Composition for Skin Soothing, Skin Regeneration, and Improvement of Skin Aging Comprising Lonicera japonica -Derived Exosomes as an Active Ingredient, and Method for Preparing the Same

Abstract

The present invention relates to a composition for improving skin condition comprising exosomes derived from honeysuckle (Lonicera japonica) as an active ingredient. The exosomes derived from *Lonicera japonica* provided by the present invention exhibit excellent anti-inflammatory effects due to nitric oxide production inhibition activity, antioxidant effects due to reduction of reactive oxygen species caused by UV, skin barrier improvement effects due to increased filaggrin gene expression, moisturizing effects due to increased HAS2 (Hyaluronan synthase 2) gene expression, skin soothing effects due to decreased Vascular Endothelial Growth Factor (VEGF) gene expression, whitening effects due to extracellular melanin inhibition activity, wrinkle improvement effects due to increased Collagen type I alpha 1 chain (COL1A1) gene expression, skin regeneration and wound healing effects due to reduction of intercellular gaps via wound healing assay, and efficacy against atopic dermatitis due to inhibition of Thymus and Activation-Regulated Chemokine (TARC) production; therefore, they are suitable for use in cosmetics for improving skin condition or in pharmaceuticals for anti-inflammatory, wound healing, and the prevention or treatment of atopic dermatitis. It has excellent effects as a composition.

Description

Technology Field

[0001] The present invention relates to honeysuckle vines ( Lonicera japonica The present invention relates to a composition for improving skin condition containing exosomes derived from ) as an active ingredient. Background Technology

[0002] Skin aging is classified into intrinsic aging, which progresses due to genetic and physiological changes over time, and extrinsic aging, which is accelerated by external environmental factors such as ultraviolet rays, air pollution, oxidative stress, and lifestyle habits. Recent research on skin aging has highlighted the importance of the concept of "skin longevity" or "healthy skin aging," which goes beyond simply improving external changes such as wrinkles, loss of elasticity, and pigmentation to maintaining a healthy skin condition for a long period through maintaining skin cell homeostasis, inhibiting oxidative damage, alleviating chronic inflammatory responses, delaying cellular aging, and preserving skin barrier function.

[0003] The skin is a biological barrier organ continuously exposed to the external environment. Ultraviolet radiation and environmental stress lead to an increase in reactive oxygen species (ROS), which can induce the production of inflammatory cytokines, senescence, mitochondrial dysfunction, degradation of the extracellular matrix (ECM), and weakening of the skin barrier function. In particular, photoaging caused by UV radiation results in structural damage to the dermal ECM through reduced collagen synthesis and increased expression of matrix metalloproteinases (MMPs); this is known to be a major cause of wrinkle formation, decreased elasticity, skin roughness, and pigmentation abnormalities. Therefore, materials for improving skin aging need to be developed beyond simple temporary moisturizing or antioxidant effects to maintain long-term skin health by regulating intercellular signaling, suppressing inflammatory responses, protecting the ECM, restoring the skin barrier, and creating an environment for cell regeneration.

[0004] Recently, extracellular vesicles (EVs), including exosomes, have garnered attention as nano-sized biological vesicles that mediate intercellular signaling. EVs can contain proteins, lipids, nucleic acids, and various bioactive substances, and their phospholipid bilayer structure protects internal active ingredients from the external environment and enables interaction with target cells. Due to these characteristics, EVs are being studied as next-generation biomaterials for regulating skin cell homeostasis, alleviating inflammation, tissue regeneration, and delivering bioactive substances.

[0005] In particular, plant-derived extracellular vesicles possess the advantages of excellent biocompatibility as naturally derived materials, lower ethical and environmental burdens compared to animal-derived ingredients, and high potential for expansion into skin application materials. Extracellular vesicles derived from plants can contain various physiologically active components inherent to plants, such as polyphenols, flavonoids, organic acids, lipids, and plant-specific biomolecules; therefore, they have the potential to be utilized as materials capable of delivering the plant's inherent antioxidant, anti-inflammatory, barrier protection, and skin damage alleviation effects in the form of nanovesicles.

[0006] The honeysuckle vine intended for use in the present invention ( Lonicera japonica Lonicera japonica is a plant that has traditionally been widely used as the herbal medicine 'Geum-eun-hwa,' and various physiological activities, including anti-inflammatory, antioxidant, and antibacterial properties, have been reported. Lonicera japonica contains chlorogenic acid, luteolin, luteolin glycosides, and various flavonoid compounds; these components are known as functional ingredients associated with inhibiting oxidative stress, alleviating inflammatory responses, and protecting against skin damage. In particular, chlorogenic acid has been reported as a substance capable of mitigating UV-induced photoaging damage, and Lonicera japonica extract has also been suggested to have the potential to inhibit MMP-1, which is involved in collagen degradation in skin fibroblasts. In this regard, Lonicera japonica holds high value as a plant material capable of comprehensively regulating oxidative damage, inflammatory aging, ECM degradation, and skin barrier deterioration from the perspective of skin longevity.

[0007] Exosomes or extracellular vesicles derived from raw honeysuckle possess the advantage of utilizing both the physiologically active components inherent to the plant and the characteristics of nano-vesicles derived from plant tissues. Specifically, exosomes obtained from raw honeysuckle may contain the plant's inherent antioxidant and anti-inflammatory components as well as skin-protection-related biomolecules; through this, they can contribute to inhibiting oxidative damage to skin cells, alleviating inflammatory responses, suppressing collagen degradation, supporting skin barrier function, and enhancing skin defense against external stress. Furthermore, based on the traditional usage experience and physiological activity of the natural plant material honeysuckle, exosomes derived from raw materials have high potential for application as natural functional cosmetic ingredients.

[0008] Meanwhile, many existing technologies related to plant-derived exosomes or exosome-like vesicles consider vesicular particles obtained through filtration and centrifugation after juicing, grinding, or extracting plant material as exosomes. This approach carries the risk of including intracellular organelles, membrane fragments, polymer complexes, and other impurities derived from the plant tissue crushing process, and therefore needs to be distinguished from extracellular vesicles naturally secreted by cells. Furthermore, since the component composition and functionality can vary depending on the cultivation environment, harvest time, plant part, and extraction conditions of the raw material, the homogeneity, reproducibility, and mass production of the raw material remain important technical challenges for industrial application.

[0009] As an alternative or complementary technology to this, a technique involving the induction and proliferation of honeysuckle callus in a sterile and controlled environment using plant tissue culture technology, and the isolation and purification of exosomes derived from callus cells, is worth noting. As a population of undifferentiated plant cells, callus offers the advantages of standardizing culture conditions, minimizing external contamination factors, and enabling the continuous production of biomaterials of consistent quality based on the same cell line. In particular, exosomes derived from honeysuckle callus can be utilized as a material that can stably secure the inherent physiological activity of honeysuckle cells and the delivery characteristics of extracellular vesicles while reducing variations caused by the cultivation region, harvest time, and growth environment of the raw material.

[0010] When obtaining exosomes naturally secreted by cells from honeysuckle callus culture medium or suspension culture medium, the homogeneity of the raw material, production reproducibility, and identity as a biological carrier can be more clearly secured compared to existing plant juice or extract-based vesicles. In addition, since callus-derived exosomes can be produced under sterile culture conditions, they are advantageous in terms of safety, quality control, and industrial mass production as cosmetic ingredients, and they have the advantage of being able to optimize the yield, particle characteristics, and physiological activity of exosomes by controlling plant cell culture conditions.

[0011] Korean Registered Patent No. 2327847 disclosed a cosmetic composition for skin moisturization containing honeysuckle extract and Aster tataricus extract as active ingredients, and Korean Registered Patent No. 2009604 disclosed an antibacterial composition containing honeysuckle extract and Magnolia bark extract. However, the above prior art relates to the application of honeysuckle extract itself, and is technically different from a composition for improving skin condition containing exosomes isolated from raw honeysuckle or exosomes derived from tissue-cultured honeysuckle callus as active ingredients.

[0012] Furthermore, to date, there have been limited cases of directly isolating exosomes derived from honeysuckle and applying them as compositions for preventing skin aging or improving skin condition. In particular, technology utilizing the specific characteristics of exosomes derived from the raw honeysuckle plant and exosomes derived from honeysuckle callus for maintaining skin cell homeostasis, antioxidant, anti-inflammatory, collagen protection, barrier strengthening, and skin regeneration promotion has not been sufficiently established. Exosomes derived from the raw plant have the advantage of utilizing the unique natural physiological activity of the honeysuckle plant in the form of nanovesicles, while exosomes derived from callus are distinguished by being extracellular vesicle materials that can be produced homogeneously and reproducibly under controlled culture conditions.

[0013] Accordingly, the present invention suggests the possibility of utilizing high-functional natural nanomaterials that are clearly distinguishable from existing simple plant extract or plant juice-based exosome-like vesicle technologies by isolating and purifying exosomes derived from the raw honeysuckle plant and / or exosomes derived from tissue-cultured honeysuckle callus, and by providing a composition for improving skin condition that includes these as active ingredients.

[0014] Furthermore, the present invention has industrial and technical significance as a skin longevity-based skin improvement technology that aims to maintain the healthy function of skin cells and preserve long-term skin homeostasis, going beyond the simple improvement of signs of skin aging, by combining the antioxidant and anti-inflammatory physiological activities of honeysuckle with the biocompatible delivery characteristics of exosomes. In particular, exosomes derived from the raw material can emphasize the unique natural functionality of honeysuckle, while callus-derived exosomes can emphasize homogeneity, reproducibility, aseptic production, and the possibility of mass production; thus, the two materials can be utilized independently or complementarily as compositions for preventing skin aging, skin regeneration, strengthening the skin barrier, improving skin elasticity, and improving overall skin condition.

[0015] Accordingly, the inventors of the present invention (honeysuckle vine) Lonicera japonicaThe present invention was completed upon discovering that exosomes derived from ) can simultaneously provide an anti-inflammatory effect due to the activity of inhibiting nitric oxide production, an antioxidant effect due to the reduction of reactive oxygen species caused by UV, a skin barrier improvement effect due to increased filaggrin gene expression, a moisturizing effect due to increased HAS2 (Hyaluronan synthase 2) gene expression, a skin soothing effect due to decreased Vascular Endothelial Growth Factor (VEGF) gene expression, a whitening effect due to the activity of inhibiting extracellular melanin, a wrinkle improvement effect due to increased Collagen type I alpha 1 chain (COL1A1) gene expression, skin regeneration and wound healing effects due to the reduction of intercellular gaps through a wound healing assay, and an improvement, prevention, and treatment effect of atopic dermatitis due to the activity of inhibiting the production of Thymus and Activation-Regulated Chemokine (TARC). The problem to be solved

[0016] The objective of the present invention is to provide a cosmetic composition for anti-inflammatory, antioxidant, skin barrier improvement, skin moisturization, skin soothing, whitening, skin elasticity, wrinkle improvement, skin regeneration, and improvement of atopic dermatitis, comprising a plant-derived active ingredient.

[0017] Another objective of the present invention is to provide a pharmaceutical composition for the prevention or treatment of inflammation, wound healing, and atopic dermatitis comprising a plant-derived active ingredient. means of solving the problem

[0018] To achieve the above objective, the present invention relates to honeysuckle vines ( Lonicera japonica The present invention provides a cosmetic composition for anti-inflammatory, antioxidant, skin barrier improvement, skin moisturization, skin soothing, whitening, skin elasticity, wrinkle improvement, skin regeneration, and improvement of atopic dermatitis, comprising exosomes derived from ) as an active ingredient.

[0019] The present invention also relates to honeysuckle vines ( Lonicera japonica The present invention provides a pharmaceutical composition for the prevention or treatment of inflammation, wound healing, and atopic dermatitis comprising exosomes derived from ) as an active ingredient.

[0020] The present invention also includes, (a) honeysuckle ( Lonicera japonica (a) a step of isolating the leaves of ); (b) a step of inducing and culturing callus from the isolated leaves; and (c) a step of isolating the callus and callus culture solution derived from the honeysuckle, mixing the isolated callus and callus culture solution, grinding them, and then separating and purifying them; characterized by comprising: (a) a honeysuckle ( Lonicera japonica The present invention provides a method for preparing a cosmetic composition for anti-inflammatory, antioxidant, skin barrier improvement, skin moisturization, skin soothing, whitening, skin elasticity, wrinkle improvement, skin regeneration, and improvement of atopic dermatitis, comprising callus-derived exosomes as an active ingredient. Effects of the invention

[0021] Honeysuckle vine provided by the present invention ( Lonicera japonicaExosomes derived from ) have excellent anti-inflammatory effects due to the activity of inhibiting nitric oxide production, antioxidant effects due to the reduction of reactive oxygen species caused by UV, skin barrier improvement effects due to increased filaggrin gene expression, moisturizing effects due to increased HAS2 (Hyaluronan synthase 2) gene expression, skin soothing effects due to decreased Vascular Endothelial Growth Factor (VEGF) gene expression, whitening effects due to the activity of inhibiting extracellular melanin, wrinkle improvement effects due to increased Collagen type I alpha 1 chain (COL1A1) gene expression, skin regeneration and wound healing effects due to reduced intercellular gaps through a wound healing assay, and excellent efficacy in improving, preventing, and treating atopic dermatitis due to the activity of inhibiting Thymus and Activation-Regulated Chemokine (TARC) production. Therefore, they are effective as cosmetic compositions for improving skin condition or as pharmaceutical compositions for anti-inflammatory, wound healing, and prevention or treatment of atopic dermatitis. Brief explanation of the drawing

[0022] FIG. 1 is a figure showing the results of confirming cell activity in mouse macrophages (RAW 264.7, a), mouse melanoma (B16F10, b), human keratinocytes (HaCaT, c) and human fibroblasts (CCD-986sk, d) for Examples 1-2 and Comparative Example 1 according to the present invention. FIG. 2 is a diagram showing the degree of nitric oxide production in mouse macrophages (RAW 264.7) to confirm the anti-inflammatory effect according to Examples 1 and 2 and Comparative Example 1 of the present invention. Figure 3 is a diagram showing the results of confirming the intracellular antioxidant effect according to Examples 1 and 2 and Comparative Example 1 of the present invention in human keratinocytes (HaCaT). Figure 4 is a diagram showing the results of confirming the mRNA expression level of filaggrin (FLG) in human keratinocytes (HaCaT) to confirm the skin barrier improvement effect according to Examples 1 and 2 and Comparative Example 1 of the present invention. Figure 5 is a diagram showing the results of confirming the degree of HAS2 (Hyaluronan synthase 2) mRNA expression in human keratinocytes (HaCaT) to confirm the moisturizing effect according to Examples 1 and 2 and Comparative Example 1 of the present invention. Figure 6 is a diagram showing the results of confirming the VEGF (Vascular Endothelial Growth Factor) gene expression levels in human keratinocytes (HaCaT) to confirm the skin soothing effect according to Examples 1 and 2 and Comparative Example 1 of the present invention. FIG. 7 is a diagram showing the degree of melanin production in mouse melanoma (B16F10) to confirm the whitening effect according to Examples 1 and 2 and Comparative Example 1 according to the present invention. FIG. 8 is a diagram showing the mRNA expression level of COL1A1 (Collagen type I alpha 1 chain) in human fibroblasts (CCD-986sk) to confirm the skin elasticity and wrinkle improvement effects according to Examples 1 and 2 and Comparative Example 1 according to the present invention. FIG. 9 is a diagram showing the results of a wound healing test conducted on human fibroblasts (CCD-986sk) to confirm the skin regeneration and wound healing effects according to Examples 1 and 2 and Comparative Example 1 of the present invention. FIG. 10 is a figure showing the results of confirming the amount of TARC (Thymus and Activation-regulated Chemokine) produced in human keratinocytes (HaCaT) to confirm the atopic improvement effect according to Examples 1 and 2 and Comparative Example 1 of the present invention. Specific details for implementing the invention

[0023] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by a skilled expert in the art to which this invention pertains. In general, the nomenclature used herein is well known and commonly used in the art.

[0024] Throughout this specification, when a part is described as "comprising" a certain component, this means that, unless specifically stated otherwise, it does not exclude other components but may include additional components.

[0025] As used herein, the term “Callus” refers to an unorganized mass of various parenchyma cells of a plant, which generally contains cells with typical functions. Additionally, calluses can be formed in various parts of a plant, such as flowers, leaves, stems, roots, and seeds. The formation and induction of calluses are typically carried out following methods officially recognized in the art. More specifically, the formation and induction of such calluses may be achieved by culturing plant tissue or explants thereof in a tissue culture medium.

[0026] The term "Exosomes" as used in this specification refers to nano-sized vesicles having a membrane structure that are secreted or released into the extracellular space from plant cells or plant stem cells, and preferably may be extracellular vesicles with an average particle size of 50 to 200 nm.

[0027] The term "extracellular vesicle" as used in this specification is a general term for membrane-bound vesicles secreted by cells for intercellular signaling, including exosomes, microvesicles, apoptotic bodies, etc.

[0028] The present invention relates to honeysuckle vines (Lonicera japonica) The present invention relates to a cosmetic composition containing derived exosomes as an active ingredient for anti-inflammatory, antioxidant, skin barrier improvement, skin moisturization, skin soothing, whitening, skin elasticity, wrinkle improvement, skin regeneration, and improvement of atopic dermatitis.

[0029] According to one embodiment of the present invention, the callus may be derived from the leaves of the honeysuckle.

[0030] According to one embodiment of the present invention, the exosome may be an extracellular vesicle having an average diameter of 50 to 200 nm.

[0031] Honeysuckle of the present invention (Lonicera japonica) In a cosmetic composition for anti-inflammatory, antioxidant, skin barrier improvement, skin moisturizing, skin soothing, whitening, skin elasticity, wrinkle improvement, skin regeneration, and improvement of atopic dermatitis containing callus-derived exosomes as an active ingredient, the exosomes derived from honeysuckle callus are 1.0 × 10⁻⁶ in the composition. 8 Up to 1.0×10 12 It may be contained at a particle / mL concentration, preferably 2.0×10 9 Up to 2.0×10 10 It may be contained at a particle / mL concentration, but is not limited thereto as long as it contains an effective amount capable of providing desirable honeysuckle callus-derived exosomes.

[0032] The exosomes are characterized by being extracellular vesicles with an average diameter of 50 to 200 nm. Since this is approximately 250 to 600 times smaller than the size of skin pores (30 to 50 µm), they are easily absorbed into the pores. Therefore, it is desirable for exosomes derived from honeysuckle callus to be included within the above range of particle size and number, as the very small particle size allows them to easily pass through the pores without destroying the active ingredients within the cells, thereby increasing the absorption capacity into the skin.

[0033] Accordingly, the present invention can be applied to a cosmetic composition for anti-inflammatory, antioxidant, skin barrier improvement, skin moisturization, skin soothing, whitening, skin elasticity, wrinkle improvement, skin regeneration, and improvement of atopic dermatitis, comprising exosomes derived from honeysuckle as an active ingredient.

[0034] According to one embodiment of the present invention, the composition may be any one selected from the group consisting of skin, tonic, lotion, cream, soap, surfactant-containing cleansing, shampoo, rinse, conditioner, treatment, suspension, emulsion, ointment, paste, gel, oil, wax, spray, aerosol, mist, foundation, and powder, and more preferably may be a lotion or a cream.

[0035] According to one embodiment of the present invention, the composition may appropriately incorporate ingredients commonly used in cosmetic compositions, such as moisturizers, antioxidants, oily ingredients, UV absorbers, emulsifiers, surfactants, thickeners, alcohols, powder ingredients, colorants, aqueous ingredients, water, various skin nutrients, etc., as needed, within a range that does not impair the effects of the present invention.

[0036] According to one embodiment of the present invention, the composition may be used by mixing conventionally used skin improving agents and / or moisturizers with exosomes derived from honeysuckle callus, to the extent that their effects (e.g., antioxidant, anti-inflammatory, moisturizing, wrinkle improvement, whitening, skin barrier improvement, skin soothing, skin regeneration, improvement of atopic dermatitis, etc.) are not impaired.

[0037] According to one embodiment of the present invention, the composition can be applied to various forms, such as, for example, a patch, a mask pack, a mask sheet, a cream, a tonic, an ointment, a suspension, an emulsion, a paste, a lotion, a gel, an oil, a pack, a spray, an aerosol, a mist, a foundation, a powder, an oil blotting paper, etc.

[0038] According to one embodiment of the present invention, the cosmetic formulation may be used for purposes such as anti-inflammatory, antioxidant, skin barrier improvement, moisturizing, skin soothing, whitening, skin elasticity, wrinkle improvement, skin regeneration, and atopic dermatitis, and the cosmetic formulation may be manufactured in any formulation conventionally manufactured in the industry. For example, it may be formulated into a patch, mask pack, mask sheet, softening lotion, nourishing lotion, astringent lotion, nourishing cream, massage cream, eye cream, cleansing cream, essence, eye essence, cleansing lotion, cleansing foam, cleansing water, sunscreen, lipstick, soap, shampoo, surfactant-containing cleansing, bath additive, body lotion, body cream, body oil, body essence, body cleanser, hair dye, hair tonic, etc., but is not limited thereto.

[0039] According to one embodiment of the present invention, the composition comprises ingredients commonly used in cosmetic compositions, and may include, for example, conventional auxiliary agents such as antioxidants, stabilizers, solubilizers, vitamins, pigments, and fragrances, as well as carriers. In addition, for each formulation of the cosmetic composition, other ingredients can be appropriately selected and combined by a person skilled in the art without difficulty depending on the type of cosmetic composition or the purpose of use.

[0040] In addition, the present invention relates to honeysuckle vines ( Lonicera japonica ) The present invention relates to a pharmaceutical composition for the prevention or treatment of inflammation, wound healing, and atopic dermatitis containing derived exosomes as an active ingredient.

[0041] According to one embodiment of the present invention, the composition may be administered or treated by microneedling, injection, iontophoresis, electroporation, ultrasound, high frequency, microcurrent and application, or a combination thereof.

[0042] According to one embodiment of the present invention, the pharmaceutical composition may be any one selected from the group consisting of a patch formulation, a spray formulation, a liquid formulation, an injection formulation, and an injectable formulation.

[0043] When used as a pharmaceutical composition of the present invention for the prevention or treatment of inflammation, wound healing, and atopic dermatitis, it may include pharmaceutically acceptable carriers, excipients, or diluents. Examples of said carriers, excipients, and diluents include, but are not limited to, lactose, dextrose, trehalose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium carbonate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, etc. Furthermore, the effective amount of the pharmaceutical composition of the embodiments of the present invention refers to the amount required for administration to expect anti-inflammatory, wound healing, and preventive or therapeutic effects for atopic dermatitis.

[0044] As described above, the honeysuckle vine provided by the present invention ( Lonicera japonica ) The derived exosomes have excellent efficacy as cosmetic compositions for improving skin condition or as pharmaceutical compositions for anti-inflammatory, wound healing, and prevention or treatment of atopic dermatitis, as well as for anti-inflammatory, wound healing, and prevention or treatment of atopic dermatitis, due to their excellent effects such as: an anti-inflammatory effect due to the activity of inhibiting nitric oxide production; an antioxidant effect due to the reduction of reactive oxygen species caused by UV; an effect of improving the skin barrier due to increased filaggrin gene expression; a moisturizing effect due to increased HAS2 (Hyaluronan synthase 2) gene expression; a skin soothing effect due to decreased Vascular Endothelial Growth Factor (VEGF) gene expression; a whitening effect due to the activity of inhibiting extracellular melanin; a wrinkle improvement effect due to increased Collagen type I alpha 1 chain (COL1A1) gene expression; skin regeneration and wound healing effects due to the reduction of intercellular gaps through a wound healing assay; and an excellent effect of improving, preventing, and treating atopic dermatitis due to the activity of inhibiting the production of Thymus and Activation-Regulated Chemokine (TARC).

[0045] In addition, the present invention (a) honeysuckle vine ( Lonicera japonica (a) a step of isolating the leaves of ); (b) a step of inducing and culturing callus from the isolated leaves; and (c) a step of isolating the callus and callus culture solution derived from the honeysuckle, mixing the isolated callus and callus culture solution, grinding them, and then separating and purifying them; characterized by comprising: (a) a honeysuckle ( Lonicera japonica The present invention relates to a method for preparing a cosmetic composition for anti-inflammatory, antioxidant, skin barrier improvement, skin moisturization, skin soothing, whitening, skin elasticity, wrinkle improvement, skin regeneration, and improvement of atopic dermatitis, comprising callus-derived exosomes as an active ingredient.

[0046] In the present invention, honeysuckle vine ( Lonicera japonicaThe step of separating the leaves of the honeysuckle includes separating the leaves of the honeysuckle, sequentially performing surface sterilization and disinfection using ethanol and an aqueous sodium hypochlorite solution, and washing with sterile water. The washed leaf or stem tissue is incised into sections of a size suitable for tissue culture using sterile tools, and all subsequent operations are performed under aseptic conditions.

[0047] Next, the prepared explants are placed on MS basal medium containing auxin and / or cytokinin-based plant growth regulators and cultured under dark conditions to induce callus formation. The induced callus is selected and proliferated into a superior cell line with uniformity and excellent proliferative capacity through several subcultures on a solid medium of the same composition. The selected superior cell line is then suspended in a liquid medium containing an appropriate growth regulator, and subsequently cultured in large quantities using a bioreactor to obtain a honeysuckle callus culture.

[0048] A mass-cultured honeysuckle callus culture is filtered to separate the callus (solid) from the culture medium. The separated callus and culture medium are then mixed in a specific ratio and ground using a homogenizer to obtain a homogenized liquid. The obtained homogenized liquid is subjected to low-speed centrifugation to remove coarse impurities such as cell debris, and then the exosomes are concentrated and precipitated by stepwise centrifugation using an ultracentrifuge. Finally, the pellet containing the precipitated exosomes is resuspended in sterile distilled water and filtered and sterilized using a sterile filter to obtain honeysuckle callus-derived exosomes.

[0049] The present invention will be described in more detail below through examples. These examples are intended solely to explain the present invention more specifically, and it will be obvious to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention.

[0050] <Example 1> Preparation of exosomes derived from honeysuckle callus

[0051] (1) In vitro introduction of honeysuckle and callus culture

[0052] Honeysuckle leaves were immersed in 95% ethanol for 60 seconds, disinfected with a disinfectant solution (50% bleach + 0.1% Tween-20) for 20 minutes, and washed five times with sterile water. After washing, tissue sections were prepared using a sharp knife. Callus was induced by incubating in the dark on a basic MS medium containing vitamins, as well as on a medium containing 1 mg / L 2,4-dichlorophenoxyacetic acid, 3.0% sucrose, and 0.35% Gelrite, which showed high callus induction rates. Callus induction rates for other hormone treatments are shown in [Table 1]. Superior cell lines were selected from the calluses by subculturing them 6 to 7 times at 4-week intervals on solid media. To culture the selected superior cell lines in large quantities, they were suspended in a liquid medium containing the appropriate hormone at a shaker speed of 120 rpm for 4 weeks. At the time suspension culture was completed, a honeysuckle callus culture solution was prepared by liquid culturing in a 10L bioreactor with an air supply of 0.2 vvm for 4 weeks under conditions of 25℃ temperature and 60% humidity.

[0053] Basic MS (%) Sucrose (%) Gelrite(%) Cytokinin (mg / L) Auxin (mg / L) Callus formation rate (%) Callus proliferation rate 6-BA kinetin NAA 2, 4-D A 0.44 3 0.35 0.0 0.0 0.0 1.0 94.6 +++ B 0.44 3 0.35 0.1 0.0 1.0 0.1 89.9 +++ C 0.44 3 0.35 0.5 0.0 0.0 0.5 88.6 +++ D 0.44 3 0.35 0.0 0.2 0.3 1.0 90.3 +++

[0054] The callus formation rate was calculated as (number of callus-forming individuals / total number of cultured individuals) × 100%, and the callus proliferation rate was measured daily by induced calluses and classified into very good (+++), average (++), and poor (+).

[0055] (2) Preparation of exosomes derived from honeysuckle callus

[0056] A mass-cultured honeysuckle callus culture was filtered to separate the callus and the culture medium. Then, 5% by weight of the obtained callus and 95% by weight of the culture medium were mixed and ground to obtain a ground liquid. Impurities were removed from the obtained ground liquid using a centrifuge. Centrifugation was performed twice at 3,000–4,000 ×g for 10 minutes, and only the supernatant was collected, excluding the pellet layer. The supernatant obtained in this process was centrifuged using an ultracentrifuge at 10,000–15,000 ×g for 30–60 minutes. To further increase the purity of the obtained supernatant, the supernatant was filtered to separate and remove residues. Exosomes present in the high-purity supernatant were centrifuged using an ultra-high-speed centrifuge at 100,000–150,000 ×g for 2 hours, and the exosomes were precipitated into a pellet layer. The exosomes in the final pellet layer were resuspended and dispersed in sterile distilled water to produce exosomes. Finally, the exosomes were sterilized using a 0.2 μm syringe filter to produce exosomes derived from honeysuckle callus.

[0057] <Example 2> Isolation of Exosomes from Raw Honeysuckle

[0058] 5% by weight of the fresh weight of honeysuckle leaves and 95% by weight of sterile distilled water were mixed and ground to obtain a ground liquid. The obtained ground liquid was centrifuged to remove impurities. It was centrifuged sequentially at 1,000–2,000 ×g for 10–20 minutes and at 3,000–4,000 ×g for 10–20 minutes, and only the supernatant was collected after excluding the pellet layer. The supernatant obtained in this process was centrifuged using an ultracentrifuge at 10,000–15,000 ×g for 30–60 minutes, and to further increase the purity of the obtained supernatant, the supernatant was filtered to separate and remove residues. Exosomes present in the high-purity supernatant were centrifuged using an ultra-high-speed centrifuge at 100,000–150,000 ×g for 2–4 hours, and the exosomes were precipitated into a pellet layer. The exosomes in the final pellet layer were redispersed and dispersed in sterile distilled water to produce exosomes. Finally, the exosomes were sterilized using a 0.2 μm syringe filter to produce the final exosomes derived from the honeysuckle plant material.

[0059] <Comparative Example 1> Preparation of Honeysuckle Extract

[0060] 1g of dried honeysuckle leaf powder was placed in a container, 100g of purified water was added, and hot water extraction was performed at 90–120℃ for 2–4 hours. After extraction, solids were removed by filtering through a 300 mesh filter, and the filtrate was filtered once more through a 0.2㎛ syringe filter to prepare the honeysuckle extract. The extract was set to 100% and diluted to 10%, 1%, and 0.1% to evaluate efficacy at concentrations equivalent to exosome concentrations.

[0061] <Experimental Example 1> Analysis of Exosome Characteristics

[0062] To quantitatively analyze the size and concentration (particle size, number of particles) of the exosomes isolated in Examples 1 and 2, measurements were taken using a nano-tracking analyzer (NTA, ZetaView MONO, Particle Metrix), and analysis was performed using ZetaView software, the analysis program of this instrument.

[0063] As a result, Example 1 had an average particle size of 135.9 nm and a particle concentration of 1.65 × 10⁻⁶ 11 Particles / mL, Example 2 has an average particle size of 141.3 nm and a particle concentration of 1.4 × 10⁻⁶ 10 It was confirmed to be particles / mL. Based on the measured particle concentration, 1.0×10 10 The product diluted to particles / mL was used in another experimental example as 100%.

[0064] <Experimental Example 2> Cytotoxicity Evaluation: WST-1 assay

[0065] For the in-vitro efficacy experiments of Examples 1 and 2 and Comparative Example 1, each cell line was treated at different concentrations to determine whether it had toxicity to the cells.

[0066] Cytotoxicity experiments were conducted on mouse macrophages (RAW 264.7), mouse melanoma cells (B16F10), human keratinocytes (HaCaT), and human fibroblasts (CCD-986sk). RAW 264.7, B16F10, and HaCaT cells were cultured in DMEM (Dulbecco's Modified Essential Medium) medium containing 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin (P / S), respectively, and CCD-986sk cells were cultured in IMDM (Iscove's Modified Dulbecco's Medium) medium containing 10% FBS and 1% P / S in an incubator at 37°C in a 5% carbon dioxide environment. Cultured cells were dispensed into 96-well plates at appropriate concentrations for each cell type and cultured in an incubator at 37°C with 5% carbon dioxide to adhere to the plates. After 24 hours, the medium was replaced with the medium of Examples 1–2 and Comparative Example 1 diluted to concentrations ranging from 0 to 10%, and cultured. After 24 hours, the medium was removed, and 10% WST-1 reagent was applied to each plate well. After reacting in the incubator for 2 hours, the absorbance value was measured at 450 nm using an ELISA Reader (BioTeck, US), and cell viability was confirmed according to the following [Equation 1].

[0067] [Mathematical Formula 1]

[0068] Cell viability (%) = [Absorbance of sample-treated group / Absorbance of control sample-treated group] × 100

[0069] As a result, as shown in Fig. 1, when Examples 1 and 2 and Comparative Example 1 were treated on RAW 264.7, B16F10, HaCaT, and CCD-986sk, no cytotoxicity was observed at any of the treated concentrations. For reference, Fig. 1a shows the results of the cytotoxicity evaluation on mouse macrophages (RAW 264.7), Fig. 1b shows the results of the cytotoxicity evaluation on mouse melanoma cells (B16F10), Fig. 1c shows the results of the cytotoxicity evaluation on human keratinocytes (HaCaT), and Fig. 1d shows the results of the cytotoxicity evaluation on human fibroblasts (CCD-986sk).

[0070] <Experimental Example 3> Anti-inflammatory Effect Test: NO Production Inhibition Test

[0071] To investigate the anti-inflammatory effects of Examples 1 and 2 and Comparative Example 1, the amount of nitric oxide (NO), an indicator of inflammatory response, was measured using mouse macrophage RAW 264.7 cells.

[0072] 2 × 10⁶ RAW 264.7 cells per well in a 24-well plate 5After dispensing the sample in the specified number, the cells were incubated for 24 hours in an incubator at 37°C and 5% carbon dioxide to allow attachment. The samples were prepared by diluting them to various concentrations in DMEM medium containing 1 μg / ml of lipopolysaccharide (LPS), an inflammatory inducer that promotes NO production. As a positive control, 50 μM N-Monomethyl-L-arginine acetate salt (L-NMMA) was prepared by dilution. After removing the culture medium from the cultured cells, the samples prepared by diluting them to various concentrations—Examples 1 and 2 and Comparative Example 1—and the positive control were treated and incubated for 24 hours in an incubator at 37°C and 5% carbon dioxide. After the culture was completed, the culture medium was collected and dispensed at a rate of 100 µl per well into a 96-well plate. Then, equal amounts of 50 µl of Griess reagent A (Naphthylethylene-diamine buffer) and 50 µl of Griess reagent B (Sulfanilamide buffer) were added to make a total of 200 µl. The mixture was reacted for 10 minutes, and the absorbance was measured at 540 nm. The amount of nitric oxide (NO) produced was determined using a standard curve constructed with nitrite diluted to different concentrations.

[0073] As a result, as shown in Figure 2, the amount of NO produced decreased in a concentration-dependent manner by Examples 1 and 2 and Comparative Example 1, and it was confirmed that the NO production inhibition activity of Examples 1 and 2 was superior to that of Comparative Example 1. In particular, when treated at a concentration of 10%, the effect of reducing NO production was confirmed to be 51.46% for Example 1, 34.13% for Example 2, and 12.96% for Comparative Example 1.

[0074] <Experimental Example 4> Antioxidant Effect: Intracellular Antioxidant Experiment

[0075] To confirm the antioxidant effects of Examples 1 and 2 and Comparative Example 1, the intracellular antioxidant effects were confirmed in human keratinocyte HaCaT cells using the H2DCFDA test method.

[0076] 1×10⁶ HaCaT cells in a 96-well plate 4 After dispensing the required number of samples, the cells were cultured for 24 hours in an incubator at 37°C under a 5% carbon dioxide environment to allow attachment, after which the medium was replaced with serum-free medium and cultured for another 24 hours. Subsequently, the samples were reacted with 5 mM CM-H2DCFDA at 37°C for 30 minutes, followed by treatment with 2 μM Trolox (as a positive control) diluted to the appropriate concentrations of Examples 1–2 and Comparative Example 1, and cultured for 1 hour in an incubator at 37°C under a 5% carbon dioxide environment. Next, UVB was applied at 500 mJ / cm² 2 After inducing the generation of reactive oxygen species by treatment, the samples were incubated for 1 hour in an incubator at 37°C with 5% carbon dioxide. After the reaction was complete, fluorescence intensity was measured at wavelengths of 488 nm for excitation and 528 nm for emission, and antioxidant capacity was evaluated according to the following [Equation 2].

[0077] [Mathematical Formula 2]

[0078] Intracellular reactive oxygen species production (%) = Fluorescence intensity of sample-treated group / Fluorescence intensity of control sample-treated group × 100

[0079] As a result, as shown in Figure 3, it was confirmed that the reactive oxygen species generated by UV in Examples 1 and 2 and Comparative Example 1 decreased in a concentration-dependent manner, and it was confirmed that the reactive oxygen species reduction effect of Examples 1 and 2 was superior to that of Comparative Example 1. In particular, when treated at a concentration of 10%, Example 1 showed a reactive oxygen species reduction effect of 29.95%, Example 2 showed 30.66%, and Comparative Example 1 showed 14.88%.

[0080] <Experimental Example 5> Skin Barrier Improvement Effect Test: Measurement of Filaggrin mRNA Expression Level

[0081] To confirm the skin barrier improvement effect of Examples 1 and 2 and Comparative Example 1, the mRNA expression level of filaggrin (FLG) was measured using human keratinocytes.

[0082] Human keratinocytes, HaCaT cells, were placed in a 24-well plate at a ratio of 1 × 10⁶ per well. 5 After dispensing the required number of samples, the cells were cultured for 24 hours in an incubator at 37°C with 5% carbon dioxide to allow for cell attachment. Subsequently, Examples 1–2 and Comparative Example 1, diluted to appropriate concentrations in serum-free medium, were added and reacted for 24 hours. RNA was then extracted according to the protocol of the NucleoSpin RNA Kit from Macherey-Nagel. Total RNA was quantified at 260 nm using a Nanodrop, and cDNA was synthesized in an amplifier using an appropriate amount of RNA. Finally, the expression level of the target gene was evaluated by performing a real-time polymerase chain reaction (RePCR) on a machine using a mixture of the synthesized cDNA, target gene-specific primers, and the cyanine dye CyberGreen (SYBR Green supermix). The primer sequences and reaction conditions for the target gene are shown in Table 2 below, and the gene expression level was finally analyzed after correction for the β-actin gene.

[0083] Sequence number gene order Reaction conditions 1 FLG Forward direction 5' - GCTGAAGGAACTTCTGGAAAAG - 3' Polymerization reaction for 35 cycles under the conditions of polymerase activation at 95°C for 10 minutes, denaturing at 95°C for 15 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 30 seconds. 2 reverse direction 5' - GCCAACTTGAATACCATCAGAAG - 3' 3 β-actin Forward direction 5' - CATGAAGTGTGACGTGGACA - 3' 4 reverse direction 5' - CAGGGCAGTGATCTCCTTCT - 3'

[0084] As a result, as shown in Figure 4, it was confirmed that the expression amount of FLG increased in a concentration-dependent manner in Examples 1 and 2 and Comparative Example 1, and that the FLG expression-increasing activity of Examples 1 and 2 was superior to that of Comparative Example 1. In particular, when treated at a concentration of 10%, it was confirmed that Example 1 increased by 58.99%, Example 2 by 39.57%, and Comparative Example 1 by 22.15% compared to the untreated group.

[0085] <Experimental Example 6> Skin Moisturizing Activity Test: Measurement of HAS2 (Hyaluronan Synthase 2) mRNA Expression Level

[0086] To confirm the moisturizing improvement effect of Examples 1 and 2 and Comparative Example 1, the level of HAS2 (Hyaluronan Synthase 2) mRNA expression was checked using human keratinocyte HaCaT cells.

[0087] Human HaCaT keratinocytes were placed in a 24-well plate at a rate of 1 × 10⁶ per well. 5 After dispensing the required number of samples, the cells were cultured for 24 hours in an incubator at 37°C with 5% carbon dioxide to allow for cell attachment. Subsequently, Examples 1–2 and Comparative Example 1, diluted to appropriate concentrations in serum-free medium, were added and reacted for 24 hours. RNA was then extracted according to the protocol of the NucleoSpin RNA Kit from Macherey-Nagel. Total RNA was quantified at 260 nm using a Nanodrop, and cDNA was synthesized in an amplifier using an appropriate amount of RNA. Finally, the expression level of the target gene was evaluated by performing a real-time polymerase chain reaction (RePCR) on a machine using a mixture of the synthesized cDNA, target gene-specific primers, and the cyanine dye CyberGreen (SYBR Green supermix). The primer sequences and reaction conditions for the target gene are shown in Table 3 below, and the gene expression level was finally analyzed after correction for the β-actin gene.

[0088] Sequence number gene order Reaction conditions 5 HAS2 Forward direction 5' - GTCATGTACACAGCCTTCAGAGC - 3' Polymerization reaction for 35 cycles under the conditions of polymerase activation at 95°C for 10 minutes, followed by denaturation at 95°C for 15 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 30 seconds. 6 reverse direction 5' - ACAGATGAGGCTGGGTCAAGCA - 3' 3 β-actin Forward direction 5' - CATGAAGTGTGACGTGGACA - 3' 4 reverse direction 5' - CAGGGCAGTGATCTCCTTCT - 3'

[0089] As a result, as shown in Figure 5, it was confirmed that the expression amount of HAS2 increased in a concentration-dependent manner by Examples 1 and 2 and Comparative Example 1, and it was confirmed that the activity of increasing HAS2 expression in Examples 1 and 2 was superior to that of Comparative Example 1. In particular, when treated at a concentration of 10%, it was confirmed that Example 1 increased by 58.79%, Example 2 by 30.44%, and Comparative Example 1 by 19.88% compared to the untreated group.

[0090] <Experimental Example 7> Skin Soothing Improvement Effect Test: Measurement of VEGF mRNA Expression Level

[0091] To confirm the skin soothing improvement effect of Examples 1 and 2 and Comparative Example 1, the mRNA expression level of Vascular Endothelial Growth Factor (VEGF) was measured using HaCaT cells, which are human keratinocytes.

[0092] Human keratinocytes, HaCaT cells, were placed in a 24-well plate at a rate of 1 × 10⁶ per well. 5 After dispensing the required number of cells, they were cultured for 24 hours in an incubator at 37°C under a 5% carbon dioxide environment to allow cell attachment. Subsequently, UVA was applied at 0.5 J / cm² to establish skin irritation conditions. 2 The concentrations were investigated. Subsequently, Examples 1–2 and Comparative Example 1, diluted to appropriate concentrations, were treated in serum-free medium and reacted for 24 hours. Afterward, RNA was extracted according to the protocol of the NucleoSpin RNA Kit from Macherey-Nagel. Total RNA was quantified at 260 nm using a Nanodrop, and cDNA was synthesized in an amplifier using an appropriate amount of RNA. Finally, the expression level of the target gene was evaluated by performing a real-time polymerase chain reaction (RePCR) on a machine using a mixture of the synthesized cDNA, target gene-specific primers, and the cyanine dye CyberGreen (SYBR Green supermix). The primer sequences and reaction conditions for the target gene are shown in Table 4 below, and the gene expression level was finally analyzed after correction for the β-actin gene.

[0093] Sequence number gene order Reaction conditions 7 VEGF Forward direction 5' - CATCCAATCGAGACCCTGGT - 3' Polymerization reaction for 35 cycles under the conditions of polymerase activation at 95°C for 10 minutes, denaturing at 95°C for 15 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 30 seconds. 8 reverse direction 5'-ATCTCTCCTATGTGCTGGCC-3' 3 β-actin Forward direction 5' - CATGAAGTGTGACGTGGACA - 3' 4 reverse direction 5' - CAGGGCAGTGATCTCCTTCT - 3'

[0094] As a result, as shown in Figure 6, it was confirmed that the mRNA expression of VEGF was reduced in a concentration-dependent manner by Examples 1 and 2 and Comparative Example 1, and it was confirmed that the VEGF mRNA expression reduction activity of Examples 1 and 2 was superior to that of Comparative Example 1. In particular, when treated at a concentration of 10%, it was confirmed that Example 1 decreased by 56.49%, Example 2 by 32.48%, and Comparative Example 1 by 12.45% compared to the untreated group.

[0095] <Experimental Example 8> Whitening Efficacy Test: Analysis of Extracellular Melanin Content

[0096] To confirm the whitening effect of Examples 1 and 2 and Comparative Example 1, a test to measure extracellular melanin content was conducted using mouse melanoma cells, specifically B16F10 cells.

[0097] 3 × 10⁶ B16F10 cells per well in a 24-well plate 4 After dispensing the required amount, the cells were cultured for 24 hours in an incubator at 37°C and 5% carbon dioxide to allow attachment. Examples 1–2 and Comparative Example 1 were prepared by diluting them to various concentrations in DMEM medium (not containing Phenol red) containing alpha-MSH (α-Melanocyte Stimulation Hormone) to induce melanin production in the cells. As a positive control, β-Arbutin was prepared by diluting it to a concentration of 200 μg / ml. After removing the culture medium from the cultured cells, the samples prepared by dilution to various concentrations and the positive control were added, and the mixture was reacted for 48–72 hours in an incubator at 37°C and 5% carbon dioxide. Upon completion of culture, the culture medium was recovered, centrifuged, dispensed into a 96-well plate, and the absorbance at 490 nm was measured. After determining the amount of melanin using a standard curve made with melanin diluted to different concentrations, the production rate of melanin secreted extracellularly was calculated according to [Equation 3].

[0098] [Mathematical Formula 3]

[0099] Melanin production rate (%) = Amount of melanin in sample-treated group / Amount of melanin in blank-treated group × 100

[0100] As a result, as shown in Figure 7, the amount of extracellularly secreted melanin decreased in a concentration-dependent manner by Examples 1 and 2 and Comparative Example 1, and it was confirmed that the extracellular melanin reduction effect of Examples 1 and 2 was superior to that of Comparative Example 1. In particular, when treated at a concentration of 10%, the extracellular melanin reduction effect was confirmed to be 23.49% for Example 1, 19.04% for Example 2, and 10.25% for Comparative Example 1.

[0101] <Experimental Example 9> Effect on skin elasticity and wrinkle improvement: Effect on increasing COL1A1 mRNA expression

[0102] To investigate the skin elasticity and wrinkle improvement effects of Examples 1 and 2 and Comparative Example 1, the mRNA expression level of COL1A1, a factor related to Type 1 collagen production, was measured using human fibroblasts.

[0103] Human fibroblasts, CCD-986sk, were placed in a 24-well plate at a rate of 2 × 10⁶ per well. 4After dispensing the required number of samples, the cells were cultured for 24 hours in an incubator at 37°C with 5% carbon dioxide to allow attachment. Subsequently, Examples 1–2 and Comparative Example 1, diluted to appropriate concentrations in serum-free medium, were treated and reacted. As a positive control, hTGF-β (human Tumor Growth Factor-β) was treated at a concentration of 5 ng / mL. Subsequently, RNA was extracted from the cells treated with each sample according to the protocol of the NucleoSpin RNA Kit from Macherey-Nagel. Total RNA was quantified at 260 nm using a Nanodrop, and cDNA was synthesized in an amplifier using an appropriate amount of RNA. Finally, the expression level of the target gene was evaluated by performing a real-time polymerase chain reaction (RePCR) on a machine using a mixture of the synthesized cDNA, target gene-specific primers, and the cyanine dye CyberGreen (SYBR Green supermix). The primer sequences and reaction conditions of the target genes are shown in Table 5 below, and the expression levels of the genes were finally analyzed after correction for the β-actin gene.

[0104] Sequence number gene order Reaction conditions 9 COL1A1 Forward direction 5'-GACCTCAAGATGTGCCACTC-3' Polymerization reaction for 35 cycles under the conditions of polymerase activation at 95°C for 10 minutes, followed by denaturation at 95°C for 15 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 30 seconds. 10 reverse direction 5' - CCAGTCTCCATGTTGCAGAA - 3' 3 β-actin Forward direction 5' - CATGAAGTGTGACGTGGACA - 3' 4 reverse direction 5' - CAGGGCAGTGATCTCCTTCT - 3'

[0105] As a result, as shown in Figure 8, it was confirmed that the expression of COL1A1 increased in a concentration-dependent manner by Examples 1 and 2 and Comparative Example 1, and it was confirmed that the activity of increasing COL1A1 expression in Examples 1 and 2 was superior to that of Comparative Example 1. In particular, when treated at a concentration of 10%, compared to the untreated group, Example 1 showed a 57.64% increase in COL1A1 expression, Example 2 showed 38.44%, and Comparative Example 1 showed 12.98%.

[0106] <Experimental Example 10> Efficacy Test for Skin Regeneration and Wound Healing Improvement: Wound Healing assay

[0107] To investigate the skin regeneration and wound healing effects of Examples 1 and 2 and Comparative Example 1, a wound healing assay was performed using human fibroblasts.

[0108] Human fibroblasts, CCD-986sk, were placed in a 24-well plate containing a Wound Healing Insert at a rate of 5 × 10⁶ per well. 4 After dispensing the required number of samples, they were cultured for 24 hours in an incubator at 37°C with a 5% carbon dioxide environment. After confirming that the cells had grown to over 80% of the plate, the Wound Healing Insert was removed and washed with DPBS. Examples 1 and 2 and Comparative Example 1, diluted to an appropriate concentration in serum-free medium, were treated and reacted for 48 hours. Cell motility was confirmed by examining under a microscope to check the extent to which the artificially created gaps between cells were filled, and the cell gap recovery (Invaded Area) was calculated according to [Equation 4] below.

[0109] [Mathematical Formula 4]

[0110] Invaded Area (%) = 100 - (Area of ​​Sample Treatment Group / Area of ​​Control Sample Treatment Group) × 100

[0111] As a result, as shown in Fig. 9, it was confirmed that the intercellular space narrowed with Examples 1 and 2 and Comparative Example 1, and it was confirmed that the intercellular space recovery of Examples 1 and 2 was very excellent compared to Comparative Example 1. In particular, when each sample was treated at a concentration of 10%, it was confirmed that the intercellular space decreased by 74.58% for Example 1, 40.11% for Example 2, and 20.68% for Comparative Example 1.

[0112] <Experimental Example 11> Effect on Atopic Dermatitis Improvement: TARC Production Measurement Test

[0113] To confirm the atopic improvement effect of Examples 1 and 2 and Comparative Example 1, a test was conducted to confirm the amount of TARC (Thymus and Activation-regulated Chemokine) produced using human keratinocyte HaCaT cells.

[0114] 1 × 10⁶ HaCaT per well in a 24-well plate 5 After dispensing the required number of samples, the cells were cultured for 24 hours in an incubator at 37°C under a 5% carbon dioxide environment to allow for cell attachment. Examples 1–2 and Comparative Example 1 were prepared by diluting them to various concentrations in serum-free DMEM medium containing the inflammatory mediators TNF-α and INF-γ at a concentration of 10 ng / ml. As a positive control, TGF-β (Transforming Growth Factor-β) was prepared by diluting it to a concentration of 10 ng / ml. After removing the culture medium from the cultured cells, the samples were treated with the positive control and the diluted versions of Examples 1–2 and Comparative Example 1, and cultured for 24 hours in an incubator at 37°C under a 5% carbon dioxide environment. The culture medium was recovered after the incubation was complete, and the amount of TARC produced was measured. To measure the amount of TARC produced, an ELISA analysis was performed according to the protocol of an ELISA kit (Biolegend, 441104). The amount of TARC produced was converted into a percentage using the standard curve of TARC obtained from the ELISA analysis.

[0115] As a result, as shown in Figure 10, it was confirmed that the amount of TARC produced decreased in a concentration-dependent manner by Examples 1 and 2 and Comparative Example 1, and it was confirmed that the activity of Examples 1 and 2 in reducing TARC production was excellent compared to Comparative Example 1. In particular, when treated at a concentration of 10%, the effect of reducing TARC production was confirmed to be 46.18% for Example 1, 21.75% for Example 2, and 9.72% for Comparative Example 1.

[0116] Foregoing, specific parts of the present invention have been described in detail. It will be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. Accordingly, the actual scope of the invention is defined by the appended claims and their equivalents.

Claims

Claim 1 honeysuckle Lonicera japonica A cosmetic composition for anti-inflammatory, antioxidant, skin barrier improvement, skin moisturizing, skin soothing, whitening, skin elasticity, wrinkle improvement, skin regeneration, and improvement of atopic dermatitis, comprising exosomes derived from ) as an active ingredient. Claim 2 A cosmetic composition for anti-inflammatory, antioxidant, skin barrier improvement, skin moisturizing, skin soothing, whitening, skin elasticity and wrinkle improvement, skin regeneration and improvement of atopic dermatitis, characterized in that, in claim 1, the exosomes are isolated from one or more selected from the group consisting of honeysuckle, honeysuckle crushed liquid, honeysuckle callus, honeysuckle callus culture medium, crushed honeysuckle callus, and honeysuckle callus extract. Claim 3 A cosmetic composition for anti-inflammatory, antioxidant, skin barrier improvement, skin moisturizing, skin soothing, whitening, skin elasticity, wrinkle improvement, skin regeneration, and improvement of atopic dermatitis, characterized in that, in claim 1, the exosomes are extracellular vesicles having an average diameter of 50 to 200 nm. Claim 4 A cosmetic composition for anti-inflammatory, antioxidant, skin barrier improvement, skin moisturizing, skin soothing, whitening, skin elasticity, wrinkle improvement, skin regeneration, and improvement of atopic dermatitis according to claim 1, characterized in that the cosmetic composition is any one selected from the group consisting of skin, tonic, lotion, cream, soap, surfactant-containing cleansing, shampoo, rinse, conditioner, treatment, suspension, emulsion, ointment, paste, gel, oil, wax, spray, aerosol, mist, foundation, and powder. Claim 5 honeysuckle Lonicera japonica A pharmaceutical composition for the prevention or treatment of inflammation, wound healing, and atopic dermatitis containing exosomes derived from ) as an active ingredient. Claim 6 A pharmaceutical composition for the prevention or treatment of inflammation, wound healing, and atopic dermatitis, characterized in that, in claim 5, the pharmaceutical composition is administered or treated by microneedling, injection, iontophoresis, electroporation, ultrasound, high frequency, microcurrent, and application, or a combination thereof. Claim 7 A pharmaceutical composition for the prevention or treatment of inflammation, wound healing, and atopic dermatitis according to claim 5, characterized in that the pharmaceutical composition is selected from the group consisting of a patch formulation, a spray formulation, a liquid formulation, an infusion formulation, and an injection formulation. Claim 8 (a) honeysuckle ( Lonicera japonica (a) a step of isolating the leaves of the honeysuckle; (b) a step of inducing and culturing callus from the isolated leaves; and (c) a step of isolating the callus and callus culture solution derived from the honeysuckle, mixing the isolated callus and callus culture solution, grinding them, and then separating and purifying them; characterized by comprising: (a) a step of isolating the leaves of the honeysuckle; (b) a step of inducing and culturing callus from the isolated leaves; and (c) a step of isolating the callus and callus culture solution, mixing them, grinding them, and then separating and purifying them. Japanese honeysuckle (Lonicera japonica) A method for preparing a cosmetic composition for anti-inflammatory, antioxidant, skin barrier improvement, skin moisturizing, skin soothing, whitening, skin elasticity, wrinkle improvement, skin regeneration, and improvement of atopic dermatitis, comprising callus-derived exosomes as an active ingredient.

Images