Papiliotrema laurentii 62uf-13 strain that degrades biodegradable plastics, and uses thereof

Abstract

The present invention relates to the strain Papiliotrema laurentii 62UF-13 (accession number: KACC 83076BP), and provides the strain Papiliotrema laurentii 62UF-13 (accession number: KACC 83076BP) having the ability to degrade at least one of polybutylene adipate terephthalate (PBAT), polyhydroxyalkanoate (PHA), and polylactic acid (PLA).

Description

Technology Field

[0001] The present invention relates to Papiliotrema Laurenti, which decomposes biodegradable plastics ( Papiliotrema laurentii This relates to the strain 62UF-13 (accession number: KACC 83076BP). Background Technology

[0002] Various microorganisms exist in agricultural environments, including plants, soil, and rhizosphere soil. Microorganisms are classified into decomposers, producers, and consumers according to their trophic level. Decomposers secrete various enzymes to break down and decompose organic matter, converting it into inorganic substances—that is, usable nutrients. The process of converting organic matter into inorganic matter is one of the critical processes in the material cycle of an ecosystem, and this is primarily carried out by fungi. As a type of fungus, mushrooms can decompose or convert high-molecular substances such as cellulose and lignin, which are difficult to decompose in the ecosystem. Furthermore, this microbial material decomposition capability is utilized in various industrial fields, such as compost production and organic wastewater treatment. Prior art literature

[65535] Chinese Published Patent Application No. 112662574, Korean Published Patent Application No. 10-2022-0108109 The problem to be solved

[0003] The objective of the present invention is to decompose biodegradable plastics (Papilliotrema Laurenti) Papiliotrema laurentii The invention provides the strain 62UF-13 (accession number: KACC 83076BP) and the use of the said strain. means of solving the problem

[0004] The present invention is Papilio Trema Laurenti ( Papiliotrema laurentii ) This relates to the strain 62UF-13 (accession number: KACC 83076BP), which has the ability to degrade at least one of polybutylene adipate terephthalate (PBAT), polyhydroxyalkanoate (PHA), and polylactic acid (PLA).

[0005] In one embodiment of the present invention, the strain may be characterized by having an ITS nucleotide sequence represented by SEQ ID NO. 1.

[0006] In one embodiment of the present invention, the strain may further include polybutylene succinate (PBS) degradation ability.

[0007] In one embodiment of the present invention, the strain may further include polycaprolactone (PCL) degradation ability.

[0008] The present invention relates to a composition for degrading biodegradable plastics, comprising a strain according to one embodiment of the present invention, a culture solution of said strain, or all of these as an active ingredient.

[0009] In one embodiment of the present invention, the culture solution may be prepared by culturing the strain under conditions of 20°C to 30°C and pH 6 to pH 8.

[0010] The present invention relates to a composition for promoting plastic degradation, comprising a strain according to one embodiment of the present invention, a culture solution of said strain, or all of these as an active ingredient.

[0011] The present invention relates to a method for degrading biodegradable plastics, comprising the step of treating at least one of polybutylene adipate terephthalate (PBAT), polyhydroxyalkanoate (PHA), and polylactic acid (PLA) selected from the group consisting of a strain according to one embodiment of the present invention, a culture medium of said strain, a composition comprising said strain, and a composition comprising a culture medium of said strain.

[0012] The present invention is Papilio Trema Laurenti ( Papiliotrema laurentii) This relates to the strain 62UF-13 (accession number: KACC 83076BP), which has the ability to degrade at least one of polybutylene adipate terephthalate (PBAT), polybutylene succinate (PBS), polycaprolactone (PCL), polyhydroxyalkanoate (PHA), and polylactic acid (PLA).

[0013] The present invention relates to a composition for degrading biodegradable plastics, comprising a strain according to one embodiment of the present invention, a culture solution of said strain, or all of these as an active ingredient.

[0014] The present invention relates to a method for degrading biodegradable plastics, comprising the step of treating at least one selected from the group consisting of a strain according to one embodiment of the present invention, a culture medium of said strain, a composition comprising said strain, and a composition comprising said strain culture medium, with at least one of polybutylene adipate terephthalate (PBAT), polybutylene succinate (PBS), polycaprolactone (PCL), polyhydroxyalkanoate (PHA), and polylactic acid (PLA). Effects of the invention

[0015] Papilliotrema Laurenti according to one embodiment of the present invention ( Papiliotrema laurentii The strain 62UF-13 (accession number: KACC 83076BP) can degrade biodegradable plastics. Brief explanation of the drawing

[0016] Figure 1 shows a phylogenetic tree of the 62UF-13 strain according to one embodiment of the present invention. FIG. 2 is a photograph of a clear halo produced by the 62UF-13 strain in each minimal medium containing different biodegradable plastics according to one embodiment of the present invention. FIG. 3 is a graph showing the length of the diameter of the clear ring produced by the 62UF-13 strain according to one embodiment of the present invention. FIGS. 4a to 4e are graphs showing the length of the diameter of the clear ring produced by the 62UF-13 strain in each minimum medium set with different pH and different biodegradable plastic conditions according to one embodiment of the present invention. FIGS. 5a to 5e are graphs showing the length of the diameter of the clear ring produced by the 62UF-13 strain in each minimum medium set to different temperatures and different biodegradable plastic conditions according to one embodiment of the present invention. Specific details for implementing the invention

[0017] Hereinafter, the strain Papiliotrema Laurentii 62UF-13 for degrading biodegradable plastics according to the present invention and its uses will be described in detail with reference to the attached drawings.

[0018] Prior to this, the terms used in this specification and claims shall not be interpreted as being limited to their dictionary meanings; rather, based on the principle that the inventor may appropriately define the concepts of the terms to best describe their invention, they shall be interpreted in a meaning and concept consistent with the technical spirit of the invention.

[0019] The exemplary embodiments described in the detailed description, drawings, and claims are not intended to be limiting, and other embodiments may be used, and other modifications are possible without departing from the spirit or scope of the technology disclosed herein.

[0020] Therefore, it should be understood that the embodiments described in this specification and the configurations illustrated in the drawings are merely preferred embodiments of the present invention and do not represent all of the technical ideas of the present invention, and that various equivalents and modifications that can replace them may exist at the time of filing this application.

[0021] Those skilled in the art will readily understand that the components of this disclosure, namely those generally described herein and those depicted in the drawings, can be arranged, configured, combined, and designed in various different configurations, all of which are obviously devised and form part of this disclosure.

[0022] The present invention is Papilio Trema Laurenti ( Papiliotrema laurentii The present invention is characterized by providing a composition for degrading biodegradable plastics comprising the strain 62UF-13 (accession number: KACC 83076BP), said strain, said culture medium of said strain, or all of these as active ingredients, and a method for degrading biodegradable plastics using said. The present invention discloses polybutylene adipate terephthalate (PBAT), polybutylene succinate (PBS), polycaprolactone (PCL), polyhydroxyalkanoate (PHA), and polylactic acid (PLA) as biodegradable plastics, and discloses a strain for degrading said plastics and the use thereof.

[0023] Polybutylene adipate terephthalate (PBAT) is a petroleum-based biodegradable plastic. Unlike conventional plastics, despite being petroleum-based, it decomposes rapidly within six months under natural conditions through reactions involving oxygen, light, and enzymes. PBAT possesses excellent flexibility, with an elongation rate reaching 600% to 800%, making it suitable for use in various disposable bags, shopping bags, and volume-based waste disposal bags. Furthermore, by compounding with other materials such as PLA and starch, it can possess strength, printability, and processability similar to existing plastic films, allowing it to be applied to various products for diverse purposes. Additionally, PBAT can be biodegradable through industrial composting and in natural soil, making it suitable for use in agricultural mulching films. The actual commercialized mulching film is 100% biodegradable, meaning it decomposes completely into water, carbon dioxide, and humus through sunlight, water in the soil, and microorganisms.

[0024] Polybutylene succinate (PBS) is a polyester-based thermoplastic polymer resin and is a biodegradable aliphatic polyester with properties similar to polypropylene. Since PBS naturally decomposes into water and carbon dioxide, it can be utilized in various fields, including packaging (such as food and cosmetic packaging films, bags, and boxes), disposable products (such as tableware and medical supplies), agriculture (such as mulching films, pesticides, and delayed-release materials for fertilizers), fisheries, forestry, and civil engineering (where the recovery and recycling of used materials is difficult), and the medical field (such as biodegradable drug encapsulation and implants).

[0025] Polycaprolactone (PCL) is a material that can be manufactured relatively inexpensively among aliphatic polyesters synthesized from petrochemical raw materials. It has the advantages of excellent processability, good miscibility with other degradable plastics, and superior biodegradability, as it has a low melting point but remains stable even at high temperatures above 200°C. As previously disclosed, due to its good miscibility, PCL can be utilized as a new biodegradable material in mixtures with polyesters, polyamides, polyurethanes, etc., or copolymers with their monomers. PCL is utilized in various fields, such as biomaterials for implants, surgical sutures, cosmetic surgery, and recreational hobbies.

[0026] Polyhydroxyalkanoates (PHA) are polyester plastics synthesized by microorganisms. They are produced when specific microorganisms generate PHA as an energy storage agent in the event of a deficiency in certain nutrients while carbon sources are sufficient. Unlike conventional microbial fermentation processes, which utilize crops such as corn as carbon sources and thus consume vast amounts of food resources, PHA is environmentally friendly as it can utilize methane gas as a carbon source. Furthermore, since PHA can be manufactured using wild microorganisms, genetic modification is unnecessary, thereby reducing the resources required. Unlike other biodegradable plastics such as PLA, PHA has the advantage of being able to decompose in the ocean.

[0027] Polylactic acid (PLA) differs from most thermoplastic polymers in that it is extracted from renewable resources such as corn starch, tapioca roots, and sugarcane fermentation. PLA is biodegradable and possesses properties similar to those of conventionally widely used polypropylene (PP), polyethylene (PE), or polystyrene (PS), such as high strength, heat resistance of 110°C, and cold resistance of -20°C, making it easy to use in various fields. For example, PLA is used in the packaging sector, including courier bags for clothing, books, and inner packaging, shopping bags for stores selling various goods, and packaging films for storing various foods. It is also used in the film sector to produce various injection-molded products such as bubble wrap, biodegradable gloves, disposable cups, bowls, and containers.

[0028] The present invention relates to a papillotrema laurenti having degradability for at least one of polybutylene adipate terephthalate (PBAT), polybutylene succinate (PBS), polycaprolactone (PCL), polyhydroxyalkanoate (PHA), and polylactic acid (PLA). Papiliotrema laurentii ) Provides the strain 62UF-13 (accession number: KACC 83076BP).

[0029] Papilliotrema Laurenti according to one embodiment of the present invention ( Papiliotrema laurentii The strain 62UF-13 (accession number: KACC 83076BP) can degrade at least one of polybutylene adipate terephthalate (PBAT), polybutylene succinate (PBS), polycaprolactone (PCL), polyhydroxyalkanoate (PHA), and polylactic acid (PLA).

[0030] Papilliotrema Laurenti according to one embodiment of the present invention ( Papiliotrema laurentii Since the degradation ability of strain 62UF-13 (accession number: KACC 83076BP) is not limited to the shape of the biodegradable plastic (PBAT, PBS, PCL, PHA, and PLA) being degraded, the biodegradable plastic including PBAT, PBS, PCL, PHA, and PLA may be provided in at least one of the forms of liquid resin, semi-solid resin, solid resin, film, and powder. Accordingly, the papillotrema Laurenti ( Papiliotrema laurentii The biodegradable plastic comprising PBAT, PBS, PCL, PHA, and PLA disclosed in ) 62UF-13 (accession number: KACC 83076BP), a composition comprising the strain, and a method using the strain may be provided in at least one of the forms of a liquid resin, a semi-solid resin, a solid resin, a film, and a powder.

[0031] Papilliotrema Laurenti according to one embodiment of the present invention ( Papiliotrema laurentii ) 62UF-13 (Accession No.: KACC 83076BP) strain is a plurality of Papiliotrema genus ( Papiliotrema It has an ITS nucleotide sequence highly similar to the sp.) strain. Among them, Papiliotrema laurentii ( Papiliotrema laurentii ) 62UF-13 (Accession No.: KACC 83076BP) strain is Papiliotrema Laurenti ( Papiliotrema laurentiiIt has the ITS nucleotide sequence of SEQ ID NO. 1, which exhibits 98.00% homology with the ) strain, and in the present invention, Papiliotrema Laurenti ( Papiliotrema laurentii The strain 62UF-13 (accession number: KACC 83076BP) was deposited with the National Institute of Agricultural Sciences (Agricultural Genetic Resources Center, KACC) on March 7, 2023, and was assigned accession number KACC 83076BP.

[0032] The present invention relates to a papillotrema laurenti comprising at least one of polybutylene adipate terephthalate (PBAT) degradation ability, polybutylene succinate (PBS) degradation ability, polycaprolactone (PCL) degradation ability, polyhydroxyalkanoate (PHA) degradation ability, and polylactic acid (PLA) degradation ability. Papiliotrema laurentii A composition for degrading biodegradable plastic is provided, comprising the strain 62UF-13 (accession number: KACC 83076BP), a culture medium of the strain, or both of these as active ingredients.

[0033] In addition, the present invention relates to a papillotrema laurenti comprising at least one of polybutylene adipate terephthalate (PBAT) degradation ability, polybutylene succinate (PBS) degradation ability, polycaprolactone (PCL) degradation ability, polyhydroxyalkanoate (PHA) degradation ability, and polylactic acid (PLA) degradation ability. Papiliotrema laurentii A composition for promoting plastic degradation is provided, comprising the strain 62UF-13 (accession number: KACC 83076BP), a culture medium of the strain, or both of these as active ingredients.

[0034] The term “culture solution” refers to a product obtained by inoculating a strain into a culture medium and culturing it for a certain period of time. It includes, but is not limited to, the culture solution itself obtained by culturing the strain according to the present invention in a suitable liquid medium; a filtrate (filtrate or supernatant after centrifugation) obtained by filtering or centrifuging the culture solution to remove the strain; a cell lysate obtained by ultrasonically treating the culture solution or treating the culture solution with a lysozyme; and a concentrate obtained by concentrating the culture solution, filtrate, and lysate.

[0035] The culture medium of the present invention may contain a solid culture medium, and a culture such as a dried product or extract of the culture medium, but is not limited thereto, and may further include a suitable excipient or carrier.

[0036] In addition, the composition for degrading biodegradable plastics according to the present invention may further include any other component or microorganism used in the field for degrading biodegradable plastics in addition to the strain of the present invention described above, the culture medium of said strain, or a mixture thereof.

[0037] A composition for degrading biodegradable plastics according to one embodiment of the present invention may include a culture medium cultured under specific conditions. For example, the culture medium in the composition for degrading biodegradable plastics of the present invention (hereinafter, the culture medium of the present invention) may be prepared by culturing the strain of the present invention under conditions of 15°C to 40°C and / or pH 5 to pH 9. Additionally, for example, the culture medium of the present invention may be prepared by culturing the strain of the present invention under conditions of 20°C to 40°C and / or pH 5 to pH 8.

[0038] In one embodiment of the present invention, the culture medium of the present invention may be prepared by culturing the strain of the present invention under conditions of 20°C to 30°C and / or pH 6 to pH 8. In addition, in one embodiment of the present invention, the culture medium of the present invention may be prepared by culturing the strain of the present invention under conditions of 28°C to 30°C and / or pH 7.

[0039] According to one embodiment of the present invention, papillotrema laurenti comprising at least one of polybutylene adipate terephthalate (PBAT) degradation ability, polybutylene succinate (PBS) degradation ability, polycaprolactone (PCL) degradation ability, polyhydroxyalkanoate (PHA) degradation ability, and polylactic acid (PLA) degradation ability ( Papiliotrema laurentii Since it contains the strain 62UF-13 (accession number: KACC 83076BP), the composition of the present invention may be used for other purposes in addition to the previously disclosed composition for biodegradable plastic degradation, and its name may also be appropriately changed.

[0040] For example, Papilio Trema Laurenti ( Papiliotrema laurentiiA composition comprising the strain 62UF-13 (accession number: KACC 83076BP), a culture medium of said strain, or all of these as active ingredients may be named as a plastic degradation accelerator or a composition for accelerating plastic degradation, a plastic degrading agent or a composition for degrading plastic, a polybutylene adipate terephthalate (PBAT) degrading agent or a composition for degrading, a polybutylene succinate (PBS) degrading agent or a composition for degrading, a polycaprolactone (PCL) degrading agent or a composition for degrading, a polyhydroxyalkanoate (PHA) degrading agent or a composition for degrading, a polylactic acid (PLA) degrading agent or a composition for degrading, a biodegradable plastic degrading agent, a degrading agent or a composition for degrading at least two of polybutylene adipate terephthalate (PBAT), polybutylene succinate (PBS), polycaprolactone (PCL), polyhydroxyalkanoate (PHA), and polylactic acid (PLA), etc. there is.

[0041] In one embodiment of the present invention, a composition for degrading biodegradable plastics can be treated with at least one of polybutylene adipate terephthalate (PBAT), polybutylene succinate (PBS), polycaprolactone (PCL), polyhydroxyalkanoate (PHA), and polylactic acid (PLA) to degrade the treated biodegradable plastics.

[0042] The present invention is Papilio Trema Laurenti ( Papiliotrema laurentii The present invention provides a method for degrading biodegradable plastic comprising the step of treating at least one selected from the group consisting of the strain 62UF-13 (accession number: KACC 83076BP), a culture medium of said strain, a composition containing said strain, and a composition containing a culture medium of said strain with at least one of polybutylene adipate terephthalate (PBAT), polybutylene succinate (PBS), polycaprolactone (PCL), polyhydroxyalkanoate (PHA), and polylactic acid (PLA).

[0043] A method for degrading biodegradable plastic according to one embodiment of the present invention may treat biodegradable plastic with the strain of the present invention, a culture medium of the strain, a composition comprising the strain, and a composition comprising the culture medium of the strain under specific conditions. For example, the method for degrading biodegradable plastic of the present invention may be carried out under conditions of 15°C to 40°C and / or pH 5 to pH 9. Additionally, for example, the method for degrading biodegradable plastic of the present invention may be carried out under conditions of 20°C to 40°C and / or pH 5 to pH 8.

[0044] In one embodiment of the present invention, the method for degrading biodegradable plastic of the present invention may be carried out under conditions of 20°C to 30°C and / or pH 6 to pH 8. In addition, in one embodiment of the present invention, the method for degrading biodegradable plastic of the present invention may be carried out under conditions of 28°C to 30°C and / or pH 7.

[0045] The present invention will be described in more detail through examples. However, these examples are intended only to explain the invention in more detail and do not limit the scope of the invention.

[0047] 실시예 1: 생분해성 플라스틱 균주의 분리 및 준비

[0048] In order to isolate a strain that degrades biodegradable plastics, in the present invention, yeast collected from grasshopper feces in 2015 and cultured in R2A medium at 28°C was purely isolated.

[0049] To test the degradation ability of biodegradable plastics, a total of five biodegradable plastic emulsions containing polybutylene adipate terephthalate (PBAT), polybutylene succinate (PBS), polycaprolactone (PCL), polyhydroxyalkanoate (PHA), and polylactic acid (PLA) and a minimal medium containing each of these were prepared.

[0050] The above emulsion was prepared by dissolving 4 g of biodegradable plastic resin in 50 mL of chloroform, adding 200 mL of distilled water and 4 mL of 2% sarkosyl NL, and using a homogenizer; and 0.1% R2A broth and 2% NL were added to 900 mL or 950 mL of R2A broth 0.003 g / L minimal medium (NaH--2PO4&12H2O 3.58 g; KH2PO4 1.361 g; (NH4)2SO4 0.3 g; MgSO4&7H2O 0.05 g; CaCl2&H-2O 0.0058 g; yeast extract 0.01 g / L (distilled water); trace element solution 10 mL; Se / W solution 1 mL; vitamin solution 1 mL; agar 15 g; distilled water 1 L-) with 0.1% R2A broth and 2% 100 mL or 50 mL of biodegradable plastic emulsion was added (final concentration 0.2% or 0.1%).

[0051] The minimum medium containing the emulsion was set to 0.2% when containing PCL, and prepared and used at a concentration of 0.1% when containing PBAT, PBS, PHA, and PLA. The specific components of the trace element solution, Se / W solution, and vitamin solution are disclosed in Tables 1 to 3 below.

[0052] 성분 함량 (g / L) nitrilotriacetic acid 1.5 MgSO-4& 7H2O 3 MnSO4& H2O 0.45 NaCl 1 FeSO4& 7H-2O 0.1 CoCl2 0.1 CaCl2 0.75 ZnSO4& 5H2O 0.18 CuSO4& 5H2O 0.01 K2Al2(SO4)4& 24H2O 0.09 H3BO3 0.01 NaMoO4& 2H2O 0.025 NiSO4& 6H2O 0.024

[0053] 성분 함량 (g / L) Sodium hydroxide (NaOH) 0.5 Sodium selenite (Na2SeO3&5H2O) 0.003 Sodium tunstate dihydrate (Na2WO4&2H-2O) 0.004

[0054] 성분 함량 (g / L) biotin 0.02 folic acid 0.02 pyridoxine hydrochloride 0.1 thiamine hydrochloride 0.05 riboflavin 0.05 nicotinic acid 0.05 calcium D-pantothenate 0.05 vitamin B 12 0.001 p-aminobenzoic acid 0.05 lipoic acid 0.05

[0056] 실시예 2: 생분해성 플라스틱 분해 균주의 동정

[0057] In the present invention, to identify the strain purified in Example 1, strain identification was performed on a strain arbitrarily named 62UF-13. For the molecular biological identification of the 62UF-13 strain, the ITS gene sequence of the 62UF-13 strain was obtained by PCR amplification using a combination of primers ITS1 and ITS4, and the 497 bp ITS gene sequence starting with SEQ ID NO. 1 was determined as shown in Table 4 below.

[0058] GGAAGGATCATTAAAGATTGACCGAAAGGTCTTATCTCTATATCCCTCACCTCTGTGAACTGTGGACCTCCGGGTCTATTTAACAAACATCAGTGTAATGAACGTATATATCATTAAACAAAAC AAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTTTTG GTATTCCGAAAGGCATGCCTGTTTGAGTGTCATGAAATCTCAATCCCCCTGGGTTTATGATCTGGGTCGGACTTGGATATGGGCGTCTGCCGGTCACACGGCTCGCCTCAAATGACTTAGTGGA TCTCTCTGCATCCGTGACAGACGTAATAAGTTTCGTTCTTGTCCCTTGCTTATGAGTCTGCTCATAACCTGCCATCGCGCACTTTAGACTGACCTCAAATCAAGGTAGGACTACCCGCTGAACTT

[0059] NCBI blast was performed on the ITS gene sequence of the 62UF-13 strain determined as disclosed in Table 4 above, and homology was compared with the gene information of the ITS database, and the results are as shown in Table 5 below.

[0060] The nearest strain Accession No. Similarity (%) Papiliotrema laurentii NR_130670.1 98.00 Papiliotrema rajasthanensis NR_155678.1 95.99 Papiliotrema odontothermitis NR_156605.1 94.62 Papiliotrema aspenensis NR_158801.1 93.83 Papiliotrema zeae NR_168772.1 91.91 Papiliotrema mangalensis NR_144816.1 90.98 Papiliotrema anemochoreius NR_130674.1 90.32 Papiliotrema pseudowhite NR_073231.1 89.80 Papiliotrema siamensis NR_155608.1 89.23 Papiliotrema nemorosus NR_137534.1 88.78

[0061] In addition, the genetic information of the above ITS gene sequence and ITS database was tested for relatedness using the MEGA 11 program.

[0062] Figure 1 shows a phylogenetic tree of the 62UF-13 strain according to one embodiment of the present invention.

[0063] Referring to Table 5 and FIG. 1 above, the 62UF-13 strain according to one embodiment of the present invention is Papiliotrema Laurentii ( Papiliotrema laurentii It showed 98.00% homology with the ) strain, and its phylogenetic position was also in the genus Papiliotrema ( Papilloedema It was confirmed to belong to sp.). Accordingly, in the following examples, the 62UF-13 strain was used (Papiliotrema laurentii) Papiliotrema laurentii It was identified as the 62UF-13 strain.

[0064] In the present invention, Papiliotrema Laurenti ( Papiliotrema laurentii The 62UF-13 strain was deposited with the National Institute of Agricultural Sciences (Agricultural Genetic Resources Center, KACC) on March 7, 2023, and was assigned accession number KACC 83076BP.

[0067] 실시예 3: 생분해성 플라스틱 분해 균주의 분해 활성 검정

[0068] In order to test the degradation activity of a strain that degrades biodegradable plastics, a medium was prepared according to the composition of Example 1 disclosed above, and a clear zone formed as the strain inoculated into the medium grew was observed.

[0069] More specifically, an emulsion medium was prepared by adding 0.1% PBAT, PBS, PHA, and PLA, and 0.2% PCL to a minimal medium containing 0.1% R2A broth, using an emulsion prepared at a concentration of 2%. Papiliotrema laurenti cultured in R2A broth medium at 28°C and 150 rpm for 16 hours ( Papiliotrema laurentii ) Strain 62UF-13 (Accession No.: KACC 83076BP) was washed 3 times with PBS (phosphate buffer saline) and then the absorbance (OD) was measured in minimal medium. 600The value was set to 0.1, and 10 µl of each was inoculated into a minimum medium containing any one of the five previously prepared biodegradable plastic emulsions. The samples were then cultured at 28°C for 7 to 28 days. After culture, the clear zones formed according to the growth of the strains were observed, and the length of each clear zone diameter was measured with a ruler. Statistical analysis according to one embodiment of the present invention was performed using the SPSS (Statistical Package for the Social Sciences Inc., Chicago, IL) program, employing a one-way analysis of variance at a 0.05% significance level, followed by a Scheffe post-hoc test. This statistical analysis was also applied to subsequent examples, and unless otherwise noted, statistical analysis was performed through the above process.

[0070] FIG. 2 is a photograph of a clear halo produced by the 62UF-13 strain in each minimal medium containing different biodegradable plastics according to one embodiment of the present invention.

[0071] FIG. 3 is a graph showing the length of the diameter of the clear ring produced by the 62UF-13 strain according to one embodiment of the present invention.

[0072] Referring to FIGS. 2 and FIGS. 3, the size of the clear halo formed as the 62UF-13 strain (accession number: KACC 83076BP) grows according to one embodiment of the present invention can be confirmed.

[0073] More specifically, the papillotrema Laurenti of the present invention ( Papiliotrema laurentii It was confirmed that the 62UF-13 strain (accession number: KACC 83076BP) formed a clear halo by degrading 0.1% PBAT, 0.1% PBS, 0.2% PCL, 0.1% PHA, and 0.1% PLA when cultured in a minimal medium containing an emulsion with a single carbon source at 28°C for 7 to 28 days.

[0074] Under 7-day culture conditions, Papiliotrema Laurenti ( Papiliotrema laurentii The strain ) 62UF-13 (accession number: KACC 83076BP) did not form a clear zone in media containing PBAT, whereas it produced a clear zone in media containing the remaining biodegradable plastics including PBS, PCL, PHA, and PLA. The size of each clear zone was measured to be approximately 16 mm to 17 mm in PBS, approximately 20 mm in PCL, approximately 15 mm in PHA, and approximately 8 mm to 9 mm in PLA, and Papiliotrema Laurenti ( Papiliotrema laurentii It was confirmed that the 62UF-13 strain (accession number: KACC 83076BP) showed high degradation rates in the order of PCL, PBS, PHA, and PLA under 7-day culture conditions.

[0075] Under 14-day culture conditions, Papiliotrema Laurenti ( Papiliotrema laurentii The strain ) 62UF-13 (accession number: KACC 83076BP) produced a clear halo in a medium containing biodegradable plastics including PBAT, PBS, PCL, PHA, and PLA. That is, Papiliotrema laurentii ( Papiliotrema laurentii ) Strain 62UF-13 (Accession No.: KACC 83076BP) was confirmed to have degradation ability for the five biodegradable plastics (PBAT, PBS, PCL, PHA, and PLA) used in the experiment under 14-day culture conditions. The size of each clear zone was measured to be approximately 35 mm for PCL, approximately 33 mm to approximately 34 mm for PBS, approximately 16 mm to approximately 17 mm for PHA, approximately 11 mm to approximately 12 mm for PLA, and approximately 9 mm to approximately 10 mm for PBAT, and Papiliotrema Laurenti ( Papiliotrema laurentii It was confirmed that the 62UF-13 strain (accession number: KACC 83076BP) showed high degradation rates in the order of PCL, PBS, PHA, PLA, and PBAT under 14-day culture conditions.

[0076] Under 21-day culture conditions, as previously disclosed, Papiliotrema Laurenti ( Papiliotrema laurentii The strain ) 62UF-13 (accession number: KACC 83076BP) produced clear zones in media containing biodegradable plastics including PBAT, PBS, PCL, PHA, and PLA. The size of each clear zone was measured to be approximately 40 mm in PBS, approximately 39 mm to approximately 40 mm in PCL, approximately 17 mm to approximately 18 mm in PHA, approximately 14 mm to approximately 15 mm in PLA, and approximately 10 mm in PBAT, and Papiliotrema Laurenti ( Papiliotrema laurentii It was confirmed that the 62UF-13 strain (accession number: KACC 83076BP) showed high degradation rates in the order of PBS, PCL, PHA, PLA, and PBAT under 21-day culture conditions.

[0077] Under 28-day culture conditions, the size of each clear halo was measured to be approximately 44 mm in PBS, 43 mm in PCL, 22 mm in PHA, 20 mm in PLA, and 11 mm in PBAT, Papiliotrema Laurenti ( Papiliotrema laurentii It was confirmed that the 62UF-13 strain (accession number: KACC 83076BP) showed high degradation rates in the order of PBS, PCL, PHA, PLA, and PBAT under 28-day culture conditions.

[0078] Therefore, the papillotrema Laurenti of the present invention ( Papiliotrema laurentii It was confirmed that the strain 62UF-13 (accession number: KACC 83076BP) has the characteristic of degrading PBAT, PBS, PCL, PHA, and PLA, that the degradation ability of PBS and PCL is significantly higher than that of other biodegradable plastics, and that the degradation rate is high in the order of PCL, PBS, PHA, PLA, and PBAT before 14 days of culture and high in the order of PBS, PCL, PHA, PLA, and PBAT after 21 days of culture.

[0080] 실시예 4: 생분해성 플라스틱 균주의 최적조건 검정

[0081] In order to verify the optimal degradation conditions (temperature and pH control) of a strain that degrades biodegradable plastics in the present invention, a medium was prepared according to the composition disclosed in Example 3 above, and a clear zone formed as the strain inoculated into the medium grew was observed. 1 M HCl and 1 M NaOH were used to set different pH values ​​for each medium, and the medium containing PLA was excluded as it did not solidify under pH 5 conditions.

[0082] More specifically, Papiliotrema laurentii cultured for 16 hours in R2A broth medium at 28°C and 150 rpm ( Papiliotrema laurentii ) Strain 62UF-13 (Accession No.: KACC 83076BP) was washed 3 times with PBS (phosphate buffer saline) and then the absorbance (OD) was measured in minimal medium. 600 The pH was set to 0.1, and 10 µl of each was inoculated into a minimum medium containing any one of the five previously prepared biodegradable plastic emulsions. Subsequently, the medium set to pH 7 and 7 to 28 days was cultured under different temperature conditions including 20 ℃, 28 ℃, 30 ℃, 37 ℃, and 50 ℃, respectively, and the medium set to 28 ℃ and 7 to 28 days was cultured under different pH conditions including pH 5, pH 6, pH 7, and pH 8, respectively. After culture, the clear zones formed according to the growth of the strain were observed, and the length of each clear zone diameter was measured with a ruler.

[0083] FIGS. 4a to 4e are graphs showing the length of the diameter of the clear ring produced by the 62UF-13 strain in each minimum medium set with different pH and different biodegradable plastic conditions according to one embodiment of the present invention.

[0084] Referring to FIGS. 4a to 4e, the size of the clear zone formed as the 62UF-13 strain (accession number: KACC 83076BP) grows under different pH conditions according to one embodiment of the present invention can be confirmed.

[0085] More specifically, the papillotrema Laurenti of the present invention ( Papiliotrema laurentii It was confirmed that the 62UF-13 strain (accession number: KACC 83076BP) formed a clear halo by degrading 0.1% PBS, 0.2% PCL, 0.1% PHA, and 0.1% PLA when cultured in a minimal medium containing an emulsion as a single carbon source at 28°C for 7 to 28 days and under pH 5 to pH 8 conditions.

[0086] Referring to Fig. 4a, under PBS and culture conditions of 7 to 28 days, Papiliotrema Laurenti ( Papiliotrema laurentii The strain 62UF-13 (accession number: KACC 83076BP) produced clear zones under all pH 5 to pH 8 conditions, and it was confirmed that the PBS degradation rate was highest in the order of pH 7, pH 8, pH 6, and pH 5 under culture conditions from 7 to 28 days. In particular, a significantly higher PBS degradation rate was observed under pH 7 conditions compared to other pH concentrations, and the diameter of the clear zone was measured to be approximately 72 mm under pH 7 and 28 days of culture.

[0087] Referring to Fig. 4b, under PCL and culture conditions of 7 to 28 days, Papiliotrema Laurenti ( Papiliotrema laurentiiIt was confirmed that the strain 62UF-13 (accession number: KACC 83076BP) produced a clear zone under all pH 5 to pH 8 conditions. Under 7 days of culture, the PCL degradation rate was high in the order of pH 7, pH 6, pH 8, and pH 5; under 14 to 21 days of culture, the PCL degradation rate was high in the order of pH 6, pH 7, pH 8, and pH 5; and under 28 days of culture, the PCL degradation rate was high in the order of pH 6, pH 8, pH 7, and pH 5.

[0088] In particular, under pH 6 conditions, a slightly higher PCL degradation rate was observed compared to other pH concentrations, and under pH 6 and 28-day culture conditions, the diameter of the clear zone was measured to be approximately 36 mm. However, since the diameter of the clear zone formed in the medium set to pH 6, pH 7, and pH 8 under pH 6 and 28-day culture conditions is the same or similar (approx. 36 mm, approximately 35 mm, and approximately 36 mm), PCL can be degraded by culturing under any one of the pH 6 to pH 8 conditions if the 28-day culture condition is fixed.

[0089] Referring to Fig. 4c, under PHA and culture conditions of 14 to 28 days, Papiliotrema Laurenti ( Papiliotrema laurentii The strain 62UF-13 (accession number: KACC 83076BP) produced clear zones under all pH 5 to pH 8 conditions, and it was confirmed that the PHA degradation rate was high in the order of pH 8, pH 7, pH 6, and pH 5 under 7 to 28 days of culture. In particular, significantly higher PHA degradation rates were observed under pH 7 and pH 8 conditions compared to other pH concentrations, and the diameter of the clear zone was measured to be approximately 36 mm under pH 8 and 28 days of culture, and approximately 32 mm under pH 7 and 28 days of culture.

[0090] Referring to Fig. 4d, under PLA and culture conditions of 7 to 28 days, Papiliotrema Laurenti ( Papiliotrema laurentii It was confirmed that the strain 62UF-13 (accession number: KACC 83076BP) produced a clear halo under pH 7 conditions and did not produce a clear halo under other pH conditions. In addition, the diameter of the clear halo was measured to be approximately 35 mm under pH 7 and 28 days of culture.

[0091] Referring to Fig. 4e, under PBAT and culture conditions of 7 to 28 days, Papiliotrema Laurenti ( Papiliotrema laurentii The strain ) 62UF-13 (accession number: KACC 83076BP) produced a clear zone under pH 7 and pH 8 conditions, and it was confirmed that the PBAT degradation rate was higher in the order of pH 7, followed by pH 8, under culture conditions ranging from 14 to 28 days. In particular, a higher PBS degradation rate was observed under pH 7 conditions compared to other pH concentrations, and the diameter of the clear zone was measured to be approximately 14 mm under pH 7 and 28 days of culture. Accordingly, Papiliotrema Laurentii ( Papiliotrema laurentii The PBS, PBAT, and PLA degradation ability of strain 62UF-13 (accession number: KACC 83076BP) is optimal under pH 7 conditions, and Papiliotrema Laurenti ( Papiliotrema laurentii The PCL degradation ability of the 62UF-13 strain is optimal under pH 6 to pH 8 conditions, and Papiliotrema Laurenti ( Papiliotrema laurentii It was confirmed that the PHA degradation ability of strain 62UF-13 (accession number: KACC 83076BP) showed optimal effect under pH 8 conditions.

[0092] FIGS. 5a to 5e are graphs showing the length of the diameter of the clear ring produced by the 62UF-13 strain in each minimum medium set to different temperatures and different biodegradable plastic conditions according to one embodiment of the present invention.

[0093] Referring to FIGS. 5a to 5e, the size of the clear halo formed as the 62UF-13 strain (accession number: KACC 83076BP) grows under different temperature conditions according to one embodiment of the present invention can be observed.

[0094] More specifically, the papillotrema Laurenti of the present invention ( Papiliotrema laurentii It was confirmed that the strain 62UF-13 (accession number: KACC 83076BP) formed a clear halo by degrading 0.1% PBS, 0.2% PCL, 0.1% PHA, and 0.1% PLA when cultured in a minimal medium containing an emulsion with a single carbon source at 20°C to 50°C, for 7 to 28 days, and under pH 7 conditions.

[0095] Referring to Fig. 5a, under PBS and culture conditions of 7 to 28 days, Papiliotrema Laurenti ( Papiliotrema laurentii It was confirmed that the strain 62UF-13 (accession number: KACC 83076BP) produced a clear halo under conditions of 20 ℃ to 37 ℃, but failed to produce a clear halo under conditions of 50 ℃, and that the PBS degradation rate was high in the order of 30 ℃, 28 ℃, 20 ℃, and 37 ℃ under conditions of 7 to 28 days of culture. In particular, a high PBS degradation rate was observed under conditions of 28 ℃ and 30 ℃ compared to other temperature concentrations, and it was measured that the diameter of the clear halo under conditions of 28 ℃ and 28 days of culture was approximately 72 mm, and the diameter of the clear halo under conditions of 30 ℃ and 28 days of culture was approximately 74 mm.

[0096] Referring to Fig. 5b, under PCL and culture conditions of 7 to 28 days, Papiliotrema Laurenti ( Papiliotrema laurentiiIt was confirmed that the strain 62UF-13 (accession number: KACC 83076BP) produced a clear halo under conditions of 20 ℃ to 37 ℃, but failed to produce a clear halo under conditions of 50 ℃, and that the PCL degradation rate was high in the order of 28 ℃, 30 ℃, 20 ℃, and 37 ℃ under conditions of 7 to 28 days of culture. In particular, significantly higher PCL degradation rates were observed under conditions of 28 ℃ and 30 ℃ compared to other temperature concentrations, and the diameter of the clear halo was measured to be approximately 35 mm under conditions of 28 ℃ and 28 days of culture, and approximately 34 mm under conditions of 30 ℃ and 28 days of culture.

[0097] Referring to Fig. 5c, under PHA and culture conditions of 7 to 28 days, Papiliotrema Laurenti ( Papiliotrema laurentii It was confirmed that the strain 62UF-13 (accession number: KACC 83076BP) produced a clear halo under conditions of 20 ℃ to 37 ℃, but failed to produce a clear halo under conditions of 50 ℃, and that the PHA degradation rate was high in the order of 28 ℃, 20 ℃, 30 ℃, and 37 ℃ under conditions of 7 to 28 days of culture. In particular, a high PHA degradation rate was observed at 28 ℃ compared to other temperature concentrations, and the diameter of the clear halo under conditions of 28 ℃ and 28 days of culture was measured to be approximately 32 mm.

[0098] Referring to Fig. 5d, under conditions of PLA and culture for 14 to 28 days, Papiliotrema Laurenti ( Papiliotrema laurentiiThe strain 62UF-13 (accession number: KACC 83076BP) produced a clear halo under conditions of 20°C to 37°C, but failed to produce a clear halo under conditions of 50°C. Additionally, it was confirmed that under conditions of 7 to 21 days of culture, the PLA degradation rate was high in the order of 28°C, 30°C, 20°C, and 37°C, and under conditions of 28 days of culture, the PLA degradation rate was high in the order of 20°C, 28°C, 30°C, and 37°C. In particular, under the condition of 28°C, an overall high PLA degradation rate was observed compared to other temperature concentrations, and the diameter of the clear halo under conditions of 28°C and 28 days of culture was measured to be approximately 35 mm. However, the highest PLA degradation ability was observed under conditions of 20°C and 28 days of culture, with the diameter of the clear halo measured to be approximately 37 mm.

[0099] Referring to Fig. 5e, under PBAT and culture conditions of 7 to 28 days, Papiliotrema Laurenti ( Papiliotrema laurentii It was confirmed that the strain 62UF-13 (accession number: KACC 83076BP) produced a clear halo under conditions of 20 ℃ to 37 ℃, but failed to produce a clear halo under conditions of 50 ℃, and that PBAT degradation rates appeared in the order of 30 ℃, 37 ℃, 28 ℃, and 20 ℃ under conditions of 14 to 28 days of culture. In particular, the PBAT degradation rate appeared faster under conditions of 30 ℃ and 37 ℃ compared to other temperature concentrations, and it was measured that the diameter of the clear halo under conditions of 30 ℃ and 28 days of culture was approximately 16 mm, and the diameter of the clear halo under conditions of 20 ℃ and 28 days of culture was approximately 17 mm.

[0100] Accordingly, Papiliotrema Laurenti ( Papiliotrema laurentii The PBS, PBAT, and PCL degradation ability of strain 62UF-13 (accession number: KACC 83076BP) is optimal under conditions of 28 ℃ and 30 ℃, and Papiliotrema Laurenti ( Papiliotrema laurentiiThe PHA degradation ability of strain ) 62UF-13 (Accession No.: KACC 83076BP) shows optimal effect under conditions of 28 ℃, and Papiliotrema Laurenti ( Papiliotrema laurentii It was confirmed that the PLA degradation ability of strain 62UF-13 (accession number: KACC 83076BP) showed optimal effects under conditions of 20 ℃ and 28 ℃.

[0101] From the foregoing, those skilled in the art will understand that various changes and modifications are possible within the scope of the technical concept of the present invention. Accordingly, the technical scope of the present invention is not limited to the contents described in the detailed description of the specification, but must be determined by the claims.

[0102] Depository Name: National Institute of Agricultural Sciences, Rural Development Administration, Microbial Bank (KACC) Accession Number: KACC83076BP Date of Deposit: 2023-03-07

Claims

Claim 1 Papilliotrema Laurenti having degradability for at least one of polybutylene adipate terephthalate (PBAT), polyhydroxyalkanoate (PHA), and polylactic acid (PLA) Papiliotrema laurentii ) 62UF-13 (Accession No.: KACC 83076BP) strain. Claim 2 In claim 1, the strain is characterized by having an ITS nucleotide sequence represented by SEQ ID NO. 1, Papillotrema Laurenti ( Papiliotrema laurentii ) 62UF-13 (Accession No.: KACC 83076BP) strain. Claim 3 In claim 1, the strain further comprises a Papillotrema Laurentii having polybutylene succinate (PBS) degradation ability ( Papiliotrema laurentii ) 62UF-13 (Accession No.: KACC 83076BP) strain. Claim 4 In claim 3, the strain further comprises Papiliotrema Laurenti (which includes polycaprolactone (PCL) degradation ability) Papiliotrema laurentii ) 62UF-13 (Accession No.: KACC 83076BP) strain. Claim 5 A composition for degrading polylactic acid, comprising as an active ingredient a strain according to any one of claims 1 to 4, a culture medium of said strain, or all of these. Claim 6 A composition for polylactic acid decomposition according to claim 5, wherein the culture solution is prepared by culturing the strain under conditions of 20°C to 30°C and pH 6 to pH 8. Claim 7 A composition for promoting the degradation of polyhydroxyalkanoates, comprising as an active ingredient a strain according to any one of claims 1 to 4, a culture medium of said strain, or all of these. Claim 8 A method for degrading polybutylene adipate terephthalate (PBAT), comprising the step of treating polybutylene adipate terephthalate (PBAT) with one or more selected from the group consisting of a strain according to claim 1, a culture medium of said strain, a composition containing said strain, and a composition containing a culture medium of said strain. Claim 9 Papilliotrema Laurenti having degrading ability for polybutylene succinate (PBS) and polycaprolactone (PCL) Papiliotrema laurentii ) 62UF-13 (Accession No.: KACC 83076BP) strain. Claim 10 A composition for degrading polycaprolactone comprising, as an active ingredient, a strain according to claim 9, a culture medium of said strain, or all of these. Claim 11 A method for degrading polybutylene succinate, comprising the step of treating polybutylene succinate (PBS) with one or more selected from the group consisting of a strain according to claim 9, a culture medium of said strain, a composition containing said strain, and a composition containing a culture medium of said strain.

Images