Diagnostic methods for prognosis of non small cell lung cancer using single nucleotide polymorphism of acadsb

KR103004956B1Active Publication Date: 2026-08-14KYUNGPOOK NAT UNIV IND ACADEMIC COOP FOUND
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
KR1020240068656
Authority / Receiving Office
KR · KR
Patent Type
Patents
Current Assignee / Owner
Filing Date
2024-05-27
Publication Date
2026-08-14
Estimated Expiration
2044-05-27

Smart Images

  • Figure 112024057132974-PAT00003_ABST
    Figure 112024057132974-PAT00003_ABST
Patent Text Reader

Abstract

The present invention relates to a method for diagnosing the prognosis of non-small cell lung cancer using single nucleotide polymorphisms of ACADSB. Through this method, the prognosis of a patient with non-small cell lung cancer can be predicted rapidly and accurately, and the method can be applied to the selection and evaluation of appropriate treatment methods. Furthermore, it can increase the survival rate of non-small cell lung cancer patients through novel targeted therapies for non-small cell lung cancer.
Need to check novelty before this filing date? Find Prior Art

Description

Technology Field

[0001] The present invention relates to a method for diagnosing the prognosis of non-small cell lung cancer using single nucleotide polymorphisms of ACADSB. Background Technology

[0002] According to data from the National Cancer Registry released in 2022, 247,952 new cases of cancer occurred in Korea in 2020, with lung cancer accounting for 11.7% of the total cancer cases, ranking second. Histologically, out of 28,913 total lung cancer cases in 2020, carcinomas accounted for 89.9% and sarcomas for 0.1%; among carcinomas, adenocarcinoma was the most common at 50.6%, followed by squamous cell carcinoma at 19.7% and small cell carcinoma at 10.5%.

[0003] Lung cancer refers to a malignant tumor that develops in the lungs. It can be divided into primary lung cancer, where cancer cells originate within the lung tissue itself, and metastatic lung cancer, where cancer cells originate in other organs and travel to the lungs via blood vessels or lymphatic vessels to proliferate. Primary lung cancer, which originates within the lungs, is classified into non-small cell lung cancer and small cell lung cancer based on the size and shape of the cancer cells. Non-small cell lung cancer accounts for 80–85% of all lung cancers, while small cell lung cancer accounts for 15–25%.

[0004] Non-small cell lung cancer (NSCLC) is classified into squamous cell carcinoma, adenocarcinoma, large cell carcinoma, adenosquamous cell carcinoma, sarcomatoid carcinoma, carcinoid tumor, salivary gland carcinoma, and unclassified carcinoma, and each of these carcinomas is further subdivided according to morphological characteristics such as the shape and arrangement of tumor cells.

[0005] As with other cancers, the treatment of lung cancer varies depending on the stage, the patient's general condition, and the patient's suitability for treatment; it can be broadly divided into local and systemic treatments. Representative local treatments applied in the localized stage without metastasis to other organs include surgical resection and radiation therapy (including proton and neutron therapy). Systemic treatments applied in the stage of systemic metastasis to areas other than the primary site and adjacent lymph nodes are chemotherapy, and targeted and immunotherapy, which are actively used recently, also fall into the same category.

[0006] The ideal treatment for lung cancer is early detection and complete surgical removal; however, early treatment is realistically difficult because more than 50% of patients are diagnosed when the disease has progressed to an advanced stage where surgery is not feasible. Furthermore, regarding cases after the onset of lung cancer—particularly in the case of non-small cell lung cancer—surgery is performed first if the disease has not progressed enough to allow for surgical intervention; however, curative resection is possible in only 30% of cases. The 5-year survival rate, which determines whether a cure is achieved after surgery, varies depending on the stage of the cancer; however, among all patients who underwent curative resection, approximately 37% of squamous cell carcinoma, 27% of adenocarcinoma, and 27% of large cell carcinoma were cured. The majority of these patients die after recurrence due to a more aggressive disease following surgical resection.

[0007] Current clinical diagnostic methods cannot determine the prognosis of early non-small cell lung cancer with sufficient accuracy to order more aggressive treatment regimens for patients at high risk of recurrence.

[0008] Therefore, it is necessary to identify high-risk early non-small cell lung cancer patients who need chemotherapy or generally need re-evaluated treatment, and if the prognosis of non-small cell lung cancer can be assessed so that additional necessary treatment methods can be easily decided, the survival rate of patients can be increased.

[0009] Accordingly, the inventors of the present invention have completed the present invention by researching a method for predicting the prognosis of non-small cell lung cancer patients using single nucleotide polymorphisms of lipid metabolism pathway genes. The problem to be solved

[0010] The present invention is capable of diagnosing and predicting the prognosis of non-small cell lung cancer. ACADSB The purpose is to provide genetic polymorphism biomarkers.

[0011] In addition, the present invention aims to provide a composition for predicting the survival prognosis of a non-small cell lung cancer patient comprising the above marker.

[0012] In addition, the present invention aims to provide a kit for predicting the survival prognosis of a non-small cell lung cancer patient comprising the above marker.

[0013] In addition, the present invention aims to provide a microarray for predicting the survival prognosis of a non-small cell lung cancer patient comprising the above marker.

[0014] In addition, the present invention ACADSB The purpose is to provide a method for predicting the survival prognosis of non-small cell lung cancer patients using genetic polymorphisms. means of solving the problem

[0015] To achieve the above objective, the present invention ACADSB The present invention provides a composition for a marker for the diagnosis and prediction of the prognosis of non-small cell lung cancer comprising the rs12220683G>C single nucleotide polymorphism.

[0016] The above ACADSB The rs12220683G>C single nucleotide polymorphism may be located at the 21st nucleotide in the nucleotide sequence consisting of SEQ ID NO. 1.

[0017] The above ACADSB The rs12220683G>C single nucleotide polymorphism is ACADSB It may regulate the promoter activity of.

[0018] The above non-small cell lung cancer may have been treated using surgical resection.

[0019] In addition, the present invention ACADSB The present invention provides a composition for predicting the survival prognosis of a non-small cell lung cancer patient comprising a preparation capable of detecting rs12220683G>C single nucleotide polymorphism.

[0020] The above preparation is ACADSB It may be a primer or probe capable of amplifying a polynucleotide consisting of 10 to 100 consecutive bases containing a single base polymorphism of rs12220683G>C or a polynucleotide complementary thereof.

[0021] The above ACADSB The rs12220683G>C single nucleotide polymorphism may be located at the 21st nucleotide in the nucleotide sequence consisting of SEQ ID NO. 1.

[0022] The above ACADSB The rs12220683G>C single nucleotide polymorphism may be associated with overall survival (OS).

[0023] In addition, the present invention provides a kit for predicting the survival prognosis of a non-small cell lung cancer patient comprising a composition for a marker for diagnosing and predicting the prognosis of non-small cell lung cancer or a composition for predicting the survival prognosis of a non-small cell lung cancer patient.

[0024] In addition, the present invention provides a microarray for predicting the survival prognosis of a non-small cell lung cancer patient comprising a composition for a marker for diagnosing and predicting the prognosis of non-small cell lung cancer or a composition for predicting the survival prognosis of a non-small cell lung cancer patient.

[0025] In addition, the present invention relates to nucleic acids extracted from a sample. ACADSB A method for providing information for predicting the survival prognosis of a non-small cell lung cancer patient is provided, comprising the step of identifying a single nucleotide polymorphism of rs12220683G>C.

[0026] The above ACADSBIf the genotype of the rs12220683G>C single nucleotide polymorphism is GC or CC, it may be determined as a group with a better survival prognosis compared to the case where the said genotype is GG, and the above ACADSB If the genotype of the rs12220683G>C single nucleotide polymorphism is GG, it may be determined that the group has a poor survival prognosis compared to when the genotype is GC or CC. Effects of the invention

[0027] The technology of the present invention, capable of diagnosing and predicting the prognosis of non-small cell lung cancer, can rapidly and accurately predict the prognosis of a patient diagnosed with non-small cell lung cancer, can be applied to methods for selecting and evaluating appropriate treatment methods, and furthermore, can increase the survival rate of non-small cell lung cancer patients through novel targeted therapies for non-small cell lung cancer. Brief explanation of the drawing

[0028] Fig. 1 is ACADSB Shows the results of the luciferase reporter analysis for rs12220683G>C (a: ACADSB mRNA expression in tumor and non-malignant lung tissues, b: in H1299 lung cancer cell line ACADSB Transcriptional activity depending on the rs12220683G>C allele). Specific details for implementing the invention

[0029] Hereinafter, embodiments and examples of the present invention will be described in detail with reference to the attached drawings so that those skilled in the art can easily implement the present invention. However, the present invention may be embodied in various forms and is not limited to the embodiments and examples described herein.

[0030] Throughout this specification, when a part is described as "comprising" a certain component, this means that, unless specifically stated otherwise, it does not exclude other components but may include additional components.

[0031] The present invention ACADSB The present invention provides a composition for a marker for the diagnosis and prediction of the prognosis of non-small cell lung cancer comprising the rs12220683G>C single nucleotide polymorphism.

[0032] The above ACADSB The rs12220683G>C single nucleotide polymorphism may be located at the 21st nucleotide in the nucleotide sequence consisting of SEQ ID NO. 1, where SEQ ID NO. 1 refers to sequences from 5,451 to 5,500 in the NG_008003.1 (NCBI Reference Sequence) sequence, and the specific nucleotide sequence is as shown in Table 1 below.

[0033] Single nucleotide polymorphism (SNP) NCBI Reference Sequence nucleotide sequence Sequence number ACADSB rs12220683G>C NG_008003.1 TGCGTCCTGAGAGCCACCGA C TCTGGATCTCTGGATCTCTGGATGCATTT Sequence No. 1

[0034] The above ACADSB The rs12220683G>C single nucleotide polymorphism is ACADSB It may regulate the promoter activity of.

[0035] The "ACADSB (acyl-CoA dehydrogenase short / branched chain)" of the present invention is a member of the acyl-CoA dehydrogenase family of enzymes that catalyzes the dehydrogenation of acyl-CoA derivatives in the metabolism of fatty acids or branched-chain amino acids.

[0036] The above ACADSB gene, or its single nucleotide polymorphism, may be located in the H3K4me3 peak region.

[0037] In the present invention, "single nucleotide polymorphism (SNP)" refers to diversity in DNA sequences that occurs when a single nucleotide (A, T, C, or G) in the genome differs between members of a species or between pairs of chromosomes of an individual. For example, when a difference in a single nucleotide is involved, such as in three DNA fragments from different individuals (e.g., AAGT[A / A]AG, AAGT[A / G]AG, AAGT[G / G]AG), it is referred to as two alleles (A or G), and generally, almost all SNPs have two alleles. Within a population, an SNP may be assigned a minor allele frequency (MAF; the lowest allele frequency at a specific gene locus found in a particular population). A single nucleotide can be altered (substituted), removed (deleted), or added (inserted) to the polynucleotide sequence. SNPs can cause changes in the translation frame.

[0038] In addition, the present invention ACADSB The present invention provides a composition for predicting the survival prognosis of a non-small cell lung cancer patient comprising a preparation capable of detecting rs12220683G>C single nucleotide polymorphism.

[0039] The above preparation is ACADSB It may be a primer or probe capable of amplifying a polynucleotide consisting of 10 to 100 consecutive bases containing a single base polymorphism of rs12220683G>C or a polynucleotide complementary thereof.

[0040] The above polynucleotide or its complementary polynucleotide may consist of 10 or more, preferably 10 to 100, more preferably 20 to 60, and even more preferably 40 to 60 consecutive bases.

[0041] The above polynucleotide or its complementary polynucleotide is a polymorphic sequence. A polymorphic sequence refers to a sequence containing a polymorphic site that exhibits a single nucleotide polymorphism within a nucleotide sequence. A polymorphic site refers to a site within a polymorphic sequence where a single nucleotide polymorphism occurs. In the present invention, the above polynucleotide may be DNA or RNA.

[0042] The above ACADSB The rs12220683G>C single nucleotide polymorphism of the nucleotide sequence consisting of SEQ ID NO. 1 may have the 21st nucleotide as guanine (G) or cytosine (C).

[0043] The above ACADSB The rs12220683G>C single nucleotide polymorphism may be associated with overall survival (OS).

[0044] In the present invention, ACADSB Since it was confirmed that when the genotype of rs12220683G>C is GC or CC, it shows better overall survival (OS) compared to when it is GG, it can be predicted that when the genotype is GC or CC, the survival prognosis is better compared to when the genotype is GG.

[0045] In addition, the present invention provides a kit for predicting the survival prognosis of a non-small cell lung cancer patient comprising a composition for a marker for diagnosing and predicting the prognosis of non-small cell lung cancer or a composition for predicting the survival prognosis of a non-small cell lung cancer patient.

[0046] The kit of the present invention is a marker for predicting the survival prognosis of non-small cell lung cancer, ACADSBIt can be used to predict the survival prognosis of non-small cell lung cancer by identifying the rs12220683G>C polymorphism site. The kit for predicting the survival prognosis of non-small cell lung cancer according to the present invention may include a polynucleotide, primer, or probe for confirming the polymorphism, as well as one or more other component compositions, solutions, or devices suitable for the analysis method. Additionally, the kit of the present invention may be a kit containing essential elements necessary for performing PCR. In addition to the polynucleotide, primer, or probe specific to the SNP, the PCR kit may include a test tube or other suitable container, a reaction buffer (with varying pH and magnesium concentration), deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, and sterile water.

[0047] In addition, the present invention provides a microarray for predicting the survival prognosis of a non-small cell lung cancer patient comprising a composition for a marker for diagnosing and predicting the prognosis of non-small cell lung cancer or a composition for predicting the survival prognosis of a non-small cell lung cancer patient.

[0048] The microarray of the present invention may be composed of a conventional microarray except that it includes the polynucleotide, primer, or probe of the present invention. Hybridization of nucleic acids on a microarray and detection of hybridization results are well known in the art. Such detection can be achieved, for example, by labeling a nucleic acid sample with a labeling material capable of generating a detectable signal, such as a fluorescent substance, such as Cy3 and Cy5, then hybridizing it on a microarray and detecting the signal generated from the labeling material.

[0049] The above microarray method allows for the simultaneous study of RNA expression in thousands or even tens of thousands of genes within a tumor, enabling more effective comprehensive insights into the molecular basis of human diseases. Additionally, it is possible to evaluate gene expression patterns in tumor classification, clinical outcomes, and responses to chemotherapy.

[0050] In addition, the present invention relates to nucleic acids extracted from a sample. ACADSB A method for providing information for predicting the survival prognosis of a non-small cell lung cancer patient is provided, comprising the step of identifying a single nucleotide polymorphism of rs12220683G>C.

[0051] The above ACADSB If the genotype of the rs12220683G>C single nucleotide polymorphism is GC or CC, it may be determined as a group with a better survival prognosis compared to the case where the said genotype is GG, and the above ACADSB If the genotype of the rs12220683G>C single nucleotide polymorphism is GG, it may be determined that the group has a poor survival prognosis compared to when the genotype is GC or CC.

[0052] In a method for providing information for predicting the survival prognosis of a non-small cell lung cancer patient according to the present invention, the method for confirming the polymorphism is the above ACADSBThe identification of the genotype of the rs12220683G>C polymorphism can be performed by a method of confirming the genotype, and the identification of the genotype can be performed by known methods such as sequencing analysis, sequencing analysis using an automated DNA sequencer, pyrosequencing, hybridization by microarray, PCR-RELP (restriction fragment length polymorphism), PCR-SSCP (single strand conformation polymorphism), PCR-SSO (specific sequence oligonucleotide), ASO (allele specific oligonucleotide) hybridization combining PCR-SSO and dot hybridization, TaqMan-PCR, MALDI-TOF / MS, RCA (rolling circle amplification), HRM (high resolution melting) method, primer extension method, Southern blot hybridization method, dot hybridization method, etc.

[0053] The results of the above SNP polymorphisms can be statistically processed using statistical analysis methods commonly used in the industry, for example, by using variables such as continuous variables, categorical variables, odds ratios, and 95% confidence intervals obtained through Student's t-test, Chi-square test, linear regression line analysis, and multiple logistic regression analysis.

[0054] The above diagnostic and predictive method relates to investigating the expression characteristics of specific markers associated with non-small cell lung cancer, and the method disclosed herein may provide a convenient, efficient, and cost-effective means for obtaining useful data and information when evaluating appropriate or effective therapies for the treatment of non-small cell lung cancer patients.

[0055] The above specimen, i.e., the nucleic acid of a non-small cell lung cancer patient, can be obtained from samples such as tissue, cell, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, or urine obtained from these patients, and the nucleic acid sample includes DNA, mRNA, or cDNA synthesized from mRNA.

[0056] The nucleic acid of the above-mentioned non-small cell lung cancer patient can be obtained by conventional methods and separation methods such as the phenol / chloroform extraction method and the protease K treatment method, and can also be obtained by amplifying the target nucleic acid through PCR and purifying it.

[0057] The diagnostic and predictive method of the present invention can provide information for determining the dosage and method of administration of anticancer drugs necessary to prevent recurrence or metastasis after treatment, such as surgical resection or chemotherapy, for non-small cell lung cancer. That is, from biological samples isolated from non-small cell lung cancer patients ACADSB By identifying the rs12220683G>C single nucleotide polymorphism, the method of administering anticancer drugs, such as the type, amount, and concentration of additional anticancer drugs to be administered, can be applied differently depending on whether the prognosis is poor or not, so as to be suitable for the type of cancer.

[0058] In the present invention, "prognosis" refers to the course of a disease, such as lung cancer, including onset, recurrence, metastatic spread, and the possibility of lung cancer-induced death or progression, including drug resistance, as well as whether a cure is achieved. For the purposes of the present invention, prognosis refers to the risk of developing lung cancer, preferably non-small cell lung cancer, and the survival prognosis after onset.

[0059] In the present invention, "prediction" relates to determining whether a patient is likely to develop lung cancer, preferably non-small cell lung cancer, and whether or not the patient will survive after treatment, e.g., a specific therapeutic agent, and / or surgical removal of the primary tumor, and / or treatment with chemotherapy for a specific period without cancer recurrence, by responding favorably or unfavorably to a treatment such as chemotherapy or radiation therapy.

[0060] The prediction method of the present invention can be clinically used to make treatment decisions by delaying the onset of or preventing the onset of non-small cell lung cancer in any specific patient with a high risk of developing the disease through special and appropriate management, or by selecting the most appropriate treatment method for a patient with non-small cell lung cancer. The prediction method of the present invention can determine whether a patient responds favorably to a treatment prescription, such as the administration of a specific therapeutic agent or combination, surgical intervention, chemotherapy, etc., or predict whether long-term survival of the patient is possible after the treatment prescription.

[0061] In the present invention, "genetic polymorphism" refers to cases where a genetic variation occurs with a frequency of at least 1% in a population. The insertion, deletion, or substitution of a single nucleotide in DNA is called a single nucleotide polymorphism (SNP).

[0062] In the present invention, the term “polymorphism” refers to an arrangement in the sequence of a gene that varies within a population. Polymorphisms consist of different “alleles.” The arrangement of such polymorphisms can be identified by their location in the gene and by different amino acids or bases found therein. These amino acid variations are the result of two possible variant bases, which are two different alleles. Since the genotype consists of two different distinct alleles, any of the various possible variants may be observed in any individual. Each polymorphism is also a designated unique identifier (“reference SNP”, “refSNP”, or “rs#”) that is known to those skilled in the art and is used, for example, in the Single Nucleotide Polymorphism Database (dbSNP) of Nucleotide Sequence Variation available on the NCBI website.

[0063] In the present invention, the term "genotype" refers to a specific allele of a specific gene in a cell or tissue sample.

[0064] In the present invention, "allele" or "allele" refers to one of two or more alternative forms of a gene that occupy the same chromosomal locus.

[0065] In the present invention, "diagnosis" means confirming the existence or characteristics of a pathological state. In particular, the present invention includes predicting the recurrence, progression, metastasis, etc., of non-small cell lung cancer.

[0066] In the present invention, "diagnostic marker" refers to a substance capable of diagnosing non-small cell lung cancer by distinguishing it from normal cells, and includes organic biomolecules such as polypeptides or nucleic acids (e.g., mRNA, etc.), lipids, glycolipids, glycoproteins, sugars (monosaccharides, disaccharides, polysaccharides, etc.) that show an increasing pattern in cells with non-small cell lung cancer compared to normal cells.

[0067] In the present invention, "marker for predicting survival prognosis of non-small cell lung cancer patients" refers to a polymorphic marker capable of predicting the risk of developing non-small cell lung cancer, whether the developed non-small cell lung cancer has been cured, or its course, and preferably refers to the nucleotide described above. Furthermore, the patient refers to a patient for determining the risk of developing non-small cell lung cancer or a patient who has undergone surgical resection, chemotherapy, etc., for non-small cell lung cancer.

[0068] In the present invention, "subject" or "patient" refers to any single individual requiring treatment, including humans, cattle, dogs, guinea pigs, rabbits, chickens, insects, etc. Additionally, any subject participating in a clinical study that does not exhibit any clinical signs of disease, a subject participating in an epidemiological study, or a subject used as a control group is included in the subject.

[0069] In the present invention, “tissue” or “cell sample” means an aggregate of similar cells obtained from the tissue of a subject or patient. Sources of the tissue or cell sample may be fresh, frozen and / or preserved organ or tissue samples or solid tissue from a biopsy or aspirate; blood or any blood component; or cells at any point in the subject’s pregnancy or development. The tissue sample may also be primary or cultured cells or cell lines.

[0070] In the present invention, "nucleic acid" means any DNA or RNA, including, for example, chromosomal, mitochondria, viral, and / or bacterial nucleic acids present in tissue samples. It includes one or both strands of a double-stranded nucleic acid molecule and includes any fragment or part of an intact nucleic acid molecule.

[0071] In the present invention, "gene" means any nucleic acid sequence or part thereof that has a functional role in protein coding or transcription or in the regulation of other gene expression. A gene may consist of all nucleic acids encoding a functional protein or only a part of nucleic acids encoding or expressing a protein. The nucleic acid sequence may include exons, introns, initiation or termination regions, promoter sequences, other regulatory sequences, or genetic abnormalities within a specific sequence adjacent to the gene.

[0072] In the present invention, "primer" refers to an oligonucleotide sequence that hybridizes to a complementary RNA or DNA target polynucleotide and functions as a starting point for the stepwise synthesis of a polynucleotide from a mononucleotide by the action of nucleotidyl transferase, for example, in a polymerase chain reaction.

[0073] In the present invention, "treatment" refers to an approach to obtain beneficial or desirable clinical outcomes. For the purposes of the present invention, beneficial or desirable clinical outcomes include, without limitation, alleviation of symptoms, reduction of disease range, stabilization of the disease state (i.e., not worsening), delay or reduction of the rate of disease progression, improvement or temporary alleviation and reduction of the disease state (partially or wholly), and whether or not detectable. Additionally, "treatment" may mean increasing survival rates compared to the survival rate expected without treatment. Treatment refers to both therapeutic treatments and preventive or preventive measures. Such treatments include treatments required for disorders that have already occurred as well as disorders that are prevented. "Palliating" a disease means reducing the range of the disease state and / or undesirable clinical signs and / or slowing or prolonging the time course of progression compared to the case without treatment.

[0074] The present invention is to be explained in more detail through the following examples, but the following examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

[0076] [Preparation Example] Research Subjects and Methods

[0077] 1. Research Subjects

[0078] This study included a total of 744 patients with non-small cell lung cancer (NSCLC) who underwent surgical resection at Kyungpook National University Hospital (KNUH) from November 1997 to June 2019. Patients who received chemotherapy or radiation therapy before surgery were excluded. They were divided into a discovery cohort (380 patients) and a validation cohort (364 patients).

[0079] This study and its protocol were conducted after receiving approval from the KNUH Institutional Review Board. Written informed consent was obtained from all patients prior to surgery, and genomic DNA was extracted from whole blood samples provided by the National Biobank (KNUH) with support from the Ministry of Health, Welfare and Family Affairs.

[0081] 2. Selection of Genetic Polymorphisms and Genotype Analysis

[0082] SNPs were collected for 76 lipid metabolism-related genes using the public SNP database (http: / / www.ncbi.nlm.nih.gov / SNP), and a total of 2,530 SNPs were collected using the FuncPred utility on the SNPinfo web server (https: / / snpinfo.niehs.nih.gov / ) to select presumed functional SNPs. Based on HapMap JPT data, 2,232 SNPs with low minority allele frequencies (<0.1) were excluded, and the linkage disequilibrium (LD) (r 2 122 SNPs were excluded due to > 0.8. Considering the excluded SNPs, a final total of 176 SNPs were analyzed. Genotypes were analyzed using the Sequenom MassARRAY iPLEX assay (Sequenom Inc., San Diego, CA, USA).

[0084] 3. TCGA Data Analysis

[0085] Lung cancer-related mRNA sequencing data were obtained through The Cancer Genome Atlas (TCGA) and analyzed after normalization using the FPKM, FPKM-UQ, and TPM methods. A total of 48 lung squamous cell carcinomas and 51 lung adenocarcinomas and their corresponding normal tissue samples were included.

[0087] 4. Promoter-Luciferase Composition and Luciferase Analysis

[0088] ACADSBThe rs12220683G>C variant of the gene ACADSBLuciferase reporter assays were used to evaluate the effect on promoter activity. A 602 bp fragment containing rs12220683G>C was synthesized via polymerase chain reaction using human genomic DNA, and forward primers (5′-GGGGTACCAAGCGAGGAGGGGCCTGTTT-3') with a KpnI restriction site and reverse primers (5′CCGCTCGAGATCACTCGGGAAAGGTGCGTTA-3′) with an XhoI restriction site were used. The polymerase chain reaction product was cloned into the KpnI / XhoI sites of the pGL3-basic vector (Promega, Madison, WA, USA) to generate the pGL3-basic-ACADSB construct containing the rs12220683 G or C allele. The construct was verified by direct sequencing prior to use. Transfection was performed using Lipofectamine® 2000 Transfection Reagent (Thermo Fisher Scientific, MA, USA) according to the manufacturer's protocol. NSCLC cell line H1299 was transfected with 500 ng of each plasmid DNA (pGL3-basic, pGL3-ACADSB_G, and pGL3-ACADSB_C for rs12220683) and 40 ng of pRL-SV40 vector (Promega, Madison, WI, USA). Cells were collected 72 hours after transfection. Cells were treated using the Dual-Luciferase Reporter Assay System (Promega) to measure promoter activity. Firefly luciferase and Renilla luciferase signals were measured sequentially using a Synergy HTX Multi-Mode Microplate Reader (BioTek Instruments, Winooski, VT, USA). The results were normalized for Renilla luciferase activity, and all experiments were performed twice each.

[0090] 5. Statistical Analysis

[0091] Differences in genotype distribution according to patients' clinicopathological characteristics are χ 2 Comparisons were made through tests. Overall survival (OS) was defined as the period from the date of surgery to death or the last follow-up, and survival estimates were calculated using the Kaplan-Meier method. Differences in survival rates were compared using log-rank tests, and adjusted hazard ratios (aHR) and 95% confidence intervals (CI) were estimated using a multivariate Cox proportional hazards model, adjusted for age, sex, smoking status, tumor histology, pathological stage, and adjuvant therapy. Statistical analysis was performed using the Statistical Analysis System for Windows, version 9.4 (SAS Institute, Cary, NC, USA) and the Statistical Package for the Social Sciences (SPSS) 25.0 (IBM Corp., Armonk, NY, USA).

[0093] [Example 1] Analysis of Clinical Variables

[0094] The overall survival (OS) of 744 patients according to their clinicopathological characteristics is shown in Table 2 below. The 5-year overall survival rates (5Y-OSR) for the discovery cohort and the validation cohort were 71% and 78%, respectively. Pathologic stage had a significant impact on overall survival (OS), and sex, smoking status, and histological type were also found to be associated with OS. These variables were adjusted for in subsequent analyses to determine the association between polymorphisms and survival outcomes.

[0095]

[0097] [Example 2] Analysis of association between SNP and total survival

[0098] Of the 176 selected SNPs, 20 were found to be associated with overall survival (OS) in the discovery cohort, but in the validation cohort ACADSB Only the SNP of rs10902859G>A was found to be associated with overall survival (OS).

[0099] As shown in Table 3 below, ACADSB rs10902859G>A was found to be associated with overall survival (OS) in non-small cell lung cancer (NSCLC) patients in the discovery, validation, and combined cohorts, and the said gene variant was found to be associated with better survival outcomes (in the dominant model, aHR = 0.56, 95% CI = 0.32-1.00, p = 0.05; aHR = 0.36, 95% CI = 0.15-0.86, p = 0.02; and aHR = 0.48, 95% CI = 0.30-0.77, p = 0.002).

[0100] However, in the UCSC Genome Browser ACADSB rs10902859G>A is ACADSB It was found that there was no possibility of affecting promoter activity, suggesting that the association with overall survival (OS) observed in rs10902859G>A may be due to different functional SNPs in the linkage disequilibrium (LD) relationship with rs10902859G>A. Despite rs10902859G>A being tagged, the other two SNPs were found to have a strong linkage disequilibrium relationship with rs10902859G>A (D' and r 2 > 0.9). Among them, rs12220683G>C has a strong disproportionate association with rs10902859G>A (D' = 1.0 and r2 = 0.94) It was located in the H3K4me3 peak region, which indicates the presence of an active promoter and appears to be highly likely to be a functional SNP.

[0101] also, ACADSB rs12220683G>C was found to be associated with better survival outcomes in non-small cell lung cancer (NSCLC) patients in the discovery, validation, and combined cohorts (in the dominant model, aHR = 0.53, 95% CI = 0.30–0.94, p = 0.03; aHR = 0.37, 95% CI = 0.15–0.89, p = 0.03; and aHR = 0.47, 95% CI = 0.29–0.75, p = 0.002). That is ACADSB When the genotype of rs12220683G>C was GC or CC, it showed better overall survival (OS) compared to when it was GG.

[0102]

[0104] [Example 3] Analysis of the effect of SNPs on promoter activity

[0105] According to the TCGA database ACADSB The mRNA expression level of was found to be significantly lower in tumors compared to normal tissues, and ACADSB rs12220683G>C is ACADSB It was expected to affect promoter activity. Therefore ACADSB Luciferase analysis was performed to determine whether rs12220683G>C is a functional SNP.

[0106] As a result, as shown in Fig. 1, in the H1299 non-small cell lung cancer (NSCLC) cell line ACADSB Promoter activity was found to be significantly increased in the C allele compared to the G allele (p=3x10 -5 ). thus ACADSBrs12220683G>C depends on the rs12220683 genotype ACADSB It was confirmed that it is a functional SNP exhibiting differences in expression, and that it can affect promoter activity.

Claims

Claim 1 ACADSB A composition for a marker for the diagnosis and prediction of the prognosis of non-small cell lung cancer comprising the rs12220683G>C single nucleotide polymorphism of (acyl-CoA dehydrogenase short / branched chain). Claim 2 In paragraph 1, the above ACADSB A composition for a marker for the diagnosis and prediction of the prognosis of non-small cell lung cancer, wherein the rs12220683G>C single nucleotide polymorphism is located at the 21st nucleotide of the nucleotide sequence consisting of SEQ ID NO.

1. Claim 3 In paragraph 1, the above ACADSB The rs12220683G>C single nucleotide polymorphism is ACADSB A composition for a marker for the diagnosis and prediction of the prognosis of non-small cell lung cancer, which regulates the promoter activity of Claim 4 A composition for a marker for the diagnosis and prediction of the prognosis of non-small cell lung cancer according to claim 1, wherein the non-small cell lung cancer is treated using a surgical resection method. Claim 5 ACADSB A composition for predicting the survival prognosis of a non-small cell lung cancer patient comprising a preparation capable of detecting rs12220683G>C single nucleotide polymorphism of (acyl-CoA dehydrogenase short / branched chain). Claim 6 In paragraph 5, the above preparation is ACADSB A composition for predicting the survival prognosis of a non-small cell lung cancer patient, comprising a primer or probe capable of amplifying a polynucleotide consisting of 10 to 100 consecutive bases containing a single nucleotide polymorphism of rs12220683G>C or a polynucleotide complementary thereof. Claim 7 In paragraph 5, the above ACADSB A composition for predicting the survival prognosis of a non-small cell lung cancer patient, wherein the rs12220683G>C single nucleotide polymorphism is located at the 21st nucleotide of the nucleotide sequence consisting of SEQ ID NO.

1. Claim 8 In paragraph 5, the above ACADSB A composition for predicting the survival prognosis of a non-small cell lung cancer patient, wherein the rs12220683G>C single nucleotide polymorphism is associated with overall survival (OS). Claim 9 A kit for predicting the survival prognosis of a non-small cell lung cancer patient comprising a composition according to claim 1 or 5. Claim 10 A microarray for predicting survival prognosis of a non-small cell lung cancer patient comprising a composition according to claim 1 or 5. Claim 11 Regarding nucleic acids extracted from a sample ACADSB A method for providing information for predicting the survival prognosis of a non-small cell lung cancer patient, comprising the step of identifying a single nucleotide polymorphism of rs12220683G>C. Claim 12 In Clause 11, the above ACADSB A method for providing information for predicting the survival prognosis of a non-small cell lung cancer patient, characterized by determining that when the genotype of the rs12220683G>C single nucleotide polymorphism is GC or CC, the group has a better survival prognosis compared to when the genotype is GG. Claim 13 In Clause 11, the above ACADSB A method for providing information for predicting the survival prognosis of a non-small cell lung cancer patient, characterized by determining that when the genotype of the rs12220683G>C single nucleotide polymorphism is GG, the group has a worse survival prognosis compared to when the genotype is GC or CC.

Citation Information

Patent Citations

  • Diagnostic methods for prognosis of non-small-cell lung cancer using foxf2 and heyl SNP

    KR101957009B1

  • GNB2l1 polymorphism marker for predicting survival of patient with lung cancer and method for predicting survival prognosis using same

    KR1020150021862A

  • Diagnostic methods for prognosis of non-small-cell lung cancer using DTX1 SNP

    KR1020180034046A

  • Diagnostic methods for prognosis of non-small-cell lung cancer using ENO1 SNP

    KR1020180107644A