Composition for promoting height growth containing berberine chloride hydrate as an active ingredient

Abstract

The present invention relates to a composition for promoting height growth comprising berberine chloride hydrate as an active ingredient. The composition according to the present invention can induce a decrease in KMT1A expression, an increase in growth hormone receptor or IGF-1 expression, and a decrease in binding between KMT1A and the growth hormone receptor promoter. Accordingly, it has a height growth-promoting effect during the growth period, including in children or adolescents, and can have preventive, improving, or therapeutic effects on height growth disorders, making it suitable for use as a material for food, pharmaceuticals, animal feed, etc.

Description

Technology Field

[0001] The present invention relates to a composition for promoting height growth comprising berberine chloride hydrate as an active ingredient. Background Technology

[0002] In our society, the developmental status of infants, children, and adolescents is showing a trend of significant improvement due to recent economic growth, improved nutritional conditions, and changes in dietary habits. Generally, growth entails not only an increase in height but also an increase in morphological and anatomical size and function, as well as the strengthening of the skeleton and muscles. Such growth is achieved through the complex action of hormones and various growth factors, the synthesis of cartilage tissue, and the growth of skeletal tissue.

[0003] Human growth mostly occurs up to puberty, and if proper nutrition is not consumed during this period, proper growth will not take place. Unlike adults, the growth plates in growing children are open, and through the intake of various nutrients and appropriate exercise during this time, the growth plates expand, leading to an overall increase in height.

[0004] However, growth disorders may occur during this period due to various reasons preventing proper growth. In Korean traditional medicine, the primary cause of such disorders is attributed to weak kidneys, which leads to sluggish secretion of growth hormone (GH) and poor bone growth. Therefore, it is urgently necessary to provide an environment, food, and nutritional supplements that can sufficiently stimulate and promote the secretion of growth hormone at the appropriate time.

[0005] Meanwhile, methods such as the administration of growth hormone preparations and Ilizanov surgery are known for promoting growth; however, these methods carry significant concerns regarding accompanying side effects, and methods like taking health supplements have the disadvantage of not providing sufficient efficacy. Specifically, the administration of growth hormone can cause various side effects, including leukemia, hypothyroidism, hyperglycemia, central nervous system tumors, diabetes, and epilepsy. Furthermore, while Ilizanov surgery is primarily used for cases of asymmetrical lower limb lengths, performing it on individuals of normal height who are short can result in serious side effects, such as an inability to walk normally.

[0006] Recent research has highlighted the use of natural materials as a safe method to induce growth while avoiding the side effects of hormone administration and surgical procedures. Specifically, methods are being sought to ultimately induce height growth by promoting the secretion of growth hormones through the consumption of natural products, leading to active exploration of such substances. Prior art literature

[0007] Chinese Patent Publication No. 116459249 The problem to be solved

[0008] The present invention aims to solve the aforementioned problem and other related problems.

[0009] The objective of the present invention is to provide a food composition for promoting height growth that includes berberine chloride hydrate as an active ingredient.

[0010] The objective of the present invention is to provide a health functional food for promoting height growth comprising berberine chloride hydrate as an active ingredient.

[0011] Another objective of the present invention is to provide a pharmaceutical composition for promoting height growth or preventing or treating height growth disorders, comprising berberine chloride hydrate as an active ingredient.

[0012] Another objective of the present invention is to provide a quasi-drug composition for promoting height growth or preventing or improving height growth disorders, comprising berberine chloride hydrate as an active ingredient.

[0013] Another objective of the present invention is to provide a feed composition for promoting height growth comprising berberine chloride hydrate as an active ingredient.

[0015] The technical problems to be solved according to the technical concept of the invention disclosed in this specification are not limited to those for solving the problems mentioned above, and other unmentioned problems will be clearly understood by a person skilled in the art from the description below. means of solving the problem

[0016] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application should not be considered limited by the specific descriptions provided below.

[0018] As one embodiment for achieving the above objective, the present invention provides a food composition for promoting height growth comprising berberine chloride hydrate as an active ingredient.

[0019] In the present invention, the 'berberine chloride hydrate' refers to a compound having the chemical structure of the following chemical formula 1.

[0020]

[0021] The above berberine chloride hydrate has a molecular weight of 389.8 g / mol and C 20 H 20 It has the molecular formula ClNO5 and is named '9,10-dimethoxy-5,6-dihydro-[1,3]dioxolo[4,5-g]isoquinolino[3,2-a]isoquinoline-7-nium chloride hydrate'. In the present invention, the berberine chloride hydrate may be obtained from biological sources known in the art, or may be chemically synthesized or commercially available.

[0022] In the present invention, berberine chloride hydrate comprises a pharmaceutically or food-grade acceptable salt form within the range having the same efficacy. Such salts are pharmaceutically or food-grade acceptable salts and may be basic salts or acidic salts; basic salts may be used in the form of either organic basic salts or inorganic basic salts, and may be selected from the group consisting of sodium salts, potassium salts, calcium salts, lithium salts, magnesium salts, cesium salts, aluminum salts, ammonium salts, triethylaminium salts, and pyridinium salts.

[0023] As for the types of such salts, acid addition salts formed by free acids are useful as acid salts. Inorganic and organic acids may be used as free acids; inorganic acids may include hydrochloric acid, bromic acid, sulfuric acid, sulfite, phosphoric acid, diphosphate, nitric acid, etc., and organic acids may include citric acid, acetic acid, maleic acid, malic acid, fumaric acid, glutonic acid, methanesulfonic acid, benzenesulfonic acid, camphorsulfonic acid, oxalic acid, malonic acid, glutaric acid, acetic acid, glyconic acid, succinic acid, tartaric acid, 4-toluenesulfonic acid, galacturonic acid, emvonic acid, glutamic acid, citric acid, aspartic acid, stearic acid, etc., but are not limited thereto and may include all salts formed using various inorganic and organic acids commonly used in the industry.

[0024] In the present invention, the term 'height growth' refers to the overall process in which growth cells within the cartilage growth plate of the bone divide to increase bone length and develop muscles, and height growth can occur when the secretion of growth hormone from the pituitary gland of the brain is smooth.

[0025] In the present invention, the 'height growth promotion' may include increasing the height growth rate, or suppressing or improving the phenomenon of height growth inhibition or delay caused by various factors.

[0026] In the present invention, the time at which height growth occurs is not particularly limited, but preferably may refer to height growth during the growth period, and the 'growth period' may generally refer to the period from birth to the age of 18.

[0027] More preferably, the height growth during the growth period may include the height growth of a child or adolescent. In the present invention, the term "child" may refer to a person aged 24 months to 12 years, and the term "adolescent" may refer to a person aged 13 to 18 years.

[0028] In the present invention, the composition may increase body length and growth rate, and may increase tibia length.

[0029] In a specific embodiment, the present invention has been confirmed to have the effect of increasing body length, body length growth rate, and tibial length without showing changes in body weight, body weight growth rate, body composition including body fat or bone mineral content, or dietary intake.

[0030] In the present invention, the composition may reduce the gene or protein expression of lysine N-methyltransferase 1A (KMT1A). The above 'KMT1A' refers to a histone H3-specific methyltransferase, meaning an enzyme that selectively methylates lysine-9 at the N-terminus of histone H3 and inhibits transcription.

[0031] In the present invention, the composition may increase the gene or protein expression of a growth hormone receptor or insulin-like growth factor-1.

[0032] In the present invention, the composition may reduce the binding between KMT1A and the promoter of the growth hormone receptor.

[0033] In the present invention, 'active ingredient' refers to a component that exhibits the desired activity alone, or can exhibit activity together with a carrier that is inactive itself.

[0034] In the composition of the present invention, the active ingredient may be included in any amount (effective amount) depending on the specific use, formulation, purpose of combination, etc., as long as it can exhibit the efficacy of promoting height growth. A typical effective amount may be determined within the range of 0.000001 weight % to 99.9 weight % based on the total weight of the composition. The above "effective amount" refers to the amount of the active ingredient included in the composition of the present invention that can exhibit intended functional and pharmacological effects, such as promoting height growth, when the composition of the present invention is administered to an individual subject to the composition of the present invention during an administration period suggested by a person skilled in the art. Such an effective amount may be determined experimentally by a person skilled in the art within the scope of ordinary ability.

[0035] The food composition of the present invention may include the active ingredient in various amounts as long as it has a height growth promoting effect.

[0036] In addition to the active ingredient, the food composition of the present invention may further include any compound or natural extract known in the art to have its safety verified and possess the corresponding activity in order to enhance convenience of taking or consuming.

[0037] These compounds or extracts may include compounds or extracts listed in pharmacopoeias of each country (the 'Korean Pharmacopoeia' in Korea), health functional food codes of each country (the 'Standards and Specifications for Health Functional Foods' notified by the Ministry of Food and Drug Safety in Korea), compounds or extracts that have received product approval in accordance with the laws of each country regulating the manufacture and sale of pharmaceuticals (the 'Pharmaceutical Affairs Act' in Korea), and compounds or extracts whose functionality has been recognized in accordance with the laws of each country regulating the manufacture and sale of health functional foods (the 'Act on Health Functional Foods' in Korea).

[0038] The term 'food' in the present invention includes meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, vitamin complexes, nutritional supplements, functional foods, food additives, health functional foods, and health foods, and includes all foods in the conventional sense.

[0039] The aforementioned "health food" refers to a food that has active effects of maintaining or promoting health compared to general food, and "health supplement food" refers to a food intended for the purpose of health support. Depending on the context, the terms "health functional food," "health food," and "health supplement food" are used interchangeably.

[0040] The term "health functional food" in this invention is synonymous with "food for special health use (FosHU)" and refers to a food with high medical or therapeutic effects that is processed to efficiently exhibit bio-regulatory functions in addition to providing nutrition. Here, "functionality" refers to obtaining useful effects for health purposes, such as regulating nutrients or physiological actions regarding the structure and function of the human body. The food of this invention may be manufactured by methods commonly used in the industry, and may be manufactured by adding raw materials and ingredients commonly added in the industry. Furthermore, the formulation of the food may also be manufactured without restriction as long as it is a formulation recognized as a food.

[0041] The food composition of the present invention may be manufactured in any form, for example, as beverages such as tea, juice, carbonated beverages, and isotonic drinks; processed dairy products such as milk and yogurt; food products such as chewing gum, rice cakes, Korean confectionery, bread, confectionery, and noodles; and formulations such as tablets, capsules, pills, granules, liquids, powders, flakes, pastes, syrups, gels, jellies, and bars. Furthermore, the food composition of the present invention may take on any product classification in terms of legal and functional classification, as long as it complies with the regulations in effect at the time of manufacture and distribution. For example, it may be a health functional food under the Korean 'Act on Health Functional Foods', or confectionery, tea, beverages, food for special medical purposes, food for special nutritional purposes, etc., according to each food type in the Food Code of the Korean 'Food Sanitation Act' (Notification of the Ministry of Food and Drug Safety 'Standards and Specifications for Food').

[0042] In addition, the food composition of the present invention may include food additives in addition to its active ingredients. Food additives can generally be understood as substances added to, mixed with, or permeated into food during its manufacture, processing, or preservation; since they are consumed daily and over a long period along with food, their safety must be guaranteed. In terms of use, such food additives are classified into sweeteners, flavor enhancers, preservatives, emulsifiers, flavorings, etc.

[0043] The above sweeteners are used to impart a suitable sweetness to food, and may be natural or synthetic. For example, sweeteners such as neotame, lactitol, D-ribose, mannitol, D-maltitol, and sodium saccharin may be used.

[0044] The above flavor enhancers are food additives that enhance the taste or aroma of food, and both natural and synthetic ones may be used. For example, flavor enhancers may include disodium 5'-guanylate, L-glutamic acid, glycine, betaine, etc.

[0045] Sodium metabisulfite, sulfur dioxide, sorbic acid, benzoic acid, grapefruit seed extract, etc. may be used as the above preservatives.

[0046] The above emulsifier is a food additive that homogeneously mixes or maintains two or more immiscible phases, such as water and oil, and may include sodium gluconate, glycerin fatty acid ester, lecithin, magnesium stearate, alginic acid, etc.

[0047] The above flavorings are food additives that impart a unique aroma to food or reinforce the original aroma of food lost during the manufacturing process, and may include ethyl vanillin, ethyl octanoate, linalyl acetate, allyl caproate, paramethylacetophenone, etc.

[0048] In addition to the food additives described above, the food composition of the present invention may include physiologically active substances or minerals known in the art and guaranteed to be safe as food additives for the purpose of supplementing and reinforcing functionality and nutritional value. Examples of such physiologically active substances include catechins contained in green tea, vitamins such as vitamin B1, vitamin C, vitamin E, and vitamin B12, tocopherol, dibenzoylthiamine, etc. Examples of such minerals include calcium preparations such as calcium citrate, magnesium preparations such as magnesium stearate, iron preparations such as iron citrate, chromium chloride, potassium iodide, selenium, germanium, vanadium, zinc, etc.

[0049] The food composition of the present invention may include the aforementioned food additives in an appropriate amount to achieve the purpose depending on the product type, and regarding other food additives that may be included in the food composition of the present invention, reference may be made to the food codes or food additive codes of each country.

[0050] In another embodiment for achieving the above objective, the present invention provides a pharmaceutical composition for promoting height growth or preventing or treating height growth disorders, comprising berberine chloride hydrate as an active ingredient.

[0051] The above 'berberine chloride hydrate', 'active ingredient', 'height growth', and 'composition' are as described above.

[0052] In the present invention, the term 'growth disorder' refers to a case where the growth rate is lower than that of the same age and gender, or where it crosses two or more height percentile curves on the growth curve downwards, and in particular, 'short stature' may be defined as a case where the height is below the 3rd percentile of the standard values ​​according to age and gender.

[0053] The causes of the above 'growth disorder' may vary, but may include cases where growth disorder occurs genetically or constitutionally without disease, and cases where growth disorder occurs due to disease. Specifically, in the present invention, the above 'height growth disorder' may be one or more selected from the group consisting of familial short stature, idiopathic short stature, constitutional growth retardation, short stature due to Down syndrome, short stature due to Turner syndrome, short stature due to Prader-Willi syndrome, short stature due to Silver-Russell syndrome, short stature due to Noonan syndrome, short stature due to nutritional deficiency, short stature due to chronic systemic disease, short stature due to growth hormone deficiency, short stature due to hypothyroidism, short stature due to precocious puberty, short stature due to Cushing's syndrome, and psychosocial dwarfism, but is not limited thereto.

[0054] In the present invention, the term "prevention" refers to any act of administering or applying the composition of the present invention to an individual to suppress or delay height growth disorders.

[0055] In the present invention, the term "treatment" refers to any act of administering or applying the composition of the present invention to an individual to improve, alleviate, or benefit from height growth disorders.

[0056] The pharmaceutical composition of the present invention may further comprise a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may further comprise, for example, a carrier for oral administration or a carrier for parenteral administration. The carrier for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, etc.

[0057] In addition, the carrier for parenteral administration may include water, suitable oil, saline solution, aqueous glucose and glycol, etc. Additionally, it may further include stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite, or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben, and chlorobutanol.

[0058] The pharmaceutical composition of the present invention may be administered to mammals, including humans, by any method. For example, it may be administered orally or parenterally, and parenteral administration methods may be intravenous, intramuscular, intra-arterial, intramedullary, intradural, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical, sublingual, or rectal administration, although not limited thereto.

[0059] The pharmaceutical composition of the present invention may be formulated into an oral or parenteral administration formulation according to the administration route described above. When formulating, it may be prepared using one or more buffers (e.g., saline or PBS (phosphate buffered saline)), antioxidants, bacteriostatic agents, chelating agents (e.g., EDTA or glutathione), fillers, extenders, binders, adjuvants (e.g., aluminum hydroxide), suspenders, thickeners, wetting agents, disintegrants or surfactants, diluents or excipients.

[0060] Solid dosage forms for oral administration include tablets, pills, powders, granules, liquids, gels, syrups, slurries, suspensions, or capsules, and such solid dosage forms may be prepared by mixing the pharmaceutical composition of the present invention with at least one excipient, for example, starch (including corn starch, wheat starch, rice starch, potato starch, etc.), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol, maltitol, cellulose, methyl cellulose, sodium carboxymethylcellulose and hydroxypropylmethylcellulose, or gelatin. For example, a tablet or a sugar-coated tablet may be obtained by combining an active ingredient with a solid excipient, grinding the mixture, adding a suitable auxiliary agent, and processing it into a granular mixture.

[0061] In addition to simple excipients, lubricants such as magnesium striate talc are also used. Liquid formulations for oral administration include suspensions, oral liquids, emulsions, or syrups, and may contain various excipients, such as humectants, sweeteners, flavorings, or preservatives, in addition to commonly used simple diluents like water or liquid paraffin. Furthermore, cross-linked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may be added as disintegrants, and may additionally contain anticoagulants, lubricants, humectants, flavorings, emulsifiers, and preservatives.

[0062] When administered parenterally, the pharmaceutical composition of the present invention may be formulated in the form of an injectable, a transdermal agent, and a nasal inhalant with a suitable parenteral carrier according to methods known in the art. The injectable must be sterile and protected from contamination by microorganisms such as bacteria and fungi. Examples of suitable carriers for the injectable may include, but are not limited to, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), mixtures thereof, and / or vegetable oils, as solvents or dispersion media. More preferably, suitable carriers may include Hanks' solution, Ringer's solution, PBS containing triethanolamine or sterile water for injection, isotonic solutions such as 10% ethanol, 40% propylene glycol, and 5% dextrose. To protect the injectable from microbial contamination, various antimicrobial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, and thimerosal may be additionally included. In addition, the above-mentioned injectable may additionally contain an isotonic agent, such as sugar or sodium chloride, in most cases.

[0063] Transdermal formulations include forms such as ointments, creams, lotions, gels, topical solutions, pastes, liniments, and aerosols. Here, 'transdermal administration' means administering a pharmaceutical composition topically to the skin so that an effective amount of the active ingredient contained in the pharmaceutical composition is delivered into the skin.

[0064] In the case of inhalation formulations, the composition used according to the present invention can be conveniently delivered in the form of an aerosol spray from a pressurized pack or atomizer using a suitable propellant, e.g., dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or other suitable gas. In the case of pressurized aerosols, the dosage unit can be determined by providing a valve that delivers a metered amount. For example, gelatin capsules and cartridges used in inhalers or blowers can be formulated to contain a mixture of the compound and a powder of a suitable powder base, such as lactose or starch. Formulations for parenteral administration are described in the literature, which is a prescription generally known in all pharmaceutical chemistry (Remington's Pharmaceutical Science, 15th Edition, 1975 Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour).

[0065] The pharmaceutical composition of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, or biological response modifiers.

[0066] As another embodiment for achieving the above objective, the present invention provides a quasi-drug composition for promoting height growth or preventing or improving height growth disorders, comprising berberine chloride hydrate as an active ingredient.

[0067] The above 'berberine chloride hydrate', 'active ingredient', 'height growth', 'growth disorder', 'prevention', and 'composition' are as described above.

[0068] In the present invention, the term "improvement" refers to any act of using the composition of the present invention to improve or benefit height growth disorders.

[0069] In the present invention, the term "quasi-drug" refers to an article used for the purpose of diagnosing, treating, alleviating, managing, or preventing diseases in humans or animals, excluding instruments, machines, or devices, and an article used for the purpose of having a pharmacological effect on the structure and function of humans or animals, excluding instruments, machines, or devices. One embodiment may include an oral formulation, but is not limited thereto. The formulation method, dosage, method of use, and components of the quasi-drug may be appropriately selected from the ordinary technology known in the technical field.

[0070] The quasi-drug composition of the present invention may further include, in addition to the active ingredient, a pharmaceutically acceptable carrier, excipient, or diluent as needed. The pharmaceutically acceptable carrier, excipient, or diluent is not limited as long as it does not impair the effects of the present invention, and may include, for example, fillers, extenders, binders, wetting agents, disintegrants, surfactants, lubricants, sweeteners, fragrances, preservatives, etc.

[0071] In another embodiment for achieving the above objective, the present invention provides a feed composition for promoting height growth comprising berberine chloride hydrate as an active ingredient.

[0072] The above 'berberine chloride hydrate', 'active ingredient', 'height growth', 'height growth promotion', and 'composition' are as described above.

[0073] In the present invention, the "feed" may be manufactured in various forms known in the art, such as any natural or artificial prescribed food, single meal, etc., for animals to eat, consume, and digest, or as an ingredient of said single meal; specifically, it may include, but is not limited to, concentrate feed, roughage, feed additives, feed aids, pet nutritional supplements, or special feeds.

[0074] The feed additive of the present invention corresponds to an auxiliary feed under the Feed Management Act and may additionally include mineral preparations such as sodium bicarbonate (baking soda), bentonite, magnesium oxide, and complex minerals; mineral preparations that are trace minerals such as zinc, copper, cobalt, and selenium; vitamin preparations such as carotene, vitamin E, vitamins A, D, E, nicotinic acid, and vitamin B complex; protected amino acid preparations such as methionine and lysic acid; protected fatty acid preparations such as calcium salts of fatty acids; probiotics (lactic acid bacteria preparations); probiotics such as yeast cultures and mold fermentation products; yeast preparations, etc.

[0075] Concentrated feeds include, but are not limited to, seed grains such as wheat, oats, and corn; bran, which is a byproduct obtained by refining grains and includes rice bran, wheat bran, and barley bran; oilseed meal, which is a byproduct obtained by extracting oil from soybeans, rapeseed, sesame, flaxseed, and coconut; residues such as residual starch, which is the main component of starch residue remaining after removing starch from sweet potatoes and potatoes; fish meal, fish residue; fish soluble, which is a concentrated fresh liquid obtained from fish; meat meal; blood meal; feather meal; skim milk powder; dried whey, which is the residue obtained when making cheese from milk or casein from skim milk; yeast, Chlorella, and seaweed. Roughage includes raw grass feeds such as wild grass, pasture grass, and green cuts; root vegetables such as feed turnips, feed beets, and a type of turnip called lutea bearger; silage, which is a stored feed made by filling a silo with raw grass, green cut crops, and grains and fermenting them with lactic acid; hay made by cutting and drying wild grass and pasture grass; straw of livestock breeding crops; and leaves of legumes, but is not limited thereto. Special feeds include mineral feeds such as oyster shells and rock salt; urea feeds such as urea or its derivatives such as diuretic isobutane; feed additives, which are substances added in trace amounts to compound feed to supplement components that are prone to being deficient when only natural feed ingredients are mixed, or to improve the shelf life of the feed; and dietary supplements, but are not limited thereto.

[0076] The feed composition of the present invention may further include ingredients added to conventional feeds. Examples of ingredients added to such feeds may include cereal powder, meat powder, and legumes. In the above, the cereal powder may be one or more selected from rice flour, wheat flour, barley flour, and corn flour. In the above, the meat powder may be powdered meat powder obtained by selecting one or more selected from chicken, beef, pork, and ostrich meat. In the above, the legumes may be one or more selected from soybeans, kidney beans, peas, and black beans.

[0077] The feed composition of the present invention may include one or more selected from nutrients and minerals in addition to the cereal powder, meat powder, and legumes, which are components added to conventional feeds mentioned above, in order to increase the nutritional value of the feed, and may include one or more selected from antifungal agents, antioxidants, anticoagulants, emulsifiers, and binders to prevent deterioration of feed quality.

[0078] The feed or feed additive of the present invention can be applied to a number of animal diets, including mammals, poultry, and fish.

[0080] The present invention will be described in more detail below through examples. These examples are solely for illustrating the present invention, and it will be obvious to those skilled in the art that the scope of the present invention is not to be interpreted as being limited by these examples. Effects of the invention

[0082] The composition according to the present invention can induce a decrease in KMT1A expression, an increase in growth hormone receptor or IGF-1 expression, and a decrease in binding between KMT1A and the growth hormone receptor promoter. Accordingly, it has a height growth-promoting effect during the growth period, including in children or adolescents, and can have preventive, improving, or therapeutic effects on height growth disorders, making it suitable for use as a material for food, pharmaceuticals, animal feed, etc. Brief explanation of the drawing

[0083] Figure 1 schematically shows the overall experimental schedule to confirm the effect of berberine chloride hydrate treatment in a glucocorticoid (GC)-treated growth-retarded animal model. Figure 2 shows the effect of berberine chloride hydrate treatment on changes in tibial length in a glucocorticoid-induced growth retardation animal model. Figure 3 shows the effect of treating with berberine chloride hydrate on changes in body length in a glucocorticoid-induced growth retardation animal model. Figure 4 shows the effects of treating with berberine chloride hydrate on dietary intake and body weight changes in a glucocorticoid-induced growth retardation animal model. Figure 5 shows the effect of treating with berberine chloride hydrate on changes in fat mass and bone mineral content in a glucocorticoid-induced growth retardation animal model. Figure 6 shows the changes in gene expression of epigenetic factors in the liver in a glucocorticoid-induced growth retardation animal model. Figure 7 shows the effect of berberine chloride hydrate treatment on changes in Ghr, Igf-1, and Kmt1a gene expression levels in a glucocorticoid-induced growth retardation animal model. Figure 8 shows the effect of berberine chloride hydrate treatment on the degree of binding between the Ghr promoter and KMT1A in a glucocorticoid-induced growth retardation animal model. Figure 9 shows the effect of treating with berberine chloride hydrate on changes in circulating IGF-1 protein levels in a glucocorticoid-induced growth retardation animal model. Specific details for implementing the invention

[0084] The structure and effects of the present invention will be explained in more detail below through examples. These examples are intended solely to illustrate the present invention, and the scope of the present invention is not limited by them.

[0086] [Experimental Method]

[0087] 1. Dual-Energy X-ray Absorptiometry (DEXA)

[0088] Bone mineral content and body fat mass were measured in each mouse by performing DEXA scans (InAlzyer; Medikors, Seongnam-si, Gyeonggi-do, South Korea). All subjects underwent DEXA measurements while anesthetized with isoflurane. Each mouse was scanned using DEXA before the start of the experiment and weekly during the experiment period. X-ray images were used to measure the body length of each mouse.

[0090] 2. Quantitative real-time polymerase chain reaction (qRT-PCR)

[0091] Liver tissue was homogenized using a pellet pestle (Chemglass Life Science, Vineland, NJ, USA) in TRI Reagent (15596018; Invitrogen, Waltham, MA, USA). Cultured cells were lysed using TRI reagent via repeated pipetting. Total RNA was isolated and dissolved in ultra-pure water (SH30538.01; Cytiva, Marlborough, MA, USA). The concentration of isolated RNA was measured using a NanoDrop spectrometer (Thermo Fisher Scientific). Then, 1 μg of total RNA was reverse transcribed into cDNA using reverse transcriptase master mix (FSQ-201; TOYOBO, Osaka, Japan).

[0092] Real-time PCR was performed using the QuantStudio 3 Real-Time PCR system (Applied Biosystems) with a total volume of 20 μL, comprising 4 μL of cDNA, 10 μL of Power SYBR Green PCR Master Mix (4368706; Applied Biosystems, Waltham, MA, USA), and 1 μL each of 5 pmol / μL forward and reverse primers.

[0093] In the present invention, the sequences of the primers used for quantitative real-time PCR are as shown in Table 1 below.

[0094] Target gene Forward direction (5' -> 3') Reverse direction (5' -> 3') Ghr GAACATGAAGTGCGGGTGAG(Sequence No. 1) CTTCGCTGAACTCGCTGTAC(Sequence No. 2) Igf-1 ACTGGAGATGTACTGTGCCC(Sequence No. 3) TGAGTCTTGGGCATGTCAGT(Sequence No. 4) Hdac1 CAGTGTGGCTCAGATTCCCT(Sequence No. 5) GGGCAGCTCATTAGGGATCT(Sequence No. 6) Hdac2 GGGACAGGCTTGGTTGTTTC(Sequence No. 7) GAGCATCAGCAATGGCAAGT(Sequence No. 8) Kmt1a TGGTTAAGTGGCGTGGGTAT(Sequence No. 9) TTGTTCCCAACGCTGAAGTG(Sequence No. 10) Kmt2a GTTCCAGCAAGCCACAAAGA(Sequence No. 11) CTCGCCGTCTTACAATCTGC(Sequence No. 12) Kmt2b CCCCTCAGTTTACCCCAAGT(Sequence No. 13) CAAGAGGAGGAGGGGTAAGC(Sequence No. 14) Kmt2e CAAAGAGTCGCAGGTCATCG (Sequence No. 15) TGCTGTCCAATGTGAGTCCT(Sequence No. 16) Gapdh AGAAGGTGGTGAAGCAGGCATC(Sequence No. 17) CGAAGGTGGAAGAGTGGGAGTTG(Sequence No. 18)

[0096] 3. Chromatin Immunoprecipitation (ChIP)-qPCR

[0097] ChIP-qPCR analysis was performed using the ChIP-IT Express Kit (102026; Active Motif, Carlsbad, CA, USA).

[0098] 60–70 mg of liver tissue per group was finely chopped with a razor blade and incubated for 8 minutes in 7 mL of 1× PBS containing 1% formaldehyde to cross-link proteins and DNA. The cross-linking reaction was stopped by adding glycine for 5 minutes, and the tissue was homogenized using a Dounce homogenizer. After centrifuging the homogenate at 2500 rpm at 4°C for 5 minutes, the pellet was suspended in 500 µL of lysis buffer containing a protease inhibitor cocktail and phenylmethanesulfonyl fluoride (PMSF). The suspension was incubated on ice for 30 minutes, after which the lysate was homogenized using a Dounce homogenizer and washed twice with 1× PBS. The homogenate was centrifuged again at 2500 rpm at 4°C for 10 minutes. A pellet containing fixed chromatin was suspended in 350 µL of shearing buffer containing a protease inhibitor and PMSF.

[0099] Fixed chromatin was sheared into 200-800-bp fragments by sonication on ice using a sonicator (Thermo Fisher Scientific) applying 20-second pulses at 50-second intervals at 35% power, and this step was repeated 20 times. The sheared chromatin samples were centrifuged at 13,000 rpm at 4°C for 10 minutes, and the supernatant was transferred to a new tube for immunoprecipitation.

[0100] The DNA of the sheared chromatin samples was quantified using a NanoDrop spectrometer. For the immunoprecipitation reaction, 20 µg of each sheared chromatin was mixed with 2 µg of primary antibody, 20 µL of protein G magnetic beads, 10 µL of 10x ChIP buffer from the ChIP assay kit (Active Motif), and 1 µL of protease inhibitor cocktail to make a total volume of 100 µL, and incubated overnight at 4°C. In this invention, a primary antibody against KMT1A (05-615; RRID:AB_2196724; Millipore, Billerica, MA, USA) was used.

[0101] The immunoprecipitated products were washed sequentially with ChIP buffers I and II on a magnetic rack (Active Motif). After the final wash, the beads were suspended in 50 μL of elution buffer and incubated at room temperature for 15 minutes with intermittent stirring. Then, 50 μL of reverse crosslinking buffer was added to each sample. The eluted chromatin was carefully transferred to a new tube and incubated at 95°C for 15 minutes. Next, 10 μL of input DNA was mixed with 88 μL of ChIP buffer II and 2 μL of 5M NaCl, followed by reverse crosslinking and incubation at 95°C for 15 minutes. The reaction mixture was added to 1 μL of protease K and incubated at 37°C for 1 hour, after which it was mixed with 2 μL of protease K stop solution. The final product was considered an immunoprecipitated DNA sample and used for real-time PCR.

[0102] Real-time PCR was performed using a QuantStudio 3 Real-Time PCR system (Applied Biosystems) with a total volume of 20 μL, comprising 4 μL of immunoprecipitation DNA, 10 μL of Power SYBR Green PCR Master Mix (Applied Biosystems), and 1 μL each of 5 pmol / μL forward and reverse primers. One-tenth of the input DNA was used for quantitative PCR to control the relative amounts of DNA fragments during immunoprecipitation and normalization for quantification. The sequences of the primers used for ChIP-qPCR are shown in Table 2 below.

[0103] target area Forward direction (5' -> 3') Reverse direction (5' -> 3') Ghr Promoter 1 (P1) TGGAAGCCAAGGACCTGAAA(Sequence No. 19) GTCATGAGGATGCACAGCG(Sequence No. 20) Ghr Promoter 2 (P2) GGCCATTGAAGAATTGGTGGA(Sequence No. 21) CTTTGGGGAAGGATTGTTGCA(Sequence No. 22)

[0105] 4. Measurement of IGF-1 levels

[0106] Mice were anesthetized with isoflurane, and blood samples were collected. Blood samples were centrifuged at 3,000 rpm at 4°C for 15 minutes, and IGF-1 levels were measured using the supernatant. The analysis was performed using the Mouse / Rat IGF-1 Quantikine ELISA Kit (MG100; R&D Systems, Minneapolis, MN, USA) according to the manufacturer's instructions. Each sample was diluted with the ELISA assay diluent of the corresponding ELISA kit. Standard samples and blood samples were placed on plates coated with monoclonal antibodies against IGF-1 and incubated for 2 hours.

[0107] After washing, a polyclonal antibody against IGF-1 bound to horseradish peroxidase was added and incubated for 2 hours. After 5 washes, a substrate solution was added and incubated for 30 minutes; the reaction was stopped with a stop solution, and the absorbance was measured immediately at 450 nm.

[0109] 5. Statistical Analysis

[0110] Statistical analysis was performed using GraphPad PRISM 8.0 software (GraphPad Software, Inc., CA, USA). Comparisons between two samples were evaluated using the Student t-test, while multiple comparisons were evaluated using one-way and two-way ANOVA followed by Turkey's post hoc test. Data are expressed as mean ± mean standard error (SEM), and statistical significance was set at the 5% level. (*p < 0.05 and **p < 0.01)

[0112] Example 1. Preparation of a Glucocorticoid-Induced Growth Retardation Animal Model

[0113] Three-week-old male C57BL / 6 mice were purchased from Koatech Animal Inc. (Pyeongtaek-si, Gyeonggi-do, South Korea). The mice were housed in individual ventilated cages containing finely chopped wood particles at a temperature of 23°C and a constant humidity of 50–60%, following a 12-hour day / night cycle (7:00 AM to 7:00 PM). All mice were free to eat and drink and were acclimated for one week prior to the experiment. All animals were handled in accordance with the Animal Care Guidelines of the Korea Food and Drug Administration (KFRI-M-23048).

[0114] To induce growth retardation, 40 mg / kg / day of glucocorticoid (GC; Sigma-Aldrich, St. Louis, MO, USA) was administered subcutaneously to mice. GC (Sigma-Aldrich) was dissolved in 0.9% (w / v) saline containing 5% dimethyl sulfoxide (Sigma-Aldrich) and 1% Tween-80 (Sigma-Aldrich), and GC or the vehicle was injected at a dose of 5 mL / kg into 4-week-old male mice.

[0116] Example 2. Confirmation of the growth-retarding improvement effect of berberine chloride hydrate

[0117] 2.1. Confirmation of the effect of berberine chloride hydrate on Kmt1a expression

[0118] In vivo experiments were performed to evaluate the effects of berberine chloride hydrate (BCH) on a glucocorticoid (GC)-induced growth retardation animal model prepared as in Example 1. Since treatment with GC for one week is sufficient to significantly reduce the body length of mice, GC and berberine chloride hydrate were administered to 4-week-old mice for one week. During the growth retardation period, i.e., between 4 and 5 weeks of development, GC was administered via subcutaneous injection and orally at a concentration of 50 mg / kg by dissolving it in 100 μL of reverse osmotic water. A schematic experimental schedule is shown in Figure 1.

[0119] As a result of the experiment, as shown in Figure 2, the administration of BCH significantly improved the GC-induced tibia length reduction, and as shown in Figure 3, the administration of BCH restored the body length reduced by GC, namely the body length from nose to tail (body+tail length) and the body length from nose to anus (body length) and its growth rate.

[0120] However, as shown in Figure 4, no difference was observed in food intake, and the body weight lost in the GC treatment group was not recovered by BCH administration, and the body growth rate also showed a similar trend to the change in body weight.

[0121] In addition, as shown in Figure 5, the results of the analysis of body composition (body fat, bone mineral content) using DEXA (Dual-Energy X-ray Absorptiometry) showed that BCH administration did not restore the increase in fat mass induced by GC, nor did it show a significant mitigating effect on the loss of bone mineral content induced by GC treatment.

[0123] These results suggest that the administration of berberine chloride hydrate (BCH) has the effect of alleviating growth retardation in a GC-induced growth retardation model, such as increasing body length and tibial length, without affecting body weight, body weight growth rate, body fat mass, or bone mineral content.

[0125] 2.2. Confirmation of the Effects of Berberine Chloride Hydrate on the Expression of GH / IGF-1 Axis-Related Factors

[0126] Longitudinal growth is regulated primarily through the growth hormone (GH) / insulin-like growth factor-1 (IGF-1) axis, which includes central and peripheral anatomical components. Central regulation involves the secretion of GH from the pituitary gland, while peripheral regulation is mediated by IGF-1 produced in the liver and growth plates, which regulate chondrocyte proliferation and bone elongation.

[0127] To determine whether epigenetic mechanisms are involved in the changes in the GH / IGF-1 axis signaling in the liver, changes in the expression of epigenetic factors in liver tissue of a glucocorticoid (GC)-induced growth retardation model were investigated, and as a result, as shown in Figure 6, it was confirmed that the expression of the Kmt1a gene was significantly increased compared to other factors.

[0128] Based on these points, changes in mRNA levels of GH / IGF-1 axis-related factors GH receptor (GH receptor, Ghr), Igf-1, and Kmt1a in liver tissues of mice administered with BCH were analyzed. As shown in Figure 7, it was confirmed that the decrease in Ghr and Igf-1 levels and the increase in Kmt1a levels induced by GC were significantly reversed by the administration of berberine chloride hydrate (BCH).

[0129] In addition, as shown in Figure 8, through ChIP analysis, it was confirmed that the degree of binding between the Ghr promoter and KMT1A, which was increased by GC in the liver, was reduced by the administration of berberine chloride hydrate.

[0130] In addition, as shown in Figure 9, ELISA analysis confirmed that the circulating IGF-1 expression levels, which had decreased with GC administration, significantly increased in the BCH administration group.

[0132] These experimental results collectively suggest that the administration of berberine chloride hydrate has the effect of improving or alleviating growth retardation by regulating GH / IGF-1 signaling in the liver.

[0134] From the foregoing description, those skilled in the art to which the present invention pertains will understand that the present invention may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.

Claims

Claim 1 A food composition for promoting height growth containing berberine chloride hydrate as an active ingredient. Claim 2 A food composition according to claim 1, wherein the height growth includes the height growth of a child or adolescent. Claim 3 A food composition according to claim 1, wherein the composition reduces the expression of lysine N-methyltransferase 1A (KMT1A). Claim 4 A food composition according to claim 1, wherein the composition increases the expression of a growth hormone receptor or insulin-like growth factor-1. Claim 5 A food composition according to claim 1, wherein the composition reduces binding between KMT1A and a growth hormone receptor promoter. Claim 6 A health functional food comprising a food composition according to any one of paragraphs 1 to 5. Claim 7 A pharmaceutical composition for promoting height growth or preventing or treating height growth disorders, comprising berberine chloride hydrate as an active ingredient. Claim 8 A pharmaceutical composition according to claim 7, wherein the height growth comprises the height growth of a child or adolescent. Claim 9 In claim 7, the above composition is a pharmaceutical composition that reduces KMT1A expression. Claim 10 In claim 7, the above composition is a pharmaceutical composition that increases the expression of a growth hormone receptor or insulin-like growth factor-1. Claim 11 In claim 7, the above composition is a pharmaceutical composition that reduces binding between KMT1A and a growth hormone receptor promoter. Claim 12 A pharmaceutical composition according to claim 7, wherein the height growth disorder is one or more selected from the group consisting of familial short stature, idiopathic short stature, constitutional growth retardation, short stature due to Down syndrome, short stature due to Turner syndrome, short stature due to Prader-Willi syndrome, short stature due to Silver-Russell syndrome, short stature due to Noonan syndrome, short stature due to nutritional deficiency, short stature due to chronic systemic disease, short stature due to growth hormone deficiency, short stature due to hypothyroidism, short stature due to precocious puberty, short stature due to Cushing's syndrome, and psychosocial dwarfism. Claim 13 A quasi-drug composition for promoting height growth or preventing or improving height growth disorders, comprising berberine chloride hydrate as an active ingredient. Claim 14 A quasi-drug composition according to claim 13, wherein the height growth includes the height growth of a child or adolescent. Claim 15 In Clause 13, the above composition is a quasi-drug composition that reduces KMT1A expression. Claim 16 In claim 13, the above composition is a quasi-drug composition that increases the expression of a growth hormone receptor or insulin-like growth factor-1. Claim 17 In claim 13, the above composition is a quasi-drug composition that reduces binding between KMT1A and a growth hormone receptor promoter. Claim 18 A quasi-drug composition according to claim 13, wherein the height growth disorder is one or more selected from the group consisting of familial short stature, idiopathic short stature, constitutional growth retardation, short stature due to Down syndrome, short stature due to Turner syndrome, short stature due to Prader-Willi syndrome, short stature due to Silver-Russell syndrome, short stature due to Noonan syndrome, short stature due to nutritional deficiency, short stature due to chronic systemic disease, short stature due to growth hormone deficiency, short stature due to hypothyroidism, short stature due to precocious puberty, short stature due to Cushing's syndrome, and psychosocial dwarfism. Claim 19 A feed composition for promoting height growth containing berberine chloride hydrate as an active ingredient.

Images