Composition for moisturizing comprising fermented extracts of Citrus Makgeolli lees

Abstract

The present invention relates to a composition for improving skin hydration, strengthening the skin barrier, providing antioxidant or anti-inflammatory effects, comprising a fermented extract of tangerine makgeolli lees. Specifically, the present invention simultaneously provides a moisturizing effect due to the promotion of hyaluronic acid synthesis, a skin barrier function strengthening effect due to increased expression of the keratinocyte outer membrane structural protein filaggrin, an antioxidant effect, and an inflammatory substance secretion inhibition effect, thereby effectively improving skin hydration to prevent, improve, or treat skin dryness, and can usefully provide skin barrier strengthening, antioxidant, and anti-inflammatory effects.

Description

Technology Field

[0001] The present invention relates to a composition for skin moisturization, skin barrier strengthening, antioxidant, and anti-inflammatory purposes comprising a fermented extract of tangerine makgeolli lees. More specifically, the present invention relates to a composition for skin moisturization, skin barrier strengthening, antioxidant, and anti-inflammatory purposes comprising a fermented extract of tangerine makgeolli lees that has excellent moisturizing power due to the promotion of hyaluronic acid synthesis in human keratinocytes and fibroblasts, strengthens skin barrier function by increasing the expression of filaggrin, a structural protein of the outer membrane of keratinocytes, and simultaneously possesses an antioxidant effect through free radical scavenging and an effect of inhibiting the secretion of inflammatory substances. Background Technology

[0002] The skin is the outermost organ of the human body and serves as an essential barrier that prevents harmful substances from the external environment from entering the body, while simultaneously preventing the loss of biological components such as body moisture. The skin is broadly divided into three layers: the epidermis, dermis, and subcutaneous fat. The moisture content of the skin is approximately 70% in the dermis and decreases towards the epidermis, with the stratum corneum retaining 10 to 20% moisture. In particular, the epidermis functions to prevent the evaporation of body moisture and block the excessive penetration of external substances. The epidermis is composed of four layers: the basal layer (stratum basale), the spinous layer (stratum spinosum), the granular layer (stratum granulosum), and the stratum corneum. Water in the dermis eventually moves to the stratum corneum by passive diffusion and is expelled externally; this transepidermal water loss (TEWL) is maintained at an appropriate level by the cornified protein envelope and cornified lipid envelope surrounding the stratum corneum. The cornified lipid envelope acts as a scaffold that forms a multilayered structure of intercellular lipids, thereby enabling the formation of a complete skin barrier structure.

[0003] In the case of dry skin, the cohesiveness between keratinocytes is often weakened, or the skin fails to prevent moisture loss due to abnormalities in the lipid membrane components of the stratum corneum. This breakdown of the skin barrier leads to dryness. Hyaluronic acid (or hyaluronan), a major component of the extracellular matrix (ECM), is the only nonsulfated glycosaminoglycan among the glycosaminoglycans widely distributed in the skin and is primarily synthesized in cell membranes. It contributes significantly to cell proliferation and migration and possesses the ability to retain moisture within the skin by binding to water molecules. Dry skin is prone to flaking and damage; however, since hyaluronic acid present within the skin can prevent this by replenishing moisture, many hyaluronic acid cosmetics and nutritional supplements have been developed recently.

[0004] Fibroblasts, primarily located in the dermis, play a crucial role in increasing the moisture content of the dermis by producing not only structural proteins like collagen and elastin but also polysaccharides such as hyaluronic acid. When both keratinocytes and fibroblasts actively produce hyaluronic acid, the skin becomes able to retain more moisture, thereby preventing dryness and signs of aging.

[0005] Profilaggrin, a precursor of filaggrin—a protein that connects the outer membrane of keratinocytes with keratin fibers—exists within keratin hyaline granules until it is degraded by proteases and subsequently converted into filaggrin through dephosphorylation. Filaggrin acts to bind keratin molecules together, contributing to the strong physical support of the skin barrier. When filaggrin undergoes deamination by proteases, it breaks down into amino acids such as PCA (pyrrocarboxylic acid) or UCA (trans-urocanic acid). As a natural moisturizing factor, it functions to maintain skin hydration, preserve the slightly acidic pH of the stratum corneum, and protect the skin from damage caused by external stimuli. When filaggrin levels are reduced due to genetic mutations or acquired factors, it can disrupt skin barrier function, leading to moisture loss and impaired protective capabilities.

[0006] An increase in unstable free radicals within skin cells, such as those causing oxidative stress, damages the cells and affects their lipid components, proteins, and DNA. Increased oxidative stress weakens the skin barrier function, which ultimately reduces the skin's ability to retain moisture and leads to dryness. Antioxidants, such as Vitamin C, are known to improve skin cell function and increase hyaluronic acid production. Furthermore, chronic inflammation caused by external stimuli or damage weakens the skin barrier, leading to increased moisture loss. Since the persistence of these causes increases skin dryness and sensitivity, eventually resulting in dry skin, substances with anti-inflammatory effects can be beneficial for skin hydration.

[0007] Tangerine Makgeolli is produced by fermenting newly harvested rice grown with Jeju volcanic bedrock water using native Korean yeast and Korean wheat koji, then adding Jeju tangerine juice, dried tangerine peel, and Dangyuja peel to the mixture for natural fermentation. After fermentation is complete, the residue remaining during the aging process becomes lees. Since this lees is a resource typically discarded as a brewing byproduct, research on its bioactivity for recycling has been almost non-existent to date.

[0008] Accordingly, the inventors continued their research to develop a natural composition for improving skin hydration that has high stability and safety and is free from skin side effects. As a result, they discovered that a fermented extract of tangerine makgeolli lees can simultaneously exhibit effects such as promoting hyaluronic acid synthesis in cells present in the epidermis and dermis, improving skin barrier function, antioxidant effect, and anti-inflammatory effect, thereby completing the present invention. The problem to be solved

[0009] One objective of the present invention is to provide a composition for skin moisturizing, skin barrier strengthening, antioxidant, and / or anti-inflammatory purposes, comprising a fermented extract of tangerine makgeolli lees as an active ingredient.

[0010] Another objective of the present invention is to provide a cosmetic, topical skin preparation, or food composition for skin moisturization, skin barrier strengthening, antioxidant, and / or anti-inflammatory purposes comprising the above composition.

[0011] Another objective of the present invention is to provide a method of administering the above composition to an individual to improve skin hydration, strengthen the skin barrier, enhance antioxidant activity, and / or prevent, improve, or treat inflammation. means of solving the problem

[0012] As a means to achieve the above objective, the present invention relates to a composition for skin moisturization, skin barrier strengthening, antioxidant, and / or anti-inflammatory purposes, comprising a fermented extract of tangerine makgeolli lees as an active ingredient. More specifically, the present invention relates to a cosmetic composition, a skin external application composition, and a food composition comprising a fermented extract of tangerine makgeolli lees as an active ingredient, wherein the composition has excellent human safety as it is free from skin irritation and cytotoxicity, while promoting hyaluronic acid synthesis in human keratinocytes and fibroblasts, increasing the expression of filaggrin, a structural protein of the outer membrane of keratinocytes, improving skin moisturization by inhibiting the secretion of inflammatory substances and antioxidant efficacy, and enhancing antioxidant effects and preventing, improving, and treating inflammation.

[0013] In one embodiment, the present invention provides a composition for improving skin moisturization, strengthening the skin barrier, antioxidant, and / or anti-inflammatory purposes, comprising a fermented lees extract of tangerine makgeolli as an active ingredient.

[0014] In the present invention, “tangerine makgeolli” refers to tangerine makgeolli produced by adding Jeju tangerine juice, dried tangerine peel, and citron peel to makgeolli made by fermenting rice with yeast and nuruk, and then fermenting it.

[0015] The above method for manufacturing tangerine makgeolli can be produced by, for example, cooking glutinous rice into steamed rice, adding Jeju tangerine juice, dried tangerine peel, and Dangyuja peel, mixing them, adding nuruk and yeast, sealing the mixture, fermenting it for about one week to one month, and then filtering it. The temperature during fermentation is 17 to 25℃.

[0016] In the present invention, “tangerine makgeolli lees” is the alcohol residue remaining after manufacturing the tangerine makgeolli.

[0017] In the present invention, “fermented tangerine makgeolli lees extract” refers to extract obtained after fermenting tangerine makgeolli lees.

[0018] The aforementioned “fermentation” is a process in which microorganisms produce useful substances from the lees of tangerine makgeolli, and the microorganisms are not necessarily limited to this, but include Lactobacillus genus (Lactobacillus) sp.), Vididobacterium genus ( Bifidobacterium sp.), Streptococcus Streptococcus sp.), Leuconostoc (Leuconostoc genus Lactococcus (Lactococcus sp.), Enterococcus genus (Enterococcus It may be one or more strains selected from sp).

[0019] Specifically, the microorganism is Lactobacillus rhamnosus ( Lactobacillus rhamnosus ), Lactobacillus plantarum ( Lactobacillus plantarum ), Lactobacillus delbrueckii ( Lactobacillus delbrueckii ), Lactobacillus bulgaricus ( Lactobacillus bulgaricus ), Lactobacillus casei ( Lactobacillus casei ), Lactobacillus brevis ( Lactobacillus brevis ), Lactobacillus acidophilus ( Lactobacillus acidophilus ), Lactobacillus reuteri ( Lactobacillus reuteri ), Bifidobacterium lactis ( Bifidobacterium lactis ), Bifidobacterium longum ( Bifidobacterium longum ) Bifidobacterium bifidum ( Bifidobacterium bifidum ), Bifidobacterium breve ( Bifidobacterium breve ), Bifidobacterium animalis( Bifidobacterium animalis ), Lactococcus lactis ( Lactococcus lactis ), Enterococcus faecium ( Enterococcus faecium ), Enterococcus faecalis ( Enterococcus faecalis ), Streptococcus thermophilus ( Streptococcus thermophilus It may be ) etc., and one or more of the above microorganisms may be used.

[0020] As a specific example, the microorganism is Lactobacillus rhamnosus ( Lacticaseibacillus rhamnosus It can be.

[0021] As a specific example, the lees of tangerine makgeolli are air-dried and ground, and then microorganisms are inoculated into a culture medium containing 10 to 500 times, preferably 100 to 200 times, the weight of the dried sample, and the microorganisms are cultured at the optimal activity temperature of microorganisms, for example, 25 to 37°C, preferably 30 to 37°C, for 48 to 80 hours, preferably 52 to 80 hours, more preferably 72 hours, to ferment.

[0022] The fermented product produced by the fermentation of the above microorganisms can be used directly in the extraction process, or after centrifugation and filtration to remove microbial cells and cell residue, it can be used in the subsequent extraction process. In this specification, the fermented product may be referred to as a “culture solution” to distinguish it from the fermented extract, and unless there are special circumstances, the “culture solution” may be understood as the “fermented product” mentioned above.

[0023] The above “extraction” refers to a process of obtaining a product such as a liquid component obtained by immersing the fermented lees of tangerine makgeolli in various solvents and then treating it for a certain period of time at room temperature or under heated conditions, or a solid component obtained by removing the solvent from the liquid component. The product may include all of the diluted solution of the liquid component or solid component described above, the concentrate thereof, the adjusted product thereof, the purified product thereof, etc.

[0024] The solvent used in the above extraction is not particularly limited to, as long as it allows obtaining an extract from the fermented lees of tangerine makgeolli that has effects of improving skin moisturization, strengthening the skin barrier, antioxidant activity, and preventing, improving, or treating inflammation, but preferably it may be water, a polar solvent, or a non-polar solvent. More preferably it may be water, a lower alcohol having 1 to 4 carbon atoms (ethanol, methanol, propanol, or butanol, etc.), a mixed solvent thereof, etc., and even more preferably water or ethanol, most preferably water.

[0025] Furthermore, the above extraction method is not particularly limited thereto, as long as it can yield an extract having effects such as improving skin hydration, strengthening the skin barrier, antioxidant properties, and preventing, improving, or treating inflammation. Extraction methods include hot water extraction, cold maceration extraction, ultrasonic extraction, high-temperature and high-pressure extraction, or reflux cooling extraction.

[0026] As a specific example, the above tangerine makgeolli fermentation extract can be obtained by high-temperature and high-pressure extraction of the tangerine makgeolli fermentation product using a high-pressure steam sterilizer at 120 to 125°C for 28 to 32 minutes.

[0027] Unless microbial cells and cell residues are removed from the fermented product, the above extract may be used after removing the microbial cells and cell residues by centrifugation. Additionally, the above extract may be used after filtration, concentration, or drying.

[0028] In the present invention, “moisturizing” means supplying moisture to the skin and regulating skin moisture. The moisturizing can also provide the efficacy of maintaining and strengthening the normal barrier function of the skin by helping dead skin cells to shed evenly, and the efficacy of eliminating symptoms such as itching caused by skin dryness.

[0029] In the present invention, “skin barrier” refers to the part present in the stratum corneum, which is the outermost layer of the epidermis among the structures constituting the skin, and “skin barrier strengthening” refers to maintaining the skin barrier to prevent moisture loss from the skin, retaining skin moisture, and preventing skin damage from external stimuli.

[0030] The skin moisturization and skin barrier strengthening of the present invention are not limited to those occurring mainly on the face, and any other part of the body, such as the hands, feet, back, and shoulders, may be selected.

[0031] In the present invention, "antioxidant" refers to the process of removing or inhibiting the generation of toxic substances related to oxygen within the human body. Diseases related to antioxidants are not necessarily limited to, but include chronic diseases such as atopic diseases, cancer, hypertension, myocardial infarction, arteriosclerosis, rheumatism, cataracts, and Parkinson's disease.

[0032] In the present invention, “anti-inflammatory” means preventing or treating inflammation. Here, the inflammation refers to a disease caused by the invasion of external infectious agents (bacteria, fungi, viruses, various types of allergens, etc.), and such diseases include, but are not particularly limited to, atopic dermatitis, allergic dermatitis, inflammatory bowel disease, gastric ulcers, or asthma.

[0033] In one specific embodiment, the degree of hyaluronic acid production in human keratinocytes according to the concentration of the fermented tangerine makgeolli lees extract of the present invention was examined, and it was found that hyaluronic acid production was promoted by the fermented tangerine makgeolli lees extract, confirming that the fermented tangerine makgeolli lees extract has a hyaluronic acid synthesis-promoting effect in human keratinocytes (see Fig. 1).

[0034] In another specific embodiment, the degree of hyaluronic acid production in human fibroblasts according to the concentration of the tangerine makgeolli lees fermentation extract of the present invention was examined, and it was found that hyaluronic acid production was promoted by the tangerine makgeolli lees fermentation extract, confirming that the tangerine makgeolli lees fermentation extract has a hyaluronic acid synthesis promoting effect in human fibroblasts (see Fig. 2).

[0035] In another specific embodiment, the expression of filaggrin, a structural protein of the outer membrane of keratinocytes, was examined according to the concentration of the tangerine makgeolli lees fermentation extract. As a result, it was found that filaggrin expression increased as the concentration of the tangerine makgeolli lees fermentation extract increased, confirming that it exhibits a skin barrier strengthening effect (see Fig. 3).

[0036] In another specific embodiment, the DPPH free radical scavenging activity according to the concentration of the tangerine makgeolli lees fermentation extract was examined, and it was found that the DPPH scavenging activity increased as the concentration of the tangerine makgeolli lees fermentation extract increased, confirming that it exhibits an antioxidant effect (see Fig. 4).

[0037] In another specific embodiment, an inflammatory response was induced in mouse macrophages and the amount of prostaglandin PGE2 produced according to the concentration of the fermented tangerine makgeolli lees extract was examined. As a result, the fermented tangerine makgeolli lees extract inhibited the production of prostaglandin PGE2, confirming that the fermented tangerine makgeolli lees extract has anti-inflammatory and skin dryness prevention, improvement, or treatment effects (see Fig. 5).

[0038] Therefore, the fermented lees extract of tangerine makgeolli, which is the active ingredient of the present invention, has the effect of preventing skin dryness and improving moisturizing power by preventing moisture loss in the skin through hyaluronic acid synthesis, and has the effect of strengthening the barrier function of the stratum corneum by increasing the expression of structural proteins of the outer membrane of keratinocytes.

[0039] In addition, the fermented lees extract of tangerine makgeolli, which is the active ingredient of the present invention, has an antioxidant effect due to oxidative stress and an anti-inflammatory effect due to the inhibition of inflammatory substance secretion, and also has the effect of preventing, improving, and treating skin dryness and strengthening the skin barrier through the aforementioned antioxidant and anti-inflammatory effects.

[0040] The content of the fermented tangerine makgeolli lees extract included in the composition of the present invention is not particularly limited thereto, but may be included in an amount of 0.00001 to 100% by weight, preferably 0.0001 to 15% by weight, more preferably 0.001 to 15% by weight, and even more preferably 0.001 to 10% by weight with respect to the total weight of the composition.

[0041] In one specific embodiment, the present invention provides a cosmetic composition for skin moisturizing, skin barrier strengthening, antioxidant, and / or anti-inflammatory purposes, comprising a fermented extract of tangerine makgeolli lees.

[0042] The fermented tangerine makgeolli lees extract included as an active ingredient in the above cosmetic composition and its skin moisturizing, skin barrier strengthening, antioxidant, and anti-inflammatory effects are as described above.

[0043] The cosmetic composition of the present invention may be used for the purposes of skin moisturization, skin barrier strengthening, antioxidant, and anti-inflammatory effects, and, although not necessarily limited thereto, may be applied to dry skin such as the face, neck, hands, and feet.

[0044] In the present invention, the components included in the "cosmetic composition" may include, as active ingredients, components commonly used in cosmetic compositions in addition to said active ingredients, such as, for example, antioxidants, stabilizers, solubilizers, vitamins, pigments, and fragrances, and carriers. The cosmetic composition of the present invention may be prepared in any formulation commonly manufactured in the art, for example, as a solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation, pack, massage cream, and spray, but is not limited thereto. More specifically, it may be prepared in the form of a softening lotion, a nourishing lotion, a nourishing cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray, or a powder.

[0045] In the case where the formulation of the present invention is a paste, cream, or gel, animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, or zinc oxide may be used as a carrier component.

[0046] When the formulation of the present invention is a solution or an emulsion, a solvent, a solubilizing agent, or an emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol, or fatty acid ester of sorbitan.

[0047] In the case where the formulation of the present invention is a suspension, liquid diluents such as water, ethanol, or propylene glycol, ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, or tracanthese may be used as carrier components.

[0048] In the case where the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, or polyamide powder may be used as a carrier component, and in particular, in the case of a spray, it may additionally include a propellant such as chlorofluorohydrocarbon, propane / butane, or dimethyl ether.

[0049] In the case where the formulation of the present invention is a cleansing agent containing a surfactant, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide ether sulfate, alkylamidobetaine, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, or ethoxylated glycerol fatty acid ester, etc. may be used as a carrier component.

[0050] If the formulation of the present invention is a soap, a surfactant-containing cleanser, or a surfactant-free cleanser, it may be applied to the skin and then wiped off, peeled off, or washed off with water. Examples of the soap include liquid soap, powder soap, solid soap, and oil soap. Examples of the surfactant-containing cleanser include cleansing foam, cleansing water, cleansing towel, and cleansing pack. Examples of the surfactant-free cleanser include cleansing cream, cleansing lotion, cleansing water, and cleansing gel.

[0051] The content of the fermented tangerine makgeolli lees extract included in the above cosmetic composition is not particularly limited thereto, but may be included in an amount of 0.00001 to 100 weight%, preferably 0.0001 to 15 weight%, more preferably 0.001 to 15 weight%, and even more preferably 0.001 to 10 weight% based on the total weight of the composition.

[0052] In another specific embodiment, the present invention provides a topical skin composition for moisturizing the skin, strengthening the skin barrier, antioxidant, and / or anti-inflammatory purposes, comprising a fermented extract of tangerine makgeolli lees as an active ingredient.

[0053] The fermented tangerine makgeolli lees extract included as an active ingredient in the above external skin composition and its skin moisturizing, skin barrier strengthening, antioxidant, and anti-inflammatory effects are as described above.

[0054] The topical skin composition according to the present invention may be formulated containing a cosmetically or dermatologically acceptable medium or base. This may be provided in any formulation suitable for topical application, for example, in the form of a solution, gel, solid, paste anhydrous product, emulsion obtained by dispersing an oil phase in an aqueous phase, suspension, microemulsion, microcapsule, microgranule, or ionic (liposome) and non-ionic vesicular dispersants, or in the form of a cream, skin toner, lotion, powder, ointment, spray, pack, or concealer stick. It may also be used in the form of a foam or in the form of an aerosol composition further containing a compressed propellant. These compositions may be prepared according to conventional methods in the art.

[0055] In addition, the topical skin composition according to the present invention may contain adjuvants commonly used in the field of cosmetics or dermatology, such as fatty substances, organic solvents, solvents, thickeners, gelling agents, emollients, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, surfactants, water, ionic or nonionic emulsifiers, fillers, metal ion chelating agents, chelating agents, preservatives, vitamins, blockers, humectants, essential oils, dyes, pigments, hydrophilic or lipophilic active agents, lipid vesicles, or any other ingredients commonly used in cosmetics. The adjuvants are introduced in amounts commonly used in the field of cosmetics or dermatology.

[0056] The content of the fermented tangerine makgeolli lees extract included in the above external preparation composition is not particularly limited thereto, but may be included in an amount of 0.00001 to 100 weight%, preferably 0.0001 to 15 weight%, more preferably 0.001 to 15 weight%, and even more preferably 0.001 to 10 weight% based on the total weight of the composition.

[0057] In another specific embodiment, the present invention provides a method for preventing and improving dry skin, a method for strengthening the skin barrier, a method for preventing and improving oxidative stress, and a method for preventing, improving, and treating inflammation, each comprising the step of administering a composition containing the above-mentioned tangerine makgeolli lees fermentation extract as an active ingredient to (1) an individual whose skin is dry or at risk of becoming dry, (2) an individual whose skin barrier is weakened or at risk of weakening, (3) an individual who needs to prevent or improve oxidative stress, or (4) an individual who needs to prevent, improve, or treat inflammation.

[0058] In the present invention, the term "individual" refers to any animal, including humans, that has dry skin or may be in a dry state. By administering the composition of the present invention to the individual, the individual can effectively prevent and improve skin dryness, strengthen the skin barrier, prevent and improve oxidative stress, and prevent, improve, or treat inflammation.

[0059] The above-mentioned fermented tangerine makgeolli lees extract and its skin moisturizing, skin barrier strengthening, antioxidant, and anti-inflammatory effects are as described above.

[0060] The method of administration of the composition according to the present invention is not particularly limited and may follow methods commonly used in the relevant technical field. As a non-limiting example of the method of administration, the composition may be administered orally or parenterally. As one specific example, the composition of the present invention may be used by methods such as direct application or scattering to areas such as the hands, feet, or face where the skin is generally damaged, dry, under oxidative stress, or inflamed.

[0061] The prevention and improvement method of the present invention may include administering a composition containing a fermented extract of tangerine makgeolli lees in an amount that is cosmetically or dermatologically effective.

[0062] In another specific embodiment, the present invention provides a food composition for skin moisturization, skin barrier strengthening, antioxidant, and / or anti-inflammatory purposes, comprising a fermented extract of tangerine makgeolli lees as an active ingredient.

[0063] The fermented tangerine makgeolli lees extract included as an active ingredient in the above food composition and its skin moisturizing, skin barrier strengthening, antioxidant, and anti-inflammatory effects are as described above.

[0064] When the composition of the present invention is used as a food additive, the fermented tangerine makgeolli lees extract may be added as is or used together with other foods or food ingredients, and may be used appropriately according to conventional methods. The mixing amount of the active ingredient may be appropriately determined according to the purpose of use (treatment for prevention, health, or improvement purposes), and may additionally include food-grade food auxiliary additives that are food-grade acceptable. Since the composition of the present invention uses a fermented extract derived from natural products as an active ingredient, there are no issues regarding stability, and because it has been confirmed to be stable in safety tests on human skin, there are no significant limitations on the mixing amount.

[0065] The food composition of the present invention may include all foods in the conventional sense and may be used interchangeably with terms known in the art, such as functional foods and health functional foods.

[0066] The term "functional food" in the present invention refers to a food manufactured and processed using raw materials or ingredients that have functional properties useful to the human body, and "functionality" means consuming for the purpose of obtaining useful effects for health purposes, such as regulating nutrients or physiological actions regarding the structure and function of the human body.

[0067] In addition, the term "health functional food" in the present invention refers to a food manufactured or processed by methods such as extraction, concentration, purification, or mixing, using a specific component as a raw material or a specific component contained in a food raw material for the purpose of health supplementation, and refers to a food designed and processed to sufficiently exert biological regulatory functions on the body, such as biological defense, regulation of biological rhythms, and prevention and recovery of disease, through the said component, and the composition for the health food can perform functions related to the prevention of disease and recovery of disease.

[0068] There are no limitations on the types of food in which the composition of the present invention can be used for moisturizing power and skin barrier improvement, antioxidant, and / or anti-inflammatory effects resulting from strengthening skin barrier function and promoting hyaluronic acid synthesis. Furthermore, the composition containing the fermented tangerine makgeolli lees extract of the present invention as an active ingredient may be prepared by mixing other appropriate auxiliary ingredients and known additives that may be contained in food, depending on the choice of a person skilled in the art. Examples of foods to which it can be added include meat, sausage, bread, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and it may be prepared by adding it to juices, teas, jellies, and juices prepared using the fermented tangerine makgeolli lees extract according to the present invention as a main ingredient.

[0069] In addition, the foods to which the present invention can be applied may include all foods, such as special nutritional foods (e.g., infant formula, baby food, etc.), processed meat products, fish products, tofu products, jelly products, noodles (e.g., ramen, noodles, etc.), health supplements, seasoning foods (e.g., soy sauce, soybean paste, red pepper paste, mixed sauce, etc.), sauces, confectionery products (e.g., snacks), dairy products (e.g., fermented milk, cheese, etc.), other processed foods, kimchi, pickled foods (various types of kimchi, pickled vegetables, etc.), beverages (e.g., fruit and vegetable beverages, soy milk, fermented beverages, etc.), and natural seasonings (e.g., ramen soup, etc.).

[0070] When the food composition of the present invention is used in the form of a beverage, it may contain various sweeteners, flavorings, or natural carbohydrates as additional ingredients, as in conventional beverages. In addition to the above, the health functional food composition of the present invention may contain various nutritional supplements, vitamins, electrolytes, flavorings, colorings, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. Furthermore, it may contain fruit pulp for the production of natural fruit juices, fruit juice beverages, and vegetable beverages.

[0071] The content of the fermented tangerine makgeolli lees extract included in the above food composition is not particularly limited thereto, but may be included in an amount of 0.00001 to 100 weight%, preferably 0.0001 to 15 weight%, more preferably 0.001 to 15 weight%, and even more preferably 0.001 to 10 weight% based on the total weight of the composition.

[0072] Meanwhile, the above-described composition containing the fermented lees extract of tangerine makgeolli according to the present invention is made from edible natural materials, so when used as a cosmetic composition, a skin external application composition, or a food composition, it not only has no side effects compared to general synthetic compounds but has also been confirmed to be stable in safety tests on human skin, so it can be safely included as a useful ingredient and used effectively. Effects of the invention

[0073] The composition comprising the fermented tangerine makgeolli lees extract according to the present invention is non-irritating to the skin and has excellent safety for the human body, while also having an excellent effect of improving moisturizing power by regulating moisture within the skin and preventing moisture loss through the synthesis of hyaluronic acid in skin keratinocytes and fibroblasts. In addition, it strengthens the skin barrier function by increasing the expression of filaggrin, a keratin structural protein, and exhibits excellent antioxidant effects through free radical scavenging and inhibition of inflammatory substance secretion. Therefore, the fermented tangerine makgeolli lees extract according to the present invention can be usefully utilized as a cosmetic composition, external skin agent, and food composition for improving skin moisturization, strengthening the skin barrier, antioxidant, and anti-inflammatory purposes. Brief explanation of the drawing

[0074] Figure 1 is the result of observing the hyaluronic acid synthesis-promoting effect of human keratinocytes by a fermented tangerine makgeolli lees extract according to one embodiment of the present invention. Figure 2 is the result of observing the hyaluronic acid synthesis-promoting effect of a fermented tangerine makgeolli lees extract according to one embodiment of the present invention on human fibroblasts. Figure 3 is a result showing an increase in filaggrin expression in human keratinocytes by a fermented tangerine makgeolli lees extract according to one embodiment of the present invention. Figure 4 is the result of observing the DPPH free radical scavenging activity of a fermented tangerine makgeolli lees extract according to one embodiment of the present invention. Figure 5 shows the results of observing the inhibitory effect of the fermented tangerine makgeolli lees extract on the secretion of inflammatory substances when an inflammatory response was induced in mouse macrophages by the fermented tangerine makgeolli lees extract according to one embodiment of the present invention. Specific details for implementing the invention

[0075] Hereinafter, the present invention will be described in detail with reference to examples and the like to aid in understanding the invention. However, the embodiments according to the present invention may be modified in various different forms, and the scope of the present invention should not be interpreted as being limited to the following embodiments. The embodiments of the present invention are provided to more completely explain the invention to those with average knowledge in the art.

[0076] Example 1: Preparation of Fermented Extract of Tangerine Makgeolli Lees

[0077] Tangerine makgeolli lees were obtained from the Jeju Gotbat Brewery within Jeju Technopark, shade-dried, ground, and then dried for use. Specifically, Jeju tangerine juice, dried tangerine peel, and citron peel were mixed with steamed glutinous rice, fermented with yeast and nuruk for one week to one month, and then filtered through a sieve or a filter cloth to produce makgeolli, thereby obtaining the byproduct, the lees.

[0078] A lees culture medium was prepared by adding 1% (v / v) of tangerine makgeolli lees to a plant medium (BioSpectrum, Inc.) containing refined glucose and yeast extract. Inoculum-cultured Lactobacillus rhamnosus ( Lactobacillus rhamnosus ) was inoculated into the above-mentioned lees culture medium at a volume ratio of 1 / 100 and fermented for 72 hours under conditions of a temperature of 37°C and a rotation speed of 150 rpm. After the fermentation was complete, the culture medium was subjected to high-temperature and high-pressure extraction using an autoclave at 121°C for 30 minutes, followed by centrifugation to remove cell bodies and cell residue from the extract, and the supernatant was filtered to completely remove the cell bodies. The fermented extract from which the cell bodies were completely removed was freeze-dried to produce a tangerine makgeolli lees fermented extract.

[0079] Example 2: Evaluation of the hyaluronic acid synthesis-promoting efficacy of fermented tangerine makgeolli lees extract in human keratinocytes

[0080] The hyaluronic acid synthesis-promoting effect of the fermented tangerine makgeolli lees extract prepared in Example 1 was confirmed in human keratinocytes. Specifically, to evaluate hyaluronic acid synthesis, 1 × 10 human immortalized keratinocytes (HaCaT) 4 Canine cells were cultured in a 96-well plate. After 24 hours, the medium was replaced with one containing 1% FBS, and the cells were treated with fermented tangerine makgeolli lees extracts at various concentrations and cultured for 24 hours, after which the supernatant was collected. Additionally, tangerine makgeolli lees extracts obtained without fermentation, using only the extraction method described in Example 1, were treated at the same concentrations and cultured for 24 hours, after which the supernatant was collected. The amount of hyaluronic acid produced from the harvested supernatant was measured using a Hyaluronic acid ELISA kit (R&D Systems, USA). Keratinocytes treated with retinoic acid (RA) were used as a positive control.

[0081] Figure 1 is a graph showing the degree of hyaluronic acid synthesis in keratinocytes by the fermented extract of tangerine makgeolli lees, and it was confirmed that hyaluronic acid synthesis was significantly promoted in the group treated with the fermented extract of tangerine makgeolli lees.

[0082] Example 3: Evaluation of the hyaluronic acid synthesis-promoting efficacy of fermented tangerine makgeolli lees extract in human fibroblasts

[0083] The hyaluronic acid synthesis-promoting effect of the fermented tangerine makgeolli lees extract prepared in Example 1 was confirmed in human fibroblasts. Specifically, to evaluate hyaluronic acid synthesis, 2 × 10 human dermal fibroblasts (HDFs) 4Canine cells were cultured in a 24-well plate. After 24 hours, the medium was replaced with one supplemented with 1% FBS, and fermented tangerine makgeolli lees extracts were added at various concentrations. After incubating for 24 hours, the supernatant was collected. The amount of hyaluronic acid produced was measured using a Hyaluronic acid ELISA kit (R&D Systems, USA) with the harvested medium. Fibroblasts treated with retinoic acid (RA) were used as a positive control.

[0084] Figure 2 is a graph showing the degree of hyaluronic acid synthesis in fibroblasts by the fermented tangerine makgeolli lees extract, and it was confirmed that hyaluronic acid synthesis was promoted in the group treated with the fermented tangerine makgeolli lees extract.

[0085] Example 4: Measurement of the effect of fermented tangerine makgeolli lees extract on promoting filaggrin expression in keratinocytes

[0086] The effect of the fermented lees extract of tangerine makgeolli on promoting filaggrin expression in keratinocytes was confirmed. Specifically, HaCaT cells were cultured in DMEM medium supplemented with 10% FBS. HaCaT keratinocytes were placed in a 6-well plate at a density of 2 × 10⁶ 5Cells were added and cultured in a 5% CO2 incubator at 37°C for 24 hours. Subsequently, the medium in the 6-well plate was replaced with DMEM supplemented with 1% FBS, and the fermented tangerine makgeolli lees extract from Example 1 was applied at various concentrations. The cells were then cultured for a total of 48 hours, with medium replacement and sample treatment performed every 24 hours. After 48 hours of culture, RNA was extracted using TRIzol (Invitrogen, USA), and cDNA was synthesized using a cDNA synthesis kit (amfiRivert cDNA Synthesis Platinum Master Mix, GenDepot, USA). The mRNA expression levels of filaggrin were determined using real-time polymerase chain reaction (RT-PCR) with the cDNA synthesized under each condition. Untreated keratinocytes were used as the negative control (Ctrl), and Ca 2+ Keratinocytes treated with [the agent] were used. Each gene primer used in the experiment is shown in Table 1 below.

[0087] gene primer Sequence (5 → 3) filaggrin sense GCTGAAGGAACTTCTGGAAAAGG (Sequence No. 1) anti-sense GTTGTGGTCTATATCCAAGTGATC (Sequence No. 2)

[0088] Figure 3 is a graph showing the pattern of filaggrin expression promotion in keratinocytes by the fermented tangerine makgeolli lees extract. Compared to the negative control group (Ctrl), expression increased with increasing concentration of the fermented tangerine makgeolli lees extract.

[0089] Example 5: In vitro ( in vitro Free radical scavenging effect of fermented tangerine makgeolli lees extract

[0090] The following experiment was conducted to investigate the antioxidant efficacy of the fermented tangerine makgeolli lees extract of Example 1. DPPH (1,1-diphenyl-2-picrylhydrazyl) is a water-soluble substance containing chemically stabilized free radicals and exhibits maximum absorbance around 515 nm to 520 nm. This method measures the antioxidant activity of a sample by utilizing the principle that when purple DPPH reacts with a substance with antioxidant activity, it releases electrons, scavenging radicals and changing color to yellow. The sample was dissolved in methanol, and 130 μl of the sample and 130 μl of DPPH diluted to 200 μM were placed in an e-tube and mixed. After reacting at room temperature for 30 minutes, the amount of remaining DPPH was calculated by measuring the absorbance at 517 nm. The antioxidant capacity of each hydrolysate is expressed as the percentage decrease compared to the absorbance of the control group. L-Ascorbic acid was used as the positive control. The degree of extinction ability was quantified using the following experimental formula 1, and the results are shown in Figure 4.

[0091] [Empirical Formula 1]

[0092] Scavenging activity (%) = [1 - Absorbance of sample / Absorbance of control] × 100

[0093] Figure 4 shows the free radical scavenging activity of the fermented tangerine makgeolli lees extract. As shown in Figure 4, in the verification of efficacy through an antioxidant efficacy test (DPPH assay), the fermented tangerine makgeolli lees extract showed DPPH free radical scavenging activity, confirming that it has antioxidant efficacy.

[0094] Example 6: Confirmation of the inhibitory effect of fermented tangerine makgeolli lees extract on the secretion of inflammatory substances in mouse macrophages

[0095] To investigate the inhibitory effect of the fermented tangerine makgeolli lees extract of Example 1 on the secretion of inflammatory substances, the following experiment was conducted. Mouse macrophages (Raw264.7) were placed in a 24-well plate containing DMEM medium supplemented with 10% FBS at a rate of 2 × 10⁶ 5Cells were added and cultured at 37°C for 24 hours in a 5% CO2 incubator. Subsequently, the fermented tangerine makgeolli lees extract of Example 1 was dissolved in DMEM medium supplemented with 2% FBS and pretreated for 2 hours, after which LPS (Lipopolysaccharide 100 ng / ml), capable of inducing an inflammatory response, was applied to each well. Mouse macrophages treated with Celexocib, which has the ability to inhibit the secretion of inflammatory substances, were used as a positive control. After 24 hours, the cell culture supernatant was collected. Using the harvested medium, the production of the inflammatory substance prostaglandin PGE2 was measured using a Prostaglandin E2 Parameter ELISA kit (R&D Systems, USA). The results are shown in Figure 5.

[0096] As shown in Figure 5, it was confirmed that the fermented tangerine makgeolli lees extract inhibited the increased production of PGE2 caused by LPS treatment in mouse macrophages. From this, it was found that the fermented tangerine makgeolli lees extract is effective in inhibiting the secretion of inflammatory substances caused by the induction of an inflammatory response in mouse macrophages.

[0097] Example 7: Safety Confirmation Experiment of Fermented Tangerine Makgeolli Lees Extract on Human Skin

[0098] In order to confirm whether the fermented tangerine makgeolli lees extract, which was found to have excellent moisturizing, skin barrier strengthening, antioxidant, and anti-inflammatory effects as described above, is safe for human skin, a topical skin preparation containing the fermented tangerine makgeolli lees extract was prepared and a skin safety line verification experiment was performed.

[0099] A topical skin preparation containing 1% of the fermented tangerine makgeolli lees extract of Example 1 was prepared with the ingredient content shown in Table 2 below. To prepare the topical skin preparation, purified water, glycerin, and butylene glycol were mixed and dissolved at 70°C (aqueous phase), and the remaining ingredients, excluding the three ingredients and trimethanolamine, were dissolved at 70°C (oil phase). The oil phase was added to the aqueous phase and first emulsified by stirring with a homomixer (Tokushu Kika, Japan), and finally, trimethanolamine was added. After removing the bubbles formed in the mixture, the mixture was cooled to room temperature to prepare the topical skin preparation.

[0100] ingredient Content (%) control group Test group purified water 72 71 glycerin 8.0 8.0 Butylene glycol 4.0 4.0 Tangerine Makgeolli Lees Fermentation Extract 0 1.0 Caprylic Capri Triglyceride 8.0 8.0 Squalan 5.0 5.0 Cetearyl glucurside 1.5 1.5 Sorbitan Stearate 0.4 0.4 cetearyl alcohol 1.0 1.0 Trimethanolamine 0.1 0.1 Total weight 100 100

[0101] Whether the fermented tangerine makgeolli lees extract irritates the skin was measured by applying a 24-hour closed patch to the back of 30 healthy adults using each topical skin preparation prepared as described above.

[0102] The patching method utilized a chamber (IQ Ultimate™) from Chemotechnique MB Diagnostics AB. 20 μL of each of the above topical agents was placed in the chamber, and closed patches were applied for 24 hours. Skin reactions were observed 30 minutes and 24 hours after patch removal, and the presence and degree of skin irritation were visually evaluated according to evaluation criteria. After calculating the average skin reactivity based on the judgment criteria in Table 3 according to Frosch & Kligman (1979) and the CTFA guideline (2007), the skin irritation level of each topical agent was evaluated using the following experimental formula 1 based on the skin irritation index in Table 4, which was classified by applying the Draize method.

[0103] [Empirical Formula 2]

[0104] Average Skin Irritation Index Calculation Formula

[0105] ∑ [(Grade × Number of subjects who responded) / (4; Highest grade × Total number of subjects)] ÷ Number of evaluations

[0106] sign Grade Irritation assessment - 0 No response + 1 Weak but distinctly visible erythematous reaction ++ 2 Erythematous reaction showing distinct erythema accompanied by papules or edema +++ 3 Severe erythematous reaction accompanied by edema and papules ++++ 4 Severe erythematous reaction accompanied by edema and blisters

[0107] Skin irritation index Skin irritation level assessment 0.00-0.25 Non-irritating 0.26-1.00 Mild irritation 1.01-2.50 Moderate irritation 2.51-4.00 Strong irritation

[0108] test substance Number of subjects who showed a response Average response 30 minutes later 24 hours later 1 2 3 4 1 2 3 4 control group - - - - - - - - 0.00 Test group - - - - - - - - 0.00 Number of subjects 30 30 30 30 30 30 30 30

[0109] As can be seen in Table 5 above, no irritation reaction was observed in either the control group or the test group. Since the average reactivity was calculated to be 0.00 according to the formula described above, the topical skin preparation containing the fermented tangerine makgeolli lees extract (test group) was determined to be a non-irritating substance and safe for human skin, just like the control group topical skin preparation.

[0110] Preparation Example 1: Cosmetic preparation

[0111] Preparation Example 1-1: Softening lotion

[0112] As shown in Table 6 below, a softening lotion containing fermented tangerine makgeolli lees extract as an active ingredient was prepared according to a conventional method.

[0113] ingredient weight% Tangerine Makgeolli Lees Fermentation Extract 0.01 glycerin 3.0 Butylene glycol 2.0 Propylene glycol 2.0 Carboxyvinyl polymer 0.1 ethanol 10.0 Triethanolamine 0.1 Preservatives, trace colors, trace flavors, and trace purified water 82.79 aggregate 100.0

[0114] Preparation Example 1-2: Nourishing lotion

[0115] As shown in Table 7 below, a nutritional cosmetic containing fermented tangerine makgeolli lees extract as an active ingredient was prepared according to a conventional method.

[0116] ingredient weight% Tangerine Makgeolli Lees Fermentation Extract 0.01 Beeswax 4.0 Polysorbate 60 1.5 Sorbitan sesquioleate 0.5 Liquid paraffin 5.0 Squalan 5.0 Caprylic / Capric Triglyceride 5.0 glycerin 3.0 Butylene glycol 3.0 Propylene glycol 3.0 Carboxyvinyl polymer 0.1 Triethanolamine 0.2 Preservatives, trace colors, trace flavors, and trace purified water 69.69 aggregate 100.0

[0117] Preparation Examples 1-3: Nourishing Cream

[0118] As shown in Table 8 below, a nourishing cream containing fermented tangerine makgeolli lees extract as an active ingredient was prepared according to a conventional method.

[0119] ingredient weight% Tangerine Makgeolli Lees Fermentation Extract 0.01 Beeswax 10.0 Polysorbate 60 1.5 Sorbitan sesquioleate 0.5 Liquid paraffin 10.0 Squalan 5.0 Caprylic / Capric Triglyceride 5.0 glycerin 5.0 Butylene glycol 3.0 Propylene glycol 3.0 Triethanolamine 0.2 Preservatives, trace colors, trace flavors, and trace purified water 56.79 aggregate 100.0

[0120] Preparation Examples 1-4: Massage Cream

[0121] As shown in Table 9 below, a nourishing cream containing fermented tangerine makgeolli lees extract as an active ingredient was prepared according to a conventional method.

[0122] ingredient weight% Tangerine Makgeolli Lees Fermentation Extract 0.01 Beeswax 10.0 Polysorbate 60 1.5 Sorbitan sesquioleate 0.8 Liquid paraffin 40.0 Squalan 5.0 Caprylic / Capric Triglyceride 4.0 glycerin 5.0 Butylene glycol 3.0 Propylene glycol 3.0 Triethanolamine 0.2 Preservatives, trace colors, trace flavors, and trace purified water 27.49 aggregate 100.0

[0123] Preparation Examples 1-5: Pack

[0124] As shown in Table 10 below, a pack containing fermented tangerine makgeolli lees extract as an active ingredient was prepared according to a conventional method.

[0125] ingredient weight% Tangerine Makgeolli Lees Fermentation Extract 0.01 polyvinyl alcohol 13.0 Sodium carboxymethylcellulose 0.2 allantoin 0.1 ethanol 5.0 nonylphenyl ether 0.3 Preservatives, trace colors, trace flavors, and trace purified water 81.39 aggregate 100.0

[0126] Preparation Example 2: Preparation of food

[0127] Preparation Example 2-1: Preparation of flour food products

[0128] 0.5 to 5.0 parts by weight of the fermented tangerine makgeolli lees extract of the present invention was added to flour, and bread, cake, cookies, crackers, and noodles were manufactured using this mixture.

[0129] Preparation Example 2-2: Preparation of soup and gravies

[0130] 0.5 to 5.0 parts by weight of the tangerine makgeolli lees fermentation extract of the present invention was added to soup and meat broth to produce meat processing products for health promotion, soup and meat broth for noodles.

[0131] Preparation Example 2-3: Preparation of ground beef

[0132] Health-promoting ground beef was prepared by adding 0.5 to 5.0 parts by weight of the tangerine makgeolli lees fermentation extract of the present invention to ground beef.

[0133] Preparation Example 2-4: Preparation of dairy products

[0134] 0.5 to 5.0 parts by weight of the fermented tangerine makgeolli lees extract of the present invention was added to milk, and various dairy products such as butter and ice cream were prepared using the milk.

[0135] Preparation Example 2-5: Preparation of sausage

[0136] A sausage food composition containing the fermented tangerine makgeolli lees extract of the present invention was prepared as follows. Specifically, 65.18 wt% pork, 25 wt% chicken, 3.5 wt% starch, 1.7 wt% soy protein, 1.62 wt% salt, 1.4 wt% glucose, and 1.5 wt% glycerin were combined with 0.1 wt% fermented tangerine makgeolli lees extract and a sausage was prepared by a conventional method.

[0137] Preparation Example 2-6: Preparation of a health drink

[0138] 5 g of the fermented tangerine makgeolli lees extract of the present invention was homogeneously mixed with auxiliary ingredients such as liquid fructose (0.5%), oligosaccharide (2%), sugar (2%), salt (0.5%), and water (75%), and then flash-sterilized and packaged in small packaging containers such as glass bottles and PET bottles.

[0139] Preparation Example 2-7: Preparation of vegetable juice

[0140] Vegetable juice was prepared by adding 5 g of the fermented tangerine makgeolli lees extract of the present invention to 1,000 ml of tomato or carrot juice.

[0141] Preparation Example 2-8: Preparation of fruit juice

[0142] Fruit juice was prepared by adding 1 g of the fermented tangerine makgeolli lees extract of the present invention to 1,000 ml of apple or grape juice.

Claims

Claim 1 Anti-inflammatory cosmetic composition containing fermented tangerine makgeolli lees extract as an active ingredient. Claim 2 delete Claim 3 A cosmetic composition according to claim 1, wherein the fermented tangerine makgeolli lees extract is obtained by fermenting the residue remaining from makgeolli made by mixing steamed rice with Jeju tangerine juice, dried tangerine peel, and citron peel, and fermenting it with yeast and nuruk. Claim 4 An anti-inflammatory topical skin composition comprising fermented tangerine makgeolli lees extract as an active ingredient. Claim 5 delete Claim 6 In claim 4, the above tangerine makgeolli lees fermentation extract is a skin external preparation composition obtained by fermenting the remaining lees from makgeolli made by mixing steamed rice with Jeju tangerine juice, dried tangerine peel, and citron peel, and fermenting it with yeast and nuruk. Claim 7 An anti-inflammatory food composition containing fermented tangerine makgeolli lees extract as an active ingredient. Claim 8 In claim 7, the above tangerine makgeolli lees fermentation extract is a food composition obtained by fermenting the residue remaining from makgeolli made by mixing steamed rice with Jeju tangerine juice, dried tangerine peel, and citron peel, and fermenting it with yeast and nuruk.

Images