A mutant microorganism having enhanced L-glutamic acid productivity and a method for producing L-glutamic acid using the same

Abstract

The present invention relates to a mutant microorganism with improved L-glutamic acid production capacity and a method for producing L-glutamic acid using the same, wherein the mutant microorganism can have an improved production yield of L-glutamic acid compared to the parent strain by weakening or inactivating the activity of the RamB protein.

Description

Technology Field

[0001] The present invention relates to a mutant microorganism with enhanced L-glutamic acid production capacity and a method for producing L-glutamic acid using the same. Background Technology

[0002] L-glutamic acid is a representative amino acid produced by microbial fermentation, and its salt form, monosodium L-glutamate (MSG), is widely used as a seasoning for household use and processed food production because it balances and harmonizes the overall taste of food, thereby increasing the preference for foods such as meat, fish, chicken, vegetables, sauces, soups, and seasonings, and can enhance the taste of low-salt foods with up to 30% less salt.

[0003] To briefly examine the fermentation pathway of L-glutamic acid, glucose primarily undergoes the glycolytic pathway, but some is metabolized into two molecules of pyruvate via the pentose phosphate pathway. One of these molecules fixes CO2 to become oxaloacetic acid, while the other molecule combines with acetyl CoA from pyruvate to become citric acid. Oxaloacetic acid and citric acid then enter the citric acid cycle (TCA cycle) to become alpha-ketoglutaric acid. Here, the oxidative metabolic pathway for the oxidation of alpha-ketoglutarate to succinic acid is absent, and isocitrate dehydrogenase and glutamate dehydrogenase are closely involved, so the reductive amino acid reaction of alpha-ketoglutarate proceeds efficiently and L-glutamic acid is produced.

[0004] L-glutamic acid production can be achieved using wild-type strains obtained from nature or mutant strains modified to enhance their glutamic acid production capabilities. Recently, to improve the efficiency of L-glutamic acid production, genetic recombination technology has been applied to microorganisms such as Escherichia coli and Corynebacterium, which are widely used for the production of useful substances like amino acids and nucleic acids. This has led to the development of various recombinant strains or mutants with superior L-glutamic acid production capabilities, as well as methods for producing L-glutamic acid using these strains. In particular, there have been attempts to increase L-glutamic acid production by directly inducing mutations in genes involved in the L-glutamic acid biosynthetic pathway, such as enzymes, transcription factors, and transport proteins, or by inducing mutations in promoters that regulate their expression. However, since the number of proteins—including enzymes, transcription factors, and transport proteins—directly or indirectly involved in L-glutamic acid production ranges from tens to hundreds, there is still a need for extensive research regarding whether changes in the activity of these proteins lead to an increase in L-glutamic acid production capabilities. Prior art literature

[0005] U.S. Patent No. 6,852,516 U.S. Patent No. 6,962,805 The problem to be solved

[0006] The present invention aims to provide a mutant microorganism with enhanced L-glutamic acid production ability.

[0007] In addition, the present invention aims to provide a method for producing L-glutamic acid using the above-mentioned mutant microorganism. means of solving the problem

[0008] One aspect of the present invention provides a mutant microorganism in which the activity of the RamB protein is weakened or inactivated, thereby enhancing the L-glutamic acid production capacity.

[0009] The “RamB protein” used in the present invention is a transcriptional regulator that controls the expression of genes aceA, aceB, ack, and pta involved in acetate metabolism. The RamB protein in the present invention may be a polypeptide encoded by the ramB gene or the Cgl0369 gene and having RamB protein activity, but is not limited thereto.

[0010] Nucleic acid and protein sequence information for the above RamB protein can be obtained through known sequence databases (e.g., GenBank, UniProt).

[0011] The term “weakening of activity” as used in the present invention means that the expression level of a gene encoding a target enzyme, transcription factor, transport protein, etc., is reduced compared to the original microorganism, i.e., the wild-type strain or the strain before modification. Such weakening of activity includes cases where the activity of the protein itself is reduced compared to the activity of the protein possessed by the original microorganism through nucleotide substitution, insertion, deletion, or a combination thereof that encode the gene, and cases where the overall degree of protein activity within the cell is lower than that of the wild-type strain or the strain before modification due to inhibition of gene expression or translation inhibition, and combinations thereof.

[0012] According to one embodiment of the present invention, the weakening of the activity of the RamB protein may be caused by the insertion, substitution, deletion, or a combination thereof of all or part of the gene encoding the RamB protein.

[0013] As used in the present invention, "inactivation" refers to a case where the expression of protein-coding genes, such as enzymes, transcription factors, and transport proteins, is not expressed at all compared to the original microorganism, i.e., the wild-type strain or the strain before modification, or where, even if expressed, the activity is nonexistent.

[0014] According to one embodiment of the present invention, the gene encoding the RamB protein may include the nucleotide sequence of SEQ ID NO. 1.

[0015] In addition, according to one embodiment of the present invention, the RamB protein may be composed of the amino acid sequence of SEQ ID NO. 2.

[0016] The nucleotide sequence or amino acid sequence of the RamB protein according to the present invention may consist of or essentially include a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology or identity compared to each sequence, and may have an original function. Here, “homology” or “identity” refers to the percentage of agreement between two sequences when a reference nucleotide sequence or amino acid sequence and any other nucleotide sequence or amino acid sequence are aligned to correspond as much as possible and analyzed.

[0017] As used in the present invention, “improved production capacity” means that the productivity of L-glutamic acid is increased compared to the parent strain. The parent strain refers to a wild-type or mutant strain that is the subject of mutation, and includes subjects that are directly subject to mutation or transformed by recombinant vectors, etc. In the present invention, the parent strain has no L-glutamic acid production capacity or possesses L-glutamic acid production capacity, and wild-type Corynebacterium ( Corynebacterium It may be a microorganism or strain of the genus Corynebacterium that is either a derivative or mutated from the wild type.

[0018] The above-mentioned Corynebacterium strains include Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis( Corynebacterium crudilactis ), Corynebacterium desertii( Corynebacterium deserti ), Corynebacterium carunae ( Corynebacterium callunae ), Corynebacterium suranaerae ( Corynebacterium suranareeae ), Corynebacterium lubricantis( Corynebacterium lubricantis ), Corynebacterium dusanense ( Corynebacterium doosanense ), Corynebacterium epiphysiens( Corynebacterium efficiens ), Corynebacterium uterechi( Corynebacterium uteriqui ), Corynebacterium stationaryis( Corynebacterium stationis ), Corynebacterium pacense ( Corynebacterium pacaense ), Corynebacterium singulare( Corynebacterium singular ), Corynebacterium humireducens( Corynebacterium humireducens ), Corynebacterium marinum( Marine Corynebacterium ), Corynebacterium halotolerans( Corynebacterium halotolerans ), Corynebacterium spaniscorum( Corynebacterium spheniscorum ), Corynebacterium freyburgense ( Corynebacterium freiburgense ), Corynebacterium striatum ( Corynebacterium striatum ), Corynebacterium canis ( Corynebacterium canis ), Corynebacterium ammoniagenes( Corynebacterium ammoniagenes ), Corynebacterium renale( Corynebacterium renale ), Corynebacterium pollatisoli ( Corynebacterium pollutisoli ), Corynebacterium imitans( Corynebacterium imitans ), Corynebacterium caspium ( Corynebacterium caspium ), Corynebacterium testudinoris( Corynebacterium testudinoris ), Corynebacterium pseudopellage ( Corynebacterium pseudopelargus ) or Corynebacterium flavescens ( Corynebacterium flavescens It may be, but is not limited to.

[0019] According to one embodiment of the present invention, the mutant microorganism may be a strain of the genus Corynebacterium.

[0020] The mutant microorganism according to the present invention can have its L-glutamic acid production capacity improved by weakening or inactivating the activity of the RamB protein.

[0021] According to one embodiment of the present invention, the mutant microorganism may have a deleted gene encoding the RamB protein.

[0022] Specifically, the mutant microorganism with enhanced L-glutamic acid production capacity exhibits increased L-glutamic acid production capacity compared to the parent strain, and in particular, compared to the parent strain, the L-glutamic acid production increases by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or by 1.1 times, 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, or 9.5 times Or it may be increased tenfold, but is not limited thereto. For example, a mutant microorganism in which the activity of the RamB protein is weakened or inactivated may have an L-glutamic acid production of 5% or more, specifically 5 to 50% (preferably 10 to 40%) increased compared to the parent strain.

[0023] A composition containing a mutant microorganism according to the present invention can be used as a composition for producing L-glutamic acid.

[0025] A mutant microorganism according to one embodiment of the present invention can be realized through a recombinant vector that deletes the gene encoding the RamB protein in the parent strain.

[0026] As used in the present invention, the term “vector” refers to any type of nucleic acid sequence carrier structure used as a means to deliver and express a target gene in a host cell. Unless otherwise noted, the vector may mean a structure in which a carried nucleic acid sequence is inserted into the host cell genome to be expressed and / or expressed independently. Such a vector comprises an essential regulatory sequence operably linked to enable the expression of the gene insertion, where “operably linked” means that the target gene and its regulatory sequence are linked in such a way that they are functionally coupled to enable gene expression, and the “regulatory sequence” comprises a promoter sequence for performing transcription, any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0027] The vector used in the present invention is not particularly limited as long as it is capable of replicating within a host cell, and any vector known in the art may be used. Examples of such vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors, but are not limited thereto.

[0028] The above vector can typically be constructed as a vector for cloning or as a vector for expression. The vector for expression may be a conventional one used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and may be constructed through various methods known in the art.

[0029] The “recombinant vector” used in the present invention may be constructed using a prokaryotic or eukaryotic cell as a host, and may be capable of replication independently of the host cell’s genome or may be sealed to the genome itself. The host cell is capable of replication by the vector and may include a replication origin, which is a specific nucleotide sequence at which replication is initiated. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it generally includes a potent promoter capable of proceeding transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. When the host is a eukaryotic cell, the replication origins included in the vector that operate in eukaryotic cells include, but are not limited to, f1 replication origins, SV40 replication origins, pMB1 replication origins, adeno replication origins, AAV replication origins, and BBV replication origins. In addition, promoters derived from the genome of mammalian cells (e.g., metallothionine promoters) or promoters derived from mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, HSV tk promoter) may be used and generally have a polyadenylation sequence as a transcription termination sequence.

[0030] The above-mentioned recombinant vector may include a selection marker, which is intended to select transformants (host cells) transformed by the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, the selection of transformed cells is possible. Representative examples of the selection marker include ampicillin, kanamycin, streptomycin, and chloramphenicol, but are not limited thereto.

[0031] A transformant can be produced by inserting the above-mentioned recombinant vector into a host cell, and the transformant may be obtained by introducing the recombinant vector into a suitable host cell. Any host cell known in the art may be used as a cell capable of stably and continuously cloning or expressing the above-mentioned expression vector.

[0032] In the case of transforming prokaryotic cells to produce recombinant microorganisms, as a host cell E. coli DH5α, E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, E. coli Various intestinal bacteria and strains such as Escherichia coli strains like XL1-Blue, Corynebacterium strains, Bacillus subtilis and Bacillus churingensis strains, Salmonella typhimurium, Serratia marcescens and Pseudomonas species may be used, but are not limited thereto.

[0033] When transforming into a eukaryotic cell to produce a recombinant microorganism, host cells such as yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell lines, etc., may be used, but are not limited thereto.

[0034] As used in this invention, “transformation” refers to a phenomenon in which external DNA is introduced into a host cell to artificially induce a genetic change, and “transformant” refers to a host cell into which external DNA is introduced to stably maintain the expression of a target gene.

[0035] The above transformation may be performed by selecting a vector introduction technique suitable for the host cell to express the target gene or a recombinant vector containing it within the host cell. For example, vector introduction may be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene may be included without limitation, whether inserted into the chromosomes of the host cell or located extrachromosomally, as long as it can be expressed within the host cell.

[0036] The above transformant comprises cells that have been transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used interchangeably with recombinant host cells, recombinant cells, or recombinant microorganisms.

[0037] The genes inserted into the recombinant vector for transformation of the present invention can be substituted into host cells, such as microorganisms of the genus Corynebacterium, through homologous recombination crossing.

[0038] According to one embodiment of the present invention, the host cell may be a microorganism of the genus Corynebacterium, for example, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum ( Corynebacterium glutamicum It can be.

[0040] In addition, another aspect of the present invention provides a method for producing L-glutamic acid, comprising the steps of: culturing the mutant microorganism in a medium; and recovering L-glutamic acid from the mutant microorganism or the medium in which the mutant microorganism is cultured.

[0041] The above culture may be carried out according to appropriate media and culture conditions known in the art, and a person skilled in the art can easily adjust and use the media and culture conditions. Specifically, the media may be liquid media, but is not limited thereto. The culture method may include, for example, batch culture, continuous culture, fed-batch culture, or a combination thereof, but is not limited thereto.

[0042] According to one embodiment of the present invention, the medium must satisfy the requirements of a specific strain in an appropriate manner and may be appropriately modified by a person skilled in the art. For culture media for microorganisms of the genus Corynebacterium, reference may be made to the known literature (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but is not limited thereto.

[0043] According to one embodiment of the present invention, the culture medium may contain various carbon sources, nitrogen sources, and trace element components. Carbon sources that may be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These substances may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that may be used include peptone, yeast extract, meat broth, malt extract, corn steep liquid, soybean meal, and urea or inorganic compounds, such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that may be used may include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium-containing salts. Additionally, the culture medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth, but are not limited thereto. Furthermore, essential growth substances such as amino acids and vitamins may be included. In addition, suitable precursors may be used in the culture medium. The medium or individual components may be added to the culture solution in a batch or continuous manner in a manner suitable for the culture process, but are not limited thereto.

[0044] According to one embodiment of the present invention, the pH of the culture medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid to the microbial culture medium in an appropriate manner during cultivation. Additionally, bubble formation can be suppressed by using an antifoaming agent such as a fatty acid polyglycol ester during cultivation. Furthermore, oxygen or an oxygen-containing gas (e.g., air) can be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium can typically be 20 to 45°C, for example, 25 to 40°C. The cultivation period can continue until a desired amount of useful material is obtained, for example, 10 to 160 hours.

[0045] According to one embodiment of the present invention, the step of recovering L-glutamic acid from the cultured microorganism of the genus Corynebacterium and the culture medium in which the microorganism is cultured may involve collecting or recovering L-glutamic acid produced from the medium using a suitable method known in the art according to the culture method. For example, methods such as centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), and chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but are not limited thereto.

[0046] According to one embodiment of the present invention, the step of recovering L-glutamic acid may involve removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.

[0047] According to one embodiment of the present invention, the step of recovering L-glutamic acid may include a process of purifying L-glutamic acid. Effects of the invention

[0048] The mutant microorganism according to the present invention can improve the production yield of L-glutamic acid compared to the parent strain by weakening or inactivating the activity of the RamB protein. Brief explanation of the drawing

[0049] Figure 1 shows the structure of plasmid pK19msb according to one embodiment of the present invention. Specific details for implementing the invention

[0050] The present invention will be described in more detail below. However, this description is provided merely as an example to aid in understanding the invention, and the scope of the invention is not limited by this exemplary description.

[0052] Example 1. RamB gene expression

[0053] To determine the effect of inactivation of the RamB protein on L-glutamic acid production, a vector in which a portion of the said gene was deleted and a strain into which said vector was introduced were constructed.

[0055] 1-1. 재조합 vector

[0056] Genomic DNA of Corynebacterium glutamicum ATCC13869 was used as a template, and PCR was performed using the primer pair of primers 1 and 2 and the primer pair of primers 3 and 4. Two PCR products, approximately 0.5kb and 0.6kb in size, amplified by PCR, were mixed and used as a template, and overlapping PCR was performed using the primer pair of primers 1 and 4 to ligate them into a single fragment. After treating the pK19msb vector (SEQ No. 3) with the restriction enzyme smaI (NEB), the fragment was cloned using T4 ligase. The vector thus constructed was named pK_△ramB.

[0057] For all PCRs, pfu premix (Bioneer) was used, and after denaturation at 95°C for 5 minutes, the reaction was repeated 30 times at 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute, followed by a reaction at 72°C for 5 minutes.

[0058] The primer sequences used for vector construction are as shown in Table 1 below.

[0059] primer கியுக்க்க்கு primer sequence (5'-3') primer 1 4 TGTACGTCCCAGATCGAGG primer 2 5 ACATATGTGGGGCCAGGTACCTGTGGATCTCACGC primer 3 sequence no. 6 GCGTGAGATCCACAGGTACCTGGACCCCACATATGT primer 4 Sequence number 7 CAGCACGTTGAATCTCAAGC

[0061] 1-2. L-glutamic acid-producing strain with RamB protein gene disrupted

[0062] A mutant strain was prepared as follows using the above vector.

[0063] Prepared with a final concentration of pK_△ramB vector of 1 μg / μl or higher and electroporated into Corynebacterium glutamicum U3 (KCCM13218P) (Reference: Tauch et al., FEMS Microbiology letters 123 (1994) 343-347), then immediately added 1 ml of regeneration medium (containing Brain Heart infusion 18.5 g / L and sorbitol 91 g / L) and heat-treated at 46°C for 6 minutes. After treatment, transferred to a 15 ml capped tube, incubated at 30°C for 2 hours, and plated on a screening medium containing kanamycin 20 mg / L (containing tryptone 5 g / L, NaCl 5 g / L, yeast extract 2.5 g / L, Brain Heart infusion powder 18.5 g / L and agar 15 g / L). Colonies produced by incubation at 30℃ for 72 hours were cultured in BHI medium (Brain Heart infusion powder 18.5 g / ℓ) for 15 hours to induce secondary recombination, and 10 -2 ~ 10 -3 The strain was diluted to [value] and plated onto a screening medium containing 10% sucrose to isolate colonies. The isolated colonies were cultured on two types of screening media containing kanamycin and sucrose, respectively, and strains that were free from kanamycin resistance and grew in the sucrose-containing medium were selected. These were named △ramB.

[0065] Experimental Example 1. Evaluation of L-glutamic acid production capacity of RamB protein with disrupted gene

[0066] The L-glutamic acid production capacity of the parent strain Corynebacterium glutamicum U3 and the RamB protein disruption mutant strain △ramB produced in Example 1 was compared.

[0067] Each strain (parent strain or mutant strain) was inoculated at a volume of 1% into a 100 mL flask containing 10 mL of the glutamic acid production medium shown in Table 2 below, and the mixture was cultured with shaking at 30°C, 200 rpm, for 48 hours. After the culture was completed, the concentration of L-glutamic acid in the medium was measured using HPLC (Agilent), and the results are shown in Table 3 below.

[0068] ingredient Content Glucose 70 g / L (NH4)2SO4 5 g / L MgSO4 0.4 g / L Urea 2 g / L Soybean hydrolysate 15 ml / L KH2PO4 1 g / L FeSO4 10 mg / L MnSO4 10 mg / L Thiamine_HCl 200 ug / L Biotin 2 ug / L CaCO3 5%

[0069] strain L-glutamic acid production (g / L) L-glutamic acid concentration increase rate (%) U3 16.0 - β 18.3 14.4

[0071] As shown in Table 3 above, it was confirmed that the production of L-glutamic acid increased by about 14.4% compared to the parent strain U3 by disrupting the gene encoding the RamB protein.

[0073] The present invention has been described above with reference to its preferred embodiments. Those skilled in the art will understand that the present invention may be embodied in modified forms without departing from the essential characteristics of the invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the invention is defined by the claims, not by the foregoing description, and all variations within the scope of the claims should be interpreted as being included in the invention.

[0074] Depository Name: Korean Culture Collection Center (KCCM) Trustee Number: KCCM13218P Date of Deposit: 2022-06-29

Claims

Claim 1 Corynebacterium glutamicum mutant strain with enhanced L-glutamic acid production capacity and weakened or inactivated RamB protein activity in Corynebacterium glutamicum U3 (KCCM13218P). Claim 2 In claim 1, the weakening of the activity of the RamB protein is a variant in which all or part of the gene encoding the RamB protein is inserted, substituted, deleted, or a combination thereof. Claim 3 A variant of claim 2, wherein the gene encoding the RamB protein comprises the nucleotide sequence of SEQ ID NO.

1. Claim 4 delete Claim 5 A method for producing L-glutamic acid comprising the steps of: culturing the mutant strain of claim 1 in a culture medium; and recovering L-glutamic acid from the mutant strain or the culture medium in which the mutant strain is cultured.

Images