Method for producing soybean plant with increased anthocyanin content using MYB1a gene derived from Ipomoea batatas and soybean plant thereof

Abstract

The present invention relates to a method for producing a soybean plant with enhanced anthocyanin content using a MYB1a gene derived from sweet potato and a soybean plant produced thereby. Since the present invention allows for the production of a transgenic soybean plant in which anthocyanin pigment is expressed at a high level in seeds by using a recombinant vector containing a β-conglycin promoter and a protein-coding sequence of MYB1a (myeloblastosis oncogene-like 1) derived from sweet potato (Ipomoea batatas), it can be usefully utilized for improving soybean varieties with enhanced anthocyanin content.

Description

Technology Field

[0001] The present invention relates to sweet potatoes ( Ipomoea batatas of ) origin MYB1a The present invention relates to a method for producing a soybean plant with enhanced anthocyanin content using a gene, and to a soybean plant produced thereby. Background Technology

[0002] bean( Glycine max Soybeans are one of the most important crops cultivated worldwide and contain abundant vegetable oil and protein. As interest in functional crops grows and research on the nutritional components of soybeans becomes more active, functional soybean varieties containing high-value substances such as isoflavones, saponins, soybean peptides, and oligosaccharides are being developed.

[0003] Anthocyanins are one of the flavonoids that constitute a large group of plant secondary metabolites, and are natural pigments extracted from the phenylpropanoid pathway of various plant species. Anthocyanins are involved in the red, purple, and blue phenotypes of flowers, fruits, and vegetables, and are known to act as powerful antioxidants and protect plants from various abiotic and biotic stresses, such as drought, ultraviolet radiation, salinity, low and high temperatures, and pathogen attacks. Furthermore, anthocyanins have been reported to protect the human body from cancer, cardiovascular disease, liver damage, diabetes, and oxidative stress. Due to these health benefits, interest in functional foods rich in anthocyanins is increasing, necessitating research on the development of plant varieties with increased anthocyanin content.

[0004] Meanwhile, Korean Registered Patent No. 1465692 contains ' AtbHLH113 A method for producing a transgenic plant with controlled anthocyanin biosynthesis using a gene and a plant according to the same is disclosed, and Korean Registered Patent No. 1359308 describes a sweet potato-derived IbOrangeAlthough a 'method for producing a transgenic sweet potato plant with high accumulation of carotenoids and anthocyanins using genes and a plant according thereto' has been disclosed, the sweet potato-derived of the present invention MYB1a There is no description of a method for producing a soybean plant with enhanced anthocyanin content using genes, nor of the soybean plant produced thereby. The problem to be solved

[0005] The present invention was derived from the above-mentioned requirements, and the inventors of the present invention (beta-conglycine) β -conglycin) promoter and sweet potato( Ipomoea batatas ) Origin MYB1a The present invention was completed by observing the seed color phenotype of the transformed soybean plants after transforming a recombinant vector linked with the (myeloblastosis oncogene-like 1) gene into soybean plants and confirming that the expression of anthocyanin pigment was increased compared to the control group (seeds of wild-type soybean plants). means of solving the problem

[0006] To solve the above problem, the present invention relates to a promoter and a sweet potato ( Ipomoea batatas Provides a recombinant vector for enhancing the anthocyanin content of soybean plants containing a protein-coding sequence of MYB1a (myeloblastosis oncogene-like 1) derived from ).

[0007] In addition, the present invention provides a host cell transformed with the recombinant vector.

[0008] In addition, the present invention relates to transforming soybean plant cells with the above-mentioned recombinant vector to produce sweet potato-derived MYB1a A method for increasing the anthocyanin content of a soybean plant is provided, comprising the step of overexpressing a gene.

[0009] In addition, the present invention relates to transforming soybean plant cells with the above-mentioned recombinant vector to produce sweet potato-derived MYB1aA method for producing a transgenic soybean plant having an enhanced anthocyanin content compared to the wild type is provided, comprising: a step of overexpressing a gene; and a step of regenerating a plant from the transgenic soybean plant cell.

[0010] In addition, the present invention provides a transgenic soybean plant with enhanced anthocyanin content produced by the above-described manufacturing method and a transgenic seed thereof.

[0011] In addition, the present invention provides a composition for enhancing the anthocyanin content of a soybean plant, comprising the recombinant vector as an active ingredient. Effects of the invention

[0012] The present invention relates to beta-conglycin ( β -conglycin) promoter and sweet potato( Ipomoea batatas Since it is possible to produce transgenic soybean plants in which anthocyanin pigment is expressed at high levels in seeds using a recombinant vector containing the protein-coding sequence of MYB1a (myeloblastosis oncogene-like 1) derived from ), it can be usefully utilized for improving soybean varieties with enhanced anthocyanin content. Brief explanation of the drawing

[0013] FIG. 1 is the P35S used in the present invention: IbMYB1a Vector (A) and Pβ-con: IbMYB1a This is a schematic diagram of vector (B). Fig. 2 shows Agrobacterium tumopaciens ( Agrobacterium tumefaciens This illustrates the process of producing transgenic soybean plants through mediated transformation. (a): Co-culture, (b): Shoot induction-1, (c): Shoot induction-2, (d): Shoot elongation, (e): Root induction, (f): Root elongation, (g): Soil acclimatization, (h): Leaf painting. Fig. 3 is P35S: IbMYB1a Vector (A) or Pβ-con: IbMYB1a Using the genomic DNA of a soybean plant transformed with an Agrobacterium tumopaciens strain containing vector (B) IbMYB1a gene, Bar This is the result of confirming the expression of the gene, 53S promoter (p53S), and β-conglycinin promoter (Pβ-con) via PCR. NT is a wild-type soybean plant. Fig. 4 is P35S: IbMYB1a Vector (A) or Pβ-con: IbMYB1a Using RNA from a soybean plant transformed with an Agrobacterium tumafaciens strain containing vector (B) IbMYB1a gene, Bar This is the result of confirming gene expression via RT-PCR. NT is a wild-type soybean plant, and TUB is used as an internal control Tubulin It is a gene. Fig. 5 is P35S: IbMYB1a Vector or Pβ-con: IbMYB1a The color phenotype of T1 seeds of soybean plants transformed with a vector-containing Agrobacterium tumopaciens strain was confirmed, where A is the abaxial side of the cotyledon with the seed coat, B is the abaxial side of the cotyledon without the seed coat, and C is the adaxial side of the cotyledon. Gwang-an soybean is a wild-type soybean seed used as a negative control, and Cheongja No. 5 and Seum soybean are wild-type black soybean seeds used as comparison groups. Fig. 6 shows wild-type black soybean Cheongja No. 5 (A) and Pβ-con: IbMYB1a This is the result of HPLC analysis for comparing the anthocyanin patterns of the transformant (B). Specific details for implementing the invention

[0014] To achieve the objective of the present invention, the present invention relates to a promoter and a sweet potato ( Ipomoea batatas Provides a recombinant vector for enhancing the anthocyanin content of soybean plants containing a protein-coding sequence of MYB1a (myeloblastosis oncogene-like 1) derived from ).

[0015] In the recombinant vector of the present invention, the sweet potato-derived MYB1a protein coding sequence may preferably consist of the nucleotide sequence of SEQ ID NO. 1, but is not limited thereto.

[0016] In addition, the recombinant vector of the present invention may be a recombinant vector prepared by operably linking the sweet potato-derived MYB1a protein coding sequence downstream of a β-conglycin promoter. The β-conglycin promoter is a seed-specific promoter known to be expressed in soybean seeds, and the range of the β-conglycin promoter sequence includes the nucleotide sequence of SEQ ID NO. 2 and homologs of said nucleotide sequence within the scope of the present invention. Homologs are nucleotide sequences that have functional characteristics similar to the nucleotide sequence of SEQ ID NO. 2, although the nucleotide sequence is altered. Specifically, the β-conglycin promoter sequence may include nucleotide sequences having sequence homology of at least 70%, more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95% with respect to the nucleotide sequence of SEQ ID NO. 2. The “% of sequence homology” for a polynucleotide is determined by comparing two optimally arranged sequences with a comparison region, and a portion of the polynucleotide sequence in the comparison region may include additions or deletions (i.e., gaps) compared to the reference sequence (which does not include additions or deletions) for the optimal arrangement of the two sequences.

[0017] In the present invention, "operably linked" refers to one nucleic acid fragment being combined with another nucleic acid fragment so that its function or expression is influenced by the other nucleic acid fragment.

[0018] The term "recombinant" refers to a cell that replicates a heterogeneous nucleic acid, expresses said nucleic acid, or expresses a protein encoded by a peptide, a heterogeneous peptide, or a heterogeneous nucleic acid. A recombinant cell may express a gene or gene fragment not found in the natural form of said cell, in either a sense or antisense form. Additionally, a recombinant cell may express a gene found in a cell in its natural state, provided that said gene is modified and has been reintroduced into the cell by artificial means.

[0019] The term "vector" is used to refer to DNA fragment(s) or nucleic acid molecules delivered into a cell. Vectors replicate DNA and can be reproduced independently within the host cell. The term "carrier" is often used interchangeably with "vector." Recombinant vectors refer to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell virus vectors, or other vectors. Generally, any plasmid or vector may be used as long as it can replicate and stabilize within the host. An important characteristic of the expression vector is that it possesses a replication origin, a promoter, a marker gene, and a translation control element.

[0020] The vector of the present invention can typically be constructed as a vector for expression or cloning. Additionally, the vector of the present invention can be constructed using a prokaryotic or eukaryotic cell as a host. For example, when the vector of the present invention is an expression vector and uses a prokaryotic cell as a host, it generally comprises a potent promoter capable of proceeding transcription (e.g., pLλ promoter, trp promoter, lac promoter, T7 promoter, tac promoter, etc.), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. As a host cell, Escherichia coli ( Escherichia coli When ) is used, E. coliThe promoter and operator sites of the tryptophan biosynthetic pathway, and the left-handed promoter of phage λ (pLλ promoter) can be used as regulatory sites.

[0021] In the recombinant expression vector of the present invention, the promoter is a promoter suitable for transformation, preferably a beta-conglycin, CaMV 35S promoter, actin promoter, ubiquitin promoter, pEMU promoter, MAS promoter, histone promoter, or Clp promoter known to be expressed in soybean seeds, and preferably a beta-conglycin promoter, but is not limited thereto.

[0022] The recombinant vector of the present invention was constructed by sequentially linking a beta-conglycine promoter sequence, a sweet potato-derived MYB1a protein coding sequence, and a CaMV 35S terminator sequence.

[0023] The expression vector of the present invention, comprising the sweet potato-derived MYB1a protein-coding sequence and a suitable transcription / translation regulatory signal, can be constructed by methods known to those skilled in the art. Such methods include in vitro recombinant DNA techniques, DNA synthesis techniques, and in vivo recombinant techniques. The DNA sequence can be effectively linked to a suitable promoter within the expression vector to lead mRNA synthesis. Additionally, the vector may include a ribosome binding site and a transcription terminator as a translation initiation site.

[0024] The recombinant vector of the present invention is preferably a plant expression vector.

[0025] A preferred example of a plant expression vector is Agrobacterium tumopaciens ( Agrobacterium tumefaciensIt is a Ti-plasmid vector capable of transferring a portion of itself, the so-called T-region, into a plant cell when present in a suitable host such as a plant. Other types of Ti-plasmid vectors (see EP 0 116 718 B1) are currently used to transfer hybrid DNA sequences into plant cells or protoplasts from which new plants can be produced by appropriately inserting the hybrid DNA into the plant genome. A particularly preferred form of the Ti-plasmid vector is the so-called binary vector as claimed in EP 0 120 516 B1 and U.S. Patent No. 4,940,838. Other suitable vectors that can be used to introduce DNA according to the present invention into a plant host may be selected from viral vectors, such as those derived from double-stranded plant viruses (e.g., CaMV) and single-stranded viruses, Gemini viruses, etc., such as incomplete plant viral vectors. The use of such vectors can be advantageous, especially when it is difficult to properly transform plant hosts.

[0026] The expression vector may preferably include one or more selectable markers. The marker is a nucleic acid sequence having characteristics that can typically be selected by chemical means, and includes all genes capable of distinguishing transformed cells from non-transformed cells. Examples include, but are not limited to, herbicide resistance genes such as glyphosate or phosphinothricin, antibiotic resistance genes such as kanamycin, hygromycin, chloramphenicol, G418 (Geneticin), and bleomycin, and the aadA (aminoglycoside-3'-adenyl transferase) gene.

[0027] In a plant expression vector according to one embodiment of the present invention, a conventional terminator may be used, examples of which include, but are not limited to, the CaMV (Cauliflower Mosaic Virus) 35S terminator, nopaline synthase (NOS) terminator, rice α-amylase RAmy1 A terminator, phaseolin terminator, and the terminator for the octopine synthase gene of Agrobacterium tumafaciens. Regarding the necessity of a terminator, it is generally known that such a region increases the certainty and efficiency of transcription in plant cells. Therefore, the use of a terminator is highly desirable within the scope of the present invention.

[0028] The present invention also provides a host cell transformed with the recombinant vector.

[0029] When the plant expression vector of the present invention is transformed into a eukaryotic cell, as a host cell, yeast ( Saccharomyce cerevisiae ), insect cells, human cells (e.g., CHO cell line (Chinese hamster ovary), W138, BHK, COS-7, 293, HepG2, 3T3, RIN and MDCK cell lines), and plant cells, etc., may be used, preferably plant cells, and most preferably soybean plant cells.

[0030] When the host cell is a prokaryotic cell, the method of transporting the plant expression vector of the present invention into a host cell can be carried out by the CaCl2 method, the Hanahan method (Hanahan, D., 1983 J. Mol. Biol. 166, 557-580), and the electroporation method. In addition, when the host cell is a eukaryotic cell, the vector can be injected into the host cell by microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAE-dextran treatment, and gene bombardment.

[0031] The present invention also involves transforming soybean plant cells with the recombinant vector to produce sweet potatoes ( Ipomoea batatas ) Origin MYB1a A method for increasing the anthocyanin content of a soybean plant is provided, comprising the step of overexpressing the (myeloblastosis oncogene-like 1) gene.

[0032] In a method for increasing the anthocyanin content of a soybean plant according to one embodiment of the present invention, the recombinant vector comprises a β-conglycin promoter consisting of the nucleotide sequence of SEQ ID NO. 2 and a sweet potato-derived MYB1a protein coding sequence consisting of the nucleotide sequence of SEQ ID NO. 1, and is characterized by the expression of a large amount of anthocyanin pigment in the seeds of a soybean plant transformed with the recombinant vector.

[0033] The present invention also,

[0034] By transforming soybean plant cells with the above recombinant vector, sweet potatoes ( Ipomoea batatas ) Origin MYB1a A step of overexpressing the (myeloblastosis oncogene-like 1) gene; and

[0035] The present invention provides a method for producing a transgenic soybean plant having an enhanced anthocyanin content compared to the wild type, comprising the step of regenerating a plant from the above-mentioned transgenic soybean plant cells.

[0036] The method for producing a transgenic soybean plant of the present invention comprises the step of transforming a plant cell with a recombinant vector according to the present invention, wherein the transformation of the plant refers to any method of transferring DNA into a plant. Such a transformation method does not necessarily require a regeneration and / or tissue culture period. Transformation of plant species is now common for plant species including both dicotyledonous and monocotyledonous plants. In principle, any transformation method may be used to introduce the hybrid DNA according to the present invention into a suitable progenitor cell. The method may be suitably selected from the calcium / polyethylene glycol method for protoplasts, electroporation of protoplasts, microinjection into plant elements, impact of (DNA or RNA-coated) particles into various plant elements, and infection by a (non-incomplete) virus in Agrobacterium tumifera-faciens-mediated gene transfer by infiltration of the plant or transformation of mature pollen or microspores.

[0037] In addition, the method for producing a transgenic soybean plant according to the present invention includes the step of redifferentiating a transgenic plant from the transgenic plant cell. Any method known in the art may be used for the method of redifferentiating a transgenic plant from the transgenic plant cell.

[0038] The “plant cell” used for the transformation of a plant may be any plant cell. The plant cell may be a cultured cell, cultured tissue, cultured organ, or whole plant, preferably a cultured cell, cultured tissue, or cultured organ, and more preferably any form of a cultured cell. The “plant tissue” includes differentiated or undifferentiated plant tissues, such as, but not limited to, fruits, stems, leaves, pollen, seeds, female tissues, and various forms of cells used for culture, namely single cells, protoplasts, buds, and callus tissues. The plant tissue may be in planta or in an organ culture, tissue culture, or cell culture state.

[0039] The present invention also provides a transgenic soybean plant with enhanced anthocyanin content and a transgenic seed thereof, produced by the method for producing the transgenic soybean plant.

[0040] The transgenic soybean plant produced by the method according to the present invention may have an anthocyanin pigment that was not expressed in the control group (wild-type soybean plant) expressed in large amounts in the soybean seeds, but is not limited thereto.

[0041] The present invention also provides a composition for enhancing the anthocyanin content of a soybean plant, comprising the recombinant vector as an active ingredient.

[0042] The above composition comprises, as active ingredients, a beta-conglycin (β-conglycin) promoter consisting of the nucleotide sequence of SEQ ID NO. 2 and a sweet potato consisting of the nucleotide sequence of SEQ ID NO. 1 ( Ipomoea batatas It is possible to increase the anthocyanin content in soybean seeds by including a recombinant vector containing a protein-coding sequence of MYB1a (myeloblastosis oncogene-like 1) derived from ), and by transforming said recombinant vector into a soybean plant.

[0044] The present invention will be explained in detail below through examples. However, the following examples are merely illustrative of the present invention, and the scope of the present invention is not limited to the following examples.

[0046] Materials and Methods

[0047] 1. Production of recombinant vectors for soybean transformation

[0048] sweet potato( Ipomoea batatas ) Origin IbMYB1aThe whole cDNA clone of the gene was amplified via a PCR reaction using a forward primer (5'-ATGGTTATTTCATCTGTATGGTCG-3': SEQ ID NO. 3) and a reverse primer (5'-TTAGCTTAACAGTTCTGACAGTAG-3': SEQ ID NO. 4) (refer to Kim et al., 2010, Physiol. Plant. 139:229-240). The amplified IbMYB1a After subcloning the gene into the pENTR / D-TOPO vector (Invitrogen), it was cloned into the pB2GW7.0_P35S vector containing the CaMV 35S promoter or the pB2GW7.0_Pβ-conglycinin vector containing the seed-specific β-conglycinin promoter, respectively, to form the final vector (P35S: IbMYB1a or Pβ-con: IbMYB1a ) was constructed (Fig. 1). Subsequently, the above final vector was applied to Agrobacterium tumopaciens ( Agrobacterium tumefaciens Soybean transformants were prepared by transforming each EHA105 strain.

[0050] 2. Development of soybean transgenic varieties and T1 seed production

[0051] 2-1. Seed Disinfection and Soaking

[0052] Approximately 100 seeds of the domestic soybean variety Gwang-an soybean were placed in a desiccator and subjected to primary disinfection for 16 hours using hydrochloric acid gas generated by mixing 5 ml of 12N hydrochloric acid and 95 ml of 12% (v / v) sodium hypochlorite. After the primary disinfection, the Gwang-an soybean seeds were divided into 50 ml tubes, with approximately 50 seeds per tube. Then, 45 ml of 1% (v / v) sodium hypochlorite and 3 drops of Tween-20 were added for secondary disinfection for 10 minutes. After rinsing with sterile water three times at 10-minute intervals, sterile water was poured over the disinfected seeds, and they were immersed at room temperature for 20 hours.

[0054] 2-2. Preparation of Agrobacterium for Transformation

[0055] P35S: IbMYB1aor Pβ-con: IbMYB1a A single colony produced by culturing the Agrobacterium tumafaciens EHA105 strain transformed with [specific ingredient] in YEP solid medium (spectinomycin 75 mg / L, rifampicin 25 mg / L, peptone 10 g / L, sodium chloride 5 g / L, yeast extract 5 g / L, 1.5% (w / v) agar, pH 7.0) at 28°C was added to 10 ml of YEP liquid medium and OD 600 After incubating at 28°C with stirring at 220 rpm until the value reached 0.6~0.8, it was stored at -70°C and used for subsequent experiments.

[0056] On the day of Agrobacterium inoculation, 50 ml of YEP liquid medium was divided into two tubes and centrifuged at 20°C and 3,270 g for 10 minutes. The Agrobacterium tumopaciens pellets in each tube were prepared by adding 15 ml of CCM (co-cultivation medium, B5 salt 0.32 g / L, benzyladenine 1.67 mg / L, MES 20 mM, GA3 0.25 mg / L, acetoxylingon 0.2 mM, L-Cysteine ​​3.3 mM, sodium thiosulfate 1.0 mM, DTT 1.0 mM, sucrose 3%, pH 5.4) liquid medium and resuspending them.

[0058] 2-3. Agrobacterium Inoculation and Co-culture

[0059] A surgical scalpel (#11 blade) was inserted between the two cotyledons of the soaked soybean seeds to cut vertically down to the hypocotyl, and the seed coat was removed. Then, the seeds were cut approximately 1 cm below the cotyledon to obtain explants with the embryonic axis attached, which were used for the experiment. The surgical scalpel was coated with the CCM / Agrobacterium tumopaciens concentrate prepared in Section 2-2 above, and the soybean explants were incised about 7 to 8 times. Approximately 50 incised soybean explants were placed in 15 ml of the CCM / Agrobacterium tumopaciens concentrate and inoculated for 30 minutes. After inoculating the explants, they were placed on sterile filter paper to remove moisture, then a sterile filter paper was placed on a CCM solid medium, seven explants were placed on top with the adaxial direction facing downward, sealed with a micropore, and co-cultured for 5 days under conditions of 25°C and an 18-hour photoperiod (Fig. 2a).

[0061] 2-4. Washing of Inoculum and Shoot Induction

[0062] The hypocotyl of the explants co-cultured for 5 days was removed, leaving 1-2 cm. To eradicate Agrobacterium tumopaciens from the explants, about 50 explants were placed in a 50 ml tube and washed twice for 10 minutes in liquid SIM (shoot induction medium, B5 salt 3.2 g / L, MES 3 mM, sucrose 3%). After removing excess water from the washed explants placed on sterile filter paper, six explants were placed per plate in 50 ml of SIM-① (B5 salt 3.2 g / L, benzyladenine 1.67 mg / L, MES 3 mM, agar 0.8%, sucrose 3%, cefotaxim 250 mg / L, vancomycin 50 mg / L, ticacillin 100 mg / L, pH 5.6) which was free of selected antibiotics. The explants were fixed so that the hypocotyls were submerged in the medium and oriented with the anterior axis facing upward. Each plate was sealed with a micropore and cultured at 25°C under an 18-hour photoperiod (Fig. 2b). After 2 weeks, five explants with shoots were placed in 50 ml of SIM-② (SIM-① with DL-phosphinotricin 10 mg / L added, pH 5.6) containing the selected antibiotic PPT (phosphinotricin). After removing the parts excluding the shoots, each plate was sealed with a micropore and cultured for 2 weeks at 25°C under an 18-hour photoperiod (Fig. 2c).

[0064] 2-5. New shoot growth

[0065] After culturing for 2 weeks in SIM-② medium containing the selected antibiotic PPT, browned shoots were removed with a surgical scalpel (#15 blade), and the shoot pads were trimmed, leaving just enough so that the shoots would not fall off. Five explants were placed in 55 ml of SEM (shoot elongation medium, MS salt 4.4 g / L, MES 3 mM, GA3 0.5 mg / L, asparagine 50 mg / L, pyroglutamic acid 100 mg / L, IAA 0.1 mg / L, zeatin 1 mg / L, sucrose 3%, agar 0.8%, cefotaxim 250 mg / L, vancomycin 50 mg / L, ticacillin 100 mg / L, DL-phosphinothricin 5 mg / L, pH 5.6) containing the selected antibiotic PPT.

[0066] After two weeks, the browned shoots and shoot pads were trimmed with a surgical scalpel (#15 blade) and placed on shoot elongation medium containing selected antibiotics. The shoots were transferred to new shoot elongation medium every two weeks, during which the browned parts of the shoots were removed with the upper edge of the surgical scalpel, and the shoot pads were continuously trimmed little by little to ensure proper absorption of the medium. When the shoots grew to the height of the Petri dish lids, two Petri dishes were stacked on top of each other to allow them to grow to approximately 8 cm. Each plate was sealed with a micropore and cultured at 25°C under an 18-hour photoperiod (Fig. 2d).

[0068] 2-6. Root Formation, Acclimatization Process, and PPT Leaf Painting

[0069] When the elongated shoot in the SEM containing the selected antibiotic PPT was 8 cm or longer, the shoot was cut off from the pad with a surgical scalpel (#11 blade), the tip of the cut shoot was cut obliquely and smoothly, and the cut portion of the shoot was immersed in 1 mg / ml IBA (indole butyric acid) for 3 minutes, then removed and transferred to a glass test tube containing RM (rooting medium, MS salt 4.4 g / L, MES 3 mM, sucrose 3%, agar 0.8%, cefotaxim 50 mg / L, vancomycin 50 mg / L, ticacillin 50 mg / L, asparagine 25 mg / L, pyroglutamic acid 25 mg / L, pH 5.6). Once the roots had grown sufficiently, the root induction medium was washed off with triple-distilled water, and the plants were planted in small pots filled with a 2:1 mixture of potting soil (Bioplug No. 2, Heung Nong Seed) and vermiculite. After adding 50 ml of water, the rooted plants were placed inside a magenta box for acclimatization. After about 7 days, leaf painting was performed on the leaf surface using 100 mg / L DL-PPT. Each plant was watered with 30 ml once a week and grown under conditions of 25°C and an 18-hour photoperiod (Figs. 2e–h).

[0071] 2-7. T 1 Seed production

[0072] When the transgenic plants grew more than 15 cm above the small pot and had more than 9 leaves, they were transplanted into larger pots and grown in a greenhouse with a plastic cover made of about 10 holes. The plastic cover was removed when the transgenic plants grew to the top surface of the plastic cover. Each transgenic plant was watered with 500 ml three times a week and grown under conditions of 25°C and an 18-hour photoperiod, and T1 seeds were harvested from each transgenic plant.

[0074] 3. Gene Introduction and Expression Analysis

[0075] 3-1. PCR Analysis

[0076] Two vectors P35S in the transformant: IbMYB1a or Pβ-con: IbMYB1a PCR analysis was performed to confirm whether the insertion was accurate. Approximately 1 g of the leaves of the transformant were weighed and cooled with liquid nitrogen. The cooled leaves were finely ground using a mortar and pestle, and then genomic DNA was extracted using the CTAB method. IbMYB1a gene, Bar PCR was performed using Prime Taq Premix (2X) (GeNet Bio) and the primers in Table 1 below to confirm the expression of the gene, 53S promoter (p53S), and β-conglycinin promoter (Pβ-con).

[0077] Primer information used in the present invention Primer name nucleotide sequence (5'→3') Sequence number IbMYB1a_F ATGGTTATTTCATCTGTATGGTCG 5 IbMYB1a_R TTAGCTTAACAGTTCTGACAGTAG 6 Bar_F ATGAGCCCAGAACGACGCCCGGCC 7 Bar_R GGGTCATCAGATTTCGGTGACGGG 8 P35S_F ATGAGCCCAGAACGACGCCCGGCC 9 P35S_F GGGTCATCAGATTTCGGTGACGGG 10 Pβ-con_F ATTTGCCGCTATTAATTAATTTGG 11 Pβ-con_R GTTAGTATATCTTAAATTCTTTAA 12 TUB_F TGAGCAGTTCACGGCCATGCT 13 TUB_R TCATCCTCGGCAGTGGCATCCT 14

[0079] 3-2. RT-PCR Analysis

[0080] RNA was isolated from the transformants using a plant RNA purification solution (Invitrogen). IbMYB1a gene, Bar To confirm gene expression, semi-quantitative RT-PCR was performed using Maxime RT-PCR PreMix (iNtRON) and the primers in Table 1 above.

[0082] 4. Analysis of Anthocyanin Phenotypes in Soybean Seeds

[0083] The color phenotype of transgenic T1 seeds was compared with that of wild-type Gwang-an soybeans and black soybeans (Cheongja No. 5, Seum soybeans). After soaking the seeds in water, they were split in half using a scalpel, and the color phenotype was confirmed by examining the abaxial side of the cotyledon with the seed coat, the abaxial side of the cotyledon without the seed coat, or the adaxial side of the cotyledon.

[0085] 5. Analysis of Anthocyanin Patterns in Soybean Seeds

[0086] Anthocyanins were extracted from soybean seeds according to the method described in Lee et al. (2009, Food Chemistry. 112:226-231). Specifically, 0.5 g of the seed coat of a transformant or wild-type black soybean (Cheongja No. 5) was crushed using a vibrating grinder, placed in 10 ml of 50% (v / v) MeOH containing 1% (v / v) TFA (Trifluoroacetic Acid), and anthocyanins were extracted for 3 days at 4°C under dark conditions. After filtration using filter paper (Whatman No. 42) and a syringe filter (0.45 μm, Whatman Inc.), high-performance liquid chromatography (HPLC) analysis was performed. HPLC analysis was performed using an Agilent 1100 series with an Eclipse XDB-18 column (250 mm x 4.6 mm, 5 μm, Agilent), with a flow rate of 0.6 mL / min at 530 nm, gradient elution of 0.5% formic acid in 0.5% water (elution A) and 0.5% formic acid in acetonitrile (elution B), a column temperature of 25℃, and a sample injection volume of 20 μL.

[0088] Example 1. IbMYB1a Production of genetically modified soybeans with increased anthocyanin content

[0089] P35S of the present invention: IbMYB1a Vector or Pβ-con: IbMYB1a After performing transformation on soybean seeds using an Agrobacterium strain into which a vector (Fig. 1) was introduced, regeneration into plants was induced (Fig. 2) to produce soybean transformants.

[0090] As a result, P35S: IbMYB1a A total of 9 soybean transformants produced by the vector, Pβ-con: IbMYB1a A total of 4 soybean transformants were obtained using the vector.

[0092] Example 2. Gene introduction and expression analysis of transformants

[0093] P35S to the soybean transformant obtained in Example 1: IbMYB1a Vector or Pβ-con: IbMYB1a To verify whether the vector has been inserted, genomic DNA is isolated from soybean transformants. IbMYB1a Gene (introduced gene), Bar PCR analysis was performed on the gene (selected gene), 53S promoter (p53S), and β-conglycinin promoter (Pβ-con), and RNA was isolated from soybean transformants. IbMYB1a gene, Bar RT-PCR analysis was performed on the genes. Wild-type soybean plants were used as a control.

[0094] As a result, P35S: IbMYB1a Among the soybean plants transformed using a vector (#1–#10, 9 individuals), in the plants (#1, #5, #6, #7, #8, #9) excluding individuals #2, #3, and #10 IbMYB1a Genes and Bar We confirmed that all genes are expressed, and Pβ-con: IbMYB1a In soybean plants (#1–#4, 4 individuals) transformed using a vector IbMYB1a Genes and Bar It was confirmed that all genes were expressed (Figs. 3, 4).

[0096] Example 3. Analysis of Anthocyanin Pigment Phenotypes in Transgenic Soybean Seeds

[0097] To analyze the anthocyanin pigment phenotype of T1 seeds harvested from the soybean transgenic organism obtained in Example 1, the color phenotype of the hypocotyl plane of the cotyledon with seed coat, the hypocotyl plane of the cotyledon without seed coat, or the axial plane of the cotyledon was observed in each seed.

[0098] As a result, P35S: IbMYB1a T1 seeds (#7) of soybean plants transformed using a vector and Pβ-con: IbMYB1aIt was confirmed that the T1 seeds (#1, #3, #4) of the soybean plants transformed using the vector showed purple or black coloration, whereas the seeds of the wild-type Gwang-an soybean plants were light green.

[0099] In addition, observation of the hypocotyl plane of the cotyledon with the seed coat revealed wild-type black soybean, P35S: IbMYB1a (#7) T1 seed, Pβ-con: IbMYB1a (#1, #3, #4) It was confirmed that the T1 seeds were dark purple or black (Fig. 5A), and upon observation of the hypocotyl or lateral planes of the seed coatless cotyledons, wild-type black soybean, P35S: IbMYB1a (#7) T1 seeds are light green, whereas Pβ-con: IbMYB1a (#1, #3, #4) It was confirmed that T1 seeds showed purple or black coloration (Figs. 5B, 5C).

[0100] Based on the above results, the Pβ-con of the present invention: IbMYB1a Anthocyanin pigment expression in the seeds of vector-transformed soybean plants is compared to wild-type soybean plants or P35S: IbMYB1a It was observed that the ratio of soybean plants transformed with the vector to seeds increased.

[0102] Example 4. Analysis of Anthocyanin Patterns in Transgenic Soybean Seeds

[0103] Pβ-con: IbMYB1a (#3) To compare and analyze the anthocyanin patterns of transformants and wild-type black soybeans, the seed coat and Pβ-con: of Black Soybean Cheongja No. 5 IbMYB1a (#3) The 50% (v / v) methanol extract of the surface layer of the cotyledons of the transformants was analyzed using HPLC chromatography. Anthocyanin composition was investigated by comparing peak patterns and retention times according to previous research results (Hsiao and Hsieh et al., Food Chemistry. 2018.261;8-14).

[0104] As a result, wild-type black beans and Pβ-con: IbMYB1a(#3) It was confirmed that the anthocyanin profiles of the transformants were significantly different. The anthocyanins contained in wild-type black soybeans are cyanidin-3-O-glucoside, glucoside derivatives of peonidin, delphinidin, petunidin, and pelargonidin, whereas Pβ-con: IbMYB1a (#3) It was confirmed that the major anthocyanin contained in the transformant is cyanidin-3-O-glucoside (Fig. 6).

Claims

Claim 1 delete Claim 2 delete Claim 3 delete Claim 4 delete Claim 5 delete Claim 6 Sweet potato (composed of the nucleotide sequence of SEQ ID NO. 1) Ipomoea batatas Soybean plant cells were transformed into sweet potatoes ( Ipomoea batatas ) Origin MYB1a A method for increasing the anthocyanin content in the seeds of a soybean plant, comprising the step of overexpressing the (myeloblastosis oncogene-like 1) gene, wherein the cotyledons of the seeds of the soybean plant exhibit purple or black coloration. Claim 7 Sweet potato (composed of the nucleotide sequence of SEQ ID NO. 1) Ipomoea batatas Soybean plant cells were transformed into sweet potatoes ( Ipomoea batatas ) Origin MYB1a A method for producing a transgenic soybean plant having an enhanced anthocyanin content in the seeds of a soybean plant compared to a wild type, comprising: a step of overexpressing a (myeloblastosis oncogene-like 1) gene; and a step of redifferentiating a plant from the transformed soybean plant cell; wherein the cotyledons of the seeds of the soybean plant exhibit purple or black coloration. Claim 8 A transgenic soybean plant with enhanced anthocyanin content, characterized by purple or black coloration appearing in the cotyledons of the seeds of the soybean plant produced by the method of claim 7. Claim 9 Transformed seeds of a plant body according to Paragraph 8. Claim 10 Sweet potato (composed of the nucleotide sequence of SEQ ID NO. 1) Ipomoea batatas A composition for enhancing the anthocyanin content of seeds of a soybean plant, comprising as an active ingredient a recombinant vector prepared by operably linking a protein-coding sequence derived from ) MYB1a (myeloblastosis oncogene-like 1) to a downstream β-conglycin promoter consisting of the nucleotide sequence of SEQ ID NO. 2, wherein the cotyledons of the seeds of the soybean plant exhibit purple or black coloration.

Images