Oligomeric nucleic acid molecules for the treatment of acute intermittent porphyria and their use

KR103003603B1Active Publication Date: 2026-08-11SINO US INST OF RNA TECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
KR1020217033428
Authority / Receiving Office
KR · KR
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-04-30
Filing Date
2020-04-29
Publication Date
2026-08-11
Estimated Expiration
2040-04-29

Smart Images

  • Figure 112021118354986-PCT00006_ABST
    Figure 112021118354986-PCT00006_ABST
Patent Text Reader

Abstract

The present invention relates to a composition of a small activated nucleic acid molecule for increasing the expression of the HMBS gene and the use thereof. The small activated nucleic acid molecule may be a double-stranded or single-stranded RNA molecule targeting the promoter region of the HMBS gene. The first nucleic acid strand and the second nucleic acid strand each contain a complementary region, and the complementary region may form a double-stranded nucleic acid structure capable of promoting the expression of the HMBS gene. The first nucleic acid strand or the second nucleic acid strand independently has a length of 16 to 35 nucleotides. The 3' ends of the two oligonucleotide strands may have an overhang having a length of 0 to 6 nucleotides. By using the small activated nucleic acid molecule for the HMBS gene, mRNA and protein expression of the HMBS gene can be upregulated and its enzymatic activity promoted.
Need to check novelty before this filing date? Find Prior Art

Description

Technology Field

[0001] The present invention relates to the field of nucleic acid technology, and in particular to oligomeric nucleic acid molecules associated with gene activation, such as small activated nucleic acid molecules, and methods of use thereof for activating or / upregulating the expression of the hydroxymethylbilan synthase HMBS gene, and methods of use thereof for the treatment of diseases such as acute intermittent porphyria caused by insufficient expression or reduced activity of HMBS. Background Technology

[0002] Hereditary porphyria is a series of diseases caused by a lack of activity of specific enzymes within the heme biosynthetic pathway, also known as the porphyrin pathway. A deficiency in enzymes within the porphyrin pathway leads to insufficient heme production and the accumulation of porphyrin precursors and porphyrins, resulting in high concentrations of these precursors and porphyrins within tissues and causing tissue toxicity.

[0003] Among hereditary porphyria, acute intermittent porphyria (AIP), such as autosomal dominant hereditary AIP; pycnidiasis (VP), such as autosomal dominant hereditary VP; hereditary coproporphyria, such as autosomal dominant HCP; chromaffin cell or HCP; 5'-aminolevulinic acid, also known as delta-aminolevulinic acid (ALA); and dihydratase deficiency porphyria (ADP), such as autosomal recessive ADP, are classified as acute intermittent porphyria. These manifest as fatal acute neurological symptoms involving the autonomic, peripheral, and central nervous systems, accompanied by severe abdominal pain, hypertension, tachycardia, constipation, motor weakness, paralysis, and epilepsy. Without appropriate treatment, it can lead to paralysis of the limbs, respiratory failure, and even death. Many drugs that can induce changes in cytochrome P450, dieting, and hormone levels can increase the activity of hepatic 5'-aminoleblin acid synthase 1 (ALAS1), thereby inducing the onset of acute porphyria (Balwani and Desnick, Blood , 120: 4496-4504, 2012).

[0004] The most common acute hepatic porphyria (AIP), also known as porfobinogen deaminase (PBGD) deficiency or hydroxymethylbilan synthase (HMBS) deficiency, is an autosomal dominant genetic disease caused by HMBS gene mutations. It has an incidence rate of 5 to 10 per 100,000 people, meaning that symptoms occur in approximately 5% to 10% of patients. In AIP patients, a mutation in one allele of the HMBS gene reduces the protein expression of hydroxymethylbilan synthase by half (half-insufficient), leading to lower enzyme activity; this, in turn, affects ALA and porfobilinogen (PBG). in vivo It leads to accumulation and a deficiency in heme synthesis.

[0005] Intravenous hemin is routinely used for the treatment and prevention of acute onset of AIP in patients. Hemin reduces the production of ALA and PBG by inhibiting the negative feedback of ALAS1 through the delivery of exogenous heme. Although patient response is excellent, the therapeutic effect of hemin is slow, and it generally takes 2 to 4 days or more to achieve normal urinary PBG and ALA concentrations. Due to the rapid metabolism of hemin, 3 to 4 intravenous injections are typically required for effective treatment or prevention of acute onset. Furthermore, repeated injections can lead to iron overload and phlebitis. Currently, the only treatment option is liver transplantation. However, there is a risk of serious complications and death associated with liver transplantation, and liver donors are limited.

[0006] Given the limitations of current treatments, there is a need for more effective, sustained, rapid, and safe alternative treatments.

[0007] The present invention uses small activated RNA (saRNA). in vivo A method is disclosed for effectively treating AIP by specifically activating the HMBS gene expression level to stimulate cells to produce endogenous porfobilinogen deaminase, also known as hebroxymethylbilan synthetase, thereby restoring intracellular levels to normal.

[0008] The present invention provides a small activated nucleic acid molecule (saRNA) that treats diseases such as acute intermittent porphyria caused by insufficient HMBS expression or reduced activity by activating or upregulating HMBS gene transcription to increase HMBS protein expression.

[0009] In one aspect of the present invention, the disclosed small activating nucleic acid molecule can activate or upregulate the expression of an HMBS gene within a cell. One strand of the activating nucleic acid molecule disclosed herein has at least 75% homology or complementarity with a sequence of 16 to 35 nucleotides in length in the promoter region of the HMBS gene, and thus can activate or upregulate said gene expression, said promoter region comprises 400 base pairs (bp) upstream of the nucleotide sequence of the HMBS gene transcription start site. Specifically, one strand of the small activating nucleic acid molecule disclosed herein comprises a nucleotide sequence having at least 75% homology or complementarity with a continuous sequence of 16 to 35 nucleotides in length in the promoter region of the HMBS gene, said promoter region comprises 400 bp upstream of the nucleotide of the HMBS gene transcription site. In one specific embodiment, one strand of the small activated nucleic acid molecule disclosed herein has at least 75% (e.g., at least about 79%, about 80%, about 165 consecutive nucleotides) of 16 to 35 consecutive nucleotides in the -395 to -351 bp (tagcctgggcaacatagtgaggccacctccccgctgtctctataa, SEQ ID 1) upstream region (Region 1) and the -179 bp to -1 bp (tgctgcctatttcaaggttgtagcaaagcta gtttgaacagagcaaaggaagcgccatagaagctgcactacttgctcatgtcacagctggggaatggggtggtcgaatggggaggtccactgtcgcaatgttccaattcccgcccagagggagggacctccccttcgagggagggcg, SEQ ID 2) upstream region (Region 2) of the HMBS gene promoter. It includes or is selected from nucleotides having homology or complementarity of 85%, about 90%, about 95%, about 99%, or 100%.More specifically, in one embodiment, one strand of the small activated nucleic acid molecule disclosed herein has at least 75% homology or complementarity, such as about 79%, about 80%, about 85%, about 90%, about 95%, or about 99%, with respect to a continuous sequence of length 16 to 35 nucleotides selected in SEQ ID 1 and SEQ ID 2. In one specific embodiment, one strand of the small activated nucleic acid molecule disclosed herein comprises or is selected from a nucleotide sequence having at least 75% homology or complementarity, such as about 79%, about 80%, about 85%, about 90%, about 95%, about 99%, or 100%, with respect to a continuous sequence of length 16 to 35 nucleotides selected in SEQ ID 1 and SEQ ID 2. In additional specific embodiments, one strand of the small activated nucleic acid molecule disclosed herein consists of a nucleotide sequence having at least 75% homology or complementarity, such as about 79%, about 80%, about 85%, about 90%, about 95%, about 99%, or 100%, with respect to a continuous sequence of length 16 to 35 nucleotides selected in SEQ ID 1 and SEQ ID 2.

[0010] In the present invention, the small activated nucleic acid molecule disclosed herein comprises a double-stranded small activated nucleic acid molecule that targets a promoter region of an HMBS gene, comprising a first nucleic acid strand and a second nucleic acid strand, wherein the first nucleic acid strand has at least 75% homology or complementarity with a continuous sequence of length 16 to 35 nucleotides at SEQ ID 1 or SEQ ID 2 of the promoter of the HMBS gene, and the second nucleic acid strand has at least 75% complementarity with the first nucleic acid strand, and the first nucleic acid strand and the second nucleic acid strand can activate the expression of the HMBS gene in a cell by forming a double-stranded nucleic acid structure complementarily between the two fragments.

[0011] The sense nucleic acid strand and the antisense nucleic acid strand of the small activated nucleic acid molecule disclosed herein may exist on two different nucleic acid strands or on the same nucleic acid strand. When the sense nucleic acid strand and the antisense nucleic acid strand are located on two different strands, at least one strand of the small activated nucleic acid molecule has an overhang at either the 5' end or the 3' end, such as an overhang at the 3' end having a length of 0 to 6 nucleotides. Preferably, both strands of the small activated nucleic acid molecule disclosed herein have an overhang, more preferably, the 3' ends of both strands of the small activated nucleic acid molecule may have an overhang having a length of 0 to 6 nucleotides, and more preferably, an overhang having a length of 2 or 3 nucleotides. Preferably, the nucleotides of the overhang are dT or U, or the overhang may be a natural nucleotide overhang. The natural nucleotide overhang described herein means that a nucleotide protruding from the end of the sense nucleic acid fragment or the antisense nucleic acid fragment is identical to or complementary to a nucleotide of the corresponding target sequence.

[0012] Additionally, the small activated nucleic acid molecule may include a single-stranded RNA molecule capable of forming a double-stranded region hairpin structure. In one embodiment, the small activated nucleic acid molecule disclosed herein is a single-stranded RNA molecule targeting the promoter region of the HMBS gene, and the small activated nucleic acid molecule may form a double-stranded region hairpin structure. When the sense nucleic acid strand and the antisense nucleic acid strand exist on the same nucleic acid strand, preferably, the small activated nucleic acid molecule may be a hairpin single-stranded nucleic acid molecule, and the complementary regions of the sense nucleic acid fragment and the antisense nucleic acid fragment may form a double-stranded nucleic acid structure between the two fragments, thereby inducing the expression of the HMBS gene, for example, through an RNA activation mechanism.

[0013] The small activated nucleic acid molecule, the sense nucleic acid fragment, and the antisense nucleic acid fragment may have a length of 16 to 35 nucleotides (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 to 35 nucleotides).

[0014] In one embodiment, the sense strand of the small activated nucleic acid molecule disclosed herein has at least 75% identity or homology, such as about 79%, about 80%, about 85%, about 90%, about 95%, about 99%, or 100%, with respect to a nucleotide sequence selected in SEQ IDs 30-48, and its antisense strand has at least 75% identity or homology, such as about 79%, about 80%, about 85%, about 90%, about 95%, about 99%, or 100%, with respect to a nucleotide sequence selected in SEQ IDs 49-67. In one embodiment, the sense strand of the small activated nucleic acid molecule disclosed herein comprises or is selected from a sequence having at least 75% identity or homology, such as about 79%, about 80%, about 85%, about 90%, about 95%, about 99%, or 100%, with respect to a nucleotide sequence selected in SEQ IDs 30-48, and the antisense strand thereof comprises or is selected from a sequence having at least 75% identity or homology, such as about 79%, about 80%, about 85%, about 90%, about 95%, about 99%, or 100%, with respect to a nucleotide sequence selected in SEQ IDs 49-67. In one embodiment, the sense strand of the small activated nucleic acid molecule disclosed herein is composed of a sequence having at least 75% identity or homology, such as about 79%, about 80%, about 85%, about 90%, about 95%, about 99%, or 100%, with respect to a nucleotide sequence selected in SEQ IDs 30-48, and the antisense strand is composed of a sequence having at least 75% identity or homology, such as about 79%, about 80%, about 85%, about 90%, about 95%, about 99%, or 100%, with respect to a nucleotide sequence selected in SEQ IDs 49-67.In one specific embodiment, the sense strand of the small activated nucleic acid molecule disclosed herein may be a sequence represented by a nucleotide sequence selected from SEQ IDs 30-48, and its antisense strand may be a sequence represented by a nucleotide sequence selected from SEQ IDs 49-67.

[0015] In one embodiment, the small activated nucleic acid molecule disclosed herein is synthesized and in vitro It can be transcribed from or expressed by a vector.

[0016] All nucleotides of the activated nucleic acid molecule disclosed herein may be non-chemically modified natural nucleotides or may include at least one modification. In one embodiment, the modification of the small activated nucleic acid molecule disclosed herein may be a chemical modification, for example, at least one nucleotide may be a chemical modification. The chemical modification used herein is

[0017] (1) Modification of the phosphodiester bonds of nucleotides within the nucleotide sequence of the small activated nucleic acid molecule;

[0018] (2) Modification of the ribose 2'-OH in the nucleotide sequence of the small activated nucleic acid molecule; and

[0019] (3) Modification of bases within nucleotides of the small activated nucleic acid molecule;

[0020] (4) At least one nucleotide in the nucleotide sequence of the small active nucleic acid molecule may be included in or selected from at least one modification or combination of modifications in which at least one nucleotide is a fixed nucleic acid.

[0021] The chemical modifications specified herein are well known to those skilled in the art, and the modification of the phosphodiester bond refers to the modification of oxygen within the phosphodiester bond, including but not limited to phosphorothioate modification and boranophosphate modification. These two modifications can stabilize the structure of small active nucleic acid molecules and maintain high specificity and high affinity for base pairing.

[0022] The above ribose modification refers to a 2'-OH modification within the pentose of the nucleotide, that is, for example, 2'-fluoro modification, 2'-oxymethyl modification, 2'-oxyethylidene methoxy modification, 2,4'-dinitrophenol modification, fixed nucleic acid (LNA), 2'-amino modification, 2'-deoxy modification, and introduces a specific substituent at the hydroxyl position of the ribose.

[0023] The above base modification refers to modifications of nucleic acid bases including, but limited to, 5'-bromouracil modification, 5'-ioduracil modification, N-methyluracil modification, and 2,6-diaminopurine modification.

[0024] These modifications increase the bioavailability of the small activated nucleic acid molecule, improve the affinity of the target sequence, and enhance resistance to intracellular nuclease hydrolysis.

[0025] Furthermore, to promote cellular uptake of the small activated nucleic acid, based on the modification, lipophilic groups such as cholesterol bind to the ends of the sense strand or antisense strand of the small activated nucleic acid molecule and promote transmembrane movement across the lipid bilayer cell membrane and nuclear envelope, thereby ultimately binding to gene promoter targets within the cell nucleus.

[0026] After contact with a cell, the small activated nucleic acid molecule disclosed in the present invention effectively activates or upregulates the HMBS gene expression within the cell, preferably upregulating the expression by at least 10%.

[0027] Additionally, another aspect of the present invention relates to a nucleic acid encoding the small activated nucleic acid molecule disclosed herein. In one embodiment, the nucleic acid may be a DNA molecule.

[0028] Another aspect of the present invention provides a cell comprising the small activated nucleic acid molecule disclosed herein or a nucleic acid encoding the small activated nucleic acid molecule. In one embodiment, the small activated nucleic acid molecule of the present invention is a double-stranded small activated nucleic acid molecule targeting a promoter region of the HMBS gene and may include a sense strand and an antisense strand. In another embodiment, the small activated nucleic acid molecule of the present invention may be a single-stranded nucleic acid molecule coating the small activated nucleic acid molecule targeting a promoter region of the HMBS gene.

[0029] Another aspect of the present invention provides a kit comprising the small active nucleic acid molecule disclosed herein and the nucleic acid encoding the small active nucleic acid molecule.

[0030] Another aspect of the present invention relates to the use of the small activated nucleic acid molecule and the nucleic acid encoding the small activated nucleic acid molecule disclosed herein in preparing a drug that activates or / upregulates intracellular HMBS gene expression.

[0031] Another aspect of the present invention relates to a method of using said small activated nucleic acid molecule, the nucleic acid encoding said small activated nucleic acid molecule disclosed herein, and said cell of the present invention in preparing a drug for treating a disease caused by a deficiency in expression or reduced activity of HMBS in a subject. In one embodiment, said disease caused by a deficiency in expression or reduced activity of HMBS may include hereditary porphyria. Hereditary porphyria may include, for example, acute intermittent porphyria.

[0032] Another aspect of the present invention relates to a method of using said small activated nucleic acid molecule, a nucleic acid encoding said small activated nucleic acid molecule disclosed herein, and said cell of the present invention in preparing a drug for treating acute intermittent porphyria in a subject.

[0033] Additionally, another aspect of the present invention relates to a method for treating a disease caused by a deficiency in the expression or reduced activity of HMBS in a subject, said method comprising administering to the subject the small activated nucleic acid molecule, the nucleic acid encoding the small activated nucleic acid molecule disclosed herein, or said cell of the present invention.

[0034] Additionally, another aspect of the present invention relates to a method for treating acute intermittent porphyria in a subject, said method comprising administering to the subject the small activated nucleic acid molecule, the nucleic acid encoding the small activated nucleic acid molecule disclosed herein, and said cell of the present invention.

[0035] The present invention also relates to a method for activating or / upregulating HMBS gene expression in cells. The method comprises administering to cells the small activated nucleic acid molecule disclosed herein or a nucleic acid encoding the small activated nucleic acid molecule.

[0036] The small activated nucleic acid molecule of the present invention may be introduced directly into a cell, or may be produced in the cell after introducing a nucleotide sequence encoding the small activated nucleic acid molecule into the cell. The cell is preferably a mammalian cell, and more preferably a human cell. The cell is such as a cell line or cell line. in vitro It may be present in or isolated from a mammalian body, such as a human. The human is a patient suffering from a disease or symptom caused by a decrease in HMBS protein expression. The small activated nucleic acid molecule disclosed herein may be administered in a dose sufficient to treat the symptom caused by a decrease in HMBS protein expression. Specifically, the symptom caused by a lack of HMBS protein expression is acute intermittent porphyria.

[0037] Another aspect of the present invention provides an isolated target site of a small activated nucleic acid molecule for an HMBS gene, said target site is a continuous sequence having a length of 16 to 35 nucleotides in a promoter region of the HMBS gene, preferably said target site is a continuous sequence having a length of 16 to 35 nucleotides in any one of the sequences specified in SEQ IDs 1-2. Specifically, said target site comprises or is selected from any one of the nucleotide sequences selected in SEQ IDs 11-29.

[0038] Advantages of the present invention

[0039] The small activated nucleic acid molecule disclosed in the present invention, capable of activating or upregulating the expression of the HMBS gene, can permanently activate the HMBS gene; therefore, it can efficiently and specifically upregulate or restore the expression of the HMBS gene and HMBS protein and the activity of the enzyme with low toxicity and side effects, and can be used to manufacture drugs or preparations that activate or upregulate the expression of the HMBS gene and HMBS protein within cells. Brief explanation of the drawing

[0040] Fig. 1 This is a diagram showing the promoter of the HMBS gene. Regions 1 and 2 are target sequence regions used to design small nucleic acid molecules. TSS is the transcription start site. Fig. 2 Figure [Figure] illustrates changes in HMBS mRNA expression levels mediated by small activated nucleic acid molecules. 180 promoter-targeted saRNAs were individually transfected into human hepatocellular carcinoma cells (Huh7) at a concentration of 10 nM. After 72 hours, HMBS mRNA expression levels were analyzed using a one-step RT-PCR assay. Figure [Figure] illustrates the relative fold changes in HMBS expression levels induced by each of the 180 saRNAs, and the fold changes were classified in descending order. Fig. 3 Figure 1 indicates the degree of change in the HMBS mRNA mediated by small activated nucleic acid molecules. Huh7 cells were transfected by individually transfecting them with 180 promoter-targeted small nucleic acid molecules (saRNA) at a concentration of 10 nM. After 72 hours, the expression levels of HMBS mRNA were analyzed using a one-step RT-PCR assay. Figure 1 illustrates the fold change in HMBS mRNA expression levels induced by each saRNA relative to the control group (Mock). The small nucleic acid molecules were classified by their target sites on the promoter of the HMBS gene from the most upstream to the TSS. Fig. 4 Figure [document] illustrates a pool of small activating RNA (saRNA) candidates that activate HMBS mRNA expression within various hepatocytes. The illustrated saRNAs (n=13, final concentration: 20 nM) were used to transfect human hepatocellular carcinoma cells (Huh7), human hepatocellular carcinoma cells (HepG2), and human embryonic hepatocytes (CCC-HEL-1). After 72 hours, cells were collected and the RNAs were extracted using the Qiagen RNeasy kit. Following reverse transcription, qPCR amplification of the HMBS gene was performed using the 7500FAST real-time PCR system. Simultaneously, the HPRT1 and TBP genes were amplified as an internal reference. Mock, dsCon2 (sense strand: 5'-ACUACUGAGUGACAGUAGATT-3' (SEQ ID 68), antisense strand: 5'-UCUACUGUCACUCAGUAGUTT-3' (SEQ ID 69)) and siHMBS (sense strand: 5'-CCUGUUUACCAAGGAGCUUTT-3' (SEQ ID 3), antisense strand: 5'-AAGCUCCUUGGUAAACAGGTT-3' (SEQ ID 4)) were used for blank transfection, sequence-independent double-stranded RNA transfection, and small interfering RNA (siRNA) control transfection, respectively. Fig. 5 Figure [] illustrates saRNA candidates that activate HMBS protein expression in hepatocytes. These saRNA candidates were used to transfect human hepatocellular carcinoma cells (HepG2) at a concentration of 20 nM. After 72 hours, the cells were collected for Western blot analysis. An anti-human HMBS antibody was used to analyze HMBS protein expression. Tubulin was used as a control to determine the accuracy of loaded protein amounts. Mock, dsCon2, and siHMBS represent blank transfection, sequence-independent double-stranded RNA transfection, and small interfering RNA control transfection, respectively. Fig. 5A represents a scan image of a cell membrane using Western blotting. Fig. 5B represents the relative value of the HMBS band intensity of each treatment group compared with the intensity of the Mock treatment group obtained using ImageJ software to quantitatively analyze the bands of Fig. 5A. Fig. 6 Figure [] plots the PPIX fluorescence intensity per unit (mg) of protein obtained by ALA conversion analysis. The saRNA indicated above was used for the transfection of human embryonic hepatocytes (CCC-HEL-1). After 48 hours, the ALA substrate was added to the cells. The cells were collected before the addition of the substrate (0h) and 24 hours after the addition of the substrate (24h) to analyze the PPIX fluorescence intensity. Simultaneously, the cells were lysed to measure protein concentration. Mock, dsCon2, and siHMBS represent blank transfection, sequence-independent double-stranded RNA transfection, and small interfering RNA control transfection, respectively. The Y-axis represents the PPIX fluorescence intensity per unit (mg) of protein. Fig. 7 This shows the PPIX fluorescence intensity per protein unit (mg) obtained by the ALA conversion assay and saRNA candidates that activate HMBS mRNA and HMBS protein expression in Li-7 cells. Fig. 7A Figure [is a diagram showing the saRNA concentration used to transfect human liver carcinoma cells Li-7; after 72 hours, cells were collected and RNA was extracted using the Qiagen RNeasy kit; after reverse transfection, qPCR amplification for the HMBS gene was performed using the 7500FAST real-time PCR system; and at the same time, the HPRT1 gene was amplified as an internal reference material. Fig. 7BThe top figure of Figure 7B illustrates the saRNA used to transfect human hepatocarcinoma cells (Li-7) at the concentration specified above; after 72 hours, the cells were collected for Western blotting analysis; protein expression of HMBS was analyzed using an anti-human HMBS antibody; and the accuracy of the loaded protein content was measured using tubulin as a control. The bottom figure of Figure 7B illustrates the relative values ​​of the HMBS band intensity of each treatment group compared to a mock treatment group obtained using ImageJ software to quantitatively analyze the bands of Figure 7A. M: Mock treatment group; C: dsCon2 treatment group . Fig. 7C Figure [] illustrates the saRNA used to transfect human hepatocarcinoma cells (Li-7) at the concentrations specified above; after 24 hours, the ALA substrate was added to the cells, and after 48 hours, the cells were collected and PPIX fluorescence intensity was analyzed; at the same time, the cells were lysed and protein concentrations were measured. Mock, dsCon2, and siHMBS represent blank transfection, sequence-independent double-stranded RNA transfection, and small interfering RNA control transfection, respectively. Fig. 8 This shows candidate saRNAs that activate HMBS mRNA and HMBS protein within GM01623 cells of a patient suffering from acute intermittent porphyria (AIP). Fig. 8A The saRNA used to transfect cells GM01623 at a final concentration of 20 nM is shown; after 72 hours, the cells were collected, and the RNA was extracted using the Qiagen RNeasy kit; after reverse transfection, qPCR amplification for the HMBS gene was performed using the 7500FAST real-time PCR system; and at the same time, the HPRT1 and TBP genes were amplified as internal reference materials. Fig. 8BFigure [] shows the saRNA used to transfect GM01623 cells at a final concentration of 20 nM; after 72 hours, the cells were collected for Western blotting analysis; protein expression of HMBS was analyzed using an anti-human HMBS antibody; and simultaneously, the accuracy of the loaded protein was measured using tubulin as a control. Mock, dsCon2, and siHMBS represent blank transfection, control dsRNA transfection, and small interfering RNA control transfection, respectively. Fig. 9 This illustrates a group of saRNA candidates that activate the HMBS mRNA and HMBS protein within GM01624 cells of a patient suffering from acute intermittent porphyria (AIP). Fig. 9A Figure [] shows the saRNA concentration used to transfect cells GM01624 at a final concentration of 20 nM; after 72 hours, the cells were collected, and the RNA was extracted using the Qiagen RNeasy kit; after reverse transfection, qPCR amplification for the HMBS gene was performed using the 7500FAST real-time PCR system; and at the same time, the HPRT1 and TBP genes were amplified as internal reference materials. Fig. 9B Figure [] shows the saRNA used to transfect cells GM01624 at a final concentration of 20 nM; after 72 hours, the cells were collected for Western blotting analysis; protein expression of HMBS was analyzed using an anti-human HMBS antibody; and simultaneously, tubulin was used as a control for protein loading. Mock, dsCon2, and siHMBS represent blank transfection, control dsRNA transfection, and small interfering RNA control transfection, respectively. Fig. 10 This shows candidate saRNAs that activate the HMBS mRNA and HMBS protein in GM01625 cells of a patient suffering from acute intermittent porphyria (AIP). Fig. 10AFigure 1 shows the saRNA concentration used to transfect cells GM01625 at a final concentration of 20 nM; after 72 hours, the cells were collected, and the RNA was extracted using the Qiagen RNeasy kit; after reverse transfection, qPCR amplification for the HMBS gene was performed using the 7500FAST real-time PCR system; and at the same time, the HPRT1 and TBP genes were amplified as internal reference materials. Fig. 10B Figure 1 shows the saRNA used to transfect GM01625 cells at a final concentration of 20 nM; after 72 hours, the cells were collected for Western blotting analysis; protein expression of HMBS was analyzed using an anti-human HMBS antibody; and simultaneously, tubulin was used as a control for protein loading. Mock, dsCon2, and siHMBS represent blank transfection, control dsRNA transfection, and small interfering RNA control transfection, respectively. Specific details for implementing the invention

[0041] Related terms used in the present invention are defined as follows.

[0042] In this document, "complementary" means the ability to form base pairs between two oligonucleotide strands. The base pairs are generally formed through hydrogen bonds between nucleotides of the antiparallel oligonucleotide strands. The bases of the complementary oligonucleotide strands may be paired by the Watson-Crick method (e.g., T instead of A, U instead of A, and G instead of C) or by other methods (e.g., Hoogstein or inverse Hoogstein base pairing) to form dimers.

[0043] Complementarity includes complete complementarity and incomplete complementarity. "Complete complementarity" or "100% complementarity" means that each nucleotide in the first oligonucleotide strand forms a hydrogen bond at the corresponding position of the second oligonucleotide strand in the double-strand region of the double-strand oligonucleotide molecule so as not to be "mismatched." "Incomplete complementarity" means that not all nucleotide units of the two strands are bonded to each other by hydrogen bonds. For example, for two oligonucleotide strands each having a length of 20 nucleotides in the double-strand region, if only two base pairs can be formed through hydrogen bonds in the double-strand region, the oligonucleotide strand has 10% complementarity. Similarly, if 18 base pairs can be formed through hydrogen bonds in the double-strand region, the oligonucleotide strand has 90% complementarity. Significant complementarity means at least about 75%, about 79%, about 80%, about 85%, about 90%, about 95%, about 99%, or about 100% complementarity.

[0044] In this document, “oligonucleotide” or “small nucleic acid molecule” means a nucleotide polymer, including but not limited to single-stranded or double-stranded molecules of DNA, RNA, or DNA / RNA hybrids, oligonucleotide strands containing regularly and irregularly alternating deoxyribosyl and ribosyl portions, and modified, naturally or non-naturally existing frameworks of such oligonucleotides. The oligonucleotide for activating the target gene transcription described herein is a small active nucleic acid molecule.

[0045] In this invention, "oligonucleotide strand" and "oligonucleotide sequence" refer to general terms for a short nucleotide sequence having fewer than 35 bases (including nucleotides of deoxyribonucleic acid (DNA) or ribonucleic acid (RNA)) and may be used interchangeably. In this invention, an oligonucleotide strand may have a length of 16 to 35 nucleotides.

[0046] In this document, "first nucleic acid strand" may be a sense strand or an antisense strand. A sense strand of small activating RNA means a nucleic acid strand contained in a small activating RNA duplex having identity with the coding strand of the promoter DNA sequence of a target gene, and an antisense strand means a nucleic acid strand within a small activating RNA duplex that is complementary to the sense strand.

[0047] Additionally, the term "second nucleic acid strand" in the present invention may be a sense strand or an antisense strand. If the first oligonucleotide strand is a sense strand, the second oligonucleotide strand is an antisense strand; if the first oligonucleotide strand is an antisense strand, the second oligonucleotide strand is a sense strand.

[0048] In this document, "gene" means any nucleotide sequence required to encode a polypeptide chain or transcribe a functional RNA. "Genus" may be endogenous or a fully or partially recombinant gene for a host cell (e.g., because a coding sequence encoding an exogenous oligonucleotide and a promoter is introduced into a host cell, or because a heterologous promoter adjacent to an exogenous coding sequence is introduced into a host cell). For example, "gene" includes a nucleic acid sequence composed of exons and introns. For example, a protein-coding sequence is a sequence contained within an exon of an open reading frame between a start codon and a stop codon, and as used herein, "gene" includes gene regulatory sequences, such as promoters, enhancers, and all other sequences known in techniques for controlling the transcription, expression, or activity of other genes, regardless of whether said gene includes a coding sequence or a non-coding sequence. For example, "gene" can be used to describe functional nucleic acids containing regulatory sequences such as promoters or enhancers. The expression of a recombinant gene can be controlled by one or more heterogeneous regulatory sequence types.

[0049] In this invention, the term "target gene" means a nucleic acid sequence, transgenic gene, viral or bacterial sequence naturally occurring within an organism, a chromosomal or extrachromosomal gene, and / or may be transiently or stably transfected or integrated into the cell and / or chromatin thereof. The target gene may be a protein-coding gene or a non-protein-coding gene (e.g., a microRNA gene and a long non-coding RNA gene). The target gene generally contains a promoter sequence, and positive regulation of the target gene can be achieved by designing a small active nucleic acid molecule that possesses sequence identity (also called homology) with respect to the promoter sequence and exhibits the characteristic of upregulating the expression of the target gene. The term "sequence of the target gene promoter" means the non-coding sequence of the target gene, and in the phrase "complementary to the target gene promoter sequence" of the present invention, the term "target gene promoter sequence" means the coding strand of the sequence, which also includes a non-template strand, in other words , is known as a nucleic acid sequence having a sequence identical to the coding sequence of the above gene. "Target sequence" means a sequence fragment within the sequence of a target gene promoter that is homologous or complementary to the sense oligonucleotide strand or antisense oligonucleotide strand of a small activated nucleic acid molecule.

[0050] In this document, "sense strand" and "sense oligonucleotide strand" may be used interchangeably, and the sense oligonucleotide strand of a small activated nucleic acid molecule refers to a first nucleic acid strand having sequence homology with the coding strand of a target gene promoter sequence within the small activated nucleic acid molecule double.

[0051] In this document, "antisense strand" and "antisense oligonucleotide strand" may be used interchangeably, and the antisense oligonucleotide strand of a small activated nucleic acid molecule refers to a second nucleic acid strand that is complementary to the sense oligonucleotide strand within the small activated nucleic acid molecule double.

[0052] In this document, "coating strand" means a DNA strand of the target gene that cannot be used for transcription, and the nucleotide sequence of said strand is identical to that of the RNA produced by transcription (in said RNA, the T of the DNA is replaced with U). In this document, the coding strand of the double-stranded DNA sequence of said target gene promoter means a promoter sequence on the same DNA strand as the DNA coding strand of said target gene.

[0053] In this document, "template strand" means another strand that is complementary to the coding strand in the double-stranded DNA of the target gene, and in other words The above strand can be transcribed into RNA as a template, and the above strand refers to a strand complementary to the transcribed RNA (U instead of A, C instead of G). During transcription, RNA polymerase binds to the above template strand, moves in the 3'→5' direction of the above template strand, and catalyzes the synthesis of the above RNA in the 5'→3' direction. In the present invention, the template strand of the double-stranded DNA sequence of the above target gene promoter refers to a promoter sequence located on the same DNA strand as the DNA template strand of the above target gene.

[0054] In this document, "promoter" means a sequence that is spatially associated with a protein-coding or RNA-coding nucleic acid sequence and performs the role of regulating the transcription of said protein-coding or RNA-coding nucleic acid sequence. Generally, eukaryotic gene promoters contain 100 to 5,000 base pairs, but the length range thereof does not limit the "promoter" used herein. Although said promoter sequence is generally located at the 5' end of said protein-coding or RNA-coding sequence, it may also be present in exon and intron sequences.

[0055] In this document, "transcription start site" means a nucleotide that marks the start of transcription on the template strand of the gene. The transcription start site may appear on the template strand of the promoter region. The gene may have one or more transcription start sites.

[0056] In this document, “identity” or “homology” means that one oligonucleotide strand (sense or antisense strand) of a small activating RNA has sequence similarity to a coding strand or template strand within a region of a target gene promoter sequence. In this document, “identity” or “homology” may be at least about 75%, about 79%, about 80%, about 85%, about 90%, about 95%, 99%, or about 100%.

[0057] In this document, "overhang" means a non-base pair nucleotide formed by a single strand extending from the other strand of a double-stranded oligonucleotide, which is located at the end (5' or 3') of the oligonucleotide strand. A single-stranded region extending from the 3' end and / or 5' end of the double is referred to as an overhang.

[0058] In this invention, "gene activation," "gene expression activation," "gene upregulation," and "gene expression upregulation" refer to increasing the transcription, translation, expression, or activity of a specific nucleic acid as determined by measuring transcription levels, mRNA levels, protein levels, enzyme activity, methylation status, chromatin status or structure, or translation levels or activities or states within a cell or organelle of the gene, and may be used interchangeably. Such activities or states may be determined directly or indirectly. Furthermore, "gene activation," "gene expression activation," "gene upregulation," or "gene expression upregulation" means increasing the activity associated with a nucleic acid sequence regardless of the mechanism of such activity. For example, said nucleic acid sequence acts as a regulatory sequence and performs a regulatory role, said nucleic acid sequence is transcribed into RNA, said RNA is translated into protein, and said RNA increases protein expression. Preferably, the small activating RNA molecule disclosed in the present invention upregulates gene or protein expression by at least 10% or increases activity.

[0059] In this document, "small activated RNA," "saRNA," and "small activated nucleic acid molecule" may be used interchangeably and refer to a nucleic acid molecule capable of upregulating target gene expression, and is composed of a first nucleic acid fragment (also called an antisense strand, or antisense oligonucleotide strand) containing a nucleotide sequence having sequence identity or homology with a non-coding nucleic acid sequence of a target gene (e.g., promoter and enhancer) and a second nucleic acid fragment (also called a sense strand, or sense oligonucleotide strand) containing a nucleotide sequence having nucleotide sequence complementarity with said first nucleic acid fragment, and said first nucleic acid fragment and second nucleic acid fragment form a dimer. The small activated nucleic acid molecule may also be composed of a synthetic or vector-expressed single-stranded RNA molecule capable of forming a hairpin structure by two complementary regions within the molecule, wherein the first region comprises a nucleotide sequence having sequence identity with the target sequence of a gene promoter, and the second region comprises a nucleotide sequence complementary to the first region. The length of the dimer region in the above small activated nucleic acid molecule is generally about 10 to about 50, about 12 to about 48, about 14 to about 46, about 16 to about 44, about 18 to about 42, about 20 to about 40, about 22 to about 38, about 24 to about 36, about 26 to about 34, about 28 to about 32 base pairs, and generally about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, or about 50 base pairs. Furthermore, "saRNA", "small activated RNA" and "small activated nucleic acid molecule" also include nucleic acids other than the above ribonucleotides, and include, but are not limited to, modified nucleotides or analogs.

[0060] In this invention, "hotspot" refers to a gene promoter region of at least 30 bp in length that is rich in functional small activated nucleic acid molecules, that is, at least 30% of the small activated nucleic acid molecules designed to target such a region are functional and can induce a change of 1.2 times or more in the target gene expression mRNA.

[0061] In this context, "synthesis" refers to RNA synthesis, for example, chemical synthesis, in vitro It refers to a method for synthesizing oligonucleotides that includes a method allowing transcription and / or vector-based expression.

[0062] According to the present invention, the expression of the HMBS gene is upregulated by an RNA activation method, and the expression of the HMBS protein is increased to promote heme production. The HMBS gene of the present invention is sometimes referred to as a target gene.

[0063] The present invention provides a method for producing the small active nucleic acid molecule, including sequence design and synthesis.

[0064] Small active nucleic acid molecules can be chemically synthesized or obtained from biotechnology companies specializing in nucleic acid synthesis.

[0065] Generally, the chemical synthesis of nucleic acids consists of four steps: (1) synthesis of oligomeric ribonucleotides; (2) deprotection; (3) purification and separation; and (4) desalting and annealing.

[0066] For example, a specific step for chemically synthesizing the oligomeric nucleic acid molecule of the present invention is as follows.

[0067] (1) Synthesis of oligomeric nucleic acid molecules

[0068] Synthesis of 1 μM RNA was set on an automated DNA / RNA synthesizer (e.g., Applied Biosystems EXPEDITE8909), and the binding time for each cycle was set to 10 to 15 minutes. Using a solid-phase binding 5'-Op-dimethoxytriphenylmethyl-thymidine substrate as an initiator, one base was bound to the solid-phase substrate in the first cycle, and then in the nth cycle (19 ≥ n ≥ 2), one base was bound to the base bound in the n-1th cycle. The above process was repeated until the synthesis of the entire nucleic acid sequence was completed.

[0069] (2) Deprotection

[0070] The solid substrate bound to the oligomer nucleic acid molecule was placed in a test tube, and 1 mL of a mixed solution of ethanol and ammonium hydroxide (volume ratio 1:3) was added to the test tube. Then, the test tube was sealed and placed in an incubator, and the mixture was incubated at 25–70°C for 2 to 30 hours. The solution containing the solid substrate bound to the oligomer nucleic acid molecule was filtered, and the filtrate was collected. The solid substrate was washed twice with double distilled water (1 mL each), and the filtrate was collected. The collected eluent was combined and dried under vacuum for 1 to 12 hours. Then, the solution was added to 1 mL of a tetrahydrofuran-based fluorotetrabutylammonium solution (1 M), left at room temperature for 4 to 12 hours, and then 2 mL of n Butanol was added. The precipitate was collected, and the single-stranded crude product of saRNA was obtained through high-speed centrifugation.

[0071] (3) Purification and Separation

[0072] The above-mentioned saRNA crude product was dissolved in 2 mL of hydrated ammonium acetate at a concentration of 1 mol / mL, and the solution was separated by reverse-phase C18 column high-pressure liquid chromatography to obtain a purified single-stranded product containing the oligomeric nucleic acid molecule.

[0073] (4) Desalination and annealing

[0074] Salt was removed using gel filtration (size exclusion chromatography). A single-sense oligomeric ribonucleic acid strand and a single-antisense oligomeric ribonucleic acid strand were mixed in a 1:1 molar ratio in 1 to 2 mL of buffer (10 mM Tris, pH = 7.5–8.0, 50 mM NaCl). The solution was heated to 95°C and then slowly cooled to room temperature to obtain a solution containing oligomeric nucleic acid molecules.

[0075] The present invention will be further described with reference to the following specific embodiments and drawings. The following embodiments are merely illustrative of the invention and do not limit the scope of the invention. In the following embodiments, research methods without specific conditions are generally Sambrook, et al., Molecular Cloning: Laboratory Manual Traditional conditions or conditions recommended by the manufacturer were followed, such as those described in (New York: Cold Spring Harbor Laboratory Press, 1989).

[0076] Examples

[0077] Example 1

[0078] Design and synthesis of small activated nucleic acid molecules targeting the HMBS promoter

[0079] The sense sequence of the HBMS gene promoter up to -395 bp upstream from the transcription start site (TSS) was obtained from the UCSC genome database, and the repetitive sequences (-350 to -180) were excluded from the targets. Using the remaining two sequences (Region 1, 45 bp in length: -395 to -351; and Region 2, 179 bp in length: -179 to -1) as templates, targets with a size of 19 bp were selected moving from the most upstream to the downstream, yielding a total of 27 targets in Region 1 and 161 targets in Region 2 ( Fig. 1 The above target sequences were filtered. The criteria for the remaining target sequences were as follows: (1) having a GC content between 35% and 75%; (2) having five or fewer consecutive identical nucleotides; (3) having three or fewer repeating dinucleotides; and (4) having three or fewer repeating trinucleotides. After filtration, 180 target sequences were retained, and the corresponding double-stranded oligomer molecules were chemically synthesized based on these candidate sequences. Each sense strand and antisense strand within the double-stranded oligomer molecules used in this study had a length of 21 nucleotides. The 19 nucleotides in the 5' region of the first ribonucleic acid strand (sense strand) of the oligonucleotide molecule had 100% sequence identity with the target sequence of the promoter, and the 3' end of the first ribonucleic acid strand contained the TT sequence. The 19 nucleotides in the 5' region of the second ribonucleic acid strand were complementary to the sequence of the first ribonucleic acid strand, and the 3' end of the second ribonucleic acid strand contained a TT sequence. Two strands of the oligonucleotide molecules were mixed in a 1:1 molar ratio and, after annealing, formed a double-stranded oligonucleotide molecule.

[0080] Example 2

[0081] Screening of saRNAs targeting the HMBS promoter

[0082] (1) Cell culture and transfection

[0083] Human hepatocarcinoma cell lines Huh7 and HepG2 were cultured in DMEM medium (Gibco). Human embryonic hepatocyte CCC-HEL-1 and human hepatocarcinoma cell Li-7 were cultured in RPMI-1640 medium (Gibco) containing 10% oxalo serum (Sigma-Aldrich) and 1% penicillin / streptomycin (Gibco). The cells were cultured under conditions of 25% CO₂ and 37°C. According to the manufacturer's instructions, double-stranded oligomeric nucleic acid molecules were transfected at a concentration of 10 nM (unless otherwise specified) by the reverse transfection method using RNAiMax (Invitrogen, Carlsbad, California).

[0084] (2) Step 1 RT-qPCR

[0085] After the transfection was completed, the medium was discarded, and each well was washed once with 150 μL of PBS. After discarding the PBS, 50 μL of cell lysis buffer was added to each well and incubated at room temperature for 5 minutes. 1 μL of the resulting cell lysate was collected from each well and analyzed by qPCR using the 1-step TB Green™ PrimeScrip™ RT-PCR Kit II (Takara, RR086A) on a LightCycler® 480 system (Roche). Each transfected sample was amplified in three replicate wells. The PCR reaction conditions are indicated in Table 1.

[0086]

[0087] The reaction conditions were as follows: Reverse transcription reaction (Step 1): 5 min at 42°C, 10 sec at 95°C; PCR reaction (Step 2): 5 sec at 95°C, 20 sec at 60°C, 45 cycles of amplification. HPRT1 and TBP were used as internal reference genes. The PCR primers used for the amplification of HMBS, HPRT1, and TBP genes are shown in Table 2, and the HMBS was amplified using the HMBS F1 / R1 primer pair.

[0088]

[0089] HMBS (target gene) expression values ​​of saRNA-transfected samples compared to the control treatment group (Mock) E rel To calculate ), the Ct values ​​of the target gene and the two internal reference genes were substituted into Equation 1.

[0090]

[0091] The above CtT m is the Ct value of the target gene of the above Mock-treated sample; CtTs is the Ct value of the target gene of the above saRNA-treated sample; CtR1 m is the Ct value of internal reference gene 1 of the above Mock-treated sample; CtR1s is the Ct value of internal reference gene 1 of the above saRNA-treated sample; CtR2 m is the Ct value of internal reference gene 2 of the above mock-treated sample; and CtR2 s is the Ct value of the internal reference gene 2 of the above saRNA-treated sample.

[0092] (3) Screening of functional saRNA

[0093] To obtain saRNAs capable of activating HMBS transcription, 180 double-stranded oligonucleotide molecules were transfected into Huh7 cells at a concentration of 10 nM. After 72 hours, cells were lysed using the same method described above and analyzed via one-step RT-qPCR to obtain the relative expression levels of the HMBS gene for each saRNA-treated sample compared to the mock treatment group. Analysis revealed that 19 saRNAs exhibited activity. These active double-stranded oligomeric nucleic acid molecules are referred to as functional saRNAs.

[0094] Fig. 2 and Fig. 3 Figure [is] illustrating the activity distribution of the saRNA on HMBS and the change in mRNA expression of HMBS mediated by the saRNA.

[0095]

[0096]

[0097] Example 3

[0098] saRNA induced the expression of the HMBS gene in various cell lines.

[0099] The saRNA (n=13, final concentration: 20 nM) shown in Table 4 was transfected into human hepatocellular carcinoma cells Huh7 and HepG2 and human embryonic hepatocyte CCC-HEL-1 according to the method described in Example 2. 72 hours after transfection, the cells were collected, and RNA was extracted using the Qiagen RNeasy kit. After reverse transcription, qPCR amplification of the HMBS gene was performed using a 7500FAST real-time PCR system. Simultaneously, the HPRT1 and TBP genes were amplified with internal reference material. Mock, dsCon2, and siHMBS represent blank and control dsRNA transfection and small interfering RNA control transfection, respectively. The PCR results were analyzed according to the method of Example 2. Fig. 4As shown in [figure], all of the above candidate saRNAs promoted HMBS mRNA expression levels in various cell lines.

[0100] Example 4

[0101] saRNA induced protein expression of HMBS.

[0102] Fig. 5 Human hepatocellular carcinoma (HEP G2) cells were refractorifected using the saRNA indicated in [figure] (final concentration: 20 nM). After 72 hours, the cells were collected and lysed in an appropriate volume of cell lysis buffer (1 χRIPA buffer, Cell Signaling Technology) containing a protease inhibitor. Proteins were quantified by the BCA method, polyacrylamide gel electrophoresis was performed, and the proteins were transfected onto 0.45 μm PVDF cell membranes. A Rabbit monoclonal anti-HMBS (ABCAM, AB 129092) α / β-tubulin antibody (Cell Signaling Technology, 2148s) was used as the primary antibody for blot detection. An anti-Rabbit IgG, HRP-conjugated antibody (Cell Signaling Technology) was used as the secondary antibody. Signals were detected by scanning using an Image Lab (BIO-RAD, Chemistry Doc™ MP imaging system). Fig. 5 As shown in [figure], the saRNA candidate increased HMBS protein expression in the cell HepG2 by nearly twofold, and some induced protein expression by 2.5fold. The effect of the active saRNA on the activation of HMBS protein expression in hepatocytes is significant.

[0103] Example 5

[0104] saRNA enhanced HMBS enzyme activity.

[0105] AIP is delta-aminolevulinic acid (ALA) and PBG (porfobilinogen). in vivoIt is a disease caused by a lack of heme synthesis resulting from accumulation and a defect or deficiency in the activity of the third enzyme (hydroxymethylbilan synthase (HMBS)) within the heme synthesis pathway. ALA is a simple exogenous five-carbon chemical, and in vivo It participates in the biosynthesis of heme. As a precursor of heme, ALA produces protoporphyrin IX (abbreviated as PPIX) through the potent photosensitivity effect of mitochondria, following the action of a series of enzymes such as ALA dehydrase. As an intermediate for the final step of heme biosynthesis, PPIX binds to Fe ions to produce heme. Typically, the heme biosynthetic pathway is regulated through a negative feedback mechanism, and since the synthesis of ALA is regulated by the amount of intracellular heme, excessive ALA does not accumulate in the body. When exogenous ALA is added to the cell, the intracellular heme synthesis pathway converts ALA into PPIX. PPIX content can be detected by fluorescence analysis. Therefore, the detected fluorescence intensity of PPIX indirectly reflects the activity of HMBS and the content of biosynthesized heme (Sassa, et al., J Exp Med 1975; 142:722-731, Divaris, et al., Am J Pathol 1990; 136:891-897, Kennedy, et al., J Photochem Photobiol . 1992; 14:275-292). This detection method is called ALA conversion analysis.

[0106] Human embryonic stem cell CCC-HEL-1 is 2×10 5 It was inoculated into a 6-well plate at a cell / well concentration. Fig. 6RNAiMax (Invitrogen, Carlsbad, California) and the saRNA indicated in [the document] were used to transfect cells at a final concentration of 20 nM according to the reverse transfection method provided in the manufacturer's instructions. 48 hours after transfection, the cells were treated with 1 mM ALA at 0 hours (baseline) and 24 hours. On the third day after transfection, the cells were collected in 1.5 ml centrifuge tubes. Fragments from each sample were taken, and the cells were lysed with 300 μl of 1 N 1:1 MeOH-PCA for 10 minutes. After centrifugation at 10,000 g and 4°C for 10 minutes, 100 μl of the supernatant was collected and added to a 96-well plate. Fluorescence intensity was detected using a multifunction microplate reader (TECAN Infintie M200PRO) with 400 nM excitation light and 660 nM emission light. Cells in different parts of each sample were lysed with 1 KR RIPA lysis buffer (Cell Signaling Technology), and then protein concentration was evaluated using the BCA method. Finally, the data were normalized to the ratio of fluorescence intensity to protein concentration.

[0107] Fig. 6 As shown in [figure], compared to the control group of Mock and dsCon2, the fluorescence intensity of protein concentration per unit in cells transfected with saRNA was significantly increased, which suggests that the HMBS gene activity induced by the saRNA increased HMBS enzyme activity and promoted heme synthesis.

[0108] Example 6

[0109] saRNA induced dose-dependent mRNA and protein expression of the HMBS gene and increased HMBS enzyme activity.

[0110] Cells were cultured as described in Example 2. Human hepatocarcinoma cells (Li-7) were 2 x 10⁻¹⁰ 5 Cells were inoculated into a 6-well plate. Fig. 7As indicated, saRNA (RAG5-386) was used to transfect cells at final concentrations of 1 nM, 10 nM, 20 nM, 50 nM, and 100 nM using RNAiMax (Invitrogen, Carlsbad, California) according to the reverse transfection method provided in the manufacturer's instructions, and the process was performed in triplicate for different analyses. One group of cells was transfected for 24 hours, and the transfected cells were treated with 1 mM ALA for 48 hours; afterward, the cells were collected and the fluorescence intensity of PPIX was analyzed. Simultaneously, the cells were lysed to measure protein concentrations. Two other groups of cells were transfected for 72 hours, and these cells were collected to evaluate HMBS mRNA and HMBS protein expression. The methods for mRNA extraction and protein lysis quantification are as described in Examples 3 and 4.

[0111] Fig. 7 As shown in [figure], when the dose of saRNA (RAG5-386) increased, HMBS mRNA and HMBS protein expression increased. Fig. 7A Figure 1 shows mRNA expression after treatment with saRNA (RAG5-386). Compared to the control group, the mRNA expression of the siHMBS group decreased by more than 90%, which suggests the effectiveness of the transfection system in this study. The saRNA (RAG5-386) group 2-fold activated HMBS, reaching a peak at a saRNA (RAG5-386) treatment concentration of 20 nM. Fig. 7B Figure 1 shows protein expression after treatment with saRNA (RAG5-386). Compared to the control group, HMBS protein expression was gradually upregulated as the concentration of saRNA (RAG5-386) increased. All concentrations induced at least 1.5-fold and were dose-dependent. Fig. 7CFigure 1 shows the change in PPIX fluorescence intensity after treatment with the saRNA (RAG5-386). PPIX fluorescence intensity increased at all concentrations of saRNA (RAG5-386). These results suggest that the saRNA (RAG5-386) promotes HMBS gene activity, increases HMBS enzyme activity, and promotes heme synthesis.

[0112] Example 7

[0113] saRNA induced mRNA and protein expression of GM01623 in cells of HMBS gene AIP patients.

[0114] GM01623, GM01624, and GM01625 cells (purchased from the Coriell Institute in Camden, NJ, USA) were cultured in MEM medium (Gibco), and all media contained 15% bovine serum (Sigma-Aldrich), 1% NEAA (non-essential amino acids, purchased from Thermo Fisher; item number 11140050), and 1% penicillin / streptomycin (Gibco). The cells were cultured under conditions of 5% CO2 and 37°C. The GM01623 cell was 1 x 10⁻¹⁰ 5 Cells were inoculated into a 6-well plate at a cell / well ratio and transfected using RNAiMax at a final transfection concentration of 20 nM. 72 hours after transfection, the cells were collected. The cell mRNA extraction and protein lysis quantification methods were as described in Examples 3 and 4.

[0115] Fig. 8 As described in [figure], the saRNA candidate induced HMBS mRNA and HMBS protein expression in the GM01623 cells of an AIP patient. Fig. 8AFigure 1 illustrates mRNA expression after treatment with the above saRNA candidate group. Compared to the control treatment group, mRNA expression in the above siHMBS group decreased by more than 90%, which suggested the effectiveness of the transfection system of the present study. The relative mRNA expression of all cells treated with saRNA was higher than that of the control treatment group, and the expression values ​​of the five groups, RAG5-126, RAG5-373, RAG5-179, RAG5-386, and RAG5-374, increased to 56%, 14%, 45%, 96%, and 25%, respectively, which suggests that all of the above saRNA candidate groups of the present invention can activate HMBS mRNA expression. Fig. 8B Protein expression after treatment with saRNA candidates is illustrated. Compared to the control group, protein expression increased by a varying range after treatment with groups RAG5-126, RAG5-373, RAG5-179, and RAG5-386, and RAG5-126 increased HMBS protein by up to 50%. Therefore, all of the saRNA candidates disclosed herein can activate HMBS protein expression.

[0116] Example 8

[0117] saRNA induced mRNA and protein expression of the HMBS gene in GM01624 cells of AIP patients.

[0118] The culture and transfection conditions of the GM01624 cells are as described in Example 7, and the cell mRNA extraction and protein lysis quantification methods are as described in Examples 3 and 4. Fig. 9 As shown in [figure], the saRNA candidate induces HMBS mRNA and HMBS protein expression in the above-mentioned cells GM01624 of AIP patients. Fig. 9AFigure [] illustrates the mRNA expression after treatment with the saRNA candidate group. Compared to the control treatment group, the mRNA expression of the siHMBS group decreased by up to 90%, which suggests the effectiveness of the transfection system of this study. Relative mRNA expression after treatment with the saRNA was higher than that of the control treatment group, and the expression values ​​of the three groups RAG5-126, RAG5-179, and RAG5-386 increased by more than 50%, which suggests that the saRNA candidate group disclosed herein can activate HMBS mRNA expression. Fig. 9B Figure 1 illustrates protein expression after treatment with saRNA candidate groups. Compared to the control group, the expression of groups RAG5-126, RAG5-373, RAG5-179, and RAG5-386 increased after saRNA treatment, which suggests that the saRNA candidate groups disclosed herein can activate HMBS protein expression.

[0119] Example 9

[0120] saRNA induced mRNA and protein expression of the HMBS gene in AIP patient cells GM01625.

[0121] The culture and transfection conditions of the GM01625 cells are the same as described in Example 7, and the cell mRNA extraction and protein lysis quantification methods are the same as described in Examples 3 and 4. Fig. 10 As shown in [figure], the candidate saRNA was able to promote HMBS mRNA and HMBS protein expression in the GM01625 cells of AIP patients. Fig. 10AFigure [] illustrates the HMBS mRNA expression after treatment with the saRNA candidate group. Compared to the control treatment group, the mRNA expression of the siHMBS group decreased by more than 90%, which suggests the efficacy of the transfection system of this study. After treatment with all saRNAs, the relative mRNA expression was higher than that of the control treatment group, and the expression values ​​of groups RAG5-126, RAG5-373, RAG5-179, RAG5-386, and RAG5-374 increased to 4%, 26%, 60%, 123%, and 14%, respectively, with RAG5-386 being the most potent among them, which suggests that the saRNA candidate group disclosed herein activates HMBS mRNA expression and exhibits an active effect. Fig. 10B Figure 1 illustrates protein expression after treatment with saRNA candidate groups. Compared to the control group, protein expression was increased after treatment with RAG5-126, RAG5-373, RAG5-179, and RAG5-374, which suggests that the saRNA candidate groups disclosed herein can activate HMBS proteins.

[0122] Multiple saRNAs capable of activating the expression of the HMBS gene were identified through high-throughput screening of saRNAs targeting the HMBS gene promoter. These saRNAs promote heme production by upregulating HMBS mRNA and HMBS protein expression. These results suggest that saRNAs targeting the HMBS gene promoter can be a therapeutic strategy for AIP.

Claims

Claim 1 As a small activating RNA (saRNA), the saRNA comprises a first nucleic acid strand and a second nucleic acid strand, wherein the first nucleic acid strand has 100% homology or complementarity with a sequence selected from SEQ ID 11-29, the second nucleic acid strand is complementary to the first nucleic acid strand, and the first nucleic acid strand and the second nucleic acid strand can complementarily form a double-stranded nucleic acid structure capable of activating the expression of the HMBS gene in a cell. Claim 2 In claim 1, the first nucleic acid strand and the second nucleic acid strand are saRNAs present on two different nucleic acid strands. Claim 3 In claim 1, the first nucleic acid strand and the second nucleic acid strand exist on the same nucleic acid strand, the saRNA is a hairpin single-stranded nucleic acid molecule, and the complementary regions of the first nucleic acid strand and the second nucleic acid strand form a double-stranded nucleic acid structure, the saRNA. Claim 4 In paragraph 2, at least one strand of the saRNA has an overhang of nucleotides having a length of 0 to 6 at the 3' end, saRNA. Claim 5 In claim 4, both strands of the saRNA have an overhang at the 3' end having a length of 0 to 6 nucleotides, and the overhang has a length of 2 to 3 nucleotides, saRNA. Claim 6 saRNA according to any one of claims 1 to 5, wherein the first nucleic acid strand and the second nucleic acid strand independently comprise nucleotides having a length of 16 to 35. Claim 7 saRNA according to claim 1, wherein the first nucleic acid strand comprises a sequence expressed as any one of the nucleotide sequences specified in SEQ ID 30-48 or is selected from the sequence, and the second nucleic acid strand comprises a sequence expressed as any one of the nucleotide sequences specified in SEQ ID 49-67 or is selected from the sequence. Claim 8 In claim 1, the saRNA comprises at least one modification, and the modification is a chemical modification. Claim 9 In claim 8, the chemical modification comprises or is selected from at least one of the following modifications: (1) modification of a phosphodiester bond connected to a nucleotide in the nucleotide sequence of the saRNA; (2) modification of a ribose 2'-OH in the nucleotide sequence of the saRNA; and (3) modification of a base in the nucleotide sequence of the saRNA; (4) modification in which at least one nucleotide in the nucleotide sequence of the saRNA is a fixed nucleic acid. Claim 10 In claim 8, the chemical modification comprises or is selected from one or more modifications of 2'-fluoro modification, 2'-oxymethyl modification, 2'-oxyethylidene methoxy modification, 2,4'-dinitrophenol modification, immobilized nucleic acid (LNA), 2'-amino modification, 2'-deoxy modification, 5'-bromouracil modification, 5'-iodouracil modification, N-methyluracil modification, 2,6-diaminopurine modification, phosphorothioate modification, and boranophosphate modification. Claim 11 Nucleic acid encoding the saRNA of claim 1. Claim 12 In paragraph 11, the nucleic acid is a DNA molecule. Claim 13 A cell comprising the saRNA of claim 1. Claim 14 A kit comprising the saRNA of claim 1. Claim 15 In claim 1, the saRNA is capable of activating or upregulating the expression of the HMBS gene by at least 10%. Claim 16 A method of using the saRNA of claim 1 to manufacture a preparation that activates or upregulates intracellular HMBS gene expression. Claim 17 A method of use according to claim 16, characterized in that the saRNA is directly introduced into the cell. Claim 18 A method of use according to claim 16, characterized in that the saRNA is produced within the cell after introducing the nucleic acid of claim 12 into the cell. Claim 19 A method of use characterized in that, in paragraph 16, the cell is a mammalian cell. Claim 20 A method of use characterized in that, in paragraph 19, the cell is a human cell. Claim 21 A method of use according to claim 20, characterized in that the above-mentioned cells exist in the human body. Claim 22 In claim 1, the saRNA is a saRNA used to activate or / upregulate the expression of the HMBS gene within a cell. Claim 23 In claim 22, the saRNA is characterized by being directly introduced into the cell. Claim 24 In claim 23, the saRNA is characterized by being produced within the cell after introducing the nucleic acid of claim 11 into the cell. Claim 25 In paragraph 22, the saRNA is characterized in that the cell is a mammalian cell. Claim 26 In paragraph 25, the saRNA is characterized in that the cell is a human cell. Claim 27 In Clause 26, the above cell is characterized as saRNA existing in the human body. Claim 28 In claim 22, the saRNA is characterized by being administered to the cell at a final concentration of 1 nM to 150 nM. Claim 29 A method of using the saRNA of claim 1 to manufacture a drug for the treatment of acute intermittent porphyria in a subject. Claim 30 delete Claim 31 delete Claim 32 delete Claim 33 delete

Citation Information

Patent Citations

  • Compositions and methods for treatment of liver diseases

    WO2017106283A1

  • Polycomb-associated non-coding rnas

    WO2012065143A1