Variant of polynucleotide and a method for producing L-valine using the same
Patent Information
- Application Number
- KR1020240140452
- Authority / Receiving Office
- KR · KR
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2024-05-14
- Filing Date
- 2024-10-15
- Publication Date
- 2026-08-14
- Estimated Expiration
- 2044-10-15
Smart Images

Figure 1020240140452
Abstract
Description
Technology Field
[0001] The present invention relates to a novel promoter and a method for producing L-valine using the same, and more specifically, to a novel polynucleotide having promoter activity, a vector containing the same, a host cell transformed with said vector, and a method for producing L-valine using said host cell. Background Technology
[0003] Efforts such as genetic manipulation of biosynthetic pathways and / or introduction of external genes have been continuously made to produce target substances, such as amino acids or useful substances, at high titers using microorganisms for various uses including feed, pharmaceuticals, and food. One such method involves inducing the overexpression of a target gene in microorganisms, which requires a high-efficiency gene expression system. Since the promoter is one of the factors significantly involved in the degree and regulation of gene expression, the development of a useful promoter is essential for developing an expression system.
[0004] Microorganisms of the genus Corynebacterium are producers of amino acids, including L-valine; however, unlike other industrial microorganisms such as E. coli or Bacillus subtilis, the general structure of promoter sequences for gene expression in these microorganisms is not known. Therefore, promoters have been developed by removing the promoter portion of antibiotic resistance genes, such as chloramphenicol, cutting chromosomal DNA isolated from Corynebacterium microorganisms with appropriate restriction enzymes, introducing it into the space, and then measuring the antibiotic resistance of strains obtained by transforming Corynebacterium microorganisms with this modified DNA. Furthermore, various promoter searches have been conducted to overexpress foreign genes in Bacillus microorganisms, and the production of enzymes for food, pharmaceutical, and other industries utilizing these findings is currently underway. Many vector systems using expression promoters of alpha-amylase, protease, and lipase genes from various Bacillus species are still being developed (Schumann 2007. Adv. Appl. Microbiol. 153:813-821).
[0005] With the increasing demand for L-valine, there is a need to overexpress L-valine-related genes in microorganisms of the genus Corynebacterium, and there is still a need to develop powerful promoters. Prior art literature
[0007] (Patent Document 0001) US 8465962 B2 The problem to be solved
[0008] One aspect of the present disclosure provides a novel polynucleotide.
[0009] Another aspect of the present disclosure provides an expression cassette comprising the polynucleotide; and a target gene.
[0010] Another aspect of the present disclosure provides a microorganism comprising the polynucleotide; or the polynucleotide and a target gene operably linked thereto.
[0011] Another aspect of the present disclosure provides a method for producing L-valine comprising the step of culturing the microorganism in a medium. means of solving the problem
[0013] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this disclosure may also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this disclosure fall within the scope of this disclosure. Furthermore, the scope of this disclosure is not to be limited by the specific descriptions provided below. Additionally, a person skilled in the art can recognize or identify numerous equivalents to the specific aspects of this disclosure described herein using only ordinary experiments. Moreover, such equivalents are intended to be included in this disclosure.
[0015] In addition, numerous papers and patent documents are referenced and cited throughout this disclosure. The disclosures of the cited papers and patent documents are incorporated by reference into this disclosure in their entirety to more clearly explain the state of the art to which this disclosure pertains and the content of this disclosure.
[0017] One aspect of the present disclosure provides a polynucleotide comprising a nucleotide sequence in which the nucleotide at the 130th position in the nucleotide sequence of SEQ ID NO. 138 is substituted with a nucleotide different from the original, a nucleotide sequence in which the nucleotide at the 71st position in the nucleotide sequence of SEQ ID NO. 139 is substituted with a nucleotide different from the original, or a nucleotide sequence in which the nucleotide at the 150th position in the nucleotide sequence of SEQ ID NO. 140 is substituted with a nucleotide different from the original.
[0018] In the present disclosure, the nucleotide sequences of SEQ ID NO. 138, SEQ ID NO. 139, or SEQ ID NO. 140 can be verified in the known database NCBI Genbank, and the sequences of SEQ ID NO. 138, SEQ ID NO. 139, or SEQ ID NO. 140 are each Corynebacterium ( Corynebacterium It may be of sp.) origin, specifically Corynebacterium glutamicum ( Corynebacterium glutamicumIt may be a sequence derived from ). The nucleotide sequence of SEQ ID NO. 138, SEQ ID NO. 139, or SEQ ID NO. 140 may be an example sequence for specifying a mutation site to be introduced for the preparation of the polynucleotide of the present disclosure, and it is obvious that the mutation introduced into the polynucleotide of the present disclosure may be introduced into any sequence functionally corresponding to the nucleotide sequence of SEQ ID NO. 138, SEQ ID NO. 139, or SEQ ID NO. 140. In one example, the functionally corresponding sequence may be a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with the sequence of SEQ ID NO. 138, SEQ ID NO. 139, or SEQ ID NO. 140, or a sequence having said homology or identity with some sequences added, deleted, or modified, but is not limited thereto. In one example according to this, the polynucleotide of the present disclosure may be composed of a nucleotide sequence in which the nucleotide at the 130th position in the nucleotide sequence of SEQ ID NO. 138 is substituted with a nucleotide different from the original, the nucleotide at the 71st position in the nucleotide sequence of SEQ ID NO. 139 is substituted with a nucleotide different from the original, or the nucleotide at the 150th position in the nucleotide sequence of SEQ ID NO. 140 is substituted with a nucleotide different from the original, and which has at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with the sequence of SEQ ID NO. 138, SEQ ID NO. 139, or SEQ ID NO. 140, or which has said homology or identity and some of the sequences are added, deleted, or modified.
[0019] In the present disclosure, the nucleotide sequence of SEQ ID NO. 138 may be the promoter sequence of a gene (gene CEY17_07095) encoding an IclR family transcriptional regulator or a part of said promoter sequence.
[0020] The above IclR family transcriptional regulators are transcriptional regulators primarily involved in the regulation of carbon metabolism, and play a role in regulating the expression of genes related to the glyoxylate cycle.
[0021] In one embodiment, the nucleotide at the 130th position in the nucleotide sequence of SEQ ID NO. 138 may be cytosine (C), but is not limited thereto.
[0022] In one embodiment, the polynucleotide may be one in which the nucleotide at the 130th position in the nucleotide sequence of SEQ ID NO. 138 is substituted with adenine (A), guanine (G), or thymine (T), and more specifically, may be substituted with thymine (T), but is not limited thereto.
[0023] In the present disclosure, the nucleotide sequence of SEQ ID NO. 139 may be the promoter sequence of a gene (CEY17_14380 gene) encoding a tricarboxylic transporter or a part of said promoter sequence.
[0024] The aforementioned tricarboxylic transporter is a protein responsible for the transport of tricarboxylic acids, such as citrate; it is located on the cell membrane and brings tricarboxylic acids from outside the cell into the cell so that they can be used in metabolic pathways.
[0025] In one embodiment, the nucleotide at the 71st position in the nucleotide sequence of SEQ ID NO. 139 may be guanine (G), but is not limited thereto.
[0026] In one embodiment, the polynucleotide may be one in which the nucleotide at the 71st position in the nucleotide sequence of SEQ ID NO. 139 is substituted with adenine (A), cytosine (C), or thymine (T), and more specifically, may be substituted with adenine (A), but is not limited thereto.
[0027] In the present disclosure, the nucleotide sequence of SEQ ID NO. 140 may be the promoter sequence of the CEY17_06565 gene or a part of said promoter sequence.
[0028] In one embodiment, the nucleotide at the 150th position in the nucleotide sequence of SEQ ID NO. 140 may be guanine (G), but is not limited thereto.
[0029] In one embodiment, the polynucleotide may be one in which the nucleotide at the 150th position in the nucleotide sequence of SEQ ID NO. 140 is substituted with adenine (A), cytosine (C), or thymine (T), and more specifically, may be substituted with adenine (A), but is not limited thereto.
[0030] In the present disclosure, the polynucleotide may comprise the nucleotide sequence of SEQ ID NO. 18, SEQ ID NO. 20, or 25. In another embodiment, the polynucleotide of the present disclosure may essentially consist of the nucleotide sequence of SEQ ID NO. 18, SEQ ID NO. 20, or 25. In yet another embodiment, the polynucleotide of the present disclosure may consist of the nucleotide sequence of SEQ ID NO. 18, SEQ ID NO. 20, or 25.
[0031] In the present disclosure, the term “polynucleotide” comprises two or more, five or more, ten or more, thirteen or more, twenty or more, or thirty or more nucleotide monomers, wherein the nucleotide monomers may be covalently bonded to form a chain.
[0032] The polynucleotide of the present disclosure may have promoter activity and may be used as a general-purpose promoter.
[0033] In one embodiment, the polynucleotide may have promoter activity for the expression of a target gene in microorganisms of the genus Corynebacterium.
[0034] The polynucleotide having the above-mentioned promoter activity may be interchangeably used with "variant promoter" in the present disclosure.
[0035] The polynucleotide of the present disclosure according to one embodiment can be utilized as a synthetic promoter having strong expression-inducing activity.
[0036] In the present disclosure, the term “promoter” may refer to a DNA region that includes a binding site for polymerase and initiates the transcription of a downstream target DNA. The promoter may be located upstream of the transcription initiation site. The promoter may be operably and / or regulated (enhanced or weakened) to the upstream of the target DNA. For example, the promoter may be connected in a forward direction upstream of the target gene to enhance (increase) the expression of the gene, or connected in a reverse direction downstream of the target gene to weaken (decrease) the expression of the gene. When the promoter is introduced in a reverse direction downstream of the target gene, for example, below a stop codon, preferably between the stop codon and the top of a transcription terminator, it may induce transcription in a direction opposite to the normal transcription direction of the gene, thereby causing the RNA polymerase complex to collide with the RNA polymerase complex in the normal direction during the transcription process, thereby weakening the expression of the gene.
[0037] The above polymerase may refer to an enzyme that synthesizes primary transcript RNA from DNA, also called RNA polymerase or DNA-dependent RNA polymerase. The above polymerase may be a prokaryotic RNA polymerase or a eukaryotic RNA polymerase (e.g., RNA polymerase I, RNA polymerase II, RNA polymerase III, RNA polymerase IV, or RNA polymerase V, etc.). The above polynucleotide according to one embodiment may be natural or non-natural, and may be, for example, a non-natural one that is chemically or recombinantly synthesized.
[0038] In this disclosure, the term “variation” refers to a genetically or non-genetically stable phenotypic change and may be used interchangeably with “mutation” in this disclosure.
[0039] The polynucleotide of the present disclosure (variant promoter) may have altered (increased or decreased) promoter activity compared to a polynucleotide that does not contain the mutation (wild type or pre-mutation polynucleotide). The polynucleotide may regulate (increase or decrease) the expression of a target gene operably linked thereto or the expression or activity of a protein encoded by said target gene, and furthermore may regulate the expression of other genes other than the target gene.
[0040] The above "target gene" refers to a gene whose expression is to be regulated by the polynucleotide of the present disclosure, and in the case of a gene encoding a protein, it may be used interchangeably with "gene encoding a target protein." A protein encoded by the above target gene may be expressed as "target protein," and a gene encoding the above "target protein" may be expressed as "target gene."
[0041] The amino acid coding sequence of the above-mentioned target gene may be varied within a range that does not alter the protein sequence encoded by the target gene, due to codon degeneracy or by considering the codon usage frequency preferred by the organism intended to express the target gene.
[0042] The polynucleotide of the present disclosure may have an activity that increases the host cell's ability to produce a target substance (amount), for example, the ability to produce amino acids (amount), when introduced into a suitable host cell together with an operably linked target gene.
[0043] In one embodiment, the polynucleotide may be for increasing the production capacity (production amount) of amino acids, and specifically, may be for increasing the production capacity (production amount) of L-valine.
[0044] In addition, the nucleotide sequence of the above polynucleotide may be further modified by conventionally known mutagenesis methods, such as direct evolution and site-directed mutagenesis, to the extent that it maintains the corresponding biological activity (promoter activity) and / or the desired activity (e.g., activity to increase the production of the target substance in host cells).
[0045] Accordingly, the polynucleotide of the present disclosure may be composed of a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with the nucleotide sequence of SEQ ID NO. 18, the nucleotide sequence of SEQ ID NO. 20, or the nucleotide sequence of SEQ ID NO. 25, or may be composed of a sequence having said homology or identity in which some sequences are added, deleted, or modified.
[0046] In this disclosure, the terms 'homology' or 'identity' refer to the degree of similarity between two given amino acid sequences or nucleotide sequences and may be expressed as a percentage. The terms homology and identity may often be used interchangeably.
[0047] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard arrangement algorithms, and a default gap penalty established by the program used may be utilized. Practically, homologous or identical sequences can generally be hybridized with the entire sequence or a part thereof under moderate or high stringent conditions. It is evident that hybridization also includes hybridization with polynucleotides containing common codons or codons that account for codon degeneracy.
[0048] Whether any two polynucleotide or polypeptide sequences have homology or identity can be determined using a known computer algorithm, such as the “FASTA” program, using default parameters as in, for example, Pearson et al (1988) [Proc.Natl. Acad. Sci. USA 85]: 2444. Alternatively, it can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Homology or identity can be determined, for example, using BLAST from the National Biotechnology Information Database Center or ClustalW.
[0049] The homology or identity of polynucleotides or polypeptides can be determined by comparing sequence information using a GAP computer program, such as that described in, for example, Smith and Waterman, Adv. Appl. Math (1981) 2:482, or Needleman et al. (1970), J Mol Biol. 48:443. In summary, a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). The default parameters for a GAP program are (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), or Gribskov et al. (1986) Nucl. Acids Res. 14: A weighted comparison matrix of 6745 (or an EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.
[0050] In one example, a polynucleotide comprising a specific nucleotide sequence provided in the present disclosure may be interpreted to comprise a polynucleotide fragment comprising not only the specific nucleotide sequence or a substantially equivalent nucleotide sequence, but also a nucleotide sequence complementary to the specific nucleotide sequence. Specifically, a polynucleotide having such complementarity can be identified under the conditions described below: such conditions are specifically described in the known literature. For example, conditions in which genes with high complementarity of 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98% or more, 99.5% or more, or 99.9% or more hybridize with each other, and genes with lower complementarity do not hybridize with each other, or the washing conditions of conventional Southern hybridization, such as 60°C, 1x SSC (saline-sodium citrate buffer), and 0.1% (w / v) SDS (Sodium Dodecyl Sulfate); 60°C, 0.1x SSC, and 0.1% SDS; Alternatively, conditions for washing once, specifically two to three times, at a salt concentration and temperature equivalent to 68°C, 0.1x SSC, and 0.1% SDS may be listed, but are not limited thereto. Hybridization requires that two nucleotides have complementary sequences; however, depending on the degree of hybridization, some base mismatches may be permitted. The term "complementary" may be used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in the case of DNA, adenosine is complementary to thymine, and cytosine is complementary to guanine. The degree of hybridization between polynucleotides depends on the length and degree of complementarity of the polynucleotides, which is well known in the relevant art (Sambrook et al., supra, 9.50-9.See 51, 11.7-11.8).
[0051] Furthermore, the polynucleotide of the present disclosure may be operably linked to a gene encoding a target protein, i.e., a target gene.
[0052] In this disclosure, the term “operatively linked” means that a polynucleotide having the promoter activity of this disclosure is functionally linked to said gene sequence to initiate and mediate the transcription of the target gene. The operatively linked may be produced using gene recombination techniques known in the art, and site-specific DNA cleavage and linkage may be produced using cleavage and linkage enzymes of the art, but is not limited thereto.
[0053] When the above polynucleotide is operably linked to a target gene, some nucleotides may be added, deleted, and / or mutated for the use of the above cleavage and linkage enzymes, etc.
[0055] In one embodiment, the target gene may be a gene encoding a protein involved in the production of L-valine according to the present disclosure, but is not limited thereto. The protein involved in the production of L-valine may be selected from the group consisting of proteins involved in at least one process or step of the intracellular production pathway of L-valine (e.g., biosynthesis, metabolism, bioconversion, etc.), intracellular transport, and / or extracellular efflux pathway, such as enzymes (various synthetases, degradases, kinases, carboxylases (e.g., pyruvate carboxylase, etc.), reductases, oxidases, decarboxylases, dehydrogenases, dehydrases, transferases, epimerases, etc.), intermediates, transport proteins, membrane proteins (channels, etc.), but is not limited thereto.
[0056] In one embodiment, the target gene may be the CEY17_07095 gene, but is not limited thereto. The CEY17_07095 gene may be a gene encoding an IclR family transcriptional regulator.
[0057] In one embodiment, the target gene may be the CEY17_14380 gene, but is not limited thereto. The CEY17_14380 gene may be a gene encoding a tricarboxylic transporter.
[0058] In one embodiment, the target gene may be the CEY17_06565 gene, but is not limited thereto.
[0060] Another aspect of the present disclosure provides an expression cassette comprising the polynucleotide of the present disclosure and a target gene.
[0061] The above polynucleotide and target gene are as described above.
[0062] In this disclosure, the term “expression cassette” refers to a unit cassette capable of expressing a target gene downstream of the promoter, comprising a promoter and a target gene operably linked thereto. Various factors capable of facilitating the efficient expression of the target gene may be included inside or outside such a gene expression cassette. In addition to a promoter typically operably linked to the target gene, the gene expression cassette may include, but is not limited to, a transcription termination signal, a ribosome binding site, and a translation termination signal.
[0064] Another aspect of the present disclosure provides a vector comprising the polynucleotide of the present disclosure; said polynucleotide and a target gene operably linked thereto; or said expression cassette.
[0065] The above polynucleotide, target gene, and expression cassette are as described above. The vector may include a target gene operably linked to the above polynucleotide.
[0066] In the present disclosure, the term “vector” means a DNA product containing a sequence of a polynucleotide encoding said target protein, which is operably linked to a suitable regulatory sequence to enable the expression of said target protein within a suitable host. The regulatory sequence may include a promoter capable of initiating transcription, any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and / or a sequence regulating the termination of transcription and / or translation. After being transformed into a suitable host cell, the vector may be expressed independently of the host cell’s genome or incorporated into the host cell’s genome.
[0067] The vectors available for use in the present disclosure are not particularly limited as long as they are capable of replicating within a host cell, and can be selected from all commonly used vectors. Examples of commonly used vectors include plasmids, cosmids, viruses, bacteriophages, etc., in their natural or recombinant state. For example, as the vectors, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A, etc., can be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors, etc., can be used as plasmid vectors. Specifically, examples include, but are not limited to, vectors such as pDZ, pDC, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pDCM2, and pDC24.
[0068] The vectors available in this disclosure may be expression vectors or insertion vectors into host cell chromosomes. Insertion of the target DNA into the host cell chromosome using the insertion vector may be performed by any method known in the art, for example, homologous recombination or a CRISPR system, but is not limited thereto. The vector may further include a selection marker to determine whether the vector has been transformed or further whether the target DNA has been inserted into the chromosome. The selection marker may be selected from genes that confer selectable phenotypes, such as drug resistance, nutritional requirements, resistance to cytotoxic agents, or the expression of surface proteins. Since only cells expressing the selection marker survive or exhibit other phenotypes in an environment treated with a selective agent, the transformed cells can be selected.
[0069] In the present disclosure, the term “transformation” means introducing a target polynucleotide into a host cell. The transformed polynucleotide may be inserted into the chromosomes of the host cell or located outside the chromosomes. Additionally, the polynucleotide may be DNA and / or RNA, and it may be introduced in any form as long as it can be introduced into the host cell and function. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a gene structure containing all the elements necessary for self-expression, or in the form of a vector containing it.
[0070] The above transformation method includes all methods for introducing the target polynucleotide into cells, and depending on the host cell, a suitable standard technique as known in the art may be selected and performed. Examples include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.
[0072] Another aspect of the present disclosure provides a microorganism (host cell) comprising the polynucleotide of the present disclosure, said polynucleotide and a target gene operably linked thereto, or said expression cassette.
[0073] The above polynucleotide, target gene, or expression cassette is as described above.
[0074] The above polynucleotide, the polynucleotide and the target gene operably linked thereto, or the above expression cassette may be introduced into a microorganism by transformation, but is not limited thereto.
[0075] In this disclosure, the term “microorganism” includes all wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification, and also includes microorganisms in which specific mechanisms are weakened or strengthened due to causes such as the insertion of external genes or the enhancement or weakening of the activity of endogenous genes.
[0076] The above microorganism may be a microorganism that naturally expresses a target gene or has the ability to produce a target product, or a microorganism that does not naturally express a target gene or a parent strain that lacks the ability to produce a target product may be endowed with the ability to express a target gene or the ability to produce a target product, but is not limited thereto. In one embodiment, the microorganism may be a microorganism that naturally produces amino acids, specifically L-valine.
[0077] In this disclosure, the term “target product” refers to a biologically active substance intended to be produced or whose production is to be controlled (increased or decreased) using a polynucleotide provided in this disclosure, said polynucleotide and a target gene operably linked thereto, an expression cassette comprising said polynucleotide and said target gene, a vector comprising said polynucleotide and said target gene, and / or a microorganism comprising said polynucleotide, and / or a concept that includes not only the biologically active substance intended to be finally produced but also the target protein that the microorganism can produce. For example, it may refer to the target protein itself encoded by said target gene, and / or any biologically active substance produced involving said target protein.The above biologically active substance refers to any substance produced or derived from an organism (e.g., a cell) or having a specific function in vivo or within a cell, such as, for example, amino acids (glycine, alanine, valine, leucine, isoleucine, threonine, serine, cysteine, glutamine, methionine, aspartic acid, asparagine, glutamic acid, lysine, arginine, histidine, phenylalanine, tyrosine, tryptophan, proline, O-acetylhomoserine, etc.), nucleic acids, vitamins (vitamins A, B (B1, B2, B3, B5, B6, B7, B9, B12, etc.), C, D, E, K, etc.), proteins (the above-mentioned target protein or other proteins, e.g., hormones, growth factors, cytokines, immunoglobulins (antibodies), antigen proteins, receptors, ligands, functional fragments thereof (fragments possessing the target function), fusion proteins formed by the fusion of two or more types, etc.), and sugars. (e.g., monosaccharides, disaccharides, polysaccharides, sugar alcohols, etc.), fatty acids (myristoleic acid, palmitoleic acid, sapienoic acid, oleic acid, elaidic acid, vacsenic acid, linoleic acid, linoleelaidic acid, arachidonic acid, eicosapentaenoic acid (EPA), erucic acid, docosahexaenoic acid (DHA), etc.), organic acids (lactic acid, citric acid, oxalic acid, uric acid, butyric acid, stearic acid, propionic acid, etc.), etc., but are not limited thereto. In addition, if the target protein is involved in producing a substance, the target product may also include, in addition to the above substances, metabolites thereof (polyhydroxyalkanoates (PHA), etc.), precursors thereof, derivatives that maintain their biological activity, etc.
[0078] In one embodiment, a microorganism comprising the polynucleotide of the present disclosure and a target gene operably linked thereto may be a microorganism with increased amino acid production capacity as a target product, specifically a microorganism with increased L-valine production capacity. The microorganism with increased L-valine production capacity may be a microorganism with increased L-valine production capacity compared to a microorganism that does not comprise the polynucleotide of the present disclosure, for example, a microorganism in which the expression of the CEY17_07095 gene, CEY17_14380 gene, or CEY17_06565 gene is regulated by the polynucleotide prior to the introduction of the mutation, but is not limited thereto. The polynucleotide prior to the introduction of the mutation may be a wild-type polynucleotide, specifically composed of the nucleotide sequence of SEQ ID NO. 138, SEQ ID NO. 139, or SEQ ID NO. 140.
[0079] In the present disclosure, "non-mutated microorganism" does not exclude strains containing mutations that may naturally occur in microorganisms, and may refer to wild-type strains or natural-type strains themselves, or strains prior to genetic mutations caused by natural or artificial factors. For example, the non-mutated microorganism may refer to strains prior to or before the introduction of variant polynucleotides into the promoter regions of the CEY17_07095 gene, CEY17_14380 gene, and / or CEY17_06565 gene described in the present disclosure. The term "non-mutated microorganism" may be used interchangeably with "pre-mutation strain," "pre-mutation microorganism," "non-mutated strain," "non-mutated strain," "non-mutated microorganism," or "reference microorganism."
[0080] The microorganisms of the present disclosure may include, without limitation, any microorganism capable of functioning as a promoter upon which the polynucleotide of the present disclosure is introduced.
[0081] In one embodiment, the microorganism is a microorganism of the genus Corynebacterium ( CorynebacteriumIt may be a microorganism of the genus Escherichia or Bacillus, but is not limited to sp.), a microorganism of the genus Escherichia or Bacillus.
[0082] Specifically, the microorganism may be a microorganism of the genus Corynebacterium, and more specifically, Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium stationaryis( Corynebacterium stationis ), Corynebacterium thermoaminogenes ( Corynebacterium thermoaminogenes ), Corynebacterium glutamicum ( Corynebacterium glutamicum ), Brevibacterium flavum( Brevibacterium flavum ), Brevibacterium lactofermentum( Brevibacterium lactofermentum ) and strains produced therefrom may be included, but are not limited thereto. Specifically, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.
[0083] In one embodiment, the microorganism may be Corynebacterium glutamicum in which a mutation has been introduced into the promoter of the CEY17_07095 gene, the CEY17_14380 gene, or the CEY17_06565 gene, but is not limited thereto.
[0084] In one embodiment, the microorganism with increased L-valine production capacity (production amount) of the present disclosure may have an L-valine production capacity (production amount) that is increased by about 0.5% or more, about 2.0% or more, about 3.0% or more, about 3.5% or more, about 3.75% or more, about 4.0% or more, about 4.25% or more, about 4.3% or more, about 4.5% or more, about 4.75% or more, or about 4.8% or more compared to the parent strain before mutation or the non-mutated microorganism (the upper limit is not specifically limited and may be, for example, about 200% or less, about 100% or less, about 50% or less, about 25% or less, or about 10% or less), but is not limited thereto. In another embodiment, the microorganism of the present disclosure with increased L-valine production capacity (production amount) may have an L-valine production capacity (production amount) that is increased by about 1.005 times or more, about 1.02 times or more, about 1.03 times or more, about 1.035 times or more, about 1.0375 times or more, about 1.04 times or more, about 1.0425 times or more, about 1.043 times or more, about 1.045 times or more, about 1.0475 times or more, or about 1.048 times or more (the upper limit is not specifically limited and may be, for example, about 5 times or less, about 2 times or less, about 1.5 times or less, about 1.2 times or less, or about 1.1 times or less), but is not limited thereto.
[0085] The above term “about” refers to a range that includes ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes, but is not limited to, all numerical values within a range equivalent to or similar to the numerical value following the term “about.”
[0087] Another aspect of the present disclosure provides a composition for producing L-valine comprising one or more selected from the group consisting of the polynucleotide of the present disclosure, the polynucleotide and the target gene operably linked thereto, the expression cassette, the vector, and the microorganism. The polynucleotide, the target gene, the expression cassette, the vector, and the microorganism, etc., are as described above.
[0088] In one example, the composition for producing L-valine may additionally include any suitable excipient commonly used in compositions for producing L-valine, and such excipient may be, for example, a preservative, a wetting agent, a dispersant, a suspending agent, a buffer, a stabilizer, or an isotonic agent, but is not limited thereto.
[0090] Another aspect of the present disclosure provides a use for producing L-valine selected from the group consisting of the polynucleotide of the present disclosure, the polynucleotide and the target gene operably linked thereto, the expression cassette, the vector, and the microorganism. The polynucleotide, target gene, expression cassette, vector, and microorganism, etc., are as described above.
[0092] According to another aspect of the present disclosure, a use is provided for using one or more selected from the group consisting of the polynucleotide of the present disclosure, the polynucleotide and the target gene operably linked thereto, the expression cassette, the vector, and the microorganism in the preparation of a composition for producing L-valine. The polynucleotide, target gene, expression cassette, vector, and microorganism, etc., are as described above.
[0094] Another aspect of the present disclosure provides a method for producing a target product, comprising the step of culturing a microorganism in a medium comprising the polynucleotide of the present disclosure, said polynucleotide and a target gene operably linked thereto, said expression cassette or said vector.
[0095] The above polynucleotide, target gene, expression cassette, vector, microorganism, and target product, etc., are as described above.
[0096] In one embodiment, the target product may be an L-amino acid, specifically L-valine.
[0097] The above method may further include a step of recovering a target product from the cultured microorganism, culture, or both thereof after the culture step.
[0098] The term “culture” in this disclosure means growing microorganisms under environmental conditions that are appropriately artificially controlled. The culture process of this disclosure may be carried out according to suitable media and culture conditions known in the art. Such culture process can be easily adjusted and used by those skilled in the art depending on the strain selected. Specifically, the culture may be batch, continuous, and / or fed-batch, but is not limited thereto. Various such methods are disclosed, for example, in “Biochemical Engineering” (James M. Lee, Prentice-Hall International Editions, pp. 138-176, 1991).
[0099] In this disclosure, the term “medium” refers to a substance mixed with nutrients as the main component required to culture the microorganisms of this disclosure, and supplies nutrients and growth factors, including water, which is indispensable for survival and growth. Specifically, any medium and other culture conditions used for culturing the microorganisms of this disclosure may be used without special limitations as long as they are media used for culturing ordinary microorganisms; however, the microorganisms of this disclosure may be cultured under aerobic conditions while controlling the temperature, pH, etc., in a conventional medium containing a suitable carbon source, nitrogen source, phosphorus, inorganic compounds, amino acids, and / or vitamins. Specifically, culture media for microorganisms can be found in literature such as the “Manual of Methods for General Bacteriology” by the American Society for Bacteriology (Washington DC, USA, 1981).
[0100] The culture medium used for cultivation must meet the requirements of a specific strain in an appropriate manner. For example, cultivation may be performed under aerobic conditions in a conventional medium containing suitable carbon sources, nitrogen sources, amino acids, vitamins, etc., while controlling the temperature, pH, etc. In this case, carbon sources include carbohydrates such as glucose, fructose, and sucrose, and amino acids such as glutamic acid and cysteine. Specifically, natural organic nutrient sources such as starch hydrolysates and molasses may be used; preferably, carbohydrates such as glucose, fructose, and sterilized pre-treated molasses (i.e., molasses converted into reducing sugars) may be used, and other appropriate amounts of carbon sources may be used without restriction, but are not limited thereto. As for nitrogen sources, inorganic nitrogen sources such as ammonia; amino acids such as glutamic acid and cysteine; and peptone, meat extract, yeast extract, etc., may be used as organic nitrogen sources. These nitrogen sources may be used individually or in combination, but are not limited thereto. Phosphoric acid, potassium dihydrogen phosphate, or dipotassium hydrogen phosphate, or a corresponding sodium-containing salt may be used as the phosphorus in the above medium, but is not limited thereto. Inorganic compounds may include magnesium sulfate, iron sulfate, manganese sulfate, and calcium chloride, and may also include amino acids, vitamins, and suitable precursors. These media or precursors may be added to the culture in a batch or continuous manner, but are not limited thereto.
[0101] During cultivation, compounds such as potassium hydroxide, ammonia, and phosphoric acid can be added to the culture in an appropriate manner to adjust the pH of the culture. Additionally, during cultivation, antifoaming agents such as fatty acid polyglycol esters can be used to suppress bubble formation. Furthermore, to maintain an aerobic state of the culture, oxygen or an oxygen-containing gas can be injected into the culture. The temperature of the culture is 27°C to 37°C, specifically 30°C to 33°C. The cultivation period may continue until the desired amount of useful substance is obtained, specifically 20 to 160 hours.
[0102] In the present disclosure, the term “culture” refers to a substance comprising a medium in which microorganisms are growing or have completed growth under appropriately artificially controlled environmental conditions. In a narrow sense, the culture does not include the grown microorganisms, but in a broad sense, it may include them. The “culture” may include various target substances released into the medium by the microorganisms during growth, along with the components of the medium composed for culturing microorganisms.
[0103] In the culture of the present disclosure, the culture temperature may be maintained at 20°C to 45°C, specifically 25°C to 40°C, 25°C to 40°C, 25°C to 37°C, 25°C to 35°C, 27°C to 40°C, 27°C to 37°C, 27°C to 35°C, 30°C to 40°C, 30°C to 37°C, or 30°C to 35°C, and may be cultured for about 10 to 160 hours, 20 to 100 hours, 30 to 90 hours, or 50 to 70 hours, but is not limited thereto.
[0104] The target product produced by the culture of the present disclosure may be secreted into the culture medium or remain within the cell.
[0105] The step of recovering the above-mentioned target product may involve collecting the target product using a suitable method known in the art according to the culture method, e.g., batch, continuous, or fed-batch culture methods. For example, various chromatographic methods such as centrifugation, filtration, treatment with a crystallizing protein precipitating agent (salting-out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, and affinity chromatography, HPLC, or a combination thereof may be used, but are not limited thereto, and the target product may be recovered from the culture medium or microorganisms using a suitable method known in the art.
[0106] Additionally, the method for producing the target product of the present disclosure may further include a purification step. The purification may be performed using a suitable method known in the art. In one example, where the method for producing the target product of the present disclosure includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially (or consecutively) regardless of the order, or simultaneously or integrated into a single step, but are not limited thereto.
[0108] Another aspect of the present disclosure provides a method for increasing the production capacity of a target product, comprising the step of culturing a microorganism in a medium comprising the polynucleotide of the present disclosure, said polynucleotide and target gene, or said polynucleotide and target gene expression cassette.
[0109] The above polynucleotide, target gene, expression cassette, and microorganism, etc. are as described above.
[0110] In one embodiment, the target product may be an L-amino acid, specifically L-valine.
[0112] Another aspect of the present disclosure provides a method for producing a microorganism with increased production capacity of a target product, comprising the step of introducing into the microorganism a polynucleotide of the present disclosure, said polynucleotide and a target gene, or an expression cassette comprising said polynucleotide and a target gene.
[0113] The above polynucleotide, target gene, expression cassette, and microorganism, etc. are as described above.
[0114] In one embodiment, the target product may be an L-amino acid, specifically L-valine. Effects of the invention
[0116] The present invention relates to a novel polynucleotide having promoter activity and a method for producing L-valine using the same. Since the microorganism to which the novel polynucleotide of the present invention is introduced has a significantly increased ability to produce L-valine, the novel polynucleotide can be usefully utilized to efficiently produce L-valine. Specific details for implementing the invention
[0118] The present application will be described in more detail below through examples. These examples are intended solely to illustrate the present application more specifically, and it will be obvious to those skilled in the art that the scope of the present application is not limited by these examples according to the gist of the application.
[0120] Examples
[0122] (Throughout this specification, "%" used to indicate the concentration of a particular substance is (weight / weight) % for solid / solid, (weight / volume) % for solid / liquid, and (volume / volume) % for liquid / liquid, unless otherwise noted.)
[0124] Example 1. Selection of mutant strains with increased valine production capacity using an artificial mutation method
[0125] Example 1-1. Random mutagenesis via UV irradiation
[0126] To select mutant strains with increased valine production capacity, the valine-producing strain CJ7V (Biotechnology and Bioprocess Engineering, June 2014, Volume 19, Issue 3, pp 456-467; Korean Patent No. 10-2263091; US 2023-0086419 A1) was plated onto a nutrient medium containing agar and cultured at 30°C for 16 hours. Hundreds of colonies obtained in this way were irradiated with UV (Ultraviolet mutation) at room temperature to induce random mutations on the strain's genome. The composition of the nutrient medium is as follows.
[0127] Nutrient medium (pH 7.2)
[0128] Glucose 10 g, meat extract 5 g, polypeptone 10 g, sodium chloride 2.5 g, yeast extract 5 g, agar 20 g, urea 2 g (based on 1 liter of distilled water)
[0130] Example 1-2. Selection of strains with improved L-valine production capacity
[0131] In order to select a mutant strain with increased valine production capacity compared to the parent strain CJ7V, the CJ7V strain and the mutant strains in which random mutations were induced in Example 1-1 were cultured in the following manner.
[0132] The above strains were each inoculated into a 96-Deep Well Plate-Dome (Bioneer) containing 400 µl of seed medium and cultured in a plate shaking incubator (TAITEC) at 32°C and 1200 rpm for approximately 48 hours. The composition of the seed medium is as follows.
[0133] <Seed medium (pH 7.0)>
[0134] Glucose 50 g, peptone 10 g, yeast extract 10 g, urea 4 g, sodium chloride 2.5 g (based on 1 liter of distilled water)
[0135] The valine concentrations of approximately 3,000 cultured strains were each confirmed by Near-Infrared Spectroscopy (NIR), and the top 6 strains with improved L-valine production ability compared to CJ7V were selected.
[0137] Examples 1-3. Analysis of L-valine production capacity of selected mutant strains
[0138] In order to finally select strains with increased L-valine production ability from the six strains selected in Examples 1-2 above, a reproducibility test was performed in a flask using the following medium.
[0139] First, each strain was subcultured in nutrient medium, then each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of production medium and cultured at 30°C for 72 hours with shaking at 200 rpm. The composition of the nutrient medium and production medium is as follows.
[0140] Nutrient medium (pH 7.2)
[0141] Glucose 10 g, Beef extract 5 g, Polypeptone 10 g, Sodium chloride 2.5 g, Yeast extract 5 g, Agar 20 g, Urea 2 g, (based on 1 liter of distilled water)
[0142] Production Medium (pH 7.0)
[0143] Glucose 100 g, Ammonium sulfate 40 g, Soy protein 2.5 g, Corn Steep Solids 5 g, Urea 3 g, Disodium potassium phosphate 1 g, Magnesium sulfate heptahydrate 0.5 g, Biotin 100 ug, Thiamine-HCl 1 mg, Calcium pantothenate 2 mg, Nicotinamide 3 mg, Calcium carbonate 30 g (based on 1 liter of distilled water)
[0145] After the culture was completed, the concentration of L-valine in the culture medium was analyzed using high-performance liquid chromatography (HPLC), and the L-valine production concentrations of each mutant strain are shown in Table 1 below.
[0147] strain name L-valine (g / L) CJ7V 2.2 CJ7V_mt1 2.21 CJ7V_mt2 2.31 CJ7V_mt3 2.24 CJ7V_mt4 2.19 CJ7V_mt5 2.22 CJ7V_mt6 2.17
[0148] Among the selected mutant strains, the mutant strain CJ7V_mt2, which showed the greatest increase in valine production compared to CJ7V, was finally selected.
[0150] Example 2. Confirmation of variants via Whole-genome sequencing (WGS)
[0151] Whole-genome sequencing (WGS) was performed on the CJ7V_mt2 strain selected in Example 1 above to analyze the sequence, and mutations occurring in the nucleotide sequences within the strain were identified by comparing them with the parent strain, CJ7V. Mutations in the CDS (coding DNA sequence) region, promoter, rRNA, and tRNA were identified, and the respective mutation types and sequences are shown in Tables 2 to 4 below.
[0152] Variation in the CDS region designation Expression protein (regulatory protein) Variant amino acid sequence variant nucleotide sequence CEY17-06240 NAD(P) / FAD-dependent oxidoreductase Sequence No. 1 Sequence No. 2 CEY17_16000 methylhydantoinase Sequence No. 3 Sequence No. 4 CEY17_05275 AAA family ATPase Sequence No. 5 Sequence number 6 CEY17_06935 DUF262 domain-containing protein Sequence number 7 Sequence number 8 CEY17_04835 16S rRNA (cytidine(1402)-2'-O)-methyltransferase Sequence number 9 Sequence number 10 CEY17_06635 co-chaperone YbbN Sequence number 11 Sequence No. 12
[0153] Variation in the promoter region designation regulatory proteins variant nucleotide sequence PCEY17_16100 50S ribosomal protein L34 Sequence No. 13 PCEY17_03290 transporter Sequence No. 14 PCEY17_01650 WhiB family transcriptional regulator Sequence number 15 PCEY17_01655 DUF4177 domain-containing protein Sequence number 16 PCEY17_02820 30S ribosomal protein S12 Sequence number 17 PCEY17_07095 IclR family transcriptional regulator Sequence number 18 PCEY17_15935 nucleotide pyrophosphohydrolase Sequence No. 19 PCEY17_14380 tricarboxylic transporter Sequence number 20 PCEY17_01395 hypothetical protein Sequence number 21 PCEY17_00355 stress protein Sequence number 22 PCEY17_10495 hypothetical protein Sequence number 23 PCEY17_15010 GlsB / YeaQ / YmgE family stress response membrane proteins Sequence No. 24 PCEY17_06565 hypothetical protein Sequence number 25 PCEY17_05270 hypothetical protein Sequence number 26 PCEY17_06260 peptide synthetase Sequence number 27
[0154] Variations in RNA regions (rRNA, tRNA) division designation RNA variant nucleotide sequence rRNA CEY17_12995 23S ribosomal RNA Sequence number 28 rRNA CEY17_15045 23S ribosomal RNA Sequence number 29 rRNA CEY17_00510 16S ribosomal RNA Sequence number 30 tRNA CEY17_12940 tRNA-Ala Sequence No. 31 tRNA CEY17_00330 tRNA-Leu Sequence No. 32
[0155] In the following examples, we intended to identify the effective factors affecting L-valine production capacity by evaluating whether each variation listed in Tables 2 to 4 affects the L-valine production capacity of microorganisms of the genus Corynebacterium.
[0158] Example 3. Preparation of an L-valine producing strain into which a variant polynucleotide was introduced
[0159] Example 3-1. Construction of a recombinant vector for the introduction of variant polynucleotides
[0160] A vector containing the target variant was constructed to introduce each of the variants shown in Tables 2 to 4 above onto the chromosome of CJ7V.
[0161] Specifically, the genomic DNA of the above CJ7V_mt2 strain was extracted using the G-spin Total DNA Extraction Mini Kit (Intron, Cat. No. 17045) according to the protocol provided in the kit, and PCR was performed using the genomic DNA as a template. The polymerase was Solg TM Pfu-X DNA polymerase was used, and the PCR conditions were denaturation at 95°C for 4 minutes; denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 50 seconds, repeated 27 times; and polymerization at 72°C for 5 minutes. The sequences of the primer pairs used in the experiment are shown in Table 5 below.
[0162] Sequence number designation Sequence (5'->3') 33 CEY17-06240*_F tgaattcgagctcggtacccCTCAAGTATGTACCGAAACC 34 CEY17-06240*_R gtcgactctagaggatccccTCCGGGTACAGGTTGTTTGG 35 CEY17_16000*_F tgaattcgagctcggtacccAGACCGACTATGTTCAGAAA 36 CEY17_16000*_R gtcgactctagaggatccccGCGTGCGACTATCTGTTCAT 37 CEY17_05275*_F tgaattcgagctcggtacccTCCATGTGGTCGACCCCGGC 38 CEY17_05275*_R gtcgactctagaggatccccCTCGTAGACAGCTCGCCCAG 39 CEY17_06935*_F tgaattcgagctcggtacccTCAGTCGACGAAACCGGCAA 40 CEY17_06935*_R gtcgactctagaggatccccGGCCATTTCTTCTGCATCAA 41 CEY17_04835*_F tgaattcgagctcggtacccTGGCGCGCATTTGTGGGAAG 42 CEY17_04835*_R gtcgactctagaggatccccGGTGATCTCGCCACGCACCC 43 CEY17_06635*_F tgaattcgagctcggtacccTATTCGTCCGGGACACACTG 44 CEY17_06635*_R gtcgactctagaggatccccCGATATTGTGCCCGAATACT 45 PCEY17_16100*_F tgaattcgagctcggtacccGCGACGCCCTTTCCTCATCA 46 PCEY17_16100*_R gtcgactctagaggatccccAGTTCAATCCACATGTCCAA 47 PCEY17_03290*_F tgaattcgagctcggtacccATGGGGCGGTGGCTTGGTGG 48 PCEY17_03290*_R gtcgactctagaggatccccCAGTGACTTAATAAGCACCC 49 PCEY17_01650*_F tgaattcgagctcggtacccAGAATTCTTCTACAAGAAAA 50 PCEY17_01650*_R gtcgactctagaggatccccAACCTACTCACATTGGATAA 51 PCEY17_01655*_F tgaattcgagctcggtacccGTCATGACGTCTGTGATTCC 52 PCEY17_01655*_R gtcgactctagaggatccccGTAAGCAACGAGGTTCTCAG 53 PCEY17_02820*_F tgaattcgagctcggtacccTTCCATGCTTTGGAGGAGCG 54 PCEY17_02820*_R gtcgactctagaggatccccGTGTTCCTGCAGGTTGTGGC 55 PCEY17_07095*_F tgaattcgagctcggtacccGCGATAAAGCTGAACGGATT 56 PCEY17_07095*_R gtcgactctagaggatccccGGTCGATGTAGAGGAGGTCG 57 PCEY17_15935*_F tgaattcgagctcggtacccCTGCGCAAATCTACCTGTCG 58 PCEY17_15935*_R gtcgactctagaggatccccTGAAATTGTCCCCAGTCGCG 59 PCEY17_14380*_F tgaattcgagctcggtacccCCTGAATATTGTTCACGATC 60 PCEY17_14380*_R gtcgactctagaggatccccCAGAAATTTGGGAGTTTAGT 61 PCEY17_01395*_F tgaattcgagctcggtacccAAGTGCCACACCTGCTCCAC 62 PCEY17_01395*_R gtcgactctagaggatccccAGTACAGCCCCAGAAGTAGC 63 PCEY17_00355*_F tgaattcgagctcggtacccGGCAGCTTTCTTGGGACTGC 64 PCEY17_00355*_R gtcgactctagaggatccccGACCGATACTGGGGCGATGC 65 PCEY17_10495*_F tgaattcgagctcggtacccTGGGGCATAAATTGCGATAC 66 PCEY17_10495*_R gtcgactctagaggatccccGCTGCAAATCGCCAGTGCCT 67 PCEY17_15010*_F tgaattcgagctcggtacccCTATTCCAATTATTCATTGG 68 PCEY17_15010*_R gtcgactctagaggatccccAACAGCAGTGGGATGAAGTA 69 PCEY17_06565*_F tgaattcgagctcggtacccTCTTAACGGCTCTCAGCGTC 70 PCEY17_06565*_R gtcgactctagaggatccccGCTGCCTTGAGGGGTTTCTC 71 PCEY17_05270*_F tgaattcgagctcggtacccAGCCTCCATCACGATCGCAC 72 PCEY17_05270*_R gtcgactctagaggatccccGCCAATCTGTGCGAAGAAGA 73 PCEY17_06260*_F tgaattcgagctcggtacccACCCATGGAGGGGCCGACGC 74 PCEY17_06260*_R gtcgactctagaggatccccCATGATCAATCCATTTCCCC 75 CEY17_12995*_F tgaattcgagctcggtacccAGTATTCTCTACCTGACTAC 76 CEY17_12995*_R gtcgactctagaggatccccGCGTTGATCCGAGGATGTCC 77 CEY17_15045*_F tgaattcgagctcggtacccACACGCTCCCAACGAAAAGT 78 CEY17_15045*_R gtcgactctagaggatccccGCGAAGACAGCCAGGAGGTTG 79 CEY17_00510*_F tgaattcgagctcggtacccTTGTTTTTTGTGGAGAGTTTTG 80 CEY17_00510*_R gtcgactctagaggatccccTCACAGTATTGACTGTGTTG 81 CEY17_12940*_F tgaattcgagctcggtacccATCGGACTCATCACCGCTGA 82 CEY17_12940*_R gtcgactctagaggatccccCGCAACGGCGACAACATCCA 83 CEY17_00330*_F tgaattcgagctcggtacccGTTCCATAAGTGTCTTCTCC 84 CEY17_00330*_R gtcgactctagaggatccccTTCTTCATATTTTCCCCTCG
[0163] Recombinant plasmids were obtained by cloning the above-mentioned mutation-introduced fragment and the pDC24 vector (SEQ No. 137) treated with restriction enzyme smaI using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix), and the vectors containing each mutation-introduced fragment were pDC24-CEY17_06240*; pDC24-CEY17_16000*; pDC24-CEY17_05275*; pDC24-CEY17_06935*; pDC24-CEY17_004835*; pDC24-CEY17_06635*; pDC24-Pn*_CEY17_16100; pDC24-Pn*_CEY17_03290; pDC24-Pn*_CEY1701650; pDC24-Pn*_CEY17_01655; pDC24-Pn*_CEY17_02820; pDC24-Pn*_CEY17_07095; pDC24-Pn*_CEY17_15935; pDC24-Pn*_CEY17_14380; pDC24-Pn*_CEY17_01395; pDC24-Pn*_CEY17_00355; pDC24-Pn*_CEY17_10495; pDC24-Pn*_CEY17_15010; pDC24-Pn*_CEY17_06565; pDC24-Pn*_CEY17_05270; They were named pDC24-Pn*_CEY17_06260; pDC24-CEY17_12995*; pDC24-CEY17_15045*; pDC24-CEY17_00510*; pDC24-CEY17_12940*; and pDC24-CEY17_00300*.
[0165] Example 3-2. Preparation of an L-valine-producing strain with introduced variant polynucleotide
[0166] The vector constructed in Example 3-1 above was transformed into the valine-producing strain CJ7V by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and strains in which the vector was inserted onto the chromosome by recombination of homologous sequences were selected using kanamycin medium. Subsequently, strains into which the variant sequence was introduced were identified by PCR using the primer pairs in Table 6 below on the transformed strains in which secondary recombination was completed, respectively: CJ7V△CEY17_06240::CEY17_06240*; CJ7V△CEY17_16000::CEY17_16000*; CJ7V△CEY17_05275::CEY17_05275*; CJ7V△CEY17_06935::CEY17_06935*; CJ7V△CEY17_04835::CEY17_04835*; CJ7V△CEY17_06635::CEY17_06635*; CJ7V△Pn_CEY17_16100::Pn*_CEY17_16100; CJ7V△Pn_CEY17_03290::Pn*_CEY17_03290; CJ7V△Pn_CEY17_01650::Pn*_CEY17_01650; CJ7V△Pn_CEY17_01655::Pn*_CEY17_01655; CJ7V△Pn_CEY17_02820::Pn*_CEY17_02820; CJ7V△Pn_CEY17_07095::Pn*_CEY17_07095; CJ7V△Pn_CEY17_15935::Pn*_CEY17_15935; CJ7V△Pn_CEY17_14380::Pn*_CEY17_14380; CJ7V△Pn_CEY17_01395::Pn*_CEY17_01395; CJ7V△Pn_CEY17_00355::Pn*_CEY17_00355; CJ7V△Pn_CEY17_10495::Pn*_CEY17_10495; CJ7V△Pn_CEY17_15010::Pn*_CEY17_15010; CJ7V△Pn_CEY17_06565::Pn*_CEY17_06565; CJ7V△Pn_CEY17_05270::Pn*_CEY17_05270; CJ7V△Pn_CEY17_06260::Pn*_CEY17_06260;It was named as CJ7V△CEY17_12995::CEY17_12995*; CJ7V△CEY17_15045::CEY17_15045*; CJ7V△CEY17_00510::CEY17_00510*; CJ7V△CEY17_12940::CEY17_12940*; and CJ7V△CEY17_00300::CEY17_00300*.
[0167] Sequence number designation Sequence (5'->3') 85 CEY17-06240*_CF TATAGGAGGCATTCATGG 86 CEY17-06240*_CR CAATCTGATCATTCTTAG 87 CEY17_16000*_CF GTGTCTTGCTCTTCTGTTG 88 CEY17_16000*_CR TAGGAGTCATGCCGCCTG 89 CEY17_05275*_CF CGCTGGTGATGTGGTCCTG 90 CEY17_05275*_CR TCCAATGAGCTGGCGGAA 91 CEY17_06935*_CF GCGCGCTGTCCGGTGCCC 92 CEY17_06935*_CR ACTCCGGTGTCTTGGGTT 93 CEY17_04835*_CF TTCATCAAAAACTGGGGT 94 CEY17_04835*_CR TTTATGTTCACGGGAGCA 95 CEY17_06635*_CF GTTGCTTTTTCTGTAGCC 96 CEY17_06635*_CR AGGGCCTTTTTGGCGCTG 97 PCEY17_16100*_CF GGAGAGTAGCTCTGGTGA 98 PCEY17_16100*_CR TCCACAATGTTGTCCACA 99 PCEY17_03290*_CF GGAAAAACCACATTTACTC 100 PCEY17_03290*_CR CTTTGAGCAGTTTCGCTC 101 PCEY17_01650*_CF ACTCCAACAATGTCAGCC 102 PCEY17_01650*_CR GCATAAACATGCTGGCAG 103 PCEY17_01655*_CF CCAAAACTGAATTTAATG 104 PCEY17_01655*_CR GCATCCTCAGCGGAAACC 105 PCEY17_02820*_CF CGCCCATAAACGAGACCG 106 PCEY17_02820*_CR GAGCTGGGTAACGAGCTC 107 PCEY17_07095*_CF CGCTCGCCCACGGACTCC 108 PCEY17_07095*_CR TGCAGGCGAACACCGAAC 109 PCEY17_15935*_CF CTAAATCAATGCGCACAC 110 PCEY17_15935*_CR GCCTGCTCGACGGGGTAC 111 PCEY17_14380*_CF TGCCTTCCAACCTTCAAT 112 PCEY17_14380*_CR AGCACACAAGGGAAAAGA 113 PCEY17_01395*_CF CGGCTGATTGTTGTTGTT 114 PCEY17_01395*_CR GGGGATTCTCTTTGGTGG 115 PCEY17_00355*_CF AAGCGATACCCATGATGA 116 PCEY17_00355*_CR GGCCCAAACTACAATGA 117 PCEY17_10495*_CF TTCTGCTTTGTCGGTTGT 118 PCEY17_10495*_CR GGAAAGATCGGTGTAGGT 119 PCEY17_15010*_CF GAAGATCAAACCGCCACC 120 PCEY17_15010*_CR TGCAAAGTGTCCAGTCGT 121 PCEY17_06565*_CF CCGTGCCAGTGATGAAAA 122 PCEY17_06565*_CR ATTGCGAACCAACCATTAG 123 PCEY17_05270*_CF CTTCGGATTCCCACAAAGTC 124 PCEY17_05270*_CR AACATCACGAGACCACGGCG 125 PCEY17_06260*_CF CTGTAAGCCCAGGAGAGAA 126 PCEY17_06260*_CR TGATGAATCTGCTCCGGT 127 CEY17_12995*_CF GCACCGGGCAGGCGTCAGTCC 128 CEY17_12995*_CR GTCGGTGGTGTGTTGTGTGA 129 CEY17_15045*_CF CTCTTAACCTTCCAGCACCG 130 CEY17_15045*_CR CTTAGGTTGAAAACTGAGGG 131 CEY17_00510*_CF GACTGTTGGGCGGGTGTG 132 CEY17_00510*_CR CATAAGGTGATGCAAGCGA 133 CEY17_12940*_CF ACAAGATGGATAACAAGA 134 CEY17_12940*_CR CCACTGAACTTCCTTGAC 135 CEY17_00330*_CF CATAGCCAAACTCAGTATG 136 CEY17_00330*_CR CACCATCACGTGAGGCTC
[0169] Example 4. Evaluation of L-valine production capacity of strains introduced with variant polynucleotides
[0170] To confirm the valine productivity of the recombinant strains produced in Example 3-2 above, a 12-well plate evaluation was conducted in the following manner.
[0171] First, the strain was inoculated into a 2 ml 96-Deep Well Plate containing 0.35 ml of seed medium, sealed with a breathable cover, and cultured at 30°C for 20 hours with shaking at 950 rpm. Then, 0.02 ml of the seed culture was inoculated into a 10 ml 12-Deep Well Plate containing 0.4 ml of production medium, sealed with a breathable cover, and cultured at 30°C for 60 hours with shaking at 950 rpm. The composition of the seed medium and production medium is as follows.
[0172] <Seed medium (pH 7.2)>
[0173] Glucose 50 g, peptone 10 g, yeast extract 10 g, urea 4 g, sodium chloride 2.5 g (based on 1 liter of distilled water)
[0174] Production Medium (pH 7.2)
[0175] Glucose 100 g, Ammonium sulfate 40 g, Soy protein 2.5 g, Corn Steep Solids 5 g, Urea 3 g, Disodium potassium phosphate 1 g, Magnesium sulfate heptahydrate 0.5 g, Biotin 100 µg, Thiamine-HCl 1 mg, Calcium pantothenate 2 mg, Nicotinamide 3 mg, Calcium carbonate 30 g (based on 1 liter of distilled water)
[0176] The above experiment was repeated three times. After the culture was finished, the amount of L-valine produced was measured using high-performance liquid chromatography (HPLC), and the average value of the analysis results is shown in Table 7 below.
[0177] strain name L-valine concentration (g / L) Percentage of concentration relative to parent strain (%) CJ7V 2.10 100.0 CJ7V△CEY17_06240::CEY17_06240* 2.16 102.8 CJ7V△CEY17_16000::CEY17_16000* 2.11 100.6 CJ7V△CEY17_05275::CEY17_05275* 2.12 101.0 CJ7V△CEY17_06935::CEY17_06935* 2.15 102.5 CJ7V△CEY17_04835::CEY17_04835* 2.16 102.9 CJ7V△CEY17_06635::CEY17_06635* 2.11 100.6 CJ7V△Pn_CEY17_16100::Pn*_CEY17_16100 2.07 98.7 CJ7V△Pn_CEY17_03290::Pn*_CEY17_03290 2.10 99.9 CJ7V△Pn_CEY17_01650::Pn*_CEY17_01650 2.15 102.2 CJ7V△Pn_CEY17_01655::Pn*_CEY17_01655 2.12 101.1 CJ7V△Pn_CEY17_02820::Pn*_CEY17_02820 2.11 100.5 CJ7V△Pn_CEY17_07095::Pn*_CEY17_07095 2.20 104.8 CJ7V△Pn_CEY17_15935::Pn*_CEY17_15935 2.12 101.1 CJ7V△Pn_CEY17_14380::Pn*_CEY17_14380 2.18 104.0 CJ7V△Pn_CEY17_01395::Pn*_CEY17_01395 2.17 103.3 CJ7V△Pn_CEY17_00355::Pn*_CEY17_00355 2.04 96.9 CJ7V△Pn_CEY17_10495::Pn*_CEY17_10495 2.13 101.5 CJ7V△Pn_CEY17_15010::Pn*_CEY17_15010 2.14 101.9 CJ7V△Pn_CEY17_06565::Pn*_CEY17_06565 2.19 104.3 CJ7V△Pn_CEY17_05270::Pn*_CEY17_05270 2.16 102.6 CJ7V△Pn_CEY17_06260::Pn*_CEY17_06260 2.11 100.5 CJ7V△CEY17_12995::CEY17_12995* 2.10 100.1 CJ7V△CEY17_15045::CEY17_15045* 2.12 100.7 CJ7V△CEY17_00510::CEY17_00510* 2.10 100.2 CJ7V△CEY17_12940::CEY17_12940* 2.09 99.6 CJ7V△CEY17_00300::CEY17_00300* 2.11 100.2
[0178] As shown in Table 7, it was confirmed that most of the valine-producing strains into which the variant polynucleotide was introduced had valine production capabilities equivalent to or greater than those of the parent strain. In particular, it was confirmed that the L-valine production capabilities of 'CJ7V△Pn_CEY17_07095::Pn*_CEY17_07095', 'CJ7V△Pn_CEY17_14380::Pn*_CEY17_14380', and 'CJ7V△Pn_CEY17_06565::Pn*_CEY17_06565' were each improved by about 4 to 5% compared to the parent strain CJ7V.
[0179] Based on the above test results, it was confirmed that L-valine can be produced more efficiently by introducing a variant of the promoter regulating the expression of the CEY17_07095 gene, and / or a variant of the promoter regulating the expression of the CEY17_14380 gene, and / or a variant of the promoter regulating the expression of the CEY17_06565 gene.
[0180] From the foregoing description, those skilled in the art to which this application pertains will understand that this application may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of this application should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.
Claims
Claim 1 A polynucleotide comprising: a nucleotide sequence in which the nucleotide at the 130th position of the nucleotide sequence of SEQ ID NO. 138 is substituted with thymine (T); a nucleotide sequence in which the nucleotide at the 71st position of the nucleotide sequence of SEQ ID NO. 139 is substituted with adenine (A); or a nucleotide sequence in which the nucleotide at the 150th position of the nucleotide sequence of SEQ ID NO. 140 is substituted with adenine (A). Claim 2 In claim 1, the polynucleotide is a polynucleotide having promoter activity. Claim 3 The polynucleotide according to claim 1, comprising the nucleotide sequence of SEQ ID NO. 18, SEQ ID NO. 20, or SEQ ID NO.
25. Claim 4 An expression cassette comprising the polynucleotide of claim 1 and the target gene. Claim 5 Corynebacterium genus comprising a polynucleotide of any one of claims 1 to 3 or said polynucleotide and a target gene operably linked thereto ( Corynebacterium sp.) Microorganisms. Claim 6 In paragraph 5, the above-mentioned microorganism of the genus Corynebacterium is Corynebacterium glutamicum ( Corynebacterium glutamicum )person, microorganism. Claim 7 A method for producing L-valine comprising the step of culturing the microorganism of claim 5 in a culture medium. Claim 8 A method for producing L-valine according to claim 7, wherein the method further comprises the step of recovering L-valine from a cultured medium or microorganism.
Citation Information
Patent Citations
Novel variant of acetohydroxy acid synthase and method for preparing L-valin using the same
KR1020230134060A
Novel ATP phosphoribosyltransferase variant and a method for producing L-valine using the same
KR102281360B1
Novel transcriptional regulator variant and a method for producing L-valine using the same
KR102306008B1