present invention to a subject, e.g., a subject who benefits from the reduction and / or inhibition of ANGPTL3 expression, in a therapeutically effective amount of iRNA targeting the ANGPTL3 gene or a pharmaceutical composition comprising iRNA targeting the ANGPTL3 gene.

[0448] The iRNA of the present invention may be administered as “free iRNA.” Free iRNA is administered in the absence of a pharmaceutical composition. The exposed iRNA may be in a suitable buffer solution. The buffer solution may contain acetate, citrate, prolamin, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate-buffered saline (PBS). The pH and osmolarity of the buffer solution containing the iRNA may be adjusted to be suitable for administration to a subject.

[0449] Alternatively, the iRNA of the present invention may be administered as a pharmaceutical composition, such as a dsRNA liposome formulation.

[0450] A subject who benefits from the reduction and / or inhibition of ANGPTL3 gene expression is a subject with a lipid metabolism disorder, e.g., a genetic disorder of lipid metabolism or an acquired disorder of lipid metabolism. In one embodiment, the subject with the lipid metabolism disorder has hyperlipidemia. In another embodiment, the subject with the lipid metabolism disorder has hypertriglyceridemia. Treatment of a subject who benefits from the reduction and / or inhibition of ANGPTL3 gene expression includes therapeutic treatment (e.g., the subject has xanthomas) and prophylactic treatment (e.g., the subject does not have xanthomas or is at risk of developing xanthomas).

[0451] The present invention further provides a method of combining iRNA or a pharmaceutical composition thereof with other agents and / or other therapeutic methods, such as known agents and / or known therapeutic methods currently employed to treat such diseases, for example, to treat a subject who benefits from the reduction and / or inhibition of ANGPTL3 expression, for example, a subject with a lipid metabolism disorder. For example, in certain embodiments, the iRNA targeting ANGPTL3 is administered in combination with an agent useful for treating lipid metabolism disorders, for example, as described somewhere in this invention. For example, additional agents suitable for treating a subject who benefits from the reduction of ANGPTL3 expression, for example, a subject with a lipid metabolism disorder, may include one or more agents that lower serum lipids. Non-limiting examples of such agents may include HMG-CoA reductase inhibitors, such as cholesterol synthesis inhibitors such as statins. Statins may include atorvastatin (Lipitor), fluvastatin (Lescol), lovastatin (Mevacor), lovastatin sustained-release (Altoprev), pitavastatin (Livalo), pravastatin (Pravachol), rosuvastatin (Crestor), and simvastatin (Zocor). Other agents useful for treating lipid metabolism disorders may include bile sequestering agents such as cholesterilamine and other resins; VLDL secretion inhibitors such as niacin; lipophilic antioxidants such as probucol; acyl-CoA cholesterol acyltransferase inhibitors; farnesoid X inhibitor antagonists; sterol modulation binding protein cleavage activating protein (SCAP) activators; microsomal triglyceride transport protein (MTP) inhibitors; ApoE-associated peptides; and therapeutic antibodies against ANGPTL3.Additional therapeutic agents may also include agents that raise high-density lipoprotein (HDL), such as cholesteryl ester transport protein (CETP) inhibitors. Additionally, additional therapeutic agents may include dietary supplements, e.g., fish oil. The iRNA and additional therapeutic agents may be administered at the same time and / or in the same combination, e.g., parenterally, or the additional therapeutic agents may be administered as part of the individual composition or at individual times and / or by other methods known in the industry or described herein.

[0452] In one embodiment, the method comprises the step of administering the composition characterized herein so that the expression of the target ANGPTL3 gene is reduced, such as for about 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 18, 24 hours or 28, 32, or 36 hours. In one embodiment, the expression of the target ANGPTL3 gene is reduced for a long period, e.g., for at least about 2, 3, 4 days, e.g., for about 1 week, 2 weeks, 3 weeks, or 4 weeks.

[0453] Preferably, the iRNA useful for the method and composition characterized herein specifically targets RNAs of the target ANGPTL3 gene (first or treated). The composition and method for inhibiting the expression of such gene using the iRNA can be prepared and carried out as described herein.

[0454] Administration of dsRNA according to the method of the present invention may reduce the disease or the severity, signs, symptoms, and / or markers of the disease in patients with lipid metabolism disorders. In this context, “reduction” means a statistically significant reduction at such level. The reduction may be, for example, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 100%.

[0455] The efficacy of the treatment or prevention of a disease may be evaluated by measuring, for example, disease progression, disease recovery, symptom severity, quality of life, the dosage of medication required to sustain the therapeutic effect, levels of disease markers, or any other measurable parameters appropriate for a given disease being treated or targeted for prevention. It is fully within the capability of a person skilled in the art to monitor the efficacy of treatment or prevention by measuring any one of such parameters or any combination of such parameters. For example, the efficacy of the treatment of a lipid metabolism disorder may be evaluated, for example, by the regular monitoring of one or more serum lipid levels. Comparing the initial reading with subsequent readings provides the physician with an indication of whether the treatment is effective. It is fully within the capability of a person skilled in the art to monitor the efficacy of treatment or prevention by measuring any one of such parameters or any combination of such parameters. With respect to the administration of iRNA targeting ANGPTL3 or its pharmaceutical composition, “effective for” lipid metabolism disorders indicates that when administered in a clinically appropriate manner, beneficial effects occur in at least a statistically significant portion of patients, such as improvement of symptoms, cure, reduction of disease, extension of life, improvement of quality of life, or other effects generally recognized as positive by physicians familiar with lipid metabolism disorders and the treatment of related causes.

[0456] The therapeutic or preventive effect is evident by a statistically significant improvement in one or more parameters of the disease state, or by not exacerbating or advancing other expected symptoms. For example, a desirable change of at least 10% in a measurable parameter of the disease, and preferably at least 20%, 30%, 40%, or 50% or more, may indicate an effective treatment. The efficacy of a given iRNA drug or a formulation of such drug may also be determined using experimental animal models for a given disease, as is known in the industry. When using experimental animal models, the efficacy of the treatment is demonstrated when a statistically significant reduction in markers or symptoms is observed.

[0457] Alternatively, efficacy may be determined by a person skilled in the art of diagnosis based on a clinically accepted disease severity grading scale, but may be measured by a reduction in disease severity, for example, as a Child-Pugh score (sometimes Child-Turcotte-Pugh score). For instance, a positive change resulting in a reduction in disease severity measured by an appropriate scale indicates appropriate treatment using iRNA or an iRNA formulation as described herein.

[0458] The subject receives a therapeutic dose of dsRNA, e.g., about 0.01 mg / kg to about 5 mg / kg, about 0.01 mg / kg to about 10 mg / kg, about 0.05 mg / kg to about 5 mg / kg, about 0.05 mg / kg to about 10 mg / kg, about 0.1 mg / kg to about 5 mg / kg, about 0.1 mg / kg to about 10 mg / kg, about 0.2 mg / kg to about 5 mg / kg, about 0.2 mg / kg to about 10 mg / kg, about 0.3 mg / kg to about 5 mg / kg, about 0.3 mg / kg to about 10 mg / kg, about 0.4 mg / kg to about 5 mg / kg, about 0.4 mg / kg to about 10 mg / kg, about 0.5 mg / kg to about 5 mg / kg, about 0.5 mg / kg to about 10 mg / kg, About 1 mg / kg to about 5 mg / kg, about 1 mg / kg to about 10 mg / kg, about 1.5 mg / kg to about 5 mg / kg, about 1.5 mg / kg to about 10 mg / kg, about 2 mg / kg to about 2.5 mg / kg, about 2 mg / kg to about 10 mg / kg, about 3 mg / kg to about 5 mg / kg, about 3 mg / kg to about 10 mg / kg, about 3.5 mg / kg to about 5 mg / kg, about 4 mg / kg to about 5 mg / kg, about 4.5 mg / kg to about 5 mg / kg, about 4 mg / kg to about 10 mg / kg, about 4.5 mg / kg to about 10 mg / kg, about 5 mg / kg to about 10 mg / kg, about 5.5 mg / kg to about 10 mg / kg, about 6 mg / kg to about 10 You may be administered mg / kg, about 6.5 mg / kg to about 10 mg / kg, about 7 mg / kg to about 10 mg / kg, about 7.5 mg / kg to about 10 mg / kg, about 8 mg / kg to about 10 mg / kg, about 8.5 mg / kg to about 10 mg / kg, about 9 mg / kg to about 10 mg / kg, or about 9.5 mg / kg to about 10 mg / kg.Intermediate values ​​and ranges of the cited values ​​may also be intended as part of the present invention.

[0459] For example, dsRNA is approximately 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8.1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8. 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8. 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8. 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8. 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8. 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8. 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8. 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8. It may be administered at a dose of 9.9, or about 10 mg / kg. Intermediate values ​​and ranges to the cited values ​​may also be intended as part of the invention.

[0460] In other embodiments, for example, where the composition of the present invention comprises dsRNA and N-acetylgalactosamine as described herein, a therapeutic amount of dsRNA, e.g., about 0.1 to about 50 mg / kg, about 0.25 to about 50 mg / kg, about 0.5 to about 50 mg / kg, about 0.75 to about 50 mg / kg, about 1 to about 50 mg / mg, about 1.5 to about 50 mg / kb, about 2 to about 50 mg / kg, about 2.5 to about 50 mg / kg, about 3 to about 50 mg / kg, about 3.5 to about 50 mg / kg, about 4 to about 50 mg / kg, about 4.5 to about 50 mg / kg, about 5 to about 50 mg / kg, about 7.5 to about 50 mg / kg, about 10 to about 50 mg / kg, About 15 to about 50 mg / kg, about 20 to about 50 mg / kg, about 20 to about 50 mg / kg, about 25 to about 50 mg / kg, about 25 to about 50 mg / kg, about 30 to about 50 mg / kg, about 35 to about 50 mg / kg, about 40 to about 50 mg / kg, about 45 to about 50 mg / kg, about 0.1 to about 45 mg / kg, about 0.25 to about 45 mg / kg, about 0.5 to about 45 mg / kg, about 0.75 to about 45 mg / kg, about 1 to about 45 mg / mg, about 1.5 to about 45 mg / kb, about 2 to about 45 mg / kg, about 2.5 to about 45 mg / kg, about 3 to about 45 mg / kg, about 3.5 to About 45 mg / kg, about 4 to about 45 mg / kg, about 4.5 to about 45 mg / kg, about 5 to about 45 mg / kg, about 7.5 to about 45 mg / kg, about 10 to about 45 mg / kg, about 15 to about 45 mg / kg, about 20 to about 45 mg / kg, about 20 to about 45 mg / kg, about 25 to about 45 mg / kg, about 25 to about 45 mg / kg, about 30 to about 45 mg / kg, about 35 to about 45 mg / kg, about 40 to about 45 mg / kg, about 0.1 to about 40 mg / kg, about 0.25 to about 40 mg / kg, about 0.5 to about 40 mg / kg, about 0.75 to about 40 mg / kg, about 1 to about 40 mg / mg, about 1.5 to about 40 mg / kb, about 2 to about 40 mg / kg, about 2.5 to about 40 mg / kg, about 3 to about 40 mg / kg, about 3.5 to about 40 mg / kg, about 4 to about 40 mg / kg, about 4.5 to about 40 mg / kg, about 5 to about 40 mg / kg, about 7.5 to about 40 mg / kg, about 10 to about 40 mg / kg, about 15 to about 40 mg / kg, about 20 to about 40 mg / kg, about 20 to about 40 mg / kg, about 25 to about 40 mg / kg, about 25 to about 40 mg / kg, about 30 to about 40 mg / kg, about 35 to about 40 mg / kg, about 0.1 to about 30 mg / kg, about 0.25 to about 30 mg / kg, about 0.5 to about 30 mg / kg, about 0.75 to about 30 mg / kg, about 1 to about 30 mg / mg, about 1.5 to about 30 mg / kb, about 2 to about 30 mg / kg, about 2.5 to about 30 mg / kg, about 3 to about 30 mg / kg, about 3.5 to about 30 mg / kg, about 4 to about 30 mg / kg, about 4.5 to about 30 mg / kg, about 5 to about 30 mg / kg, about 7.5 to about 30 mg / kg, about 10 to about 30 mg / kg, about 15 to about 30 mg / kg, about 20 to about 30 mg / kg, about 20 to about 30 mg / kg, about 25 to about 30 mg / kg, about 0.1 to about 20 mg / kg, about 0.25 to about 20 mg / kg, about 0.5 to about 20 mg / kg, about 0.75 to about 20 mg / kg, about 1 to about 20 mg / mg, about 1.5 to about 20 mg / kb, about 2 to about 20 mg / kg, about 2.5 to about 20 mg / kg, about 3 to about 20 mg / kg, about 3.5 to about 20 mg / kg, about 4 to about 20 mg / kg, about 4.5 to about 20 mg / kg, about 5 to about Doses of 20 mg / kg, about 7.5 to about 20 mg / kg, about 10 to about 20 mg / kg, or about 15 to about 20 mg / kg may be administered. Intermediate values ​​and ranges to the cited values ​​may also be intended as part of the invention.

[0461] For example, the subject receives a therapeutic dose of dsRNA, e.g., about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8. 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8. 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8. 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8. 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8. 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8. 9.9, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or may be administered at a dose of approximately 50 mg / kg. Intermediate values ​​and ranges of the cited values ​​may also be intended as part of the present invention.

[0462] iRNA may be administered by intravenous infusion over a period of time, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or over a period of about 25 minutes. Administration may be repeated regularly, for example, every other week (i.e., every 2 weeks) for one, two, three, or four months or more. After the initial treatment period, treatment may be administered less frequently. For example, after administration every other week for three months, administration may be repeated once a month for six months or one year or more. Due to the administration of iRNA, for example, ANGPTL3 levels in the patient's cells, tissues, blood, urine, or other compartments are at least about 5%, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 39, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or at least about 99% or more may be reduced.

[0463] Before administering the full dose of iRNA, the patient may be given a smaller dose, such as a 5% infusion response, and may be monitored for adverse effects such as allergic reactions. In other cases, the patient may be monitored for unwanted immunostimulatory effects, such as increased cytokine levels (e.g., TNF-alpha or INF-alpha).

[0464] Alternatively, iRNA may be administered subcutaneously, for example, by subcutaneous injection. A desired daily dose of iRNA may be delivered to the subject using one or more injections. Injections may be repeated over a period of time such as 2, 3, 4, 5, 6, 7, 8, 9, 10, or 15 days. Administration may be repeated regularly, for example, every other week (i.e., every 2 weeks) for one, two, three, or four months or longer. After the initial treatment period, treatment may be administered less frequently. In some embodiments, a monthly administration follows a single dose of iRNA. In some embodiments, administration may include a loading phase of multiple doses over consecutive days.

[0465] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention pertains. Although methods and materials similar or equivalent to those described herein may be used in practice or testing of the iRNA and methods characterized by the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In the event of a conflict, this specification shall prevail, including definitions. Furthermore, materials, methods, and examples are illustrative only and are not intended to be limiting.

[0467] Examples

[0468] Example 1. iRNA Synthesis

[0469] Source of reagents

[0470] Where the source of the reagent is not specifically given herein, such reagent may be obtained from any supplier of reagents for molecular biology as a quality / purity standard for applications in molecular biology.

[0472] Transfer work

[0473] Synomolgus monkeys generated by performing siRNA design and sequencing of cDNA prepared from human ANGPTL3 transcripts annotated in the NCBI gene database (http: / / www.ncbi.nlm.nih.gov / gene / ) and liver RNA ( Macaca pasicularis Here, siRNAs targeting “sino”) ANGPTL3 transcripts were identified. Sequencing of sino ANGPTL3 mRNA was performed in-house, and the mRNA sequence is shown in SEQ ID NO:9.

[0474] For the design, the following transcripts from the NCBI set were used: human NM_014495.2 (SEQ ID NO:1); mouse - NM_013913.3 (SEQ ID NO:2). All siRNA duplexes sharing 100% identity with the listed human and siRNA transcripts were designed. A subset of the siRNA duplexes described below also shared 100% identity with the mouse (Mus musculus) ANGPTL3 transcript found in the NCBI gene database.

[0476] siRNA Design, Specificity, and Efficacy Prediction

[0477] The predicted specificity of all possible 19-mers was predicted from their respective sequences. Subsequently, candidate 19-mers lacking repeats longer than 7 nucleotides were selected. These 977 candidate human / cyno siRNAs and a subset of 38 mouse-matched siRNAs were subsequently used in an extensive investigation of the human transcriptome (defined as the NM_ and XM_ record sets within the human NCBI Refseq set) using a comprehensive "brute-force" algorithm implemented in the Python script 'BruteForce.py'. The following script analyzed transcript-oligo alignment to generate a score based on the position and the number of mismatches between the siRNA and any potential 'off-target' script. The off-target score is weighted to highlight differences in the 'seed' region of the siRNA, located 2–9 positions from the 5' end of the molecule. From the brute-force investigation, each oligo transcript pair was assigned a mismatch score by summing the individual mismatch scores; Mismatches within positions 2-9 were calculated as 2.8, mismatches within cleavage site positions 10-11 as 1.2, and mismatches within the 12-19 region as 1.0. Additional off-target prediction was performed by comparing the frequencies of heptomers and octomers derived from three different seed-derived hexamers of each oligo. Two heptomers and one octomer were produced using a hexamer from positions 2-7 with a 5' start. 'Heptomer 1' was produced by adding 3' A to the heptomer; 'Heptomer 2' was produced by adding 5' A to the heptomer; and the octomer was produced by adding A to both the 5' and 3' ends of the heptomer. The frequencies of octamers and heptamers in the human 3' UTRome (defined by transcript sequences from the NCBI Refseq database, where the end of the coding region 'CDS' is clearly defined) were calculated in advance.The octamer frequencies were normalized to heptamer frequencies using the median value from the range of octamer frequencies. Then, 'mirSeedScore' was calculated by calculating the sum of ((3 X normalized octamer coefficients) + (2 X heptamer 2 coefficients) + (1 X heptamer 1 coefficient)).

[0478] Both strands of siRNA were assigned to categories of specificity based on calculated scores: scores exceeding 3 were considered highly specific, scores equal to 3 were considered specific, and scores between 2.2 and 2.8 were considered moderately specific. Classification was performed based on the specificity of the antisense strand. Subsequently, duplexes were selected from the human / cyno set having antisense oligos with four or more Us or As within the seed region and a GC at the 19th position, lacking miRNA seed mismatches, having a score of 3 or higher and less than 65% of the total GC content, and lacking a GC at the 1st position. Duplexes from the human / cyno / mouse set having antisense oligos with a score of 2 or higher and less than 65% of the total GC content, and lacking a GC at the 1st position were also selected.

[0480] siRNA sequence selection

[0481] A total of 47 sense and 47 antisense-derived siRNA oligos were synthesized from the human / sino / mouse set and formed into duplexes. A total of 15 sense and 15 antisense-derived siRNAs were synthesized from the human / sino / mouse set and formed into duplexes.

[0483] Synthesis of ANGPTL3 sequences

[0484] ANGPTL3 sequences were synthesized on a MerMade 192 synthesizer at a scale of 1 or 2 μmol. Single strands were synthesized with 2' O-methyl modifications for delivery-infection-based in vitro screening. For use in free-uptake screening assays, 3' GalNAc conjugates with 2'F and 2'-O methyl chemical modifications were constructed. In this design, the GalNAc moiety was placed at the 3' end of the sense strand. The antisense sequence was 23 nucleotides long and also included 2'F and 2'O methyl chemical modifications with two phosphorothioate linkages at the 3' end.

[0485] 'Endolight' chemistry was applied in detail below to a subset of 21-mer single strands and duplexes.

[0486] ● All myrimidines (cytosine and uridine) in the sense strand were modified into 2'-O-methyl nucleotides (2' O-methyl C and 2' O-methyl U).

[0487] ● In the antisense strand, pyrimidines adjacent to the ribo-A nucleoside (facing the 5' position) were replaced with corresponding 2'-O-methyl nucleosides.

[0488] ● A 2-base dTsdT extension was introduced at the 3-terminus of the sense and antisense sequences.

[0489] For GalNAc-conjugated 21-mer sense and complementary 23-mer antisense sequences, 2'F and 2'O methyl-modified single strands were synthesized. Synthesis was performed on a GalNAc-modified CPG support for the sense strand and modified into a universal support for the antisense sequence at a 1 μmol scale. A sequence named TOFFEE was applied, in which the sense strand contains three nucleotide 2'F-modified motifs at positions 9, 10, and 11, and in the antisense, 2'O methyl-modified motifs are included at positions 11, 12, and 13.

[0491] Synthesis, cutting, and deprotection

[0492] The synthesis of ANGPTL3 sequences utilized solid-supported oligonucleotide synthesis using phosphoamidite chemistry. For the 21-mer endolite sequences, deoxythymidine CPG was used as the solid support, whereas for the GalNAc conjugates, a GalNAc solid support was used for the sense strand and a universal CPG was used for the antisense strand.

[0493] The synthesis of the above sequences was performed in 96-well plates at a scale of 1 or 0.2 μm. The amidite solution was prepared at a concentration of 0.1 M, and ethyl thiotetrazole (0.6 M in acetonitrile) was used as the activator.

[0494] The synthesized sequences were cleaved and deprotected in 96-well plates using methylamine in the first step and fluoride reagents in the second step. For GalNAc and 2' F nucleoside-containing sequences, the deprotection conditions were modified. The sequences after cleaving and deprotection were precipitated using an acetone:ethanol (80:20) mix, and the pellets were resuspended in 0.2 M sodium acetate buffer. Samples from each sequence were analyzed by LC-MS for identity, and purity was measured by confirming the set of selected samples using UV and IEX chromatography for quantification.

[0496] Refining, desalination, and annealing

[0497] ANGPTL3 sequences were precipitated and purified on an AKTA purification system using a Sephadex column. ANGPTL3 was performed at ambient temperature. Sample injection and collection were performed in 96-well plates with 1.8 mL depth wells. Single peaks corresponding to the full-length sequences were collected within the eluent. The desalted ANGPTL3 sequences were at a concentration (A 260 The purity (by UV measurement) and ion exchange HPLC were analyzed. Subsequently, complementary single strands were combined in a 1:1 stoichiometric ratio to form siRNA duplexes.

[0499] Example 2. In vitro screening

[0500] Cell Culture and Transmission Infection:

[0501] Hep3B cells (ATCC, Manassas, Virginia) were grown to near confluence in RPMI (ATCC) supplemented with 10% FBS, streptomycin, and glutamine (ATCC) at 37°C in a 5% CO2 atmosphere before being released from the plate by trypsin treatment. Transfection was performed by adding 14.8 ml of Opti-MEM to 5 ml of siRNA duplexes per well in 96-well plates (Invitrogen, Carlsbad, CA. cat # 13778-150), adding 0.2 ml of Lipofectamine RNAiMax per well, and incubated at room temperature for 15 minutes. Subsequently, ~2 x 10 4 80 ml of antibiotic-free complete growth medium containing Hep3B cells was added to the siRNA mixture. Cells were cultured for 24 or 120 hours prior to performing RNA purification. Single-dose experiments were performed at final duplex concentrations of 10 nM and 0.1 nM, and dose-response experiments were performed at final duplex concentrations of 10, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001, 0.0005, 0.0001, 0.00005, and 0.00001 nM unless otherwise noted.

[0503] Free uptake transfection

[0504] 5 ml of each GalNac-conjugated siRNA in PBS was added to each well of a 96-well plate, along with 4 x 10⁶ siRNAs resuspended in 95 μl of In Vitro Gro CP medium (In Vitro Technologies - Celsis, Baltimore, MD). 4Freshly thawed cryopreserved cynomolgus monkey hepatocytes were combined. The mixture was incubated at 37°C in a 5% CO2 atmosphere for approximately 24 hours. SiRNAs were tested at final concentrations of 500 nM, 100 nM, and 10 nM for the efficiency of the free uptake assay. The final siRNA concentrations for the dose-response screen were 500 nM, 100 nM, 20 nM, 4 nM, 0.8 nM, 0.16 nM, 0.032 nM, and 0.0064 nM.

[0506] Total RNA isolation using the DYNABEADS mRNA isolation kit (Invitrogen, Part No.: 610-12):

[0508] Cells were collected and lysed in 150 ml of lysis / binding buffer, and then mixed for 5 minutes at 850 rpm using an Eppendorf thermal mixer (mixing speed remained constant throughout the process). A mixture of 10 micrometer magnetic beads and 80 ml of lysis / binding buffer was added to a round-bottom plate and mixed for 1 minute. The magnetic beads were captured using a magnetic stand, and the supernatant was removed without disturbing the beads. After removing the supernatant, the lysed cells were added to the remaining beads and mixed for 5 minutes. After removing the supernatant, the magnetic beads were washed twice with 150 ml of wash buffer A and mixed for 1 minute. The beads were captured again, and the supernatant was removed. Subsequently, the beads were washed with 150 ml of wash buffer B, captured, and the supernatant was removed. Next, the beads were washed with 150 ml of elution buffer, captured, and the supernatant was removed. The beads were allowed to dry for 2 minutes. After drying, 50 ml of elution buffer was added and mixed at 70°C for 5 minutes. The beads were captured on a magnet for 5 minutes. 40 ml of the supernatant was removed and added to another 96-well plate.

[0510] cDNA synthesis using the ABI High-Dose cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, California, Cat #4368813)

[0511] A master mix of 2 ml 10X buffer, 0.8 μml 25X dNTPs, 2 μml random primers, 1 μml reverse transcriptase, 1 μml RNase inhibitor, and 3.2 μml H2O per reaction was added to 10 ml of total RNA. cDNA was generated using a Bio-Rad C-1000 or S-1000 thermal cycler (Hercules, California) through the following steps: 25°C for 10 min, 37°C for 120 min, 85°C for 5 sec, and hold at 4°C.

[0513] Real-time PCR:

[0514] 2 ml of cDNA was added to a master mix containing 0.5 ml of GAPDH TaqMan probes (Applied Biosystems Cat #4326317E), 0.5 ml of ApoC3 TaqMan probes (Applied Biosystems cat #Hs00163644_m1), and 5 ml of Lightcycler 480 probe master mix (Roche Cat #04887301001) per well in 50 plates of 384 wells (Roche cat #04887301001). Real-time PCR was performed in an ABI 7900HT real-time PCR system (Applied Biosystems) using the ΔΔCt(RQ) assay. Unless otherwise indicated in the summary tables, each duplex was tested in two independent transfer infections, and each transfer infection was analyzed in pairs.

[0515] To calculate the relative multiple change, real-time data were analyzed using the ΔΔCt method and normalized to the assay performed with cells transfected with 10 nM AD-1955 or mock transfected cells. IC 50It was calculated using a 4-parameter fitting model with XLFit and normalized to cells delivered to or uncontacted with AD-1955 across the same dose range or at its own lowest dose. The AD-1955 sequence used as a negative control targets luciferase and has the following sequences: Sense: cuuAcGcuGAGuAcuucGAdTsdT(SEQ ID NO: 14); Antisense: UCGAAGuACUcAGCGuAAGdTsdT(SEQ ID NO: 15).

[0517] Survival Screen

[0518] Cell viability was measured in HeLa and Hep3B cells on days 3 and 6 following transfection with 10, 1, 0.5, 0.1, and 0.05 nM siRNA. Cells were plated in 96-well plates at a density of 10,000 cells per well. Each siRNA was analyzed in three sets, and the data were averaged. siRNAs targeting PLK1 and AD-19200 were included as positive controls for viability loss, while AD-1955 and mock transfected cells were included as negative controls. PLK1 and AD-19200 lead to dose-dependent viability loss. To measure viability, 20 μl of cell titer blue (Promega) was added to each well of the 96-well plate after days 3 and 6, and the cells were incubated at 37°C for 2 hours. Subsequently, plates were read on a Molecular Devices spectrophotometer at 560Ex / 590Em. Viability was expressed as the mean value in light units from three replication transfer infections + / - standard deviations. Relative viability was analyzed by first averaging three replication transfer infections and then normalizing the simulated transfer-infected cells. Data are expressed as % viable cells.

[0520] Abbreviations of nucleotide monomers used in nucleic acid sequence notationYou will know that when these monomers exist within an oligonucleotide, they are interconnected by 5'-3'-phosphodiester bonds. abbreviation nucleotide(s) A Adenosine C Citidin G Guanosine T Timidin U Uridin N Any nucleotide (G, A, C, T, or U) a 2'-O-methyladenosine c 2'-O-methylcytidine g 2'-O-methylguanosine u 2'-O-methyluridine dT 2'-deoxythymidine s Phosphorothioate connection

[0521] Non-modifying sense and antisense strand sequences of ANGPTL3 dsRNA Duplex ID Sense name Sense sequence (SEQ ID NOS 16-77 respectively in order of appearance) Location at NM_014495.2 Antisense name Antisense sequence (SEQ ID NOS 78-139 in order of appearance) Location at NM_014495.2 AD-45939.1 A-96225.1 UAUUUGAUCAGUCUUUUUA 281-299 A-96226.1 UAAAAAGACUGAUCAAAUA 281-299 AD-45858.1 A-96149.1 GAGCAACUAACUAACUUAA 478-496 A-96150.1 UUAAGUUAGUUAGUUGCUC 478-496 AD-45869.1 A-96137.1 GGCCAAAUUAAUGACAUAU 247-265 A-96138.1 AUAUGUCAUUAAUUUGGCC 247-265 AD-45884.1 A-96189.1 CGAAUUGAGUUGGAAGACU 1045-1063 A-96190.1 AGUCUUCCAACUCAAUUCG 1045-1063 AD-45892.1 A-96129.1 CCUCCUUCAGUUGGGACAU 198-216 A-96130.1 AUGUCCCAACUGAAGGAGG 198-216 AD-45899.1 A-96147.1 CACUUGAACUCAACUCAAA 401-419 A-96148.1 UUUGAGUUGAGUUCAAGUG 401-419 AD-45915.1 A-96231.1 GUCCAUGGACAUUAAUUCA 890-908 A-96232.1 UGAAUUAAUGUCCAUGGAC 890-908 AD-45924.1 A-96219.1 AAUCAAGAUUUGCUAUGUU 152-170 A-96220.1 AACAUAGCAAAUCUUGAUU 152-170 AD-45860.1 A-96181.1 CUAGAGAAGAUAUACUCCA 1000-1018 A-96182.1 UGGAGUAUAUCUUCUCUAG 1000-1018 AD-45870.1 A-96153.1 CUAACUAACUUAAUUCAAA 484-502 A-96154.1 UUUGAAUUAAGUUAGUUAG 484-502 AD-45870.2 A-96153.2 CUAACUAACUUAAUUCAAA 484-502 A-96154.2 UUUGAAUUAAGUUAGUUAG 484-502 AD-45877.1 A-96171.1 CAUUAAUUCAACAUCGAAU 899-917 A-96172.1 AUUCGAUGUUGAAUUAUG 899-917 AD-45885.1 A-96205.1 CAAAAUGUUGAUCCAUCC 1392-1410 A-96206.1 UGGAUGGAUCACAUUUUG 1392-1410 AD-45893.1 A-96145.1 CAUAUAAACUACAAGUCAA 359-377 A-96146.1 UUGACUUGUAGUUUUAAUUG 359-377 AD-45900.1 A-96163.1 GACCCAGCAACUCUCAAGU 839-857 A-96164.1 ACUUGAGAGGUUGCUGGUC 839-857 AD-45925.1 A-96235.1 GGUUGGGCCUAGAGAAGAU 992-1010 A-96236.1 AUCUUCUCUUAGGCCCAACC 992-1010 AD-45861.1 A-96197.1 GUGUGGAGAAACAACCUA 1272-1290 A-96198.1 UAGGUUGUUUUCCCACAC 1272-1290 AD-45871.1 A-96169.1 GACAUUAAUUCAACAUCGA 897-915 A-96170.1 UCGAUGUUGAAUUAAUUGUC 897-915 AD-45878.1 A-96187.1 CAUAGUGAAGCAAUCUAAU 1017-1035 A-96188.1 AUUAGAUUGCUUCACUAUG 1017-1035 AD-45886.1 A-96127.1 CUAUGUUAGACGAUGUAA 164-182 A-96128.1 UUUACAUCGUCUAACAUAG 164-182 AD-45894.1 A-96161.1 CACAGAAAUUUCUCUAUCU 684-702 A-96162.1 AGAUAGAGAAAUUUCUGUG 684-702 AD-45901.1 A-96179.1 GUUGGGCCUAGAGAAGUA 993-1011 A-96180.1 UAUCUUCUCUAGGCCCAAC 993-1011 AD-45909.1 A-96213.1 GCCAAAAUCAAGAUUUGCU 147-165 A-96214.1 AGCAAAUCUUGAUUUUGGC 147-165 AD-45934.1 A-96223.1 ACAUAUUUGAUCAGUCUUUU 278-296 A-96224.1 AAAGACUGAUCAAAUAUGU 278-296 AD-45934.2 A-96223.2 ACAUAUUUGAUCAGUCUUUU 278-296 A-96224.2 AAAGACUGAUCAAAUAUGU 278-296 AD-45863.1 A-96135.1 CUUAAAGACUUUGUCCAUA 220-238 A-96136.1 UAUGGACAAAGUCUUUAAG 220-238 AD-45872.1 A-96185.1 CCUAUGUAAGCAAUCUAA 1016-1034 A-96186.1 UUAGAUUGCUUCACUAUGG 1016-1034 AD-45879.1 A-96203.1 CAACCAAAAUGUUGAUCCCA 1388-1406 A-96204.1 UGGAUCAACAUUUUGGUUG 1388-1406 AD-45887.1 A-96143.1 CUACAUAUAACUACAAGU 356-374 A-96144.1 ACUUGUAGUUUUAUAUGUAG 356-374 AD-45895.1 A-96177.1 GGGAGGCUUGAUGGAGAAAU 970-988 A-96178.1 AAUCUCCAUCAAGCCCUCCC 970-988 AD-45902.1 A-96195.1 GGUGUUUUUCUACUUGGGAU 1188-1206 A-96196.1 AUCCCAAGUAGAAAACACC 1188-1206 AD-45910.1 A-96229.1 AAGAGCACCAAGAACUACU 711-729 A-96230.1 WATERCOURSE 711-729 AD-45935.1 A-96239.1 UGGAAAAAAAAAAU 1275-1293 A-96240.1 AUUUAKEEP 1275-1293 AD-45864.1 A-96151.1 GCAACUAACUAAUU 480-498 A-96152.1 AAUUAAGUUUUGC 480-498 AD-45873.1 A-96201.1 LITTLE LITTLE! 1284-1302 A-96202.1 AUAUUUACCAUUUAGGUUG 1284-1302 AD-45880.1 A-96125.1 HOME 163-181 A-96126.1 UUACAUCCUAACAUAGC 163-181 AD-45888.1 A-96159.1 CCCAGAUUUCUCUAU 682-700 A-96160.1 AUAGAGAAAUUUCGUGGG 682-700 AD-45896.1 A-96193.1 YOU 1183-1201 A-96194.1 WATERAAAAAUC 1183-1201 AD-45903.1 A-96211.1 CAGAGCCAAAAUCAAGAUU 143-161 A-96212.1 AAUCUGAUUUUGGCUCUG 143-161 AD-45919.1 A-96217.1 AAAUCAAGAUUUGCUAUGU 151-169 A-96218.1 HOUSEHOLD 151-169 AD-45865.1 A-96167.1 CAUGGAUAAUCACACA 893-911 A-96168.1 UGUUGAAUUAAUGUCCAUG 893-911 AD-45874.1 A-96123.1 GAUUGCUAUGUUAGACGA 158-176 A-96124.1 TAKE CAAUAGCAAAUC 158-176 AD-45881.1 A-96141.1 WATERWATERWATER 353-371 A-96142.1 WOW 353-371 AD-45889.1 A-96175.1 CGAAUGGAUCCAAA 913-931 A-96176.1 UUUGUGAUCCAUCAUUCG 913-931 AD-45897.1 A-96209.1 CUGUAAACUCUACU 1817-1835 A-96210.1 AGUUAGAGUUUUAACAAG 1817-1835 AD-45904.1 A-96227.1 AUUUUUUUUU 282-300 A-96228.1 AUAAAAAACUAAU 282-300 AD-45920.1 A-96233.1 UCCAUGCAUUAAUUCAA 891-909 A-96234.1 UUGAAUUAAUGUCCAUGGA 891-909 AD-45856.1 A-96117.1 CACAAUUAACOCK 57-75 A-96118.1 AAGAGGAGCUUAUUGUG 57-75 AD-45929.1 A-96221.1 WHAT YOU DO 276-294 A-96222.1 HOLDINGAAUAUGUUG 276-294 AD-45866.1 A-96183.1 CUCKHOODGROW 1014-1032 A-96184.1 AGAUGQUACAUGGAG 1014-1032 AD-45875.1 A-96139.1 GCCAAAUAUAUGACAAUUU 248-266 A-96140.1 AAUAUGUCAUUAAUUUGGC 248-266 AD-45882.1 A-96157.1 HAPPENINGHAPPENING 622-640 A-96158.1 UUUUUGACUAUGCUGUUG 622-640 AD-45890.1 A-96191.1 GGAAAUCACGAAACCAACU 1105-1123 A-96192.1 AGUUGGUUUCGUGAUUUCC 1105-1123 AD-45898.1 A-96131.1 CAGUUGGGACAUGGUCUUA 205-223 A-96132.1 UAAGACCAUGUCCCAACUG 205-223 AD-45857.1 A-96133.1 GACAUGGUCUUAAAGACUU 212-230 A-96134.1 AAGUCUUUAAGACCAUGUC 212-230 AD-45930.1 A-96237.1 UGUGGAGAAAACAACCUAA 1273-1291 A-96238.1 UUAGGUUGUUUUCUCCACA 1273-1291 AD-45867.1 A-96199.1 GUGGAGAAAACAACCUAAA 1274-1292 A-96200.1 UUUAGGUUGUUUUCUCCAC 1274-1292 AD-45876.1 A-96155.1 CCAACAGCAUAGUCAAAUA 621-639 A-96156.1 UAUUUGACUAUGCUGUUGG 621-639 AD-45883.1 A-96173.1 CAACAUCGAAUAGAUGGAU 907-925 A-96174.1 AUCCAUCUAUUCGAUGUUG 907-925 AD-45891.1 A-96207.1 GCAAAUUUAAAAGGCAAUA 1441-1459 A-96208.1 UAUUGCCUUUUAAAUUUGC 1441-1459 AD-45914.1 A-96215.1 CAAAAUCAAGAUUUGCUAU 149-167 A-96216.1 AUAGCAAAUCUUGAUUUUG 149-167 AD-15838.1 A-26242.1 AGAGCCAAAAUCAAGAUUU 144-162 A-26243.2 AAAUCUUGAUUUUGGCUCU 144-162

[0522] Modified sense and antisense strand sequences of ANGPTL3 dsRNA Duplex ID Sense Oligo Myeong Sense sequence (SEQ ID NOS 140-201 respectively in order of appearance) Antisense oligosaccharides Antisense sequence (SEQ ID NOS 202-263 respectively in order of appearance) AD-45939.1 A-96225.1 uAuuuGAucAGucuuuuuAdTsdT A-96226.1 uAAAAAGACUGAUcAAAuAdTsdT AD-45858.1 A-96149.1 GAGcAAcuAAcuAAcuuAAdTsdT A-96150.1 UuAAGUuAGUuAGUUGCUCdTsdT AD-45869.1 A-96137.1 GGccAAAuuAAuGAcAuAudTsdT A-96138.1 AuAUGUcAUuAAUUUGGCCdTsdT AD-45884.1 A-96189.1 cGAAuuGAGuuGGAAGAcudTsdT A-96190.1 AGUCUUCcAACUcAAUUCGdTsdT AD-45892.1 A-96129.1 ccuccuucAGuuGGGAcAudTsdT A-96130.1 AUGUCCcAACUGAAGGAGGdTsdT AD-45899.1 A-96147.1 cAcuuGAAcucAAcucAAAdTsdT A-96148.1 UUUGAGUUGAGUUcAAGUGdTsdT AD-45915.1 A-96231.1 GuccAuGGAcAuuAAuucAdTsdT A-96232.1 UGAAUuAAUGUCcAUGGACdTsdT AD-45924.1 A-96219.1 AAucAAGAuuuGcuAuGuudTsdT A-96220.1 AAcAuAGcAAAUCUUGAUUdTsdT AD-45860.1 A-96181.1 cuAGAGAAGAuAuAcuccAdTsdT A-96182.1 UGGAGuAuAUCUUCUCuAGdTsdT AD-45870.1 A-96153.1 cuAAcuAAcuuAAuucAAAdTsdT A-96154.1 UUUGAAUuAAGUuAGUuAGdTsdT AD-45870.2 A-96153.2 cuAAcuAAcuuAAuucAAAdTsdT A-96154.2 UUUGAAUuAAGUuAGUuAGdTsdT AD-45877.1 A-96171.1 cAuuAAuucAAcAucGAAudTsdT A-96172.1 AUUCGAUGUUGAAUuAAUGdTsdT AD-45885.1 A-96205.1 cAAAAuGuuGAuccAuccAdTsdT A-96206.1 UGGAUGGAUcAAcAUUUUGdTsdT AD-45893.1 A-96145.1 cAuAuAAAcuAcAAGucAAdTsdT A-96146.1 UUGACUUGuAGUUuAuAUGdTsdT AD-45900.1 A-96163.1 GAcccAGcAAcucucAAGudTsdT A-96164.1 ACUUGAGAGUUGCUGGUGCdTsdT AD-45925.1 A-96235.1 GGuuGGGccuAGAGAAGAudTsdT A-96236.1 AUCUUCUCuAGGCCcAACCdTsdT AD-45861.1 A-96197.1 GuGuGGAGAAAAcAAccuAdTsdT A-96198.1 uAGGUUGUUUUCUCcAcACdTsdT AD-45871.1 A-96169.1 GAcAuuAAuucAAcAucGAdTsdT A-96170.1 UCGAUGUUGAAUuAAUGUCdTsdT AD-45878.1 A-96187.1 cAuAGuGAAGcAAucuAAudTsdT A-96188.1 AUuAGAUUGCUUcACuAUGdTsdT AD-45886.1 A-96127.1 cuAuGuuAGAcGAuGuAAAdTsdT A-96128.1 UUuAcAUCGUCuAAcAuAGdTsdT AD-45894.1 A-96161.1 cAcAGAAAuuucucuAucudTsdT A-96162.1 AGAuAGAGAAAUUUCUGUGdTsdT AD-45901.1 A-96179.1 GuuGGGccuAGAGAAGAuAdTsdT A-96180.1 uAUCUUCUCuAGGCCcAACdTsdT AD-45909.1 A-96213.1 GccAAAAucAAGAuuuGcudTsdT A-96214.1 AGcAAAUCUUGAUUUUGGCdTsdT AD-45934.1 A-96223.1 AcAuAuuuGAucAGucuuudTsdT A-96224.1 AAAGACUGAUcAAAuAUGUdTsdT AD-45934.2 A-96223.2 AcAuAuuuGAucAGucuuudTsdT A-96224.2 AAAGACUGAUcAAAuAUGUdTsdT AD-45863.1 A-96135.1 cuuAAAGAcuuuGuccAuAdTsdT A-96136.1 uAUGGAcAAAGUCUUuAAGdTsdT AD-45872.1 A-96185.1 ccAuAGuGAAGcAAucuAAdTsdT A-96186.1 UuAGAUUGCUUcACuAUGGdTsdT AD-45879.1 A-96203.1 cAAccAAAAuGuuGAuccAdTsdT A-96204.1 UGGAUcAAcAUUUUGGUUGdTsdT AD-45887.1 A-96143.1 cuAcAuAuAAAcuAcAAGudTsdT A-96144.1 ACUUGuAGUUuAuAUGuAGdTsdT AD-45895.1 A-96177.1 GGGAGGcuuGAuGGAGAAudTsdT A-96178.1 AUUCUCcAUcAAGCCUCCCdTsdT AD-45902.1 A-96195.1 GGuGuuuucuAcuuGGGAudTsdT A-96196.1 AUCCcAAGuAGAAAAcACCdTsdT AD-45910.1 A-96229.1 AAGAGcAccAAGAAcuAcudTsdT A-96230.1 AGuAGUUCUUGGUGCUCUUdTsdT AD-45935.1 A-96239.1 uGGAGAAAAcAAccuAAAudTsdT A-96240.1 AUUuAGGUUGUUUUCUCcAdTsdT AD-45864.1 A-96151.1 GcAAcuAAcuAAcuuAAuudTsdT A-96152.1 AAUuAAGUuAGUuAGUUGCdTsdT AD-45873.1 A-96201.1 cAAccuAAAuGGuAAAuAudTsdT A-96202.1 AuAUUuACcAUUuAGGUUGdTsdT AD-45880.1 A-96125.1 GcuAuGuuAGAcGAuGuAAdTsdT A-96126.1 UuAcAUCGUCuAAcAuAGCdTsdT AD-45888.1 A-96159.1 cccAcAGAAAuuucucuAudTsdT A-96160.1 AuAGAGAAAUUUCUGUGGGdTsdT AD-45896.1 A-96193.1 GAuuuGGuGuuuucuAcuudTsdT A-96194.1 AAGuAGAAAAcACcAAAUCdTsdT AD-45903.1 A-96211.1 cAGAGccAAAAucAAGAuudTsdT A-96212.1 AAUCUUGAUUUUGGCUCUGdTsdT AD-45919.1 A-96217.1 AAAucAAGAuuuGcuAuGudTsdT A-96218.1 AcAuAGcAAAUCUUGAUUUdTsdT AD-45865.1 A-96167.1 cAuGGAcAuuAAuucAAcAdTsdT A-96168.1 UGUUGAAUuAAUGUCcAUGdTsdT AD-45874.1 A-96123.1 GAuuuGcuAuGuuAGAcGAdTsdT A-96124.1 UCGUCuAAcAuAGcAAAUCdTsdT AD-45881.1 A-96141.1 GAAcuAcAuAuAAAcuAcAdTsdT A-96142.1 UGuAGUUuAuAUGuAGUUCdTsdT AD-45889.1 A-96175.1 cGAAuAGAuGGAucAcAAAdTsdT A-96176.1 UUUGUGAUCcAUCuAUUCGdTsdT AD-45897.1 A-96209.1 cuuGuuAAAAcucuAAAcudTsdT A-96210.1 AGUUuAGAGUUUuAAcAAGdTsdT AD-45904.1 A-96227.1 AuuuGAucAGucuuuuuAudTsdT A-96228.1 AuAAAAAGACUGAUcAAAUdTsdT AD-45920.1 A-96233.1 uccAuGGAcAuuAAuucAAdTsdT A-96234.1 UUGAAUuAAUGUCcAUGGAdTsdT AD-45856.1 A-96117.1 cAcAAuuAAGcuccuucuudTsdT A-96118.1 AAGAAGGAGCUuAAUUGUGdTsdT AD-45929.1 A-96221.1 cAAcAuAuuuGAucAGucudTsdT A-96222.1 AGACUGAUcAAAuAUGUUGdTsdT AD-45866.1 A-96183.1 cuccAuAGuGAAGcAAucudTsdT A-96184.1 AGAUUGCUUcACuAUGGAGdTsdT AD-45875.1 A-96139.1 GccAAAuuAAuGAcAuAuudTsdT A-96140.1 AAuAUGUcAUuAAUUUGGCdTsdT AD-45882.1 A-96157.1 cAAcAGcAuAGucAAAuAAdTsdT A-96158.1 UuAUUUGACuAUGCUGUUGdTsdT AD-45890.1 A-96191.1 GGAAAucAcGAAAccAAcudTsdT A-96192.1 AGUUGGUUUCGUGAUUUCCdTsdT AD-45898.1 A-96131.1 cAGuuGGGAcAuGGucuuAdTsdT A-96132.1 uAAGACcAUGUCCcAACUGdTsdT AD-45857.1 A-96133.1 GAcAuGGucuuAAAGAcuudTsdT A-96134.1 AAGUCUUuAAGACcAUGUCdTsdT AD-45930.1 A-96237.1 uGuGGAGAAAAcAAccuAAdTsdT A-96238.1 UuAGGUUGUUUUCUCcAcAdTsdT AD-45867.1 A-96199.1 GuGGAGAAAAcAAccuAAAdTsdT A-96200.1 UUuAGGUUGUUUUCUCcACdTsdT AD-45876.1 A-96155.1 ccAAcAGcAuAGucAAAuAdTsdT A-96156.1 uAUUUGACuAUGCUGUUGGdTsdT AD-45883.1 A-96173.1 cAAcAucGAAuAGAuGGAudTsdT A-96174.1 AUCcAUCuAUUCGAUGUUGdTsdT AD-45891.1 A-96207.1 GcAAAuuuAAAAGGcAAuAdTsdT A-96208.1 uAUUGCCUUUuAAAUUUGCdTsdT AD-45914.1 A-96215.1 cAAAAucAAGAuuuGcuAudTsdT A-96216.1 AuAGcAAAUCUUGAUUUUGdTsdT AD-15838.1 A-26242.1 AGAGccAAAAucAAGAuuudTsdT A-26243.2 AAAUCUuGAUUUuGGCUCUdTsdT

[0523] The lowercase nucleotides (a, u, g, c) are 2'-O-methyl nucleotides; s is a phosphothiorate linkage.

[0525] Results of a single-dose screen using the ANGPTL3 dsRNA sequence Experiments were performed using the modified oligonucleotide duplexes listed in Table 3. The sequence of AD-15838.2 is identical to the sequence of AD-15838.1. Delivery of siRNA duplexes was performed using LNP. Human Hep3B Duplex 10 nM 0.1 nM STDEV, 10 nM STDEV, 0.1 nM AD-15838.2 0.09 0.66 0.008 0.030 AD-45856.1 0.32 0.91 0.026 0.032 AD-45857.1 2.46 1.07 0.140 0.044 AD-45858.1 0.10 0.74 0.010 0.070 AD-45860.1 0.02 0.47 0.002 0.097 AD-45861.1 0.03 0.68 0.004 0.062 AD-45863.1 1.42 0.95 0.145 0.126 AD-45864.1 0.02 0.17 0.002 0.045 AD-45865.1 0.32 0.93 0.022 0.062 AD-45866.1 0.10 0.92 0.010 0.041 AD-45867.1 0.04 0.61 0.000 0.048 AD-45869.1 0.45 1.08 0.028 0.081 AD-45870.1 0.01 0.10 0.003 0.010 AD-45871.1 0.05 0.57 0.006 0.071 AD-45872.1 0.07 0.71 0.007 0.034 AD-45873.1 0.02 0.23 0.001 0.011 AD-45874.1 0.08 0.75 0.013 0.049 AD-45875.1 0.13 0.82 0.017 0.040 AD-45876.1 0.03 0.54 0.000 0.013 AD-45877.1 0.06 0.47 0.002 0.025 AD-45878.1 0.02 0.44 0.002 0.031 AD-45879.1 0.03 0.35 0.003 0.023 AD-45880.1 0.49 1.00 0.039 0.088 AD-45881.1 0.20 0.90 0.019 0.095 AD-45882.1 0.20 0.95 0.012 0.086 AD-45883.1 0.16 0.98 0.011 0.058 AD-45884.1 0.09 0.94 0.003 0.044 AD-45885.1 0.22 0.91 0.020 0.145 AD-45886.1 0.04 0.40 0.008 0.080 AD-45887.1 0.03 0.35 0.002 0.057 AD-45888.1 0.05 0.80 0.006 0.042 AD-45889.1 0.31 0.91 0.013 0.052 AD-45890.1 0.06 0.90 0.001 0.047 AD-45891.1 0.06 0.82 0.007 0.034 AD-45892.1 1.01 1.09 0.033 0.211 AD-45893.1 0.04 0.58 0.002 0.046 AD-45894.1 0.04 0.59 0.003 0.024 AD-45895.1 0.84 1.00 0.047 0.047 AD-45896.1 0.84 0.98 0.032 0.095 AD-45897.1 0.36 0.61 0.032 0.053 AD-45898.1 0.98 1.09 0.021 0.117 AD-45899.1 0.04 0.59 0.005 0.095 AD-45900.1 0.06 0.80 0.005 0.091 AD-45901.1 0.33 0.94 0.025 0.096 AD-45902.1 0.24 1.03 0.010 0.079 AD-45903.1 0.74 1.02 0.003 0.092 AD-45904.1 0.39 0.87 0.010 0.010 AD-45909.1 0.04 0.73 0.008 0.013 AD-45910.1 1.08 1.01 0.037 0.089 AD-45914.1 0.52 0.99 0.018 0.071 AD-45915.1 0.06 0.48 0.004 0.046 AD-45919.1 0.67 0.98 0.048 0.064 AD-45920.1 0.61 1.00 0.031 0.038 AD-45924.1 0.09 0.67 0.005 0.012 AD-45925.1 0.13 0.90 0.008 0.100 AD-45929.1 0.02 0.42 0.001 0.083 AD-45930.1 0.05 0.63 0.005 0.052 AD-45934.1 0.04 0.41 0.001 0.062 AD-45935.1 0.08 0.76 0.006 0.058 AD-45939.1 0.23 0.82 0.030 0.028 AD-1955.1 0.93 0.93 0.068 0.073 AD-1955.1 0.94 1.01 0.028 0.113 AD-1955.1 1.00 1.02 0.032 0.065 AD-1955.1 1.15 1.06 0.053 0.019

[0526] Dose-response screen results for ANGPTL3 dsRNA sequences Experiments were performed using the modified oligonucleotide duplexes listed in Table 3. The sequence of AD-15838.2 is identical to the sequence of AD-15838.1. Hep3B IC 50 24 hours 120 hours Duplex IC 50 I (nM) IC 50 II (nM) IC 50 Weighted (nM) IC 50 I (nM) IC 50 II (nM) IC 50 Weighted (nM) AD-15838.2 0.027 0.006 0.017 0.657 0.937 0.800 AD-45860.1 0.006 0.002 0.004 0.045 0.032 0.039 AD-45864.1 0.002 0.001 0.002 0.046 0.042 0.044 AD-45870.1 0.002 0.001 0.001 0.011 0.008 0.010 AD-45873.1 0.005 0.004 0.005 0.037 0.025 0.031 AD-45876.1 0.032 0.006 0.019 0.269 0.045 0.156 AD-45877.1 0.018 0.012 0.015 1.660 0.538 1.091 AD-45878.1 0.023 0.015 0.019 0.252 0.131 0.190 AD-45879.1 0.002 0.003 0.003 0.023 0.029 0.026 AD-45886.1 0.004 0.004 0.004 0.030 0.018 0.025 AD-45887.1 0.010 0.009 0.010 0.058 0.059 0.059 AD-45915.1 0.016 0.015 0.015 0.110 0.056 0.083 AD-45929.1 0.023 0.008 0.016 0.227 0.025 0.124 AD-45934.1 0.006 0.006 0.006 0.110 0.045 0.077

[0527] [Table 6] Results of the cell viability screen using modified ANGPTL3 dsRNA sequences Experiments were performed using the modified oligonucleotide duplexes listed in Table 3. The sequence of AD-15838.2 is identical to the sequence of AD-15838.1. Viability data are expressed as viability percentage for mock-treated cells.

[0528]

[0529]

[0530]

[0531]

[0532] Non-modified sense and antisense strand sequences of ANGPTL3 GalNac-conjugated dsRNA Duplex ID Sense name Sense sequence (SEQ ID NOS 264-448 in order of appearance) Location at NM_014495.2 Antisense name Antisense sequence (SEQ ID NOS 449-633 in order of appearance) Location at NM_014495.2 AD-53063.1 A-108558.1 AAAGACAACAAACAUUAUAUUx 1066-1086 A-108559.1 AAUAUAAUGUUUGUUGUCUUUCC 1064-1086 AD-52965.1 A-108310.1 ACAAUUAAGCUCCUUCUUUUUx 58-78 A-108311.1 AAAAAGAAGGAGCUUAAUUGUGA 56-78 AD-53030.1 A-108410.1 UGUCACUUGAACUCAACUCAAx 398-418 A-108411.1 UUGAGUUGAGUUCAAGUGACAUA 396-418 AD-52953.1 A-108306.1 UCACAAUUAAGCUCCUUCUUUx 56-76 A-108307.1 AAAGAAGGAGCUUAAUUGUGAAC 54-76 AD-53001.1 A-108416.1 CUUGAACUCAACUCAAAACUUx 403-423 A-108417.1 AAGUUUUGAGUUGAGUUCAAGUG 401-423 AD-53080.1 A-108548.1 CUCCAUAGUGAAGCAAUCUAAx 1014-1034 A-108549.1 UUAGAUUGCUUCACUAUGGAGUA 1012-1034 AD-52971.1 A-108312.1 CAAUUAAGCUCCUUCUUUUUAx 59-79 A-108313.1 UAAAAAGAAGGAGCUUAAUUGUG 57-79 AD-53071.1 A-108498.1 ACCCAGCAACUCUCAAGUUUUx 840-860 A-108499.1 AAAACUUGAGAGUUGCUGGGUCU 838-860 AD-53024.1 A-108408.1 GAAUAUGUCACUUGAACUCAAx 393-413 A-108409.1 UUGAGUUCAAGUGACAUAUUCUU 391-413 AD-52977.1 A-108314.1 AAUUAAGCUCCUUCUUUUUAUx 60-80 A-108315.1 AUAAAAAGAAGGAGCUUAAUUGU 58-80 AD-53064.1 A-108574.1 CAUUAUAUUGAAUAUUCUUUUux 1078-1098 A-108575.1 AAAAGAAUUUCAAUAUAAUGUU 1076-1098 AD-53033.1 A-108458.1 ACUAACUAACUUAAUUCAAAAx 483-503 A-108459.1 UUUUGAAUUAAGUUAGUUAGUUG 481-503 AD-52954.1 A-108322.1 UUAUUGUUCCUCUCUAGUUAUUUx 77-97 A-108323.1 AAAUAACUAGAGGAACAAUAAA 75-97 AD-53098.1 A-108554.1 CAUAGUGAAGCAAUCUAAUUAx 1017-1037 A-108555.1 UAAUUAGAUUGCUUCACUAUGGA 1015-1037 AD-53092.1 A-108552.1 CCUAUGUAAGCAAUCUAAUUx 1016-1036 A-108553.1 AAUUAGAUUGCUUCACUAUGGAG 1014-1036 AD-53073.1 A-108530.1 GAUCACAAAACUUCAAUGAAaX 923-943 A-108531.1 UUUCAUUGAAGUUUUGGAUCCA 921-943 AD-53132.1 A-108628.1 AUGGAAGGUUAAUCUCUAUAAx 1364-1384 A-108629.1 UUAUAGAGUAUAACCUUCCAUUU 1362-1384 AD-53086.1 A-108550.1 UCCAUAGUGAAGCAAUCUAAUx 1015-1035 A-108551.1 AUUAGAUUGCUUCACUAUGGAGU 1013-1035 AD-52961.1 A-108340.1 CUAUGUUAGACGAUGUAAAAx 164-184 A-108341.1 UUUUUACAUCGUCUAACAUAGCA 162-184 AD-52983.1 A-108316.1 AUUAAGCUCCUUCUUUUUUUUUx 61-81 A-108317.1 AAUAAAAAGAAGGAGCUUAAUUG 59-81 AD-53027.1 A-108456.1 AACUAACUAACUUAAUUCAAAx 482-502 A-108457.1 UUUGAAUUAAGUUAGUAUGUUGC 480-502 AD-52986.1 A-108364.1 GGCCAAAUUAAUGACAUAUUUx 247-267 A-108365.1 AAAUAUGUCAUUAAUUUGGCCCU 245-267 AD-52989.1 A-108318.1 UUUUAUUGUUCCUCUAGUUAUx 75-95 A-108319.1 AUAACUAGAGGAACAAUAAAAAG 73-95 AD-52981.1 A-108378.1 ACAUAUUUGAUCAGUCUUUUUx 278-298 A-108379.1 AAAAAAGACUGAUCAAAUAUGUUG 276-298 AD-53077.1 A-108500.1 CCCAGCAACUCUCAAGUUUUUx 841-861 A-108501.1 AAAAACUUGAGAGUUGCUGGUC 839-861 AD-53095.1 A-108506.1 CAGGUAGUCCAUGGACAUUAx 884-904 A-108507.1 UUAAUGUCCAUGGACUACCUGAU 882-904 AD-52970.1 A-108390.1 ACUGAGAAGAACUACACUAUUAAAx 345-365 A-108391.1 UUAUAUGUAGUUCUUCUCAGUUC 343-365 AD-53015.1 A-108452.1 GAGCAACUACUAACUUAAUUx 478-498 A-108453.1 AAUUAAGUUAGUUAGUUGCUCUU 476-498 AD-53147.1 A-108618.1 AACAACCUAAUGGUAAAAUAUx 1282-1302 A-108619.1 AUAUUUACCAUUUAGGUUGUUUU 1280-1302 AD-53103.1 A-108540.1 CCUAGAGAAGAUAUACUCCAUx 999-1019 A-108541.1 AUGGAGUAUAUCUUCUCUAGGCC 997-1019 AD-52969.1 A-108374.1 CAACAUAUUUGAUCAGUCUUUx 276-296 A-108375.1 AAAGACUGAUCAAAUAUGUUGAG 274-296 AD-53075.1 A-108562.1 ACAACAAACAUUAUAUUGAAUx 1070-1090 A-108563.1 AUUCAAUAUAAUGUUUGUGUCU 1068-1090 AD-52994.1 A-108398.1 ACAUAUAACUACAAGUCAAAx 358-378 A-108399.1 UUUGACUUGUAGUUUAUAUGUAG 356-378 AD-52960.1 A-108324.1 CUAGUUAUUUCCUCCUCCAGAAUUx 88-108 A-108325.1 AAUUCUGGAGGAAAUAACUAGAG 86-108 AD-53003.1 A-108448.1 AAGAGCAACUACUAACUUAAx 476-496 A-108449.1 UUAAGUUAGUUAGUUGCUCUUCU 474-496 AD-52995.1 A-108320.1 UUUAUUGUUCCUCUCUAGUUAUUx 76-96 A-108321.1 AAAAACUAGGAAACAAUAAAA 74-96 AD-53037.1 A-108428.1 CUCCUAGAAGAAAAAAUUCUAx 430-450 A-108429.1 UAGAAUUUUUUCUUCUAGGAGGC 428-450 AD-53087.1 A-108566.1 AACAAACAUUAUAUUGAAUAUx 1072-1092 A-108567.1 AUAUUCAAUAUAAUGUUUGUGU 1070-1092 AD-53076.1 A-108578.1 GGAAAUCACGAAACCAACUAUx 1105-1125 A-108579.1 AUAGUUGGUUUCGUGAUUUCCCA 1103-1125 AD-52975.1 A-108376.1 AACAUAUUUGAUCAGUCUUUUx 277-297 A-108377.1 AAAAGACUGAUCAAAUUGUGA 275-297 AD-53138.1 A-108630.1 UGGAAGGUUAAUCUCUAUAAa 1365-1385 A-108631.1 UUUAUAGAGUAUAACCUUCCAUU 1363-1385 AD-53091.1 A-108536.1 GGAGAACUACAAAUAUGGGUUUx 948-968 A-108537.1 AAACCAUAUUUGUAGUUCCUCCCA 946-968 AD-53124.1 A-108594.1 GAAAACAAAGAUUUGGUGUUUux 1174-1194 A-108595.1 AAACACCAAAUCUUUGUUUCCG 1172-1194 AD-53125.1 A-108610.1 AGUGUGGAGAAAAACAACCUAx 1271-1291 A-108611.1 UUAGGUUGUUUUCUCCACACUCA 1269-1291 AD-53036.1 A-108412.1 GUCACUUGAACUCAACUCAAAx 399-419 A-108413.1 UUUGAGUUGAGUUCAAGUGACAU 397-419 AD-53061.1 A-108526.1 GAUGGAUCACAAAACUUCAAUx 919-939 A-108527.1 AUUGAAGUUUUGGAUCCAUCUA 917-939 AD-53093.1 A-108568.1 ACAAACAUUAUAUUGAAUAUUx 1073-1093 A-108569.1 AAUAUUCAAUAUAAUGUUGUUG 1071-1093 AD-53137.1 A-108614.1 UGUGGAGAAAAACAACCUAAAUx 1273-1293 A-108615.1 AUUUAGGUGUUUUCUCCACACU 1271-1293 AD-52999.1 A-108384.1 AUCAGUCUUUUUAUAGAUCUAUx 287-307 A-108385.1 AUAGAUCAUAAAAAGACUGAUCA 285-307 AD-53069.1 A-108560.1 GACAACAAACAUUAUAUUGAAx 1069-1089 A-108561.1 UUCAAUAUAAUGUUUGUGUCUU 1067-1089 AD-53034.1 A-108474.1 CAACAGCAUAGUCAAAUAAAAx 622-642 A-108475.1 UUUUAUUUGACUAUGCUGUUGGU 620-642 AD-52976.1 A-108392.1 CUGAGAAGAAGACUACACUAUAAAAx 346-366 A-108393.1 UUUAUAUUGUAGUUCUUCUCAGUU 344-366 AD-52996.1 A-108336.1 UGCUAUGUUAGACGAUGUAAa 162-182 A-108337.1 UUUACAUCGUCUAACAUAGCAAA 160-182 AD-53029.1 A-108488.1 AACCCACAGAAAUUUCUCUAUx 680-700 A-108489.1 AUAGAGAAAAUUUCUGUGGGGUUCU 678-700 AD-53020.1 A-108438.1 CUUCAACAAAAAGUGAAAUAUx 451-471 A-108439.1 AUAUUUUCACUUUUUGUAAGUA 449-471 AD-53042.1 A-108414.1 UCACUUGAACUCAACUCAAAAx 400-420 A-108415.1 UUUUGAGUUGAGUUCAAGUGACA 398-420 AD-53011.1 A-108482.1 CAUAGUCAAAUAAAGAAAAUAx 628-648 A-108483.1 UAUUUCUUUUAUUUGACUAUGCU 626-648 AD-52957.1 A-108370.1 CAAAAACUCAACAUAUUUGAUx 268-288 A-108371.1 AUCAAAUAUGUUGAGUUUUUGAA 266-288 AD-53008.1 A-108434.1 UACUUCAAAAAGUGAAAUx 449-469 A-108435.1 AUUUCACUUUUUGUUGAAGUAGA 447-469 AD-53065.1 A-108496.1 GACCCAGCAACUCUCAAGUUUx 839-859 A-108497.1 AAACUUGAGAGUUGCUGGUCUG 837-859 AD-53115.1 A-108638.1 UUGAAUGAACUGAGGCAAAUUx 1427-1447 A-108639.1 AAUUUGCCUCAGUUCAUUCAAAG 1425-1447 AD-53012.1 A-108404.1 UAUAAACUACAAGUCAAAAUx 361-381 A-108405.1 AUUUUGACUUGUAGUUUUAAUUG 359-381 AD-53004.1 A-108464.1 AAACAAGAUAAUAGCAUCAAAx 559-579 A-108465.1 UUUGAUGCUAUUAUCUUGUUUUU 557-579 AD-53...

Claims

Claim 1 A double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of ANGPTL3, wherein the dsRNA comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence 5'-AAUAAAAAGAAGGAGCUUAAUUG-3' of SEQ ID NO:468 by 3 nucleotides or fewer, wherein all nucleotides of the sense strand and all nucleotides of the antisense strand comprise nucleotide modifications, and at least one strand is conjugated to a ligand. Claim 2 dsRNA according to claim 1, characterized in that the antisense strand comprises at least 17 consecutive nucleotides that differ from the nucleotide sequence 5'-AAUAAAAAGAAGGAGCUUAAUUG-3' of SEQ ID NO:468 by 3 nucleotides or fewer. Claim 3 dsRNA according to claim 1, characterized in that the antisense strand comprises at least 18 consecutive nucleotides that differ from the nucleotide sequence 5'-AAUAAAAAGAAGGAGCUUAAUUG-3' of SEQ ID NO:468 by 3 nucleotides or fewer. Claim 4 dsRNA according to claim 1, characterized in that the antisense strand comprises at least 18 consecutive nucleotides from the nucleotide sequence 5'-AAUAAAAAGAAGGAGCUUAAUUG-3' of SEQ ID NO:

468. Claim 5 dsRNA according to claim 1, characterized in that the sense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence 5'-AUUAAGCUCCUUCUUUUUAUU-3' of SEQ ID NO:283 by 3 nucleotides or fewer. Claim 6 dsRNA according to claim 1, characterized in that the sense strand comprises at least 17 consecutive nucleotides that differ from the nucleotide sequence 5'-AUUAAGCUCCUUCUUUUUAUU-3' of SEQ ID NO: 283 by 3 nucleotides or fewer. Claim 7 dsRNA according to claim 1, characterized in that the sense strand comprises at least 18 consecutive nucleotides that differ from the nucleotide sequence 5'-AUUAAGCUCCUUCUUUUUAUU-3' of SEQ ID NO: 283 by 3 nucleotides or fewer. Claim 8 dsRNA according to claim 1, characterized in that the sense strand comprises at least 18 consecutive nucleotides from the nucleotide sequence 5'-AUUAAGCUCCUUCUUUUUAUU-3' of SEQ ID NO:

283. Claim 9 The dsRNA of claim 1, wherein at least one of the nucleotide modifications is selected from the group consisting of 2'-O-methyl nucleotide modification, nucleotide modification including a 5'-phosphorothioate group, terminal nucleotide modification linked to a cholesteryl derivative, dodecanoic acid bisdecylamide group modification, 2'-deoxy-2'-fluoronucleotide modification, 2'-deoxy-nucleotide modification, locked nucleotide modification, abasic nucleotide modification, 2'-amino-nucleotide modification, 2'-alkyl-nucleotide modification, morpholino nucleotide modification, phosphoramidate nucleotide modification, and non-natural base modification including a nucleotide. Claim 10 dsRNA according to claim 1, characterized in that all nucleotides include nucleotide modifications selected from the group consisting of 2'-O-methyl nucleotide modifications, 2'-fluoronucleotide modifications, and 2'-deoxy-nucleotide modifications. Claim 11 dsRNA according to claim 1, characterized in that each strand independently has a length of 15 to 30 nucleotides. Claim 12 dsRNA according to claim 11, characterized in that each strand independently has a length of 19 to 25 nucleotides. Claim 13 dsRNA according to claim 1, characterized in that the double-stranded region has a length of 15 to 30 base pairs. Claim 14 dsRNA according to claim 1, characterized in that at least one strand comprises a 3' overhang of at least one nucleotide. Claim 15 dsRNA according to claim 1, characterized in that at least one strand comprises a 3' overhang of at least two nucleotides. Claim 16 The dsRNA according to claim 1, characterized in that the ligand is conjugated to the 3' end of the sense strand of the dsRNA. Claim 17 In claim 1, the ligand is dsRNA characterized by being Claim 18 dsRNA according to claim 1, characterized in that the ligand is conjugated to the dsRNA as illustrated in the following reaction scheme: . Claim 19 The dsRNA according to claim 1, characterized in that the dsRNA further comprises at least one phosphorothioate or methylphosphonate internucleotide bond. Claim 20 In claim 19, the dsRNA is characterized in that the phosphorothioate or methylphosphonate internucleotide bond is located at the 3'-terminus of one strand. Claim 21 In claim 19, the dsRNA is characterized in that the phosphorothioate or methylphosphonate internucleotide bond is located at the 5'-terminus of one strand. Claim 22 In claim 19, the dsRNA is characterized in that the phosphorothioate or methylphosphonate internucleotide bond is located at both the 5'- and 3'- ends of one strand. Claim 23 A double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of angiopoietin-like 3 (ANGPTL3), wherein the dsRNA comprises a sense strand and an antisense strand forming a double-stranded region, each strand independently having a length of 18 to 25 nucleotides, wherein the sense strand comprises at least 18 consecutive nucleotides from the nucleotide sequence 5'-AUUAAGCUCCUUCUUUUUAUU-3' of SEQ ID NO:283, and the antisense strand comprises at least 18 consecutive nucleotides from the nucleotide sequence 5'-AAUAAAAAGAAGGAGCUUAAUUG-3' of SEQ ID NO:468, and all nucleotides of the sense strand and all nucleotides of the antisense strand are nucleotides selected from the group consisting of 2'-O-methylnucleotide modifications, 2'-fluoronucleotide modifications, and 2'-deoxynucleotide modifications. Double-stranded ribonucleic acid (dsRNA), characterized by including a modification and having a ligand comprising an N-acetylgalactosamine (GalNAc) derivative conjugated to the sense strand. Claim 24 A cell comprising dsRNA of any one of claims 1 to 23. Claim 25 A pharmaceutical composition for treating lipid metabolism disorders selected from the group consisting of hypertriglyceridemia, obesity, hyperlipidemia, atheromatous arteriosclerosis, diabetes mellitus, cardiovascular disease, and coronary artery disease in a subject, comprising dsRNA of any one of claims 1 to 23. Claim 26 A pharmaceutical composition according to claim 25, characterized in that the dsRNA is in a buffer solution. Claim 27 A pharmaceutical composition according to claim 25, characterized in that the dsRNA is in a non-buffered solution. Claim 28 Inhibiting ANGPTL3 expression within cells In a test tube A method comprising: (a) contacting the cell with the dsRNA of any one of claims 1 to 23; and (b) maintaining the cell produced in step (a) for a time to obtain degradation of the mRNA transcript of the ANGPTL3 gene, thereby suppressing the expression of the ANGPTL3 gene within the cell. Claim 29 delete Claim 30 delete Claim 31 delete Claim 32 A pharmaceutical composition according to claim 25, characterized in that the disease is hyperlipidemia. Claim 33 A pharmaceutical composition according to claim 25, characterized in that the composition is administered to the subject together with an additional therapeutic agent. Claim 34 A pharmaceutical composition according to claim 33, characterized in that the additional therapeutic agent is a statin. Claim 35 delete Claim 36 A pharmaceutical composition according to claim 25, characterized in that the administration of the dsRNA to the subject results in a reduction of one or more serum lipids. Claim 37 A pharmaceutical composition according to claim 25, characterized in that the administration of the dsRNA to the subject results in a reduction of ANGPTL3 protein accumulation. Claim 38 A pharmaceutical composition according to claim 25, characterized in that the subject is a human subject. Claim 39 delete Claim 40 delete

Citation Information

Patent Citations

  • Carbohydrate conjugates as delivery agents for oligonucleotides

    WO2009073809A2

  • Improved lipid formulation

    WO2010144740A1

  • Monoclonal antibodies against angptl3

    WO2008073300A2