DNA aptamer for colorectal cancer diagnostics

KR103000704B1Active Publication Date: 2026-08-05KONKUK UNIV IND COOP CORP
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
KR1020230150082
Authority / Receiving Office
KR · KR
Patent Type
Patents
Current Assignee / Owner
Filing Date
2023-11-02
Publication Date
2026-08-05
Estimated Expiration
2043-11-02

Smart Images

  • Figure 112023121189876-PAT00003_ABST
    Figure 112023121189876-PAT00003_ABST
Patent Text Reader

Abstract

The present invention relates to a DNA aptamer for diagnosing colorectal cancer, specifically comprising a nucleotide sequence of any one of SEQ ID NOs 4 to 21. The present invention provides a composition for diagnosing colorectal cancer, a kit, and a colorectal cancer-specific drug delivery composition comprising the said aptamer. The aptamer of the present invention exhibits high affinity and specificity for sEVs derived from colorectal cancer cells, and thus can be used for specific and accurate diagnosis of colorectal cancer. It is also expected that it can be utilized to construct new biomarkers for colorectal cancer diagnosis through binding with specific protein biomarkers present on the outer membrane of sEVs.
Need to check novelty before this filing date? Find Prior Art

Description

Technology Field

[0001] The present invention relates to a technology for a DNA aptamer capable of diagnosing colorectal cancer with high heterogeneity characteristics, and is a technology that confirms the possibility of diagnosing colorectal cancer with high affinity and specificity by utilizing an aptamer. Background Technology

[0002] Colorectal cancer (CRC), a threat to global healthcare, is the third most diagnosed cancer worldwide and the second leading cause of cancer death. In 2020, colorectal cancer accounted for 10% of global cancer diagnoses and 9.4% of cancer mortality. The neoplastic progression of colorectal cancer is initiated by a combination of factors, including genetic mutations, epigenetic modifications, and environmental factors, ultimately promoting recurrence and metastasis in various organs, particularly the liver. Colorectal cancer is known to be a difficult cancer to diagnose and treat, particularly due to its high tumor heterogeneity. Despite significant advances in the prevention and control of colorectal cancer, detection and survival prediction remain unsatisfactory due to the lack of specific symptoms and precise biomarkers. Therefore, exploring colorectal cancer-specific biomarkers is crucial for the effective diagnosis of colorectal cancer.

[0003] Meanwhile, small extracellular vesicles (sEVs), also known as exosomes, are nanoscale lipid-membrane-encased vesicles (50–200 nm in diameter) secreted extracellularly from all cell types. sEVs are stable in various bodily fluids such as blood, urine, sweat, and saliva. sEVs transport active biomolecules, such as DNA, RNA, and proteins, to locally and systematically mediate intercellular signaling between originating and receiving cells. In particular, sEVs derived from tumor cells can act as regulators of cancer development, progression, invasion, and metastasis. Increasingly, the potential applications of CRC-derived sEVs have been demonstrated in numerous studies. For example, the expression patterns of sEV microRNA (miRNA), long non-coding RNA (lncRNA), messenger RNA (mRNA), and proteins are upregulated in CRC, which enhances the diagnostic potential of the disease. In addition, candidate sEV biomarkers for CRC prognosis, including metastasis, chemoresistance, and recurrence, were identified. Since sEVs circulating in human body fluids are considered mini-versions of progenitor cells, non-invasive diagnosis of colorectal cancer is possible. Consequently, there is increasing research interest in utilizing sEVs as a promising tool for diagnostic and therapeutic applications. In particular, it is crucial to distinguish between sEVs derived from colorectal cancer and sEVs derived from the serum of healthy individuals, the exact origin of which is difficult to determine.

[0004] Furthermore, aptamers, which are single-stranded DNA or RNA capable of binding to specific targets, are receiving significant attention in the development of diagnostics and therapeutics as well as biomarker discovery due to their outstanding advantages, such as high stability, small size, ease of synthesis and modification, low immunogenicity, and high binding affinity and specificity. Aptamers are generally screened through an iterative in vitro selection process known as the systematic evolution of ligands by SELEX (Systematic Evolution of Ligands by Exponential Enrichment). A major advantage of SELEX is that aptamers can be obtained from any biological entity that maintains its natural form, such as cells, tissues, and in vivo models, without prior knowledge of the target.

[0005] Accordingly, the inventors of the present invention found a DNA aptamer with high binding affinity to colorectal cancer sEVs capable of diagnosing colorectal cancer, and developed a highly sensitive biosensor using the aptamer, thereby completing the present invention. The problem to be solved

[0006] The object of the present invention is to provide one or more DNA aptamers for diagnosing colorectal cancer selected from the group consisting of the nucleotide sequences of SEQ ID NOs 4 to 21.

[0007] Another objective of the present invention is to provide a colorectal cancer diagnostic composition, a kit, and a colorectal cancer-specific drug delivery composition comprising the aptamer.

[0008] Another objective of the present invention is to provide a method for manufacturing the aptamer, a method for providing information for diagnosing colorectal cancer using the aptamer, and a method for detecting colorectal cancer sEVs-specific surface biomarkers.

[0009] However, the technical problems that the present invention aims to solve are not limited to those mentioned above, and other unmentioned problems will be clearly understood by those skilled in the art from the description below. means of solving the problem

[0010] The inventors constructed Colorectal Cancer Toggle sEV-SELEX (hereinafter TEV-SELEX) to generate high-quality aptamers specific to three types of colorectal cancer cells (SW620, LS 174T, HT29). TEV-SELEX was constructed by running a total of eight loops, with each loop consisting of three consecutive positive screenings and one counter-screening. Based on NGS results, the top 10 aptamer candidates with the highest frequency (%) were selected, and their binding affinities were evaluated using the Enzyme-linked oligonucleotide assay (ELONA) method. Finally, the optimal aptamer was obtained through post-SELEX optimization, which yielded Kd values ​​of 3.848 nM, 5.904 nM, and 5.234 nM for SW620, LS 174T, and HT29 cells, respectively, and 3.6 x 10⁻¹⁴ for each. 2 Particles / μL, 3.5 x 10⁻⁶ 3 Particles / μL, 8.4 x 10 2 A detection limit of particles / μL was derived, confirming that it has sufficient sensitivity to detect sEVs derived from colorectal cancer cells within the serum or plasma concentration range. In addition, it showed high specificity for non-target sEVs (e.g., sEVs derived from healthy serum and sEVs derived from normal colon cells) and effectively distinguished highly heterogeneous sEVs derived from colorectal cancer cells.

[0011] Accordingly, the present invention provides one or more DNA aptamers for diagnosing colorectal cancer selected from the group consisting of the nucleotide sequences of SEQ ID NOs. 4 to 21.

[0012] In the present invention, "sEV (small extracellular vesicle)" refers to a small extracellular vesicle and is a concept that includes sEVs.

[0013] In this invention, colorectal cancer is used interchangeably with "colorectal cancer," "Colorectal cancer," and "CRC."

[0014] In the present invention, "DNA aptamer" refers to a single-stranded oligonucleotide having a unique three-dimensional structure and having the characteristic of binding to a target with high affinity and specificity. Through repeated in vitro screening and concentration processes, it is possible to select DNA molecules that specifically bind to a target, i.e., DNA aptamers, from a DNA aptamer library.

[0015] In the present invention, "diagnosis" means confirming the existence or characteristics of a pathological condition. The diagnosis in the present invention is to confirm the presence or occurrence of colorectal cancer using DNA aptamers.

[0016] In one aspect of the present disclosure, a DNA aptamer having 90% or more sequence homology with the base sequences of SEQ ID NOs. 4 to 21 may be included, and "base sequence having 90% or more sequence homology" means a base sequence having 90% or more or less than 100% commonality with one or more nucleotides, and exhibiting similar cancer-specific binding ability.

[0017] In the present invention, the aptamer can specifically bind to sEVs derived from colorectal cancer cells. In one embodiment of the present invention, sEVs were isolated from a positive target and a counter target, and it was confirmed that when the DNA aptamer of the present invention was used, it did not have binding affinity to sEVs derived from serum and normal colon cells, which are counter targets, but specifically bound only to sEVs derived from various colorectal cancer cells.

[0018] The aptamer of the present invention may further include a forward primer sequence or a reverse primer sequence.

[0019] In the present invention, "primer" refers to a short nucleic acid sequence having a short free 3' hydroxyl group, capable of forming base pairs with a complementary template, and functioning as a starting point for template replication. In the present invention, colorectal cancer can be diagnosed by performing PCR amplification using the forward and reverse primers of the aforementioned DNA aptamer. The PCR conditions and the lengths of the forward and reverse primers can be modified based on those known in the art. For example, the sequence of the forward primer may consist of the nucleotide sequence of SEQ ID NO. 2, and the sequence of the reverse primer may consist of the nucleotide sequence of SEQ ID NO. 3, but is not limited thereto.

[0020] In a specific embodiment, the primer regions were used for PCR amplification by including a forward primer in the 5' portion and a reverse primer region in the 3' portion of the aptamer sequence in the ssDNA library during the TEV-SELEX process. It is obvious to a person skilled in the art that primer regions can be combined in the 5' and 3' portions for PCR amplification.

[0022] In one embodiment, the DNA aptamer may consist of the nucleotide sequence of SEQ ID NO. 18. In a specific embodiment, the top 10 candidate aptamers with the highest frequency (%) after SELEX were selected, and aptamers with high binding affinity and specificity were chosen. As a result, as shown in FIG. 4, T6 had the highest affinity for sEVs. Subsequently, the T6 aptamer sequence was optimized. Thus, as shown in [Table 4], the sequences T6F T6R T6FR T6RA T6RB T6RB1 T6RB2 T6RB3 were used.

[0023] As with the nucleotide sequence of SEQ ID NO. 9 of the present invention, the T6 DNA aptamer may be composed of a forward primer nucleotide sequence and a reverse primer nucleotide sequence linked together. However, according to the present invention, a DNA aptamer composed of the nucleotide sequence of SEQ ID NO. 18, from which the reverse primer and additional sequences have been removed, exhibited the highest affinity for three types of colorectal cancer cell-derived sEVs. Additionally, when evaluating the binding affinity of the DNA aptamer, the binding dissociation constant may be 3 to 6 nM, and preferably 3.8 to 5.9 nM.

[0025] The present invention also provides a composition for diagnosing colorectal cancer comprising the above-mentioned aptamer.

[0026] In the present invention, the composition may further include physiologically acceptable excipients, carriers, or additives, such as starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, lactose, mannitol, malt syrup, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, carnauba wax, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, calcium stearate, sucrose, dextrose, sorbitol, and talc, but are not limited thereto.

[0027] In another embodiment of the present invention, it was confirmed that when using a composition containing the DNA aptamer, it hardly binds to normal serum or normal colon cell lines other than colorectal cancer cell lines, thereby specifically detecting various colorectal cancer cell lines.

[0029] The present invention also provides a colorectal cancer diagnostic kit comprising the above composition.

[0030] In one embodiment, it may be provided in the form of a colorectal cancer diagnostic kit containing an aptamer that specifically binds to colorectal cancer-derived sEVs. This colorectal cancer diagnostic kit may include, as needed, a buffer solution and containers for performing detection and analysis, which may take the form of a bottle, tub, sachet, envelope, tube, ampoule, etc., and may be formed partially or wholly from plastic, glass, paper, foil, wax, etc. The container may be fitted with a cap that is initially part of the container or can be attached to the container by mechanical, adhesive, or other means and is fully or partially detachable. The container may also be fitted with a stopper that allows access to the contents by a needle. The kit may include an outer package, which may include instructions for the use of the components.

[0031] The above kit may be a diagnostic sensor, an RT-PCR kit, a competitive RT-PCR kit, a real-time RT-PCR kit, a DNA chip kit, and a protein chip kit.

[0032] The kit of the present invention may include a composition, solution, or device comprising a primer and probe that recognize the DNA aptamer, as well as one or more other components suitable for an analysis method.

[0033] For example, the DNA aptamer that specifically binds to the colorectal cancer-derived sEVs can be used for colorectal cancer diagnosis by being immobilized on a conventional support such as a bead, particle, dipstick, fiber, filter, membrane, and glass slide, and on a solid support such as a silane or silicate support, and thus provided as a detection sensor. The present invention may be a colorectal cancer diagnostic sensor having the DNA aptamer that specifically binds to the colorectal cancer-derived sEVs immobilized thereon.

[0034] The solid support comprises at least one substantially hard surface, on which the DNA aptamers can be immobilized. In this case, the DNA aptamers can be immobilized by any conventional chemical coupling method. For example, biotin can be attached to the ends of the DNA aptamers to form a complex, and streptavidin can be immobilized on the surface of a substrate such as a chip, thereby immobilizing the DNA aptamers on the substrate surface through the interaction between the biotin and the streptavidin immobilized on the substrate surface.

[0035] In addition, various methods may be applied to the above kit as signal generation methods for detecting DNA aptamers bound to colorectal cancer sEVs. Examples include colorimetry, fluorescence, and electrochemistry, but are not limited thereto; any method that can be implemented through a labeling method suitable for each signal generation may be used without limitation.

[0036] Meanwhile, in one aspect of the present disclosure, DNA aptamers may be administered to a subject in various forms according to a selected route of administration as understood by a person skilled in the art through the aforementioned itself, composition, or kit. For example, they may be administered by topical, enteral, or parenteral application. Topical application includes, but is not limited to, application through the epidermis, inhalation, enema, ophthalmic drops, ear drops, and mucous membranes within the body. Enteral application may include oral administration, rectal administration, vaginal administration, and gastric feeding tubes, etc. Parenteral administration may include intravenous, intra-arterial, intracapsular, intraorbital, intracardiac, intradermal, transtubercular, subcutaneous, intra-articular, subcapsular, subarachnoid, intraspinal, epidural, intrasternal, intraperitoneal, subcutaneous, intramuscular, transepithelial, nasal, intrapulmonary, intrathecal, rectal, and local administration methods.

[0037] In addition, in one aspect of the present disclosure, the DNA aptamer itself, the composition, or the kit may be formulated into an appropriate form depending on the route of administration, etc. When formulating, it may be prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc., but is not limited thereto.

[0038] The present invention also provides a method for producing the DNA aptamer.

[0039] Specifically, the above method

[0040] a) Step to generate a random library;

[0041] b) Step to perform TEV-SELEX;

[0042] c) a step of analyzing DNA aptamer sequences using NGS techniques; and

[0043] d) Step of characterizing DNA aptamers;

[0044] It may include.

[0045] In addition, regarding the method for manufacturing DNA aptamers, the aptamers can specifically bind to sEVs derived from colorectal cancer cells, but this is omitted to avoid duplication as previously described in the description of DNA aptamers.

[0046] The present invention also provides a method for providing information for diagnosing colorectal cancer using the DNA aptamer.

[0047] The present invention provides a method for detecting colorectal cancer sEVs-specific surface biomarkers using the aptamer.

[0048] At this time, the above method may include the step of contacting the DNA aptamer with a sample such as colon tissue, colon cells, blood, serum, plasma, saliva, sputum, and urine. The sample may be isolated from mammals, preferably the human body, and may be a sample or secretory fluid, in vitro cell culture medium component sample, etc., which can be obtained through minimal invasiveness, but preferably may be sEVs derived from colon cancer cells, and it is obvious that the sample is not limited to the above, provided it may contain a colon cancer marker.

[0049] Specifically, when the DNA aptamer is brought into contact with a sample, a specific binding occurs between the DNA aptamer and a marker present in sEVs derived from colorectal cancer cells present in the sample. Therefore, by labeling the DNA aptamer with fluorescence or the like to bind it and then confirming the presence or absence of a signal, colorectal cancer can be detected.

[0050] Since colorectal cancer biomarkers can be isolated through the analysis of substances bound to the DNA aptamer in a sample, the present invention can be used for the detection of colorectal cancer cell-specific surface biomarkers using the DNA aptamer.

[0052] The present invention also provides a colorectal cancer-specific drug delivery composition comprising the aptamer. Since it is a known fact in the technical field to which the present invention belongs that an aptamer specifically binds to sEVs derived from colorectal cancer cells and inhibits the progression of cancer through sEVs, thereby being used for the treatment of colorectal cancer, it is obvious to those skilled in the art in the technical field to which the present invention belongs that a composition containing the aptamer according to the present invention can be provided as a composition for the treatment of colorectal cancer, as the aptamer specifically binds to sEVs derived from colorectal cancer cells and inhibits the mechanism of colorectal cancer progression.

[0053] In addition, by attaching the aptamer to the surface of a liposome or nanoparticle, anticancer agents, toxins, cancer growth inhibitory genes, siRNA (small interfering RNA), etc., loaded inside the liposome or nanoparticle can be selectively delivered to sEVs derived from colorectal cancer cells. Furthermore, known colorectal cancer-specific drugs, toxins and anticancer agents that induce cancer cell death, or known suicide genes such as Herpes simplex virus thymidine kinase (HSV-TK) and cytosine deaminase (CD), or siRNA (small interfering RNA) that inhibits the expression of genes that play an important role in colorectal cancer growth and metastasis can be directly attached to the aptamer according to the present invention and delivered to sEVs derived from colorectal cancer cells, and the present invention can be provided in the form of a colorectal cancer-specific drug delivery composition containing the above DNA aptamer. Effects of the invention

[0054] According to the present invention, an aptamer that specifically binds only to sEVs derived from various colorectal cancer cells can be used for the diagnosis of highly heterogeneous colorectal cancer. Brief explanation of the drawing

[0055] Figure 1 shows the characterization of isolated sEVs. Figure 1 (A) shows the NTA results for SW620 sEV (inset: cryo-TEM image), Figure 1 (B) shows the NTA results for LS 174T sEV (inset: cryo-TEM image), Figure 1 (C) shows the NTA results for HT29 sEV (inset: cryo-TEM image), and Figure 1 (D) shows the NTA results for HS sEV (inset: cryo-TEM image). Figure 1 (E) shows the Western blot analysis results for CD63, Hsp90α, and Calnexin expression, with a scale bar of 100 nm for each cryo-TEM image. FIG. 2 shows the workflow of Toggle sEV-SELEX (CRC TEV-SELEX) performed according to one embodiment of the present invention. Figure 3 shows the TEV-SELEX monitoring results. Figure 3 (A) is the amplification curve, Figure 3 (B) is the ratio of the 20th cycle fluorescence intensity (F20th) to the Fmax maximum fluorescence intensity to estimate the degree of homogeneity of ssDNA from the random library (Lib) and loops 1 through 8 (F20th). 20th / F max ) represents, and (C) of Fig. 3 is the melt analysis curve. In Fig. 3, all bars represent the mean ± SD (n=3). Figure 4 is the result of the binding affinity analysis of the top 10 candidate aptamers (T1 to T10) selected according to the present invention. Figure 5 shows the results of the binding affinity analysis of aptamer candidates according to the present invention. Figure 5 (A) shows the binding affinity of T6 and its derivative sequences (T6F, T6R, and T6FR), and Figures 5 (B) to (D) show the binding affinity along with the ratio of T6 and its derivative sequences to positive targets (SW620, LS 174T, HT29) relative to counter-targets (HS). FIG. 6 shows the structural schematics and binding affinities of aptamers and their derived sequences according to the present invention. FIG. 6 (A) and (B) show the structure and binding affinity of T6R and its truncated derived sequences (T6RA, T6RB), and FIG. 6 (C) and (D) show the structure and binding affinity of T6RB and its truncated derived sequences (T6RB1, T6RB2, T6RB3). Figure 7 shows the evaluation results of the optimal aptamer, T6RB. Figure 7 (A) T6RB dissociation constant ( K d ) curve and its values, Fig. 7 (B) shows potassium ions (K +Figure 7 (C) shows the circular dichroism (CD) spectrum of T6RB in the absence / presence of K+, Figure 7 (D) shows the fluorescence intensity (FI) of NMM bound to T6RB in the absence / presence of K+, and Figure 7 (D) shows the results of biomarker topology analysis. Figure 8 shows the results of parameter optimization for the TSA reaction. Figure 8 (A) shows the aptamer concentration, Figure 8 (B) shows the biotin-tiramide (b-tiramide) concentration, Figure 8 (C) shows the H2O2 concentration, and Figure 8 (D) shows the optimization results according to the TSA reaction time. Figure 9 shows the evaluation results of the T6RB aptamer. In Figure 9, ELONA and ELONA loaded with TSA were compared and analyzed. Figure 10 shows the results of confirming CRC sEV detection by TSA under optimized conditions. Figure 10 (A) shows the sensitivity of SW620 sEV, Figure 10 (B) shows the sensitivity of LS 174T sEV, Figure 10 (C) shows the sensitivity of HT29 sEV, and Figure 10 (D) shows the specificity of T6RB for CRC, HS, and sEV derived from normal colon. Specific details for implementing the invention

[0056] The structure and effects of the present invention will be explained in more detail below through examples. These examples are solely for the purpose of illustrating the present invention, and the scope of the present invention is not limited by these examples.

[0058] [Preparation Example]

[0059] cell culture

[0060] SW620 (human colorectal cancer), LS 174T (human colorectal cancer), HT29 (human colorectal cancer), and CCD-18Co (human normal colon) cell lines were obtained from the Korean Cell Line Bank (KCLB). SW620, LS 174T, HT29, and CCD-18Co cells were cultured in DMEM (Welgene, Gyeongsan, Korea). All cell lines were cultured in their respective media supplemented with 10% (v / v) FBS (Gibco; Thermo Fisher Scientific, Waltham, MA, USA) and 1% (v / v) penicillin-streptomycin (Welgene) under humid conditions of 37°C and 5% CO2.

[0062] Separation of sEVs (small extracellular vesicles)

[0063] At approximately 80% confluence, cells were replaced with conditioned medium supplemented with 5% (v / v) sEVs-depleted FBS (Gibco; Thermo Fisher Scientific) and 1% (v / v) penicillin-streptomycin, and cultured for 48 hours in a 5% CO2 incubator under humidified conditions at 37°C. The conditioned medium containing secreted sEVs was recovered, and the sEVs were concentrated, isolated, and purified for further use. The conditioned medium was first subjected to a series of centrifugations at 300 xg for 5 minutes, 2,000 xg for 20 minutes, and 10,000 xg for 30 minutes to remove cells, cell debris, microvesicles, and apoptotic cells, respectively. Subsequently, the supernatant was sequentially syringe-filtered using filters with pore sizes of 0.45 and 0.22 μm (Sartorius, Gφttingen, Germany) to exclude extracellular vesicles larger than 200 nm. For concentration and purification, a tangential flow filtration system equipped with a 300K membrane (Pall Corporation, New York, NY, USA) was used until the medium was concentrated to the desired volume. Next, the concentrated medium was subjected to size exclusion chromatography using a qEV10 / 35 nm column on an automated qEV fraction collector (Izon Science, Christchurch, NZ) to separate sEVs with high yield and purity. Subsequently, the fraction containing sEVs from SEC was pooled and centrifuged again at 5,000 xg for 20 minutes in a Macrosep (Pall Corporation) with a 3K membrane to further concentrate the sEVs, and then stored at -80°C until use in PBS. All centrifugation steps were performed at 4°C to ensure the stability of the sEVs.sEVs were isolated from human serum (HS) (Sigma-Aldrich, St Louis, MO, USA) in the same manner as described above, except that they were diluted with 1X PBS before a series of centrifugations.

[0065] Characterization of SW620 and HS-derived sEVs (small extracellular vesicles; hereinafter sEVs)

[0066] The integrity and sEV markers of sEVs isolated from SW620, LS174T, HT29 (positive target) cells and healthy human serum (HS, counter target) were evaluated using NTA, cryo-TEM, and Western blot analysis.

[0068] Nanoparticle Trace Analysis (NTA)

[0069] In this example, the concentration and size of small extracellular vesicle (sEV) samples were determined using a MONO Zetaview (PMX-130, Particle Metrix, Bavaria, Germany) in light scatter mode. Prior to NTA analysis of the samples, the instrument was calibrated using 100 nm polystyrene standard beads (diluted 1:250,000 in deionized water). Before applying the sEV samples to the instrument for measurement, 4–6 x 10⁶ samples were prepared using 1x PBS. 7 The samples were diluted to particles / mL. For all samples, the detailed parameters for NTA analysis were consistently set to a minimum brightness of 30, sensitivity of 80, shutter of 100, and cell temperature of 23℃. The data from this experiment were analyzed using ZetaView. The deionized water and PBS used for analysis were filtered through a 0.1μm syringe filter membrane for optimal measurement.

[0071] Cryo-TEM

[0072] To analyze the size and morphology of the sEV samples, the samples were applied to a Cryo-TEM instrument. A carbon-coated copper grid (200 mesh; Quantifoil, Großlφbichau, Germany) was first made hydrophilic by glow-discharge, and each sEV sample (3 μL) was applied. Subsequently, using a Thermo Scientific Vitrobot (Thermo Fisher Scientific), the samples were placed in liquid ethane and maintained with liquid nitrogen, then transferred to a cryoholder that continuously maintained the temperature at approximately -180°C using liquid nitrogen for vitrification. Cryo-TEM images were acquired at 25 kV using a JEM-2100 PLUS electron microscope (JEOL, Tokyo, Japan) coupled with a CMOS camera.

[0073] FIGS. 1(A) to FIGS. 1(D) show the characteristics of sEVs analyzed according to the present embodiment. FIG. 1(A) shows the NTA results for SW620 sEV (inset: cryo-TEM image), FIG. 1(B) shows the NTA results for LS 174T sEV (inset: cryo-TEM image), FIG. 1(C) shows the NTA results for HT29 sEV (inset: cryo-TEM image), and FIG. 1(D) shows the NTA results for HS sEV (inset: cryo-TEM image). In each cryo-TEM image, the scale bar is 100 nm.

[0075] Western blotting

[0076] According to the manufacturer's instructions, equal volumes of SW620, LS 174T, HT29 cells, and HS-derived sEVs were concentrated using a qEV concentration kit (Izon Science). Each sample was supplemented with 5x SDS-PAGE loading buffer (Biosesang, Seongnam, Republic of Korea), heated at 95°C for 10 minutes, and dissolved in a 10% TGX stain-free protein gel (Bio-Rad Laboratories, Hercules, CA, USA) at 300V for 20 minutes using a Mini-Protean tetra system (Bio-Rad Laboratories). The dissolved proteins were transferred to a 0.2 μm PVDF membrane (Bio-Rad Laboratories) using a Trans-Blot Turbo Transfer System (Bio-Rad Laboratories) according to the manufacturer's instructions. The membrane was blanked with a 5% BSA TBST solution dissolved in 0.1% TBST (1x TBS containing 0.1% Tween-20), incubated overnight at 4°C with primary antibodies [mouse anti-CD63 (Santa Cruz, Dallas, TX, USA), rabbit anti-Hsp90α and rabbit anti-calnexin (ABclonal, Woburn, MA, USA), 1:1,000] Can Get Signal solution 1 (Toyobo, New York, NY, USA), and then washed three times with 0.1% TBST. Then, the membrane was incubated at room temperature for 1 hour with the corresponding HRP-conjugated secondary antibodies [HRP goat anti-rabbit IgG (ABclonal), 1:10,000 and HRP goat anti-mouse IgG (Biolegend, San Diego, CA, USA), 1:5000] diluted in Can Get Signal Solution 2 (Toyobo), and washed 4 times with 0.1% TBST.Proteins in the membrane were visualized using the Clarity Western ECL substrate (Bio-Rad Laboratories) in the ChemiDoc Imaging System (Bio-Rad Laboratories).

[0077] As a result, as shown in Figures 1 (A) to (D), SW620 sEV, LS 174T sEV, HT29 sEV, and HS sEV were approximately 100 nm to 150 nm in size, which was consistent with values ​​obtained using cryo-TEM. Furthermore, sEVs derived from SW620, LS 174T, HT29, and HS all exhibited a circular morphology and were within a size range consistent with previous literature, confirming that the sEVs were effectively isolated using the SEC method. Additionally, the Western blot image shown in Figure 1 (E) confirmed that the isolated sEVs were positive for CD63 and Hsp90α, which are well-known sEV biomarkers, and negative for calnexin, a marker for the endoplasmic reticulum (ER) membrane. Through all these analyses, it was confirmed that the isolated sEVs are suitable targets for E-SELEX.

[0079] In vitro selection of aptamers for SW620-derived sEVs

[0080] As can be seen in Figure 2, an important step of TEV-SELEX is to efficiently separate the pool of bound aptamers from the pool of unbound aptamers. To this end, an immunoplate was used as an easy target sEV immobilization platform that can not only maintain the integrity of biologically active sEVs but also facilitate the selection of high-quality aptamers of diagnostic value.

[0082] Toggle sEV-SELEX(TEV-SELEX)

[0083] All oligonucleotides used were synthesized by Integrated DNA Technologies (IDT; Coralville, IA, USA). The DNA types included in the DNA library and the types of forward and reverse primers used are as shown in Table 1 below.

[0084] Sequence (5'→3') Sequence number Random library ATCCAGAGTGACGCAGCA- N 40 -CTGGCTCGAACAAGCTTGC 1 Forward primer ATCCAGAGTGACGCAGCA 2 Reverse primer GCAAGCTTGTTCGAGCCAG 3

[0086] A random library was designed with a central random region of 40 nucleotides (N40) between the two terminal primer regions used in the PCR amplification step.

[0087] Three different types of CRC cells (SW620, LS 174T, HT29) and sEVs derived from HS were used as positive and counter-targets, respectively, and TEV-SELEX was performed using a known method with slight modifications.

[0088] Throughout the TEV-SELEX process, negative screening was performed initially to remove ssDNA binding to BSA or the maxi-binding immune plate itself (SPL Life Sciences, Pocheon, Republic of Korea). Before incubation with target sEVs, an initial single-stranded DNA (ssDNA) library (100 nM) dissolved in binding buffer (DPBS containing BB, 1 g / L BSA, 5 mM MgCl2, and 0.5 mg / mL salmon sperm ssDNA) was denatured at 95°C for 5 minutes and rapidly cooled on ice for 10 minutes.

[0089] Negative selection was performed first to remove ssDNA potentially bound to BSA and immune plates. A 1 g / L BSA solution was inoculated into immune plates and incubated at 37°C for 2 hours. After washing three times with wash buffer (WB; DPBS with 5 mM MgCl2) at a shaker (500 rpm) for 30 seconds each, the prepared ssDNA library was added and incubated for 1 hour. Subsequently, the supernatant containing unbound ssDNA was recovered and concentrated using Nucleospin Gel and PCR clean-up (Macherey-Nagel, Duren, Germany) according to the manufacturer's instructions.

[0090] Then, the recovered ssDNA was amplified using asymmetric PCR (Asy-PCR) with different primer concentration ratios. Briefly, a mixed buffer for the Asy-PCR reaction (Enzynomics, Daejeon, South Korea) was prepared containing 0.2 mM dNTPs, ssDNA templates recovered from each selection, high-fidelity nPfu-forte DNA polymerase, and a forward-to-reverse primer ratio of 20:1 at 1x nPfu-forte.

[0091] The thermal cycling protocol was set as follows: initial denaturation at 95°C for 3 minutes, followed by 20 cycles of denaturation at 95°C for 10 seconds, annealing at 68°C for 1 minute, and final extension at 68°C for 5 minutes. Next, the Asy-PCR product was separated on a 2.5% agarose gel, and the ssDNA band was extracted and purified using Nucleospin gel and PCR clean-up.

[0092] For positive selection, each positive target (sEV, 20 μg / mL) was incubated in an immunoplate at 37°C for 2 hours and then washed with WB (3 times). Subsequently, ssDNA obtained from negative selection was added to wells, incubated at 37°C for 1 hour, and washed with WB (3 times) to remove unbound ssDNA. Next, samples from each well were suspended in BB and heated to 95°C for 10 minutes to recover ssDNA bound to sEV, and then processed as previously described.

[0093] Counterselection relying on the incubation of HS-derived sEVs with an ssDNA pool was also performed in the same manner as negative selection to remove ssDNA binding to normal serum sEVs. To obtain an ssDNA pool with high binding affinity and specificity only for positive target sEVs, the process was carried out under strict conditions in each TEV-SELEX loop (Table 2 below).

[0094] Strict conditions for TEV-SELEX Positive selection Voice selection Incubation time 1 hour (1 st -2 nd ) * 45 mins (3 rd -4 th )30 minutes (5-6 th )20 mins (7-8 th ) 1 h (1 st -2 nd )1.25 h (3 rd -4 th )1.5 h (5-6 th )2 h (7-8 th ) Washing (30 s, 500 rpm) 3 X (1 st -2 nd )5 X (3 rd -4 th )7 X (5-6 th )9 X (7-8 th ) No washing required Competitor (Salmon sperm DNA) 0.5 mg / ml (2 nd -8 th )

[0095] * The numbers inside () represent the loop order in TEV-SELEX.

[0097] In the TEV-SELEX procedure (Fig. 2), negative selection was performed to remove non-target single-stranded DNA (ssDNA) that binds non-specifically to components of the buffer and / or the immune plate itself. The unbound ssDNA obtained from negative selection was enhanced for further selection involving three E-SELEX loops, where each loop (SW620 sEV, LS 174T sEV, HT29 sEV, HS sEV; 1 in order) st -8 thThe loop involved three consecutive positive screenings and one counter-screen. Considering the highly heterogeneous nature of colorectal cancer, three types of CRC cell-derived sEVs—SW620, LS 174T, and HT29—were selected as positive targets, while HS-derived sEVs were determined as counter-targets to establish a clinical environment for potential in vivo applications. The loop was repeated a total of eight times, during which stricter conditions were progressively increased to improve the binding affinity and specificity of the aptamers (Table 2). Furthermore, the entire process of TEV-SELEX was simplified by performing ssDNA amplification and generation in a single step using Asy-PCR, which does not require biotin or phosphate group conjugation for magnetic separation, enzymatic digestion, or additional NaOH treatment.

[0098] Another important consideration for the success of TEV-SELEX is determining the number of loops to be performed by monitoring the TEV-SELEX procedure. qPCR can study DNA pools of various sequences and provides important information regarding the homogeneity of ssDNA recovered via TEV-SELEX in terms of ssDNA pool diversity. Each loop (1 st -8 th The number of loops was determined by analyzing the ssDNA obtained from ) using qPCR.

[0100] Quantitative Polymerase Chain Reaction (qPCR)

[0101] Selection efficiency during TEV-SELEX was evaluated using qPCR. A final concentration 1X qPCR buffer from TOPreal qPCR premix (Enzynomics) was mixed with the ssDNA templates recovered from each selection. qPCR was performed on a CFX Connect Real-Time PCR detection system (Bio-Rad Laboratories) using the following thermal cycling parameters: initial denaturation (activation) at 95°C for 15 minutes, followed by 20 cycles of denaturation at 95°C for 10 seconds, annealing at 60°C for 15 seconds, and extension at 72°C for 15 seconds. This was followed by melting temperature (Tm) analysis while gradually increasing the temperature from 55°C to 95°C at an incremental rate of 0.5°C. The qPCR amplification curves and Tm were analyzed using CFX Maestro Software (Bio-Rad Laboratories).

[0102] The initial ssDNA library is highly sequence-heterogeneous due to a 40-nucleotide random region. However, heterogeneity will be reduced as a continuous, repetitive selection process will be performed to select an aptamer pool that specifically binds to the target. This expected behavior was demonstrated through changes in the amplification and melting curves (Fig. 3). In Fig. 3 (A), the amplification of the random library (red line; Lib) shows an initial increase reaching maximum fluorescence intensity; however, while the primer region undergoes complete hybridization, the central random region undergoes partial non-complementary hybridization, resulting in a sharp decline in fluorescence due to the formation of unstable heteroduplexes. These results indicate that the low melting temperature (Tm) of 68.5°C in Fig. 3 (C) corresponds well with the instability of the heteroduplexes. In contrast, the repetitive loops of TEV-SELEX enriched the specific ssDNA pool that binds with high binding affinity, thereby increasing homogeneity. Therefore, 8 thThe ssDNA obtained after the loop (light pink line) exhibited a normal exponential curve with an extreme stable phase during qPCR, and the Tm peak shifted completely from a low temperature to a higher temperature of 81.5°C. This indicates a significant increase in the proportion of highly stable homoduplexes.

[0103] In addition, to estimate the degree of homogeneity, the last cycle (20) for maximum fluorescence intensity in the final qPCR cycle th The amplification curve was quantitatively analyzed by calculating the ratio of fluorescence intensities. In this study, a ratio higher than 0.95 was considered the stable phase of amplification and was sufficient to ensure high homogeneity in the ssDNA library. In Figure 3 (B), the random ssDNA library (Lib) shows a low ratio, reflecting significant heterogeneity, but the ratio increases as the TEV-SELEX loop is continuously repeated. 8 th Only the -loop (light pink line) showed a fluorescence ratio greater than 0.95, indicating that due to increased ssDNA homogeneity, 8 th - It proved that the loop reached a stable phase in amplification.

[0104] All these results of qPCR monitoring are 8 th It was shown that the -loop is optimal for achieving maximum enrichment of the ssDNA pool. Therefore, 8 th The ssDNA obtained from the loop was applied to NGS analysis.

[0106] Candidate Aptamer Evaluation

[0107] The ssDNA obtained from the 8th cycle of Example 2 above was analyzed by NGS, and the top 10 candidate aptamers were selected based on frequency (%) and further evaluation was performed.

[0109] Next-generation sequencing (NGS)

[0110] Final loop of TEV-SELEX (8 thdsDNA was generated by symmetrically PCR amplifying the ssDNA pool concentrated in ) using primers, digested on an agarose gel (2.5%), and purified using Nucleospin Gel and PCR clean-up (Macherey-Nagel). Finally, the purified dsDNA was processed to analyze the sequences of candidate aptamers via next-generation sequencing (NGS), which was performed by a sequencing company (Clinomics, Ulsan, Republic of Korea).

[0111] Purified dsDNA was fragmented with Frag enzyme (MGI, Shenzhen, China) for Paired-End (PE) 150 sequencing according to the manufacturer's instructions (MGI FS DNA Library Preparation Set). The fragmented DNA was further selected between 300 and 500 bp by DNA Clean Beads (MGI), then recovered to generate blunt ends and modified to have a single adenosine residue at the 3' end. Adapter sequences containing a single thymine residue at the 5' end were ligated to both ends of the DNA fragments. The ligation products were then amplified for 7 cycles and subjected to the following single-strand cycling process:

[0112] Briefly, the PCR product was heat-denatured with a specific inverse complement molecule, a single-stranded circular DNA library was constructed using DNA ligase, and the remaining linear DNA was digested with exonuclease. The DNA library was finally sequenced using DNBSEQ-T7 (MGI) with a PE read length of 150 bp and evaluated by FastQC (v0.11.8) to assess the overall sequencing quality of the MGI sequencing platform.

[0113] In this embodiment, the sequences of the top 10 candidate aptamers are as shown in [Table 3] below.

[0114] Sequence (5'→3')*# Read Frequency (%) Sequence number T1 ATCCAGAGTGACGCAGCACCTAGAACCCGCACTAACACTCACCACGACTAACACACACCTGGCTCGAACAAGCTTGC 357817 3.23 4 T2 ATCCAGAGTGACGCAGCAACACTGAAGGGAAGGGAGAGAGGGAGTTGTGGAGGGTAAAACTGGCTCGAACAAGCTTGC 197439 1.78 5 T3 ATCCAGAGTGACGCAGCACCCCCAATCCGCCTATGCTATCTGGCCTCCATCTCTCTGTCTGGCTCGAACAAGCTTGC 188125 1.7 6 T4 ATCCAGAGTGACGCAGCAACACAGACAAGGCGGTAGAGGAGAGGAGAGGAACTGGCCACTGGCTCGAACAAGCTTGC 178936 1.61 7 T5 ATCCAGAGTGACGCAGCAGTGGCCAGTTCCTCTCTCCTCCTCTCTACCGCCTTGTCTGTGCTGGCTCGAACAAGCTTGC 170334 1.54 8 T6 ATCCAGAGTGACGCAGCAGGGACAAAGGACACAGGTGGGGGGTGTTGGGATCGGGGGTGCTGGCTCGAACAAGCTTGC 159087 1.44 9 T7 ATCCAGAGTGACGCAGCAGCCTCGCCTCTACTAGATCATACCTCCCTTCCCCTCCGCTCTGGCTCGAACAAGCTTGC 147763 1.33 10 T8 ATCCAGAGTGACGCAGCATGCCACGCCTTTATTTTACGTCCTCTCCCACCCTCTCCTCTCTGGCTCGAACAAGCTTGC 146723 1.32 11 T9 ATCCAGAGTGACGCAGCAGACTAACGGTGCAAAAGTGTGGCAAGAGGGAGAGAGGGGGTCTGGCTCGAACAAGCTTGC 145779 1.32 12 T10 ATCCAGAGTGACGCAGCACACCCCCTCTCTCCCTCTTGCCACACTTTTGCACCGTTAGTCTGGCTCGAACAAGCTTGC 136694 1.23 13

[0115] For PCR amplification during the TEV-SELEX process, the forward primer of SEQ ID NO. 2 and the reverse primer region of SEQ ID NO. 3 were included in the ssDNA library at the 5' end of the aptamer sequence, but the forward and reverse primer regions are not indicated in [Table 3]. In Table 3, T stands for Toggle.

[0116] To select aptamers with high binding affinity and specificity, candidate aptamers modified with a 5'-biotin group were prepared, and their binding affinities for SW620, LS 174T, HT29 (positive target) and HS (counter-target) sEVs were evaluated using the ELONA method.

[0118] Enzyme-linked oligonucleotide analysis (ELONA)

[0119] ELONA was performed using a known method with slight modifications. Maxi-coupled immunoplate (SPL) wells were heated at 37°C for 2 hours with each sEV (1 x 10⁶). 9First, the plates were coated with (particles / mL) and then blocked with 3% BSA in PBST (1x PBS containing 0.1% Tween-20) for 1 hour at 37°C. After washing three times with PBST, the immunoplates were incubated with the prepared biotin-conjugated aptamer (IDT) in BB at 37°C for 1 hour, followed by washing three times with 0.1% PBST. The immunoplates were further incubated with streptavidin-peroxidase polymer (Sigma-Aldrich; 1:1,000) diluted in 0.1% PBST for 1 hour at 37°C, followed by washing three times with 0.1% PBST. Next, 1x TMB substrate solution (Invitrogen, Carlsbad, CA, USA) was added to each well and incubated in a dark room at room temperature for 6 minutes. The reaction was terminated by adding 0.5 M sulfuric acid, and the absorbance was immediately measured at 450 nm using a Spectramax iD5 multi-mode microplate reader (Molecular Devices, San Jose, CA, USA). The normalized value ΔA was calculated based on the following Equation 1.

[0120] <Equation 1>

[0121] ΔA = A t - A b

[0122] Here, A t is the absorbance of a sample containing both sEV and aptamer, and A b ε₀ is the absorbance of the blank. The concentration of aptamers varies depending on the analytical method, and all experiments were repeated three times.

[0123] As shown in Figure 4, the top 10 most frequent (%) candidate aptamers showed different affinities for SW620, LS 174T, HT29, and HS sEVs. T6 had the highest affinity for SW620, LS 174T, and HT29 sEVs, and the affinity for HS sEVs was low. Overall, these results confirmed the high binding affinity and specificity of T6 for SW620, LS 174T, and HT29 sEVs; therefore, T6 was selected for optimization after SELEX.

[0125] Post-SELEX Optimization of T6 Aptamer

[0126] During the TEV-SELEX process, primer regions were included in the ssDNA library for PCR amplification. Since shorter aptamers are synthesized at a lower cost and are more suitable for the development of aptamer-based biosensors, post-SELEX optimization of T6 aptamers was performed by cleaving forward or reverse primer regions. T6 aptamers lacking forward, reverse, or both regions were named T6F, T6R, and T6FR, respectively, and derivative sequences of T6 with additional regions removed were designated as T6RA, T6RB, T6RB1, T6RB2, and T6RB3, respectively (see Table 4). T6 aptamers are indicated by sequence number 9 in the aforementioned [Table 3].

[0127] Sequence (5'→3') Sequence number Random library ATCCAGAGTGACGCAGCA-N40-CTGGCTCGAACAAGCTTGC 1 Forward primer ATCCAGAGTGACGCAGCA 2 Reverse primer GCAAGCTTGTTCGAGCCAG 3 T6F GGGACAAAGGACACAGGTGGGGGGTGTTGGGATCGGGGGTGCTGGCTCGAACAAGCTTGC 14 T6R ATCCAGAGTGACGCAGCAGGGACAAAGGACACAGGTGGGGGGTGTTGGGATCGGGGGTG 15 T6FR GGGACAAAGGACACAGGTGGGGGGTGTTGGGATCGGGGTG 16 T6RA ATCCAGAGTGACGCAGCAGGGACAAAGG 17 T6RB CAAAGGACACAGGTGGGGGGGTGTTGGGATCGGGGTGTG 18 T6RB1 ACACAGGTGGGGGGTGTTGGGATCGGGGGTG 19 T6RB2 CAAAGGACACAGGTGGGGGGTGT 20 T6RB3 ACACAGGTGGGGGGTGT 21

[0129] As shown in Fig. 5, the binding affinities of the cleaved T6 aptamers (T6F, T6R, and T6FR) for SW620, LS 174T, HT29 sEVs (positive targets) and HS sEVs (counter-targets) were similar to those of the uncleaved T6 aptamers (Fig. 5 (A)). However, since the binding affinity of T6FR for HS sEVs (counter-targets) was high, the specificity was low, so it was not selected. More specifically, to quantitatively compare the binding affinities for T6, T6F, and T6R, ΔA대항표적 ΔA for 양성표적 The ratio was analyzed, and as a result, T6R showed the highest value ((BD) in Fig. 5). Overall, these results confirmed the high binding affinity and specificity of T6R for SW620, LS 174T, and HT29 sEVs; therefore, after finally selecting T6R, a more specific sequence optimization process was carried out.

[0130] Subsequently, the inventors prepared T6RA, T6RB, T6RB1, T6RB2, and T6RB3 by cleaving other regions of T6R (Fig. 6 (A) and (C)). After analyzing the binding affinity for each positive target (SW620, LS174T, HT29) and antagonist (HS) as described in the above example, and comparing and evaluating the ΔA values ​​for each cleaved aptamer, T6RB was selected as the most suitable aptamer for this study. As shown in Fig. 6 (B), in T6RB, ΔA 대항표적 The value of remains unchanged, but ΔA 양성표적 The value for increased, exhibiting the highest binding affinity and specificity. Furthermore, as shown in Fig. 6 (C), additional sequence optimization of T6RB rather ΔA 양성표적 The value for was low, which was determined to be a sequence that reduces binding affinity, so T6RB was finally selected as the optimal sequence.

[0132] Harry constant, K d decision

[0133] The binding affinity of T6RB is K d It was estimated and quantitatively evaluated. Specifically, T6RB was exposed to a certain number of SW620, LS 174T, HT29, and HS sEVs at various concentrations (0-100 nM) and then analyzed using the ELONA method described in Example 5.

[0135] Binding affinity analysis

[0136] To evaluate the binding affinity of the selected aptamer T6RB, the concentration (0-100 nM) of the selected aptamer labeled with biotin was varied, and the equilibrium dissociation constant ( K d ...was determined. The normalized ΔA value was expressed as a function of aptamer concentration and K d is the nonlinear regression equation Y = (Bmax Х X) / ( K d It was determined using (+ X). Here, Y is ΔA, Bmax is the maximum ΔA, K d is the dissociation constant, and X is the aptamer concentration.

[0137] As a result, (A) of Fig. 7 is the dissociation constant of T6RB ( K d ) represents the curve. As seen in Fig. 7 (A), for SW620, LS 174T, and HT29 sEV, the absorbance signal increases as the concentration of T6RB increases, at 3.848 nM, 5.904 nM, and 5.234 nM, respectively. K d While it indicates a value, in the case of HS sEV, the absorbance signal does not change, K d The value could not be determined. Low nanomolar range K d The values ​​indicated a high binding affinity of T6RB for SW620, LS 174T, and HT29 sEV. Accordingly, T6RB was determined to be a suitable candidate aptamer for diagnostic applications.

[0139] Circular dichroism (CD) measurement

[0140] Secondary structures were formed by denaturing 10 μM T6RB in a buffer containing 10 mM Tris / HCl (pH 7.4) and / or 100 mM KCl at 95°C for 5 minutes, followed by slow cooling to 25°C. CD spectra were recorded in the spectral range of 210–300 nm using a J-810 spectropolarimeter (Jasco, Tokyo, Japan) at a scan rate of 50 nm / min and a bandwidth of 1 nm. All measurements were performed three times and averaged, and background CD spectra for the corresponding buffer were measured and subtracted from the experimental spectra. Spectral analysis was performed using Spectra Manager (Jasco), and DNA secondary structures were analyzed using the conformation index r (Equation 2 below).

[0141] [Equation 2]

[0142]

[0143] CD here 265 and CD 290 θ are the CD molar ellipses [θ] at 265 nm and 290 nm, respectively. r ≥ 0.5, 0 ≤ r < 0.5, and r < 0 correspond to mainly parallel, hybrid, and antiparallel topologies, respectively.

[0144] Fig. 7 (B) shows potassium ions (K + Shows the circular dichroism (CD) spectrum of T6RB in the absence / presence of ). Potassium ions (K + When examining the circular dichroism (CD) spectrum of T6RB in the presence of ), positive peaks were observed in the 210 nm and 265 nm regions, and calculations based on Equation 2 showed that r > 0.5, confirming that T6RB forms a parallel structure among the G-quadruplex secondary structures.

[0146] Fluorescence measurement of N-methyl mesoporphyrin IX (NMM)

[0147] T6RB at a concentration of 500 nM was denatured at 95°C for 5 minutes in a buffer containing 10 mM Tris / HCl (pH 7.4) with or without 100 mM KCl, then slowly cooled to 37°C and incubated for an additional 0.5 hours to allow for the formation of a secondary structure. Then, NMM (Cayman Chemical, Ann Arbor, MI, USA) was added to the mixture at a concentration of 5 μM, and incubated for an additional 0.5 hours to allow the NMM to be inserted into the T6RB structure. Fluorescence intensity (FI) was measured at an excitation wavelength of 399 nm and an emission wavelength of 610 nm using a Spectramax iD5 multimode microplate reader (Molecular Devices).

[0148] As can be seen in (C) of Fig. 7, consistent with the circular dichroism spectrum results, potassium ions (K + It was confirmed that the fluorescence intensity of NMM bound to T6RB was stronger in the presence of ), which reconfirmed that T6RB forms a G-quadruplex secondary structure.

[0150] Topology analysis of aptamer-targeted biomarkers for T6RB sEV (sEV lysis and enzymatic proteolysis of sEV surface proteins)

[0151] For sEV lysis, SW620 sEV lysates were prepared using RIPA lysis buffer supplemented with a Halt protease inhibitor cocktail (Thermo Fisher Scientific) at a final concentration of 1X. Briefly, sEVs were mixed with the lysis buffer supplemented with the protease inhibitor and incubated on ice for 30 minutes, followed by sonication in a water bath sonicator (SH-2140D, SAE HAN ULTRASONIC, Seoul, Republic of Korea) with 5 cycles of 30-second on / off at 40 kHz. For proteinase K (proK) treatment, SW620 sEVs were treated with proK (20 μg / mL, Enzynomics) for 1 hour at 37°C while gently vortexing every 20 minutes. proK activity was inhibited by treatment with phenylmethylsulfonyl fluoride (PMSF, 5 mM) for 10 minutes at room temperature. For trypsin treatment, trypsin-ethylenediaminetetraacetic acid (trypsin-EDTA, 0.25%) was incubated with SW620 sEV at 37°C for 30 minutes, and activity was stopped by adding an equal amount of 10% FBS to 1x PBS. The final composition of each treatment was stored at -80°C until use.

[0152] As a result, Figure 7 (D) shows the results of the biomarker topology analysis (in order, untreated / proteinase K (proK) treated / trypsin treated / RIPA treated sEVs). That is, Figure 7 (D) indicates that T6RB exhibits negligible binding affinity for proK and trypsin-treated sEVs. Meanwhile, T6RB exhibited comparable binding affinity for RIPA-soluble sEVs compared to untreated (untreated) intact sEVs (Figure 7 (D)). These results confirmed that the biomarker targeted by T6RB is identified as a protein and is topologically located on the outer membrane of the sEV.

[0154] ELONA equipped with Tiramide Signal Amplification (TSA) function

[0155] A TSA equipped with a biotin-tiramide (b-tiramide) / SA-PP system was used as an additional step of ELONA to improve the sensitivity of the assay. HT29 sEVs (2×10⁶) coated on an immunoplate 7 Optimized experimental conditions for TSA were explored using particles / mL, and the concentrations of T6RB, b-tyramide, and H2O2, as well as the reaction time of TSA, were optimized. When the first incubation of SA-HRP (1:1000 diluted in PBST) was performed in ELONA, the optimized conditions [15 μg / mL b-tyramide (APExBIO Technology LLC, Texas, USA) in 0.1 M borate (pH 8.5) and 0.001% H2O2 (Sigma-Aldrich)] were administered at 37°C for 25 minutes, followed by a washing step. Finally, the second incubation of SA-HRP (1:1000 diluted in PBST) was treated at 37°C for 1 hour, followed by a washing step. The TMB reaction and absorbance value normalization were performed in the same manner as described above for ELONA, and all experiments were performed three times.

[0156] To find the optimal conditions for the ELONA method equipped with TSA, the key variables (T6RB / b-tyramide / H2O2 concentration and reaction time) in the TSA were optimized, and as a result, 160 nM T6RB, 15 μg / mL b-tyramide, 0.001% H2O2, and a reaction time of 25 minutes were obtained ((AD) in Fig. 8).

[0157] As shown in Figure 9, a comparative analysis of the standard ELONA and the TSA-equipped ELONA under TSA optimization conditions revealed that at low sEV concentrations, the standard ELONA yielded an undetectable ΔA for positive targets (SW620, LS 174T, HT29 sEVs). In contrast, the TSA-equipped ELONA did not show a significant ΔA value in the control group without sEVs, but showed a much larger ΔA for positive targets (SW620, LS 174T, HT29 sEVs). This can be interpreted as the final ΔA value being significantly increased due to signal amplification by the TSA compared to the standard ELONA, and it was expected to ultimately lead to an increase in sensitivity.

[0159] Best Aptamer Rating (T6RB)

[0160] Finally, the detectability of SW620, LS 174T, and HT29 sEVs was analyzed using the T6RB and TSA-mounted ELONA method, which possess high coupling and specificity. The results shown in Fig. 10 (A) indicate that the absorbance signal (ΔA) corresponds to the concentration of SW620 sEV (2.0 × 10⁻¹⁰). 4 - 1.0 X 10 6 It is proportional to particles / μL) and the linear regression function is Y = 0.02782X + 0.03430 (R 2 It shows that = 0.9871) was obtained as follows. Additionally, in (B) of Figure 10, the absorbance signal (ΔA) is proportional to the concentration of LS 174T sEV and the linear regression function is Y = 0.01075X + 0.03711 (R 2 It shows that = 0.9850) was obtained as follows, and in (C) of Fig. 10, the absorbance signal (ΔA) is proportional to the concentration of HT29 sEV and the linear regression function is Y = 0.03014X + 0.2759 (R 2 This indicates that = 0.9861) was obtained. In addition, the result of calculating the limit of detection (LOD) for each sEV is 3.6 x 102 Particles / μL (SW620), 3.5 x 10⁻⁶ 3 Particles / μL (LS 174T), 8.4 x 10 2 It was derived as particles / μL (HT29). This indicates that the concentration of sEV in serum or plasma is 10 5 Considering that it exists in the particle / μL range, this suggests the precision to strongly validate the diagnostic ability of T6RB for CRC-derived sEVs.

[0162] In conclusion, the designed TEV-SELEX method was utilized to employ various CRC cell-derived sEVs to enable broader targeting of highly heterogeneous CRCs, and the top 10 putative aptamers were selected and analyzed for the highest binding affinity ( K d The best aptamer T6RB was selected, exhibiting specificity and nM = 3.848 (SW620), 5.904 (LS 174T), 5.234 (HT29). The diagnostic validity of the aptamer was 3.6 x 10⁻¹⁰. 2 Particles / μL (SW620), 3.5 x 10⁻⁶ 3 Particles / μL (LS 174T), 8.4 x 10 2 This was demonstrated by detecting CRC cell-derived sEVs with a detection limit of particles / μL (HT29) and distinguishing non-targeted sEVs, which are healthy serum and normal cell sEVs. In addition, it was confirmed that T6RB targets a protein present on the outer membrane of sEVs, and it is expected that it can be used to establish new biomarkers by identifying biomarkers through future studies.

Claims

Claim 1 DNA aptamer for diagnosing colorectal cancer, comprising the nucleotide sequence of SEQ ID NO.

18. Claim 2 In claim 1, the aptamer is a DNA aptamer that specifically binds to small extracellular vesicles (sEVs) derived from various colorectal cancer cells. Claim 3 In claim 1, the aptamer is a DNA aptamer comprising at least one sequence among a forward primer sequence and a reverse primer sequence. Claim 4 A DNA aptamer according to paragraph 3, wherein the sequence of the forward primer is composed of the nucleotide sequence of SEQ ID NO.

2. Claim 5 In paragraph 3, the sequence of the reverse primer is a DNA aptamer composed of the nucleotide sequence of SEQ ID NO.

3. Claim 6 delete Claim 7 In claim 1, the DNA aptamer is a DNA aptamer having a binding dissociation constant of 3 to 6 nM. Claim 8 A composition for diagnosing colorectal cancer comprising an aptamer according to any one of claims 1 to 5 and 7. Claim 9 A colorectal cancer diagnostic kit comprising the composition of claim 8. Claim 10 In claim 9, the kit is any one selected from the group consisting of a diagnostic sensor, an RT-PCR kit, a competitive RT-PCR kit, a real-time RT-PCR kit, a DNA chip kit, and a protein chip. Claim 11 delete Claim 12 A method for producing a DNA aptamer according to any one of claims 1 to 5 and 7, comprising: a) generating a random oligonucleotide library; b) performing SELEX using different small extracellular vesicles (sEVs) derived from colorectal cancer cells in alternation; c) sequencing the DNA aptamer using an NGS technique; and d) characterizing the DNA aptamer. Claim 13 In claim 12, the method wherein the aptamer specifically binds to small extracellular vesicles (sEVs) derived from various colorectal cancer cells. Claim 14 A method for providing information for diagnosing colorectal cancer, comprising the step of detecting small extracellular vesicles (sEVs) derived from colorectal cancer cells using a DNA aptamer of any one of claims 1 to 5 and 7. Claim 15 A method for detecting a surface biomarker specific to small extracellular vesicles (sEVs) derived from colorectal cancer cells, comprising the step of contacting an aptamer of any one of claims 1 to 5 and 7 with a sample to be analyzed. Claim 16 A colorectal cancer-specific drug delivery composition comprising an aptamer of any one of claims 1 to 5 and 7.