Hyperthermia treatment method for autoimmune hemolytic anemia using anti-FCRN antibodies
Patent Information
- Application Number
- KR1020227016333
- Authority / Receiving Office
- KR · KR
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2019-11-19
- Filing Date
- 2020-11-18
- Publication Date
- 2026-08-14
- Estimated Expiration
- 2040-11-18
Smart Images

Figure 112022051250281-PCT00041_ABST
Abstract
Description
Technology Field
[0001] This disclosure claims the benefit of priority of U.S. Provisional Application No. 62 / 937,395 filed November 19, 2019, the full text of which is incorporated herein by reference.
[0002] The present application comprises a list of sequences submitted electronically in ASCII format, the full text of which is incorporated herein by reference. The said ASCII copy created on November 12, 2020, is named 15193_0005-00304_SL.txt and has a size of 34,226 bytes.
[0003] The present disclosure relates to compositions, uses, and methods of treatment comprising an isolated anti-FcRn antibody or an antigen-binding fragment thereof that binds to the neonatal Fc receptor (FcRn) to prevent, control, or treat hyperthermia autoimmune hemolytic anemia. In certain embodiments, the present disclosure provides a method of treating or preventing hyperthermia autoimmune hemolytic anemia by administering the anti-FcRn antibody or an antigen-binding fragment thereof to a patient in need thereof. In certain embodiments, the present disclosure provides a pharmaceutical composition for the treatment or prevention of hyperthermia autoimmune hemolytic anemia comprising an anti-FcRn antibody or an antigen-binding fragment thereof and at least one pharmaceutically acceptable carrier. Background Technology
[0004] Antibodies are immunological proteins that bind to specific antigens. In most animals, including humans and mice, antibodies consist of paired heavy and light chain polypeptides, with each chain comprising two distinct regions referred to as the variable and constant regions. The heavy and light chain variable regions exhibit significant sequence diversity among antibodies and are responsible for binding to target antigens. The constant region exhibits less sequence diversity and binds to many natural proteins to induce important biochemical events.
[0005] Under normal conditions, the average serum half-life of most IgGs (i.e., IgG1, IgG2, and IgG4, excluding IgG3 isotypes) in humans is about 21 days (Morell et al., J.Clin. Invest. 49(4):673-80, 1970), which is an extended period compared to the serum half-lives of other plasma proteins. In relation to this extended serum half-life of IgG, IgG entering the cell via endocytosis can avoid the degradable lysosomal pathway by binding strongly to the neonatal Fc receptor (FcRn) within the endosome at pH 6.0 (FcRn, a type of Fc gamma receptor, is also referred to as FcRP, FcRB, or Brambel receptor). Once the IgG-FcRn complex circulates to the cell membrane, IgG rapidly detaches from FcRn in the bloodstream at a weakly basic pH (~7.4). Through this receptor-mediated recycling mechanism, FcRn effectively rescues IgG from degradation in lysosomes, thereby extending the half-life of IgG (Roopenian et al., J. Immunol. 170:3528, 2003).
[0006] FcRn has been identified in the intestines of neonatal rats and functions to mediate the absorption of IgG from breast milk and facilitate the transport of IgG into the circulatory system. FcRn is also isolated from the human placenta, where it mediates the absorption and transport of maternal IgG into the fetal circulatory system. In adults, FcRn is expressed in various tissues, including the epithelial tissues of the lungs, intestines, and kidneys, as well as the surfaces of the nasal cavity, vagina, and biliary tree.
[0007] FcRn is a non-covalent heterodimer typically found in the endosomes of endothelial and epithelial cells. FcRn is a membrane-bound receptor possessing three heavy chain alpha domains (α1, α2, and α3) and one soluble light chain β2-microglobulin (β2m) domain. Structurally, it belongs to the family of major histocompatibility complex class 1 molecules, possessing β2m as a common light chain. The FcRn chain has a molecular weight of approximately 46 kDa and contains α1, α2, and α3 heavy chain domains and a β2m light chain domain, consisting of an ectododomain with a single glycosylation, a single-pass transmembrane, and a relatively short cytoplasmic tail.
[0008] To investigate the contribution of FcRn to IgG homeostasis, mice were engineered to "knock out" at least one portion of the gene encoding the β2m and FcRn heavy chains so that the protein is not expressed. In these mice, the serum half-life and concentration of IgG were dramatically reduced, suggesting an FcRn-dependent mechanism for IgG homeostasis. Furthermore, it has been suggested that anti-human FcRn antibodies can be generated in these FcRn knockout mice and that these antibodies can interfere with the binding of IgG to FcRn. Inhibition of IgG binding to FcRn negatively alters the IgG serum half-life by disrupting IgG recycling.
[0009] Autoimmune hemolytic anemia is a rare and heterogeneous disease affecting approximately 1 to 3 people per 100,000 annually (Michel, Expert Rev. Hematol. 4(6):607-18, 2011; Sokol et ak, Br. Med. J.( Clin. Res. Ed.) 282(6281):2023-7, 1981). The pathology of this disease can be caused by increased destruction of normal red blood cells (RBCs) triggered by autoantibodies reacting to RBC antigens, regardless of complement activation (Barcellini, Transfus. Med. Hemother. 42(5):287-93, 2015). Autoimmune hemolytic anemia is classified into three major types—warm autoimmune hemolytic anemia, cold agglutinin syndrome, and paroxysmal cold hemoglobinuria—depending on the optimal temperature at which autoantibodies bind to the patient's red blood cells in vivo. Warm autoimmune hemolytic anemia is the most common type of autoimmune hemolytic anemia, accounting for approximately 70 to 80% of all adult cases and 50% of pediatric cases (Sokol et al., Br. Med. J.(Clin. Res. Ed.) 282(6281):2023-7, 1981).
[0010] In hyperthermia autoimmune hemolytic anemia, autoantibodies react optimally with red blood cells at approximately 37°C. Red blood cells coated with heat-responsive IgG typically bind to splenic macrophages that possess Fcγ receptors for IgG heavy chains, forming microfixed cells that are further destroyed during phagocytosis or as they pass through the next spleen (Kalfa, Hematology Am. Soc. Hematol. Educ. Program 2016(l):690-7, 2016). When high concentrations of IgG or IgG with high affinity for complement bind to red blood cells, complement (C1q) can bind to C3b and become activated. C3b-opsonin-treated red blood cells are phagocytosed by hepatic macrophages carrying C3b receptors, contributing further to the destruction of red blood cells (Barcellini, Transfus. Med. Hemother. 42(5):287-93, 2015; Berentsen, Transfus. Med. Hemother. 42(5):303-10, 2015; LoBuglio et al., Science 158(3808): 1582-5, 1967). Therefore, autoantibodies such as IgG play a role in the pathogenesis of hyperthermia autoimmune hemolytic anemia. means of solving the problem
[0011] In various embodiments, the present disclosure provides a therapeutic method, use, and composition for treating a patient suffering from hyperthermic autoimmune hemolytic anemia. More specifically, in various embodiments, the present disclosure provides a method for treating a patient suffering from hyperthermic autoimmune hemolytic anemia by administering a therapeutically effective amount of an anti-FcRn antibody or its antigen-binding fragment to the patient. In various embodiments, the antibody or antigen-binding fragment is formulated as a pharmaceutical composition. Additionally, the present disclosure provides therapeutic uses of the antibody, antigen-binding fragment, and pharmaceutical composition disclosed herein.
[0012] In various embodiments, treatment using the antibody, antigen-binding fragment, or pharmaceutical composition disclosed herein reduces the level of at least one autoantibody and / or pathogenic antibody (e.g., at least one IgG, e.g., pathogenic IgG (e.g., pathogenic IgG1, IgG2, IgG3, or IgG4), serum IgG1, serum IgG2, serum IgG3, or serum IgG4) in a patient, e.g., a patient suffering from hyperthermic autoimmune hemolytic anemia, and / or a sample of the patient. In various embodiments, treatment using the antibody, antigen-binding fragment, or pharmaceutical composition disclosed herein reduces the level of at least one autoantibody and / or pathogenic antibody (e.g., at least one IgG) in the patient and / or a sample of the patient by at least about 25%, about 35%, about 45%, about 50%, about 60%, about 70%, or about 80% compared to the level of at least one autoantibody and / or pathogenic antibody in the patient and / or sample prior to treatment. In various embodiments, treatment using the antibody, antigen-binding fragment, or pharmaceutical composition disclosed herein reduces the level of at least one IgG in a patient, e.g., a patient suffering from hyperthermic autoimmune hemolytic anemia, and / or a sample of the patient. In various embodiments, one or more IgGs comprise pathogenic IgG (e.g., pathogenic IgG1, IgG2, IgG3, or IgG4). In various embodiments, at least one IgG comprises serum IgG1. In various embodiments, one or more IgGs comprise serum IgG2. In various embodiments, at least one IgG comprises serum IgG3. In various embodiments, at least one IgG comprises serum IgG4.
[0013] In various embodiments, the maximum reduction in the level of one or more autoantibodies and / or pathogenic antibodies (e.g., at least one IgG) occurs about 5 to about 30 days after administration of the antibody, antigen-binding fragment, or pharmaceutical composition. In some embodiments, the maximum reduction in the level of one or more autoantibodies and / or pathogenic antibodies (e.g., one or more IgG) occurs about 8 days after a single dose of the antibody, antigen-binding fragment, or pharmaceutical composition. In some embodiments, a steady state is reached after about 3 to 4 doses of the antibody, antigen-binding fragment, or pharmaceutical composition.
[0014] In various embodiments, treatment using the antibody, antigen-binding fragment, or pharmaceutical composition disclosed herein reduces the level of total serum IgG in a patient, e.g., a patient suffering from hyperthermic autoimmune hemolytic anemia, and / or a sample of the patient. In various embodiments, treatment using the antibody, antigen-binding fragment, or pharmaceutical composition disclosed herein reduces the level of total serum IgG in the patient and / or a sample of the patient by at least about 25%, about 35%, about 45%, about 50%, about 60%, about 70%, or about 80% compared to the total serum IgG level of the patient and / or sample before treatment. In various embodiments, treatment using the antibody, antigen-binding fragment, or pharmaceutical composition disclosed herein reduces the level of total serum IgG in the patient and / or a sample of the patient by at least about 40% (e.g., about 40% to about 50%) after about 1 or 2 weeks of weekly administration compared to the total serum IgG level of the patient and / or sample before treatment. In various embodiments, treatment using the antibody, antigen-binding fragment, or pharmaceutical composition disclosed herein reduces the level of total serum IgG in the patient and / or sample of the patient by at least about 60% (e.g., about 60% to about 70%) after about 3 weeks of weekly administration compared to the total serum IgG level of the patient and / or sample before treatment. In various embodiments, treatment using the antibody, antigen-binding fragment, or pharmaceutical composition disclosed herein reduces the level of total serum IgG in the patient and / or sample of the patient by at least about 70% (e.g., about 70% to about 80%) after about 5 weeks of weekly administration compared to the total serum IgG level of the patient and / or sample before treatment. In various embodiments, the maximum reduction in the total serum IgG level occurs after about 5 to about 30 days after administration of the antibody, antigen-binding fragment, or pharmaceutical composition.In various embodiments, the maximum decrease in total serum IgG levels occurs after about 3 to 5 doses of the antibody, antigen-binding fragment, or pharmaceutical composition (e.g., after about 4 doses).
[0015] In various embodiments, treatment using the antibody, antigen-binding fragment, or pharmaceutical composition disclosed herein increases the hemoglobin level in a patient, e.g., a patient suffering from hyperthermic autoimmune hemolytic anemia, and / or a sample of the patient. In various embodiments, treatment using the antibody, antigen-binding fragment, or pharmaceutical composition disclosed herein increases the hemoglobin level in the patient and / or a sample of the patient by at least about 5%, about 10%, about 15%, or about 20% (e.g., about 5% to about 30%) compared to the hemoglobin level in the patient and / or a sample before treatment. In various embodiments, treatment using the antibody, antigen-binding fragment, or pharmaceutical composition disclosed herein increases the hemoglobin level in the patient and / or a sample of the patient by at least about 10% (e.g., about 10% to about 15%) after about 1 or 2 weeks of weekly administration compared to the hemoglobin level in the patient and / or a sample before treatment. In various embodiments, treatment using the antibody, antigen-binding fragment, or pharmaceutical composition disclosed herein increases the level of hemoglobin in the patient and / or sample of the patient by at least about 20% (e.g., about 20% to about 25%) after about 1 or 2 weeks of weekly administration compared to the hemoglobin level of the patient and / or sample before treatment. In some embodiments, the increase in the hemoglobin level in the patient and / or sample of the patient (e.g., about 10%, about 20%, or more) is maintained for the entire treatment period or for a part thereof. In some embodiments, the increase in the hemoglobin level in the patient and / or sample of the patient (e.g., about 10%, about 20%, or more) is maintained for at least 2, 3, or 4 weeks (e.g., 4 weeks or more). In some embodiments, an increase in hemoglobin levels in the patient and / or sample of the patient (e.g., an increase of about 10%, about 20% or more) is maintained for about 2 to about 6 weeks.
[0016] In various embodiments, the present disclosure provides a treatment method, use, and composition for treating or preventing hyperthermia autoimmune hemolytic anemia.
[0017] In various embodiments, the present disclosure provides a method for treating or preventing hyperthermia autoimmune hemolytic anemia in a patient in need thereof, comprising administering to the patient a pharmaceutical composition comprising at least one pharmaceutically acceptable carrier and a therapeutically effective amount of the anti-FcRn antibody or its antigen-binding fragment; or (ii) administering to the patient a pharmaceutical composition comprising at least one pharmaceutically acceptable carrier and a therapeutically effective amount of the anti-FcRn antibody or its antigen-binding fragment.
[0018] In various embodiments, the present disclosure provides an anti-FcRn antibody or an antigen-binding fragment thereof for use in a method for treating or preventing hyperthermia autoimmune hemolytic anemia in a patient requiring such treatment, the method comprising administering to the patient (i) a therapeutically effective amount of the antibody or antigen-binding fragment, or (ii) a pharmaceutical composition comprising at least one pharmaceutically acceptable carrier and a therapeutically effective amount of the antibody or antigen-binding fragment.
[0019] In various embodiments, the present disclosure provides the use of an anti-FcRn antibody or an antigen-binding fragment thereof in a method for treating or preventing hyperthermia in a patient in need thereof, comprising administering to the patient at least one pharmaceutically acceptable carrier and a pharmaceutical composition comprising a therapeutically effective amount of the antibody or antigen-binding fragment thereof, or (ii) administering to the patient a pharmaceutical composition comprising at least one pharmaceutically acceptable carrier and a therapeutically effective amount of the antibody or antigen-binding fragment thereof.
[0020] In various embodiments, the present disclosure provides the use of an anti-FcRn antibody or its antigen-binding fragment in the manufacture of a medicine for treating or preventing hyperthermia in a patient in need thereof, comprising (i) a therapeutically effective amount of the antibody or its antigen-binding fragment, or (ii) administering to the patient a pharmaceutical composition comprising at least one pharmaceutically acceptable carrier and a therapeutically effective amount of the antibody or its antigen-binding fragment.
[0021] In various embodiments, the present disclosure provides a kit comprising an anti-FcRn antibody or an antigen-binding fragment thereof and instructions for using the antibody or antigen-binding fragment for the treatment or prevention of hyperthermia autoimmune hemolytic anemia in patients requiring it.
[0022] In various embodiments, the present disclosure provides a pharmaceutical composition for use in the treatment or prevention of hyperthermic autoimmune hemolytic anemia in patients requiring it, wherein the pharmaceutical composition comprises at least one pharmaceutically acceptable carrier and an anti-FcRn antibody or an antigen-binding fragment thereof.
[0023] In some embodiments of the therapeutic methods, uses, and compositions disclosed herein (e.g., for the treatment or prevention of hyperthermia autoimmune hemolytic anemia), the antibody or antigen-binding fragment comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 27 (HCDR1), the amino acid sequence of SEQ ID NO: 28 (HCDR2), and the amino acid sequence of SEQ ID NO: 29 (HCDR3); and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 30 (LCDR1), the amino acid sequence of SEQ ID NO: 31 (LCDR2), and the amino acid sequence of SEQ ID NO: 32 (LCDR3). In some embodiments, the antibody or antigen-binding fragment comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 21 (HCDR1), the amino acid sequence of SEQ ID NO: 22 (HCDR2), and the amino acid sequence of SEQ ID NO: 23 (HCDR3); and includes a light chain variable region comprising the amino acid sequence of SEQ ID NO: 24 (LCDR1), the amino acid sequence of SEQ ID NO: 25 (LCDR2), and the amino acid sequence of SEQ ID NO: 26 (LCDR3). In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 170 mg to about 1500 mg. In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 300 mg to about 800 mg. In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 340 mg or about 680 mg. In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 340 mg or about 680 mg administered once a week. In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 340 mg or about 680 mg administered by subcutaneous injection at least once a week. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 340 mg or about 680 mg (e.g., about 680 mg) administered once a week for at least 2 weeks (e.g., 2, 3, 4, 5, 6, 7, 8, 10, 12 weeks or more).In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 340 mg or about 680 mg (e.g., about 680 mg) administered once a week for at least 4 weeks. In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 340 mg or about 680 mg (e.g., about 680 mg) administered once a week for at least 7 weeks. In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 340 mg or about 680 mg (e.g., about 680 mg) administered once a week for at least 12 weeks.
[0024] In various embodiments of the therapeutic methods, uses and compositions disclosed herein, the antibody or antigen-binding fragment is one of the antibody or antigen-binding fragment disclosed in International Application No. PCT / KR2015 / 004424 (Publication No. WO 2015 / 167293 A1), which is incorporated herein by reference.
[0025] In various embodiments of the therapeutic methods, uses, and compositions disclosed herein, the antibody or antigen-binding fragment is
[0026] CDR1 comprising one or more amino acid sequences selected from the group consisting of SEQ ID NOs 21, 24, 27, 30, 33, 36, 39 and 42;
[0027] CDR2 comprising one or more amino acid sequences selected from the group consisting of SEQ ID NOs: 22, 25, 28, 31, 34, 37, 40 and 43; and
[0028] It includes a CDR3 comprising one or more amino acid sequences selected from the group consisting of sequence numbers 23, 26, 29, 32, 35, 38, 41 and 44.
[0029] In various embodiments of the therapeutic methods, uses, and compositions disclosed herein, the antibody or antigen-binding fragment is
[0030] CDR1 comprising an amino acid sequence that is at least 90% identical to one or more amino acid sequences selected from the group consisting of SEQ ID NOs 21, 24, 27, 30, 33, 36, 39 and 42;
[0031] CDR2 comprising an amino acid sequence that is at least 90% identical to one or more amino acid sequences selected from the group consisting of SEQ ID NOs: 22, 25, 28, 31, 34, 37, 40 and 43; and
[0032] It includes a CDR3 having an amino acid sequence that is at least 90% identical to one or more amino acid sequences selected from the group consisting of sequence numbers 23, 26, 29, 32, 35, 38, 41 and 44.
[0033] In various embodiments, the antibody or antigen-binding fragment comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 27 (HCDR1), the amino acid sequence of SEQ ID NO: 28 (HCDR2), and the amino acid sequence of SEQ ID NO: 29 (HCDR3); and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 30 (LCDR1), the amino acid sequence of SEQ ID NO: 31 (LCDR2), and the amino acid sequence of SEQ ID NO: 32 (LCDR3). In various embodiments, the antibody or antigen-binding fragment comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 21 (HCDR1), the amino acid sequence of SEQ ID NO: 22 (HCDR2), and the amino acid sequence of SEQ ID NO: 23 (HCDR3); and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 24 (LCDR1), the amino acid sequence of SEQ ID NO: 25 (LCDR2), and the amino acid sequence of SEQ ID NO: 26 (LCDR3).
[0034] In various embodiments of the therapeutic methods, uses and compositions disclosed herein, the antibody or antigen-binding fragment comprises one or more heavy chain variable regions and one or more light chain variable regions, and the heavy chain variable region and the light chain variable region comprise one or more amino acid sequences selected from the group consisting of the amino acid sequences of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20.
[0035] In various embodiments, the antibody or antigen-binding fragment comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 4 or SEQ ID NO: 6; and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 14 or SEQ ID NO: 16. In various embodiments, the antibody or antigen-binding fragment comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 6; and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 16. In various embodiments, the antibody or antigen-binding fragment comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 4; and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 14. In various embodiments, the antibody or antigen-binding fragment comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 2; and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 12.
[0036] In various embodiments of the therapeutic methods, uses and compositions disclosed herein, the antibody or antigen-binding fragment comprises one or more heavy chain variable regions and one or more light chain variable regions, wherein the heavy chain variable region and the light chain variable region comprise an amino acid sequence that is at least 90% identical to one or more amino acid sequences selected from the group consisting of the amino acid sequences of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20. In various embodiments, the heavy chain variable region and the light chain variable region comprise an amino acid sequence that is at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one or more amino acid sequences selected from the group consisting of the amino acid sequences of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20.
[0037] In various embodiments, the antibody or antigen-binding fragment comprises a heavy chain variable region comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 6; and a light chain variable region comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 16. In various embodiments, the antibody or antigen-binding fragment comprises a heavy chain variable region comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 4; and a light chain variable region comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 14. In various embodiments, the antibody or antigen-binding fragment comprises a heavy chain variable region comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 2; and a light chain variable region comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 12.
[0038] In various embodiments, the antibody or antigen-binding fragment is about 0.01 to about 2 nM K at pH 6.0 or 7.4, as measured, for example, by surface plasmon resonance (SPR). DIt binds to FcRn via (dissociation constant). In various embodiments, K D is measured by surface plasmon resonance (e.g., human FcRn-bound surface plasmon resonance). In various embodiments, K D It is measured by human FcRn-fixed surface plasmon resonance.
[0039] In various embodiments, the antibody or antigen-binding fragment is any one of the antibody or antigen-binding fragment disclosed or included by reference in this specification.
[0040] In various embodiments of the therapeutic methods, uses, and compositions disclosed herein, a patient or a sample of a patient (e.g., a patient suffering from hyperthermic autoimmune hemolytic anemia) has a detectable level of anti-red blood cell IgG (anti-RBC IgG). In some embodiments, the anti-RBC IgG is anti-RBC IgG1. In some embodiments, the anti-RBC IgG is anti-RBC IgG2. In some embodiments, the anti-RBC IgG is anti-RBC IgG3. In some embodiments, the anti-RBC IgG is anti-RBC IgG4.
[0041] In various embodiments of the therapeutic methods, uses, and compositions disclosed herein, the antibody, antigen-binding fragment, or pharmaceutical composition is administered subcutaneously. In various embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered by one or more subcutaneous injections. In various embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered by one or more intravenous injections. In various embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered by one or more subcutaneous injections without prior intravenous administration (e.g., intravenous induction). In various embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is contained in a syringe prior to administration. In various embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered by a single (i.e., one) subcutaneous injection. In various embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered by two or more (e.g., two) consecutive subcutaneous injections. In various embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered at a fixed dose.
[0042] In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once or once a week as a single dose. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week as a single subcutaneous injection. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week as two or more consecutive subcutaneous injections. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week for at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 7 weeks, at least 8 weeks, at least 9 weeks, at least 10 weeks, at least 12 weeks, at least 20 weeks, at least 24 weeks, at least 30 weeks, at least 40 weeks, at least 50 weeks, at least 60 weeks, at least 70 weeks, at least 76 weeks, at least 80 weeks, or for longer. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week for at least 4 weeks. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week for 6 to 76 weeks or any period in between. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week for at least 6 weeks. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week for at least 7 weeks. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week for at least 12 weeks. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week for at least 24 weeks. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week for at least 76 weeks.In various embodiments, an antibody, antigen-binding fragment, or pharmaceutical composition is administered to a patient once a week until sufficient to treat, prevent, reduce the severity, delay the onset, and / or reduce the risk of occurrence of one or more symptoms of hyperthermia autoimmune hemolytic anemia.
[0043] In some embodiments, the patient has hyperthermic autoimmune hemolytic anemia. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week as a single subcutaneous injection for at least 4 weeks (e.g., at a dose of about 340 mg). In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week as a single subcutaneous injection for at least 7 weeks (e.g., at a dose of about 340 mg). In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week as a single subcutaneous injection for at least 12 weeks (e.g., at a dose of about 340 mg). In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week as two or more consecutive subcutaneous injections (e.g., 2 times) for at least 4 weeks (e.g., at a dose of about 680 mg). In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week as a consecutive subcutaneous injection at least twice (e.g., 2 times) for at least 7 weeks (e.g., at a dose of about 680 mg). In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week as a consecutive subcutaneous injection at least twice (e.g., 2 times) for at least 12 weeks (e.g., at a dose of about 680 mg). In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week as a consecutive subcutaneous injection at least once until sufficient to treat, prevent, reduce the severity, delay onset, and / or reduce the risk of occurrence of one or more symptoms of the patient's hyperthermic autoimmune hemolytic anemia. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient at a dose of about 340 mg or about 680 mg.
[0044] In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once every two weeks (every other week). In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once every two weeks as a single subcutaneous injection. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once every two weeks as two or more consecutive subcutaneous injections. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once every two weeks for at least two weeks, at least four weeks, at least six weeks, at least eight weeks, at least ten weeks, at least twelve weeks, at least twenty weeks, at least twenty-four weeks, at least thirty weeks, at least for fourty weeks, at least fifty weeks, at least sixty weeks, at least seventy weeks, at least seventy-six weeks, at least eighty weeks, or for longer. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once every two weeks for 6 to 76 weeks or any period in between. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once every two weeks for at least 6 weeks. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once every two weeks for at least 12 weeks. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once every two weeks for at least 24 weeks. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once every two weeks for at least 76 weeks. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once every two weeks until it is sufficient to treat, prevent, reduce the severity, delay the onset, and / or reduce the risk of occurrence of one or more symptoms of hyperthermia autoimmune hemolytic anemia.
[0045] In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a month. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a month as a single subcutaneous injection. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a month as two or more consecutive subcutaneous injections. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a month for at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, at least 12 months, at least 18 months, at least 24 months, at least 30 months, at least 36 months, or longer. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a month until sufficient to treat, prevent, reduce the severity, delay onset, and / or reduce the risk of occurrence of one or more symptoms of hyperthermic autoimmune hemolytic anemia.
[0046] In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once or more over a period of about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 24 months, 30 months, 36 months, or longer.
[0047] In various embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is self-administered by the patient. In various embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is self-administered by the patient at home. In various embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered by a treating clinician. In various embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered alone, for example, as a single agent. In various embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered in combination with at least one additional therapeutic agent.
[0048] In various embodiments of the therapeutic methods, uses, and compositions disclosed herein, the therapeutically effective amount of the antibody or antigen-binding fragment is about 170 mg to about 300 mg. In various embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 300 mg to about 500 mg. In various embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 500 mg to about 700 mg. In various embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 700 mg to about 900 mg. In various embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 900 mg to about 1100 mg. In various embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 1100 mg to about 1300 mg. In various embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 1300 mg to about 1500 mg. In various embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is the amount required to reduce the level of at least one autoantibody and / or pathogenic antibody (e.g., at least one IgG) in the patient and / or the patient's sample by at least about 25%, about 35%, about 45%, about 50%, about 60%, about 70%, about 80%, or more. In various embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is the amount required to reduce the level of total serum IgG in the patient and / or the patient's sample by at least about 25%, about 35%, about 45%, about 50%, about 60%, about 70%, about 80%, or more. In various embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is the amount required to increase the level of hemoglobin in the patient and / or sample of the patient by about 5%, about 10%, about 15%, or about 20% or more.
[0049] In various embodiments of the therapeutic methods, uses and compositions disclosed herein, the therapeutically effective amount of the antibody or antigen-binding fragment is about 300 mg to about 900 mg. In various embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 300 mg to 900 mg administered once a week or once every two weeks. In various embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 300 mg to about 400 mg, about 400 mg to about 500 mg, about 500 mg to about 600 mg, about 600 mg to about 700 mg, 700 mg to about 800 mg, or about 800 mg to about 900 mg. In various embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 300 mg to about 400 mg, about 400 mg to about 500 mg, about 500 mg to about 600 mg, about 600 mg to about 700 mg, about 700 mg to 800 mg, or about 800 mg to about 900 mg administered once a week or once every two weeks.
[0050] In various embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 300 mg to about 400 mg (e.g., about 300 mg to about 350 mg, e.g., about 340 mg). In various embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 340 mg. In various embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 340 mg administered once a week. In various embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 340 mg administered once a week as a single subcutaneous injection. In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 340 mg administered once a week for at least 2 weeks (e.g., 2, 3, 4, 5, 6, 7, 8, 10, 12 weeks or more). In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 340 mg administered once a week for at least 4 weeks. In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 340 mg administered once a week for at least 7 weeks. In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 340 mg administered once a week for at least 12 weeks.
[0051] In various embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 650 mg to about 750 mg (e.g., about 650 mg to about 700 mg, e.g., about 680 mg). In various embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 680 mg. In various embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 680 mg administered once weekly. In various embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 680 mg administered once weekly as two or more (e.g., two) consecutive subcutaneous injections. In various embodiments, each subcutaneous injection contains approximately the same amount (e.g., about 340 mg) of the antibody or antigen-binding fragment. In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 680 mg administered once a week for at least 2 weeks (e.g., 2, 3, 4, 5, 6, 7, 8, 10, 12 weeks or more). In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 680 mg administered once a week for at least 4 weeks. In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 680 mg administered once a week for at least 7 weeks. In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 680 mg administered once a week for at least 12 weeks.
[0052] In various embodiments of the therapeutic methods, uses, and compositions disclosed herein, treatment using an antibody, antigen-binding fragment, or pharmaceutical composition according to the present disclosure reduces the level of at least one autoantibody and / or pathogenic antibody (e.g., at least one IgG) in a patient and / or a sample of a patient (e.g., a patient suffering from hyperthermic autoimmune hemolytic anemia). In some embodiments, treatment reduces the level of at least one autoantibody and / or pathogenic antibody (e.g., at least one IgG) in the patient and / or a sample of a patient by at least about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, or about 90% compared to the level of at least one autoantibody and / or pathogenic antibody in the patient and / or sample prior to treatment. In some embodiments, treatment reduces the level of at least one autoantibody and / or pathogenic antibody (e.g., at least one IgG) in the patient and / or sample of the patient by at least about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, or about 90% compared to the level of at least one autoantibody and / or pathogenic antibody in the patient and / or sample before treatment. In some embodiments, the level of at least one autoantibody and / or pathogenic antibody (e.g., at least one IgG) is measured at the start of treatment and / or after about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, and / or about 8 weeks after the start of treatment. In some embodiments, the maximum reduction in the level of at least one autoantibody and / or pathogenic antibody (e.g., at least one IgG) in the patient occurs about 5 to about 40 days or about 5 to about 30 days after administration of the antibody, antigen-binding fragment, or pharmaceutical composition.In some embodiments, the maximum reduction in the level of at least one autoantibody and / or pathogenic antibody (e.g., at least one IgG) in the patient occurs about 15 to about 30 days after administration of the antibody, antigen-binding fragment, or pharmaceutical composition.
[0053] In some embodiments, at least one IgG comprises pathogenic IgG (e.g., pathogenic IgG1, IgG2, IgG3, or IgG4). In some embodiments, at least one IgG comprises anti-RBC IgG (e.g., anti-RBC IgG1, anti-RBC IgG2, anti-RBC IgG3, and / or anti-RBC IgG4). In some embodiments, at least one IgG comprises IgG1, IgG2, IgG3, or IgG4. In some embodiments, at least one IgG comprises serum IgG1. In some embodiments, at least one IgG comprises serum IgG2. In some embodiments, at least one IgG comprises serum IgG3. In some embodiments, at least one IgG comprises serum IgG4.
[0054] In various embodiments of the therapeutic methods, uses, and compositions disclosed herein, treatment using an anti-FcRn antibody or an antigen-binding fragment or a pharmaceutical composition reduces the level of total serum IgG in a patient, e.g., a patient suffering from hyperthermic autoimmune hemolytic anemia, and / or a sample of the patient. In some embodiments, treatment reduces the level of total serum IgG in the patient and / or a sample of the patient by, i.e., by at least about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, or about 90% compared to the total serum IgG level of the patient and / or sample before treatment. In some embodiments, treatment reduces the level of total serum IgG in the patient and / or the patient's sample by at least about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, or about 90% compared to the total serum IgG level of the patient and / or the sample before treatment. In various embodiments, treatment reduces the level of total serum IgG in the patient and / or the patient's sample by at least about 40% (e.g., about 40% to about 50%) after about 1 or 2 weeks of weekly administration. In various embodiments, treatment reduces the level of total serum IgG in the patient and / or the patient's sample by at least about 60% (e.g., about 60% to about 70%) after about 3 weeks of weekly administration. In various embodiments, treatment reduces the level of total serum IgG in the patient and / or the patient's sample by at least about 70% (e.g., about 70% to about 80%) compared to the patient's total serum IgG level after about 5 weeks of weekly administration.In some embodiments, total serum IgG levels are measured at the start of treatment and / or about 1, 2, 3, 4, 5, 6, 7, and / or 8 weeks after the start of treatment. In some embodiments, the maximum decrease in total serum IgG levels in the patient occurs about 5 to 40 days or about 5 to 30 days after administration of the antibody, antigen-binding fragment, or pharmaceutical composition. In some embodiments, the maximum decrease in total serum IgG levels in the patient occurs about 15 to 30 days after administration of the antibody, antigen-binding fragment, or pharmaceutical composition. In some embodiments, the maximum decrease in total serum IgG levels occurs after about 3 to 5 doses (e.g., after about 4 doses) of the antibody, antigen-binding fragment, or pharmaceutical composition.
[0055] In various embodiments of the therapeutic methods, uses, and compositions disclosed herein, treatment using an anti-FcRn antibody or an antigen-binding fragment or a pharmaceutical composition increases the level of hemoglobin in a patient, e.g., a patient suffering from hyperthermic autoimmune hemolytic anemia, and / or a sample of the patient. In various embodiments, treatment increases the level of hemoglobin in the patient and / or a sample of the patient, i.e., by at least about 5%, about 10%, about 15%, or about 20% (e.g., about 5% to about 30%) compared to the hemoglobin level of the patient and / or sample before treatment. In various embodiments, treatment increases the level of hemoglobin in the patient and / or a sample of the patient, i.e., by at least about 10% (e.g., about 5% to about 30%) after about 1 or 2 weeks of weekly administration. In various embodiments, treatment increases the level of hemoglobin in the patient and / or the patient's sample by at least about 20% (e.g., about 20% to about 25%) after about 1 or 2 weeks of weekly administration, i.e., compared to the hemoglobin level of the patient and / or the patient's sample before treatment. In some embodiments, the increase in the hemoglobin level in the patient and / or the patient's sample (e.g., an increase of about 10%, about 20%, or more) is maintained for the entire treatment period or for part thereof. In some embodiments, the increase in the hemoglobin level in the patient and / or the patient's sample (e.g., an increase of about 10%, about 20%, or more) is maintained for at least 2, 3, or 4 weeks (e.g., 4 weeks or more). In some embodiments, the increase in the hemoglobin level in the patient and / or the patient's sample (e.g., an increase of about 10%, about 20%, or more) is maintained for about 2 to about 6 weeks. Brief explanation of the drawing
[0056] Figure 1 shows the results of antibody expression using CHO-S cells and the analysis of HL161A, HL161B, HL161C, and HL161D antibody proteins obtained through Protein A purification on an SDS-PAGE gel in reduced or non-reduced states. It was confirmed that each HL161 antibody possesses a complete human IgG1 structure of approximately 160 kDa in the non-reduced state, and in the reduced state, consists of a typical antibody structure with a heavy chain of approximately 55 kDa and a light chain of approximately 25 kDa. In Figure 1, Lane 1 represents the molecular weight (MW) marker, Lane 2 represents 2 µg of the non-reduced (*NEM-treated) antibody, and Lane 3 represents 2 µg of the reduced antibody. FIGS. 2a to 2h show the kinetic dissociation constants (K) of four antibodies (HL161A, HL161B, HL161C, and HL161D) binding to FcRn. D This is a diagram showing the results of analysis performed using a surface plasma resonance (SPR) system to measure ), and the results obtained by analyzing the interaction between human FcRn and HL161A, HL161B, HL161C, or HL161D antibodies at pH 6.0 and pH 7.4, respectively, using the Proteon GLC chip and Proteon XPR36 (Bio-Rad) instrument. Figure 2a shows the results of analyzing the interaction between human FcRn and HL161A at pH 6.0. Figure 2b shows the results of analyzing the interaction between human FcRn and HL161A at pH 7.4. Figure 2c shows the results of the analysis of the interaction between human FcRn and HL161B at pH 6.0. Figure 2d shows the results of the analysis of the interaction between human FcRn and HL161B at pH 7.4. Figure 2e shows the results of the analysis of the interaction between human FcRn and HL161C at pH 6.0. Figure 2f shows the results of the analysis of the interaction between human FcRn and HL161C at pH 7.4. Figure 2g shows the results of the analysis of the interaction between human FcRn and HL161D at pH 6.0. Figure 2h shows the results of the analysis of the interaction between human FcRn and HL161D at pH 7.4. Figure 3 is a diagram showing the binding ability of two selected antibodies to human FcRn (hFcRn) on the cell surface. The results were obtained by treating human FcRn-overexpressing HEK293 cells with selected HL161A and HL161B antibodies that bind to human FcRn present on the cell surface, and analyzing the antibodies binding to cell surface FcRn at pH 6.0 and pH 7.4. The binding of each HL161A and HL161B antibody to human FcRn was expressed as an MFI value obtained by performing FACS (fluorescent activated cell sorter) using an Alexa488-labeled anti-human goat antibody after treating the cells with each antibody at various pH values. Figure 4 illustrates the results of analyzing the ability of human IgG to inhibit binding to human FcRn-expressing cells at pH 6.0, and the results of observing whether two selected antibodies that bind to cell-surface human FcRn can inhibit the binding of human IgG to human FcRn at the cellular level. Profiles of the ability of Alexa488-labeled human IgG to inhibit binding to human FcRn were obtained by sequentially diluting each of the HL161A and HL161B antibodies, which were confirmed to bind to human FcRn-overexpressing HEK293 cells, from 200 nM to 4-fold. Figures 5a and 5b illustrate the results of confirming the effects of antibodies HL161A and HL161B, selected from human FcRn-expressing transgenic mice Tg32 (hFcRn+ / +, hβ2m+ / +, mFcRn- / -, mβ2m- / -), on the catabolism of hIgG1. At 0 hours, 5 mg / kg of biotin-hIgG and 495 mg / kg of human IgG were administered intraperitoneally to saturate IgG in vivo. Regarding drug administration, IgG1, HL161A, HL161B, or PBS were injected intraperitoneally at doses of 5, 10, and 20 mg / kg once daily at 24, 48, 72, and 96 hours after administration of biotin-IgG. Samples were collected 24, 48, 72, 96, 120, and 168 hours after administration of biotin-IgG. At 24, 48, 72, and 96 hours, blood was collected prior to drug administration, and the residual amount of biotin-IgG was determined using the ELISA method. The results were expressed as relative ratios of the residual amount at each time point, with the residual amount of the 24-hour blood sample set as 100%. Figures 6a to 6c illustrate the results of analyzing changes in blood levels of monkey IgG induced by the administration of two antibodies (HL161A and HL161B) to cyanomolgus monkeys having 96% sequence homology with human FcRn. The antibodies HL161A and HL161B were administered intravenously to cyanomolgus monkeys at doses of 5 mg / kg and 20 mg / kg, respectively, once daily. Figure 6a illustrates the serum IgG-reducing effects of HL161A and HL161B antibodies according to antibody concentration. Figure 6b illustrates the serum IgG-reducing effect of HL161A and HL161B antibodies (concentration: 5 mg / kg in monkey individuals). Figure 6c illustrates the serum IgG-reducing effect of HL161A and HL161B antibodies (concentration: 20 mg / kg in monkey individuals). Figures 7a and 7b show the results of analyzing the pharmacokinetic profiles of HL161A and HL161B in experiments using cyanomorphic monkeys. Figures 8a to 8c illustrate the results of analyzing changes in blood levels of monkey IgM, IgA, and albumin following the administration of antibodies HL161A and HL161B in experiments using cyanomolgus monkeys. Figure 8a illustrates changes in serum IgM levels in monkeys. Figure 8b illustrates changes in serum IgA levels in monkeys. Figure 8c illustrates changes in serum albumin levels in monkeys. Figure 9 shows single and multiple doses of RVT-1401 (HL161BKN) in healthy subjects after subcutaneous (SC) or intravenous (IV) administration (N = RVT-1401: placebo). Figures 10a and 10b show the mean concentration-time profiles in healthy subjects after single-dose IV and SC administration of RVT-1401 (Figure 10a: IV; Figure 10b: SC). Figures 11a and 11b show the mean concentration-time profiles in healthy subjects after weekly SC administration of 340 mg or 680 mg of RVT-1401 (Figure 11a: linear plot; Figure 11b: semi-log plot). Figure 12 shows the serum IgG concentration-time profile in healthy subjects after weekly SC administration of 340 mg or 680 mg of RVT-1401. Figure 13a shows the percentage (%) decrease in serum IgG from baseline in healthy subjects after a single intravenous dose of RVT-1401 (340 mg, 765 mg, 1530 mg) or placebo. The arrow indicates the time of RVT-1401 administration. Figure 13b shows the percentage (%) decrease in serum IgG from baseline in healthy subjects after a single subcutaneous dose of RVT-1401 (340 mg, 765 mg) or placebo. The arrow indicates the time of RVT-1401 administration. Figures 14a through 14e show the percentage (%) reduction in serum IgG (total and subclass) from baseline in healthy subjects after multiple-dose SC administration of RVT-1401 (340 mg, 680 mg) or placebo. Arrows indicate the time of RVT-1401 administration (once a week x 4 weeks). Figure 14a shows the percentage (%) decrease in serum IgG (total) from baseline in healthy subjects after multiple SC administration of RVT-1401 (340 mg, 680 mg) or placebo. Figure 14b shows the percentage (%) decrease in serum IgG1 from baseline in healthy subjects after multiple SC administration of RVT-1401 (340 mg, 680 mg) or placebo. Figure 14c shows the percentage (%) decrease in serum IgG2 from baseline in healthy subjects after multiple SC administration of RVT-1401 (340 mg, 680 mg) or placebo. Figure 14d shows the percentage (%) decrease in serum IgG3 from baseline in healthy subjects after multiple SC administration of RVT-1401 (340 mg, 680 mg) or placebo. Figure 14e shows the percentage (%) decrease in serum IgG4 from baseline in healthy subjects after multiple SC administration of RVT-1401 (340 mg, 680 mg) or placebo. Figure 15 illustrates the study design of a non-randomized, open-label study to evaluate the safety, tolerability, PK, PD, and efficacy of RVT-1401 (680 mg and 340 mg weekly) in patients with hyperthermic autoimmune hemolytic anemia (WAIHA). Patients diagnosed with WAIHA are treated with RVT-1401: once-weekly subcutaneous injections of regimen A (680 mg weekly for 12 weeks (Cohort 1)) and regimen B (340 mg weekly for 12 weeks (Cohort 2)). Regimen A (680 mg weekly) is administered as two subcutaneous injections per week, and regimen B (340 mg weekly) is administered as a single subcutaneous injection per week. An asterisk (**) indicates that Cohort 1 is enrolled first, followed by Cohort 2. Specific details for implementing the invention
[0057] To facilitate a better understanding of this disclosure, specific terms are defined throughout the detailed description. Unless otherwise defined in this specification, all scientific and technical terms associated with this disclosure have the same meaning as generally understood by those skilled in the art. All references cited in this specification are also incorporated by reference in their entirety. In the event that a cited reference conflicts with this disclosure, this specification shall prevail.
[0058] As used herein, the singular form of a word includes the plural form unless the context otherwise indicates. For example, the terms "one (a)," "one (an)," and "the" are understood as singular or plural. For example, "one element" means one or more elements. The term "or" may mean "and / or" unless the specific context otherwise indicates. All ranges include endpoints and all points between them unless the specific context otherwise indicates. All ranges, including those referred to in the form "between X value and Y value," include endpoints and all points between them unless the specific context otherwise specifies.
[0059] In some embodiments, the present disclosure relates to a method for treating or preventing hyperthermic autoimmune hemolytic anemia by administering an anti-FcRn antibody or an antigen-binding fragment thereof to a patient requiring treatment, or by administering a pharmaceutical composition comprising at least one pharmaceutically acceptable carrier and an anti-FcRn antibody or an antigen-binding fragment thereof. In some embodiments, the present disclosure relates to the use of an anti-FcRn antibody or an antigen-binding fragment thereof in a method for treating or preventing hyperthermic autoimmune hemolytic anemia by administering an anti-FcRn antibody or an antigen-binding fragment thereof to a patient requiring treatment, or by administering a pharmaceutical composition comprising an anti-FcRn antibody or an antigen-binding fragment and at least one pharmaceutically acceptable carrier. In some embodiments, the present disclosure relates to the use of an anti-FcRn antibody or an antigen-binding fragment thereof in the manufacture of a medicine for treating or preventing hyperthermic autoimmune hemolytic anemia. In some embodiments, the present disclosure relates to an anti-FcRn antibody or an antigen-binding fragment thereof for use in a method of treating or preventing hyperthermia autoimmune hemolytic anemia. A pharmaceutical composition comprising an anti-FcRn antibody or an antigen-binding fragment thereof and at least one pharmaceutically acceptable carrier is also disclosed, which is useful for the treatment methods and uses described herein.
[0060] As used herein, the term “treat” and its cognates refer to the improvement of a disease, disorder, or condition (e.g., hyperthermic autoimmune hemolytic anemia) or at least one identifiable symptom thereof (e.g., any one or more of the signs and symptoms described herein). The term “treat” includes, but is not limited to, the complete cure or complete improvement of one or more symptoms of hyperthermic autoimmune hemolytic anemia. In some embodiments, “treat” refers to at least a partial improvement of at least one measurable physical parameter, which is not necessarily identifiable by the patient, e.g., a decrease in the level of at least one autoantibody and / or pathogenic antibody (e.g., pathogenic IgG) and / or the level of total serum IgG or an increase in the level of hemoglobin. In some embodiments, “treat” refers to inhibiting the progression of hyperthermic autoimmune hemolytic anemia physically (e.g., stabilization of identifiable symptoms), physiologically (e.g., stabilization of physical parameters), or both. In some embodiments, “treat” refers to slowing or reversing the progression of hyperthermia autoimmune hemolytic anemia. As used herein, “treat” and its cognates also include reducing the risk of acquiring hyperthermia autoimmune hemolytic anemia or delaying its onset. The antibodies, antigen-binding fragments, and pharmaceutical compositions disclosed herein may be used for the prevention or prophylaxis of hyperthermia autoimmune hemolytic anemia. For example, a prophylaxis method may include administering the antibodies, antigen-binding fragments, or pharmaceutical compositions disclosed herein to a subject at risk of hyperthermia autoimmune hemolytic anemia to prevent or reduce the probability of occurrence of hyperthermia autoimmune hemolytic anemia or at least one identifiable symptom thereof. In some embodiments, the disease, disorder, or condition to be treated is hyperthermia autoimmune hemolytic anemia.
[0061] The terms “subject” and “patient” are used interchangeably herein to refer to any human or non-human animal. Non-human animals include all vertebrates such as any animal (e.g., mammals and non-mammalians). Non-limiting examples of mammals include humans, mice, rats, rabbits, dogs, monkeys, and pigs. In various embodiments, the subject is a human. In various embodiments, the subject is a human who has or is suspected of having thermal autoimmune hemolytic anemia.
[0062] As used herein, the term “warm autoimmune hemolytic anemia” or “WAIHA” refers to an autoimmune condition defined by the presence of autoantibodies that attach to red blood cells and destroy them (regardless of whether complement is activated) at a temperature higher than or equal to normal body temperature. Warm autoimmune hemolytic anemia may also be referred to as warm antibody hemolytic anemia, idiopathic warm antibody hemolytic anemia, warm antibody autoimmune hemolytic anemia, and / or warm reacting antibody disease. Generally, antibodies in warm autoimmune hemolytic anemia react optimally at 37 degrees Celsius. The most common antibody isotype associated with hyperthermia autoimmune hemolytic anemia is IgG, with higher prevalence of IgG1 and IgG3 (Kalfa, Hematology Am. Soc. Hematol. Educ. Program 2016(l):690-7, 2016). Intravascular destruction of red blood cells via complement-mediated mechanisms contributes to only a very small fraction of patients with hyperthermia autoimmune hemolytic anemia. In most patients, hyperthermia-responsive IgG-coated red blood cells bind to splenic macrophages via FcRn, which may convert them into phagocytes or retain a portion of the membrane removed by the spleen. In the latter case, these red blood cells may form microspheres that become targets for further destruction as they pass through the next spleen (Kalfa, Hematology Am. Soc. Hematol. Educ. Program 2016(l):690-7, 2016). CD8+ T cells and natural killer (NK) cells can also contribute to RBC lysis through antibody-dependent cell-mediated cytotoxicity (ADCC).
[0063] The clinical symptoms of WAIHA are generally characterized by fatigue, exertional dyspnea, pallor, and splenomegaly. Common experimental findings include, but are not limited to: decreased hemoglobin (Hb), reticulocytosis, increased unconjugated bilirubin and lactate dehydrogenase, serum aspartate aminotransferase disproportionately higher than serum alanine aminotransferase, and decreased haptoglobin (Kalfa, Hematology Am. Soc. Hematol. Educ. Program 2016(l):690-7, 2016). Signs and symptoms of hyperthermia autoimmune hemolytic anemia may include, but are not limited to, abnormal paleness of the skin (pallor), fatigue, shortness of breath during exercise, dizziness, palpitations, yellowing of the skin and / or the whites of the eyes (jaundice), enlargement of the spleen (splenomegaly), and enlargement of the liver (hepatomegaly). Affected individuals, particularly those with progressively developing anemia, may also be asymptomatic and may not exhibit any signs or symptoms. Diagnosis of hyperthermia autoimmune hemolytic anemia may include a thorough clinical evaluation, a detailed patient history, identification of characteristic symptoms, and / or various tests, such as blood tests measuring hemoglobin and / or hematocrit. Blood tests may also indicate elevated bilirubin levels and / or elevated levels of immature red blood cells (reticulocytes), which can occur when the body is forced to produce extra red blood cells to replace those destroyed prematurely. Additionally, specialized tests such as Coombs and / or dithiothreitol (DTT) tests may be performed. The Coombs test can be used to detect antibodies acting against red blood cells. For the Coombs test, a blood sample is taken in some specific cases and then exposed to the Coombs reagent. A positive result in the Coombs test may appear if red blood cells clump or clump together in the presence of the reagent.For example, since DTT generally reacts with IgM but not with IgG, a DTT test can also be performed to distinguish hyperthermia-induced autoimmune hemolytic anemia caused by IgM autoantibodies from the more common form caused by IgG autoantibodies.
[0064] In some embodiments, patients requiring or receiving treatment for hyperthermia or autoimmune hemolytic anemia are evaluated using evaluation scales, e.g., all evaluation scales described herein.
[0065] In some embodiments, patients requiring or receiving treatment for hyperthermia-autoimmune hemolytic anemia are evaluated using the Functional Assessment of Fatigue in Chronic Disease Treatment (FACIT-F) scale. The FACIT-F scale is a validated scale that measures the physical, emotional, and social impacts of fatigue, which is one of the major clinical symptoms of hyperthermia-autoimmune hemolytic anemia (Acaster et al., Health Qual. Life Outcomes 13(l):60-9, 2015; Webster et al., Health Qual. Life Outcomes 1(79):1-7, 2003). The score range is 0 to 52, with higher scores indicating a higher quality of life. A score below 30 generally indicates severe fatigue.
[0066] In some specific examples, patients requiring or receiving treatment for hyperthermia-autoimmune hemolytic anemia are evaluated using the Medical Research Council (MRC) Dyspnea Scale. The MRC Dyspnea Scale is a questionnaire consisting of five statements regarding perceived dyspnea. The focus of the scale is not on the severity of dyspnea, but on quantifying the impairment associated with dyspnea (Stenton, Occupational Med. 58:226-7, 2008). This scale has been replicated using the current Modified MRC Subject Version, ranging from Grade 0 (limited to no impairment) to Grade 4 (severe impairment). This scale was used for patients with chronic obstructive pulmonary disease (COPD) and was further stratified for patients with low hemoglobin levels to demonstrate that anemic COPD patients may have significantly higher MRCs (Ferrari et al., BMC Pulm. Med. 15:58, 2015). The scale enables self-management by asking patients to select the phrase that best describes their condition. The score is the number that best fits the patient's activity level.
[0067] In some specific examples, patients requiring or receiving treatment for hyperthermia or autoimmune hemolytic anemia are evaluated using the EQ-5D-3L scale. The EQ-5D-3L is a validated measure of health-related quality of life (Devlin et al., Health Econ. 27(1):7-22, 2018; Hernandez et al., EEPRU Report: "Quality review of a proposed EQ-5D-5L value set for England" [online]). The scale consists of two components: the EQ-5D descriptive system and the EQ visual analog scale. The descriptive system assesses mobility, self-care, daily activities, pain / discomfort, and anxiety / depression. The scale allows patients to self-care by selecting the most appropriate statement within each category. A lower score corresponds to a better quality of life. The EQ VAS records the patient's self-assessed health on a vertical visual analog scale with endpoints marked as 'best health possible' (100) and 'worst health possible' (0). The patient can select a number from 0 to 100.
[0068] In some embodiments, a patient requiring treatment for hyperthermic autoimmune hemolytic anemia exhibits one or more signs and symptoms of hyperthermic autoimmune hemolytic anemia (e.g., pallor, fatigue, jaundice, and / or splenomegaly), and / or is diagnosed with any form of condition by a treating clinician. In some embodiments, a patient (or a sample of the patient) requiring treatment for hyperthermic autoimmune hemolytic anemia has detectable levels of anti-erythrocyte IgG (anti-RBC IgG), i.e., IgG capable of binding to one or more red blood cells. In some embodiments, anti-RBC IgG acts on and / or contributes to the pathogenesis of the disease via complement fixation (CF). In some embodiments, anti-RBC IgG acts on and / or contributes to the pathogenesis of the disease (e.g., activation of the patient's innate immune system, including cytokine release and / or phagocytosis) by binding to one or more Fc receptors. In some embodiments, anti-RBC IgG acts on and / or contributes to the pathogenesis of disease, e.g., cytokine release and / or phagocytosis, by activation of the patient's innate immune system, including the following. In some embodiments, anti-RBC IgG is present in the patient's blood. In some embodiments, anti-RBC IgG is anti-RBC IgG1. In some embodiments, anti-RBC IgG is anti-RBC IgG2. In some embodiments, anti-RBC IgG is anti-RBC IgG3. In some embodiments, anti-RBC IgG is anti-RBC IgG4.
[0069] One embodiment is a method for treating or preventing hyperthermia in a patient requiring this, comprising administering to the patient (i) a therapeutically effective amount of an anti-FcRn antibody or an antigen-binding fragment thereof; or (ii) a pharmaceutical composition comprising at least one pharmaceutically acceptable carrier and a therapeutically effective amount of an anti-FcRn antibody or an antigen-binding fragment thereof.
[0070] Another embodiment is an anti-FcRn antibody or an antigen-binding fragment thereof for use in a method for treating or preventing hyperthermia autoimmune hemolytic anemia in a patient requiring such treatment, said method comprising administering to the patient (i) a therapeutically effective amount of the anti-FcRn antibody or an antigen-binding fragment thereof; or (ii) a pharmaceutical composition comprising at least one pharmaceutically acceptable carrier and a therapeutically effective amount of the anti-FcRn antibody or an antigen-binding fragment thereof.
[0071] Another embodiment is the use of an anti-FcRn antibody or its antigen-binding fragment in a method for treating or preventing hyperthermic autoimmune hemolytic anemia in a patient in need thereof, comprising administering to the patient (i) a therapeutically effective amount of an anti-FcRn antibody or its antigen-binding fragment; or (ii) a pharmaceutical composition comprising at least one pharmaceutically acceptable carrier and a therapeutically effective amount of the anti-FcRn antibody or its antigen-binding fragment.
[0072] Another specific example is the use of an anti-FcRn antibody or its antigen-binding fragment in the manufacture of a drug for treating or preventing hyperthermia-autoimmune hemolytic anemia in patients requiring it.
[0073] In various embodiments of the therapeutic methods, uses, and compositions disclosed herein, the anti-FcRn antibody or antigen-binding fragment acts as a non-competitive inhibitor of IgG in binding to FcRn. In various embodiments, binding of the antibody or antigen-binding fragment to FcRn inhibits the binding of at least one autoantibody and / or pathogenic antibody to FcRn. In various embodiments, such inhibition promotes the clearance (i.e., removal) of at least one autoantibody and / or pathogenic antibody from the subject's body. In various embodiments, such inhibition reduces the level of at least one autoantibody and / or pathogenic antibody in the subject and / or a sample of the subject. In various embodiments, the reduction in the level of at least one autoantibody and / or pathogenic antibody results in and / or is correlated with an improvement in at least one clinical parameter of hyperthermia autoimmune hemolytic anemia.
[0074] As used herein, the term “autoantibody” refers to an antibody produced by an organism’s immune system against one or more of the organism’s own proteins, tissues, and / or organs. For example, one or more autoantibodies may be produced by a human patient’s immune system when the human patient’s immune system cannot distinguish between “auto” and “non-auto”. In some embodiments, the autoantibody is a pathogenic antibody (e.g., pathogenic IgG, e.g., pathogenic IgG1, IgG2, IgG3, or IgG4). As used herein, the term “pathogenic antibody” refers to an antibody (e.g., autoantibody) that contributes to and / or causes the development of one or more diseases, disorders, or conditions (e.g., hyperthermia autoimmune hemolytic anemia).
[0075] In some embodiments, the pathogenic antibody is pathogenic IgG (e.g., pathogenic IgG1, IgG2, IgG3, or IgG4). In some embodiments, the pathogenic antibody and / or pathogenic IgG is anti-erythrocyte IgG (anti-RBC IgG).
[0076] In some embodiments, the autoantibody and / or pathogenic antibody is an autoantibody capable of binding to red blood cells (RBCs) (i.e., one or more red blood cell antigens). In some embodiments, the autoantibody and / or pathogenic antibody is anti-red blood cell IgG (anti-RBC IgG). In some embodiments, the autoantibody and / or pathogenic antibody is anti-red blood cell IgG1 (anti-RBC IgG1). In some embodiments, the autoantibody and / or pathogenic antibody is anti-red blood cell IgG2 (anti-RBC IgG2). In some embodiments, the autoantibody and / or pathogenic antibody is anti-red blood cell IgG3 (anti-RBC IgG3). In some embodiments, the autoantibody and / or pathogenic antibody is anti-red blood cell IgG4 (anti-RBC IgG4). In some embodiments, treatment of a patient with the antibody, antigen-binding fragment, or pharmaceutical composition described herein reduces the level of anti-RBC IgG (e.g., anti-RBC IgG1, anti-RBC IgG2, anti-RBC IgG3, and / or anti-RBC IgG4) by at least about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, or about 50% compared to the level of anti-RBC IgG before treatment, for example, using the method disclosed herein.
[0077] In some embodiments, the autoantibody and / or pathogenic antibody is IgG, IgM, IgA, IgD, or IgE. In some embodiments, the autoantibody and / or pathogenic antibody is IgG (e.g., pathogenic IgG). In some embodiments, the autoantibody and / or pathogenic antibody is IgG1, IgG2, IgG3, or IgG4. In some embodiments, the autoantibody and / or pathogenic antibody is IgG1 (e.g., pathogenic IgG1, e.g., anti-RBC IgG1). In some embodiments, the autoantibody and / or pathogenic antibody is IgG2 (e.g., pathogenic IgG2, e.g., anti-RBC IgG2). In some embodiments, the autoantibody and / or pathogenic antibody is IgG3 (e.g., pathogenic IgG3, e.g., anti-RBC IgG3). In some embodiments, the autoantibody and / or pathogenic antibody is IgG4 (e.g., pathogenic IgG4, e.g., anti-RBC IgG4). In some embodiments, the autoantibody is a pathogenic antibody.
[0078] In various embodiments of the therapeutic methods, uses, and compositions disclosed herein, the anti-FcRn antibody or antigen-binding fragment may non-competitively inhibit the binding of at least one autoantibody and / or pathogenic antibody (e.g., at least one IgG) to FcRn at physiological pH (i.e., pH 7.0–7.4). Without being bound by theory, FcRn is believed to bind to its ligand (i.e., IgG) and to exhibit substantially no affinity for IgG at physiological pH rather than at acidic pH. Therefore, in various embodiments, at physiological pH, the anti-FcRn antibody or antigen-binding fragment may act as a non-competitive inhibitor of the binding of IgG to FcRn, and the binding of the anti-FcRn antibody or antigen-binding fragment to FcRn is not affected by the presence of IgG. Accordingly, in various embodiments, an anti-FcRn antibody or antigen-binding fragment that specifically binds to FcRn non-competitively with IgG in a pH-independent manner can provide advantages over conventional competitive inhibitors (i.e., antibodies that bind to FcRn competitively with IgG), thereby providing therapeutic or preventive effects even at significantly low concentrations through FcRn-mediated signaling of IgG. Additionally, in various embodiments, during intracellular transport procedures while bound to FcRn, the anti-FcRn antibody or antigen-binding fragment can maintain binding to FcRn with a higher affinity than IgG in the blood. Thus, in various embodiments, the anti-FcRn antibody or antigen-binding fragment can inhibit the binding of IgG to FcRn even in endosomes in an acidic pH environment where IgG can bind to FcRn, thereby promoting the clearance of IgG. In various embodiments, the anti-FcRn antibody or antigen-binding fragment is RVT-1401 (referred to herein as HL161BKN). In some embodiments, the antibody or antigen-binding fragment is RVT-1401 or its antigen-binding fragment.In some embodiments, the antibody or antigen-binding fragment comprises three heavy chain CDR amino acid sequences of SEQ ID NO: 27 (HCDR1), SEQ ID NO: 28 (HCDR2), and SEQ ID NO: 29 (HCDR3); and three light chain CDR amino acid sequences of SEQ ID NO: 30 (LCDR1), SEQ ID NO: 31 (LCDR2), and SEQ ID NO: 32 (LCDR3). In some embodiments, the antibody or antigen-binding fragment comprises a heavy chain variable region amino acid sequence of SEQ ID NO: 6; and a light chain variable region amino acid sequence of SEQ ID NO: 16. In some embodiments, the antibody or antigen-binding fragment comprises a heavy chain amino acid sequence of SEQ ID NO: 46; and a light chain amino acid sequence of SEQ ID NO: 48.
[0079] Binding "affinity" refers to the strength of the interaction between an antibody and an antigen at a single antigenic site. Within each antigenic site, the variable regions of the antibody's "arms" interact with the antigen at numerous sites through weak non-covalent forces. Generally, the more interactions there are, the stronger the affinity.
[0080] As used herein, the terms “specific,” “specifically binds,” and “binds specifically” refer to binding interactions between an antibody or its antigen-binding fragment (e.g., an anti-FcRn antibody or its antigen-binding fragment) and a target antigen (e.g., FcRn) in a heterogeneous population of proteins and other biopharmaceuticals. The specificity of the binding of an antibody can be tested by comparing its binding to a substitute antigen or antigen mixture under a given set of conditions with its binding to a suitable antigen. If an antibody binds to a suitable antigen with at least 2, at least 5, or at least 10 (or more) greater affinity than to the substitute antigen or antigen mixture, it is considered specific.
[0081] "Specific antibodies" or "target-specific antibodies" bind only to the target antigen (e.g., FcRn) and not to other antigens (or indicate minimal binding). In some embodiments, an antibody or its antigen-binding fragment that specifically binds to the target antigen (e.g., FcRn) is 1 x 10⁶ at pH 6.0 or pH 7.4. -6 Less than M, 1x10 -7 Less than M, 1x10 -8 Less than M, 1x10 -9 Less than M, 1x10 -10 Less than M, 1x10 -11 Less than M, 1x10 -12 Less than M, or 1x10 -13 K less than M D It has. In some embodiments, K D is about 0.01 nM to about 2 nM at pH 6.0 or pH 7.4. In some embodiments, K D is about 300 pM or less to about 2 nM or less at pH 7.4. In some embodiments, K D It is about 2 nM or less to 900 pM or less at pH 6.0.
[0082] As used in this specification, the term "K D " refers to the equilibrium dissociation constant for antibody-antigen pairs, obtained as the ratio of kd to ka (i.e., kd / ka), and is generally expressed in molar concentration (M). The term "k assoc " or "ka" refers to the binding rate of a specific antibody-antigen interaction, whereas the term "k dis " or "kd" refers to the dissociation rate of a specific antibody-antigen interaction. Measurements of kd and / or ka can be performed at 25°C or 37°C. K for antibody and antigen-binding fragments D The value may be measured using methods well established in the art (see, e.g., Pollard, Mol. Biol. Cell 21(23):4061-7, 2010). In some embodiments, KD is measured by direct binding and / or competitive binding analysis (e.g., surface plasmon resonance and / or competitive ELISA). In some embodiments, K D is measured by surface plasmon resonance (e.g., human FcRn-immobilized surface plasmon resonance). In some embodiments, K of the anti-FcRn antibody or antigen-binding fragment disclosed herein D It is measured by human FcRn-fixed surface plasmon resonance.
[0083] In some embodiments of the therapeutic methods, uses, and compositions disclosed herein, the anti-FcRn antibody or antigen-binding fragment is about 0.01 to 2 nM K at pH 6.0 and pH 7.4, as measured, for example, by surface plasmon resonance. D It has a (dissociation constant). In some embodiments, the anti-FcRn antibody or antigen-binding fragment has K from about 300 pM or less to about 2 nM or less at pH 7.4, as measured by surface plasmon resonance, for example. D , and / or K from about 2 nM or less to about 900 pM or less at pH 6.0 D It has. In some embodiments, the anti-FcRn antibody or antigen-binding fragment binds to the outside of the cell and maintains its binding to the endosome upon binding. In some embodiments, the anti-FcRn antibody or antigen-binding fragment effectively blocks the binding of one or more autoantibodies to FcRn (e.g., human FcRn), as measured by blocking assays and FACS performed, for example, using human FcRn-expressing cells.
[0084] As used herein, the terms “anti-FcRn antibody” or “antibody specifically binding to FcRn” refer to any form of an antibody specifically binding to FcRn or an antigen-binding fragment thereof, with a K of less than 2 nM at pH 6.0 or pH 7.4 as measured by surface plasmon resonance (e.g., human FcRn-immobilized surface plasmon resonance). D It refers to those that bind to FcRn. The term includes monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies, and biologically functional fragments that bind specifically to FcRn.
[0085] In some embodiments of the therapeutic methods, uses, and compositions disclosed herein, the anti-FcRn antibody or antigen-binding fragment is
[0086] CDR1 comprising an amino acid sequence that is at least 90% identical to one or more amino acid sequences selected from the group consisting of SEQ ID NOs 21, 24, 27, 30, 33, 36, 39, and 42;
[0087] CDR2 comprising an amino acid sequence that is at least 90% identical to one or more amino acid sequences selected from the group consisting of SEQ ID NOs: 22, 25, 28, 31, 34, 37, 40 and 43; and
[0088] It includes a CDR3 having an amino acid sequence that is at least 90% identical to one or more amino acid sequences selected from the group consisting of sequence numbers 23, 26, 29, 32, 35, 38, 41 and 44.
[0089] In some embodiments of the therapeutic methods, uses, and compositions disclosed herein, the anti-FcRn antibody or antigen-binding fragment is
[0090] CDR1 comprising an amino acid sequence that is at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one or more amino acid sequences selected from the group consisting of SEQ ID NOs 21, 24, 27, 30, 33, 36, 39, and 42;
[0091] A CDR2 comprising an amino acid sequence that is at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one or more amino acid sequences selected from the group consisting of SEQ ID NOs: 22, 25, 28, 31, 34, 37, 40, and 43; and
[0092] It includes a CDR3 having an amino acid sequence that is at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one or more amino acid sequences selected from the group consisting of SEQ ID NOs 23, 26, 29, 32, 35, 38, 41, and 44.
[0093] In some embodiments of the therapeutic methods, uses, and compositions disclosed herein, the anti-FcRn antibody or antigen-binding fragment may comprise one or more amino acid deletions, additions, or substitutions in the amino acid sequences described herein.
[0094] In some embodiments of the therapeutic methods, uses, and compositions disclosed herein, the anti-FcRn antibody or antigen-binding fragment may comprise an amino acid sequence that is identical to or homologous to the amino acid sequence described herein. The terms “identity” or “homology” refer to the relationship between the sequences of two or more polypeptides, as measured by comparing the sequences. The term “identity” refers to the degree of sequence relatedness between polypeptides, as measured by the number of matches between strings of two or more amino acid residues. The percentage of “identity” between two sequences is a function of the number of identical positions shared by the sequences (i.e., the percentage of identity is equal to the number of identical positions / total number of positions x 100), taking into account the number of gaps required to be introduced for optimal alignment of the two sequences and the length of each gap. Sequence comparison and measurement of the percentage of identity between two sequences may be performed using mathematical algorithms. For sequence comparison, typically one sequence acts as a reference sequence to which the test sequence is compared. When inputting test and reference sequences into a computer using a sequence comparison algorithm, subsequence coordinates and sequence algorithm parameters are specified as needed. Basic program parameters may be used, or alternative parameters may be specified. Then, the sequence comparison algorithm calculates the percentage of sequence identity of the test sequence with respect to the reference sequence based on the program parameters. Additionally, or alternatively, the amino acid sequence disclosed herein may be further used as a "query sequence" to perform a search in a public database to identify, for example, associated sequences. For example, such a search may be performed using the BLAST program of Altschul et al. (J. Mol. Biol. 215:403-10, 1990).
[0095] When comparing and aligning for maximum correspondence in the comparison window, or when specifying a region when measured by using one of the following sequence comparison algorithms or by manual alignment and visual inspection, if two sequences have a specific percentage of identical amino acid residues (i.e., 60% identity, optionally 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity over the optionally specified region or if not specified, over the entire sequence), the two sequences are "substantially identical." Optionally, identity exists over a region of at least about 10 amino acids in length, or over a region of about 20, 50, 200, or more amino acids in length. In some embodiments, the anti-FcRn antibody and antigen-binding fragment described herein comprise at least one amino acid sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20-48. In some embodiments, the anti-FcRn antibody and antigen-binding fragment described herein comprise at least one amino acid sequence that is at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20-48.
[0096] In some embodiments, the antibody or antigen-binding fragment is
[0097] CDR1 containing the amino acid sequence of SEQ ID NO: 21; CDR2 containing the amino acid sequence of SEQ ID NO: 22; and CDR3 containing the amino acid sequence of SEQ ID NO: 23;
[0098] CDR1 containing the amino acid sequence of SEQ ID NO: 27; CDR2 containing the amino acid sequence of SEQ ID NO: 28; and CDR3 containing the amino acid sequence of SEQ ID NO: 29;
[0099] CDR1 comprising the amino acid sequence of SEQ ID NO: 33; CDR2 comprising the amino acid sequence of SEQ ID NO: 34; and CDR3 comprising the amino acid sequence of SEQ ID NO: 35; or
[0100] It includes a heavy chain variable region comprising CDR1 having the amino acid sequence of SEQ ID NO: 39; CDR2 having the amino acid sequence of SEQ ID NO: 40; and CDR3 having the amino acid sequence of SEQ ID NO: 41.
[0101] In some embodiments, the antibody or antigen-binding fragment is
[0102] CDR1 containing the amino acid sequence of SEQ ID NO: 24; CDR2 containing the amino acid sequence of SEQ ID NO: 25; and CDR3 containing the amino acid sequence of SEQ ID NO: 26;
[0103] CDR1 containing the amino acid sequence of SEQ ID NO: 30; CDR2 containing the amino acid sequence of SEQ ID NO: 31; and CDR3 containing the amino acid sequence of SEQ ID NO: 32;
[0104] CDR1 comprising the amino acid sequence of SEQ ID NO: 36; CDR2 comprising the amino acid sequence of SEQ ID NO: 37; and CDR3 comprising the amino acid sequence of SEQ ID NO: 38; or
[0105] It includes a light chain variable region comprising CDR1 having the amino acid sequence of SEQ ID NO: 42; CDR2 having the amino acid sequence of SEQ ID NO: 43; and CDR3 having the amino acid sequence of SEQ ID NO: 44.
[0106] In some embodiments, the antibody or antigen-binding fragment comprises: a heavy chain variable region comprising a CDR1 having the amino acid sequence of SEQ ID NO: 21 (HCDR1), a CDR2 having the amino acid sequence of SEQ ID NO: 22 (HCDR2), and a CDR3 having the amino acid sequence of SEQ ID NO: 23 (HCDR3); and a light chain variable region comprising a CDR1 having the amino acid sequence of SEQ ID NO: 24 (LCDR1), a CDR2 having the amino acid sequence of SEQ ID NO: 25 (LCDR2), and a CDR3 having the amino acid sequence of SEQ ID NO: 26 (LCDR3); and a heavy chain variable region comprising a CDR1 having the amino acid sequence of SEQ ID NO: 27 (HCDR1), a CDR2 having the amino acid sequence of SEQ ID NO: 28 (HCDR2), and a CDR3 having the amino acid sequence of SEQ ID NO: 29 (HCDR3). and a light chain variable region comprising a CDR1 containing the amino acid sequence of SEQ ID NO: 30 (LCDR1), a CDR2 containing the amino acid sequence of SEQ ID NO: 31 (LCDR2), and a CDR3 containing the amino acid sequence of SEQ ID NO: 32 (LCDR3); a heavy chain variable region comprising a CDR1 containing the amino acid sequence of SEQ ID NO: 33 (HCDR1), a CDR2 containing the amino acid sequence of SEQ ID NO: 34 (HCDR2), and a CDR3 containing the amino acid sequence of SEQ ID NO: 35 (HCDR3); and a light chain variable region comprising a CDR1 containing the amino acid sequence of SEQ ID NO: 36 (LCDR1), a CDR2 containing the amino acid sequence of SEQ ID NO: 37 (LCDR2), and a CDR3 containing the amino acid sequence of SEQ ID NO: 38 (LCDR3); and a heavy chain variable region comprising a CDR1 having the amino acid sequence of SEQ ID NO: 39 (HCDR1), a CDR2 having the amino acid sequence of SEQ ID NO: 40 (HCDR2), and a CDR3 having the amino acid sequence of SEQ ID NO: 41 (HCDR3);and includes one or more heavy chain variable regions and one or more light chain variable regions selected from the group consisting of a CDR1 having the amino acid sequence of SEQ ID NO: 42 (LCDR1), a CDR2 having the amino acid sequence of SEQ ID NO: 43 (LCDR2), and a CDR3 having the amino acid sequence of SEQ ID NO: 44 (LCDR3).;
[0107] In some embodiments, the antibody or antigen-binding fragment comprises one or more heavy chain variable regions and / or one or more light chain variable regions comprising one or more amino acid sequences selected from the group consisting of the amino acid sequences of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20.
[0108] In some embodiments, the antibody or antigen-binding fragment comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 2, 4, 6, 8 or 10 and / or a light chain variable region comprising the amino acid sequence of SEQ ID NO: 12, 14, 16, 18 or 20.
[0109] In some embodiments, the antibody or antigen-binding fragment comprises one or more heavy chain variable regions and one or more light chain variable regions selected from the group consisting of a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 2 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 12; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 4 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 14; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 6 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 16; a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 8 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 18; and a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 10 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 20.
[0110] With respect to antibodies, the terms “fragment,” “antibody fragment,” and “antigen-binding fragment” as used herein refer to one or more fragments of a full-length antibody that possess the ability to specifically bind to a target antigen (e.g., FcRn) and / or provide the function of a full-length antibody (e.g., non-competitive interference of IgG binding to FcRn). The antigen-binding fragment may also exist as larger macromolecules, e.g., bispecific, trispecific, and multispecific antibodies. Examples of antigen-binding fragments include, but are not limited to, single-stranded antibodies, bispecific, trispecific, and multispecific antibodies, such as diabadies, triabadies, and tetraabadies, Fab fragments, F(ab')2 fragments, Fd, scFv, domain antibodies, bispecific antibodies, minibodies, scap (sterol regulatory binding protein cleavage activating protein), chelating recombinant antibodies, tribodies or bibodies, intrabodies, nanobodies, small modular immunopharmaceuticals (SMIP), binding-domain immunoglobulin fusion proteins, camellized antibodies, VHH-containing antibodies, IgD antibodies, IgE antibodies, IgM antibodies, IgG1 antibodies, IgG2 antibodies, IgG3 antibodies, IgG4 antibodies, derivatives in antibody constant regions, and protein scaffold-based synthetic antibodies capable of binding to FcRn. In some embodiments, the antigen-binding fragments exhibit the same or similar characteristics as full-length antibodies. Without limitation, antigen-binding fragments may be produced by any suitable method known in the art. For example, the various antigen-binding fragments described herein may be produced by enzymatic or chemical modification of full-length antibodies, synthesized de novo using recombinant DNA methodologies (e.g., scFv), or identified using phage display libraries (e.g., Pini and Bracci, Curr. Protein Pept. Sci.See 1(2):155-69, 2000). Antigen-binding fragments can be screened for utility in the same way as full-length antibodies (e.g., specificity, binding affinity, activity).
[0111] Additionally, antibodies or antigen-binding fragments having mutations in variable and / or constant regions may be used in the therapeutic methods, uses, and compositions described herein. Examples of such antibodies or antigen-binding fragments include antibodies having conservative substitutions of amino acid residues in variable and / or constant regions. As used herein, the term “conservative substitution” refers to substitution with another amino acid residue having characteristics similar to the original amino acid residue. For example, lysine, arginine, and histidine are similar in that they have basic side chains, and aspartic acid and glutamic acid are similar in that they have acidic side chains. In addition, glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, and tryptophan have similar characteristics in that they have uncharged polar side chains, and alanine, valine, leucine, threonine, isoleucine, proline, phenylalanine, and methionine have similar characteristics in that they have non-polar side chains. In addition, tyrosine, phenylalanine, tryptophan, and histidine have similar characteristics in that they have aromatic side chains. Therefore, it will be obvious to those skilled in the art that even if substitution of amino acid residues occurs in the group showing similar characteristics as described above, it will not show a significant change in the characteristics of the antibody or antigen-binding fragment.
[0112] Additionally, in some embodiments, the antibody or antigen-binding fragment may be conjugated to another substrate (e.g., a therapeutic agent or a detectable label). Substrates that may be conjugated to or administered in combination with the antibody or antigen-binding fragment include, but are not limited to, therapeutic agents commonly used for hyperthermic autoimmune hemolytic anemia (e.g., standard of care agents, e.g., any one or more of the standard of care agents disclosed herein or included by reference); substrates capable of inhibiting the activity of FcRn; and moietyes physically bound to the antibody or antigen-binding fragment to improve, for example, its stabilization and / or maintenance in circulation, e.g., blood, serum, lymph, or other tissues. For example, the antibody or antigen-binding fragment may be bound to a polymer, e.g., a non-antigen polymer such as polyalkylene oxide or polyethylene oxide. Suitable polymers will vary substantially by weight. Polymers having a molecular number average molecular weight in the range of about 200 to about 35,000 (or about 1,000 to about 15,000 and 2,000 to about 12,500) may be used. For example, the antibody or antigen-binding fragment may be conjugated to a water-soluble polymer, for example, a hydrophilic polyvinyl polymer, for example, polyvinyl alcohol and polyvinylpyrrolidone. Non-limiting examples of such polymers include, but are not limited to, polyalkylene oxide homopolymers, such as polyethylene glycol (PEG) or polypropylene glycol, polyoxyethyleneated polyols, copolymers thereof, and block copolymers thereof provided that the water solubility of the block copolymer is maintained.
[0113] In various embodiments of the therapeutic methods, uses and compositions disclosed herein, the antibody or antigen-binding fragment comprises: a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 27 (HCDR1), the amino acid sequence of SEQ ID NO: 28 (HCDR2), and the amino acid sequence of SEQ ID NO: 29 (HCDR3); and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 30 (LCDR1), the amino acid sequence of SEQ ID NO: 31 (LCDR2), and the amino acid sequence of SEQ ID NO: 32 (LCDR3).
[0114] In various embodiments, the antibody or antigen-binding fragment comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 6; and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 16. In various embodiments, the antibody or antigen-binding fragment comprises a heavy chain variable region comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 6; and a light chain variable region comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 16. In various embodiments, the antibody or antigen-binding fragment comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 4; and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 14. In various embodiments, the antibody or antigen-binding fragment comprises a heavy chain variable region comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 4; and a light chain variable region comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 14. In various embodiments, the antibody or antigen-binding fragment is 0.01 nM to 2 nM of K at pH 6.0 or pH 7.4, as measured, for example, by surface plasmon resonance. D It binds to FcRn via (dissociation constant).
[0115] In various embodiments of the therapeutic methods, uses and compositions disclosed herein, the antibody or antigen-binding fragment comprises: a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 21 (HCDR1), the amino acid sequence of SEQ ID NO: 22 (HCDR2), and the amino acid sequence of SEQ ID NO: 23 (HCDR3); and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 24 (LCDR1), the amino acid sequence of SEQ ID NO: 25 (LCDR2), and the amino acid sequence of SEQ ID NO: 26 (LCDR3).
[0116] In various embodiments, the antibody or antigen-binding fragment comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 2; and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 12. In various embodiments, the antibody or antigen-binding fragment comprises a heavy chain variable region comprising an amino acid sequence at least 90% identical to SEQ ID NO: 2; and a light chain variable region comprising an amino acid sequence at least 90% identical to SEQ ID NO: 12. In various embodiments, the antibody or antigen-binding fragment comprises 0.01 nM to 2 nM of K at pH 6.0 or pH 7.4, for example, as measured by surface plasmon resonance. D It binds to FcRn.
[0117] In various embodiments, the antibody or antigen-binding fragment comprises the heavy chain amino acid sequence of SEQ ID NO: 46 or a sequence that is at least 90% identical to SEQ ID NO: 46. In various embodiments, the antibody or antigen-binding fragment comprises the light chain amino acid sequence of SEQ ID NO: 48 or a sequence that is at least 90% identical to SEQ ID NO: 48. In various embodiments, the antibody or antigen-binding fragment comprises the heavy chain amino acid sequence of SEQ ID NO: 46 and the light chain amino acid sequence of SEQ ID NO: 48. In various embodiments, the antibody or antigen-binding fragment comprises a heavy chain amino acid sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 46 and a light chain amino acid sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 48.
[0118] RVT-1401 (also referred to herein as HL161BKN) is an example of an anti-FcRn antibody. In some embodiments, the antibody or antigen-binding fragment is RVT-1401 or its antigen-binding fragment. In some embodiments, the antibody or antigen-binding fragment comprises three heavy chain CDR amino acid sequences of RVT-1401 (HCDR1 (SEQ No. 27), HCDR2 (SEQ No. 28), HCDR3 (SEQ No. 29)); and three light chain CDR amino acid sequences of RVT-1401 (LCDR1 (SEQ No. 30), LCDR2 (SEQ No. 31), LCDR3 (SEQ No. 32)). In some embodiments, the antibody or antigen-binding fragment comprises the heavy chain variable region amino acid sequence of RVT-1401 (SEQ No. 6); and includes the amino acid sequence of the light chain variable region of RVT-1401 (SEQN: 16). In some embodiments, the antibody or antigen-binding fragment includes the heavy chain amino acid sequence of RVT-1401 (SEQN: 46); and the light chain amino acid sequence of RVT-1401 (SEQN: 48).
[0119] In various embodiments of the treatment methods and uses disclosed herein, the antibody or antigen-binding fragment is administered alone. In various embodiments, the antibody or antigen-binding fragment is administered in combination with at least one additional therapeutic agent. In various embodiments, at least one additional therapeutic agent may comprise or consist of a standard therapeutic agent for hyperthermia autoimmune hemolytic anemia.
[0120] "Concurrent administration" or "co-administration" as used herein means that two or more different therapeutic agents are delivered to a subject while the subject is suffering from hyperthermic autoimmune hemolytic anemia. For example, in some embodiments, two or more therapeutic agents are delivered after the subject is diagnosed with the disease and before the disease is treated or eliminated, or after the subject is identified as at risk but before the subject exhibits symptoms of the disease. In some embodiments, there is overlap as the delivery of one therapeutic agent is still occurring when the delivery of the second therapeutic agent begins. In some embodiments, the first and second therapeutic agents are initiated simultaneously. This type of delivery is sometimes referred to herein as "simultaneous," "concurrent," or "concurrent" delivery. In other embodiments, the delivery of one therapeutic agent is terminated before the delivery of the second therapeutic agent begins. This type of delivery is sometimes referred to herein as "sequential" or "sequential" delivery. In some embodiments, the antibody or antigen-binding fragment and at least one additional therapeutic agent are administered simultaneously. In some embodiments, the antibody or antigen-binding fragment and at least one additional therapeutic agent are administered sequentially.
[0121] In some embodiments, two therapeutic agents (e.g., an anti-FcRn antibody or antigen-binding fragment and a secondary therapeutic agent) are included in the same composition. Such a composition may be administered in any suitable form and by any suitable route. In other embodiments, two therapeutic agents (e.g., an anti-FcRn antibody or antigen-binding fragment and a secondary therapeutic agent) are administered as separate compositions in any suitable form and by any suitable route. For example, a composition containing an anti-FcRn antibody or antigen-binding fragment and a composition containing a secondary therapeutic agent (e.g., a standard therapeutic agent for hyperthermia autoimmune hemolytic anemia) may be administered simultaneously or sequentially in any order at different times; in either case, they must be administered at a time sufficiently close to provide the desired therapeutic or prophylactic effect.
[0122] As used herein, the term “agent” refers to a compound, a mixture of compounds, a biological macromolecule, or an extract made from a biological material. The terms “therapeutic agent” or “drug” refer to a therapeutic agent capable of modulating biological processes and / or biological activities. The anti-FcRn antibody and antigen-binding fragment described herein are examples of therapeutic agents.
[0123] As used herein, the term “standard-of-care agent” refers to any agent or other form of therapy accepted as appropriate treatment for a specific type of disease (e.g., hyperthermia, autoimmune hemolytic anemia). As used herein, the terms “standard dosage” or “standard dosing regimen” refer to any ordinary or routine regimen of administration for an agent proposed, for example by a manufacturer, approved by a regulatory authority, or tested in human subjects to meet the needs of a general patient.
[0124] One example of a standard treatment for hyperthermic autoimmune hemolytic anemia is IVIG. In some embodiments, the standard dosing regimen for IVIG includes or consists of: 1 g / kg / day of IVIG for 2 days. Another example of a standard treatment for hyperthermic autoimmune hemolytic anemia is one or more corticosteroids (e.g., prednisone). In some embodiments, the standard dosing regimen for one or more corticosteroids (e.g., prednisone) includes or consists of: 1.0-1.5 mg / kg / day of prednisone for 1-3 weeks until a hemoglobin level of 10 g / dL or higher is reached; and subsequent doses of prednisone are gradually reduced to a daily dose of 20-30 mg by 10-15 mg weekly, then reduced by 5 mg every 1-2 weeks to 15 mg, and then reduced by 2.5 mg every 2 weeks with the ultimate goal of discontinuing the drug. Additional standard treatments for hyperthermia autoimmune hemolytic anemia, as well as standard regimens of administration for such agents, are known in the art, for example, Kalfa, Hematology Am. Soc. Hematol. Educ. Program 2016(l):690-7, 2016; and Zanella and Barcellini, Haematologica 99(10): 1547-54, 2014, disclosed in the literature, both of which are incorporated herein by reference.
[0125] The anti-FcRn antibody and antigen-binding fragment disclosed herein may be administered in combination with any of the exemplary standard therapeutic agents disclosed and / or included by reference in this specification.
[0126] Additionally, pharmaceutical compositions comprising an anti-FcRn antibody or an antigen-binding fragment thereof formulated with at least one pharmaceutically acceptable carrier are provided herein. The composition may also include one or more additional therapeutic agents suitable for treating or preventing, for example, hyperthermic autoimmune hemolytic anemia (e.g., standard therapeutic agents for hyperthermic autoimmune hemolytic anemia). Methods of formulating pharmaceutical compositions and suitable formulations are known in the art (see, for example, "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, PA). Suitable formulations may depend on the route of administration.
[0127] As used herein, “pharmaceutical composition” refers to a preparation of an anti-FcRn antibody or its antigen-binding fragment in addition to other components suitable for administration to a patient, e.g., pharmaceutically acceptable carriers and / or excipients. The pharmaceutical composition provided herein is in vitro ( in vitro) and / or in vivo ( in vivo It may be suitable for administration in ). In some embodiments, the pharmaceutical composition provided herein is a form that allows administration, subsequently provides the intended biological activity of the active ingredient(s), and / or achieves a therapeutic effect. The pharmaceutical composition provided herein preferably does not contain additional ingredients that are toxic to the extent that the formulation is unacceptable to the subject to whom it is administered.
[0128] As used herein, the terms “pharmaceuticalally acceptable carrier” and “physiologically acceptable carrier” may be used interchangeably and refer to a carrier, diluent, or excipient that does not cause significant irritation to a subject and does not impair the biological activity and characteristics of an administered antibody or antigen-binding fragment. Accordingly, a pharmaceutically acceptable carrier must be compatible with an active ingredient such as an antibody or its antigen-binding fragment and may comprise physiological saline, sterile water, Ringer’s solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, or a mixture of two or more of these. A pharmaceutically acceptable carrier may also be used to enhance or stabilize a composition or to facilitate the preparation of a composition. A pharmaceutically acceptable carrier may comprise other conventional additives that are physiologically compatible, such as antioxidants, buffers, solvents, bacteriostatic agents, dispersion media, coatings, antimicrobial and antifungal agents, isotonic agents, and absorption retardants. The carrier may be selected to minimize side effects in the target and / or to minimize degradation of the active ingredient(s).
[0129] As used herein, the term “excipient” refers to an inert substance added to a pharmaceutical composition to further facilitate the administration of an active ingredient. Formulations for parenteral administration may include, for example, sterile water or saline solution, polyalkylene glycols such as polyethylene glycol, vegetable oil, or hydrogenated naphthalene. Other excipients include, but are not limited to, calcium bicarbonate, calcium phosphate, various sugars and starches, cellulose derivatives, gelatin, types of ethylene-vinyl acetate copolymer particles, and surfactants including, for example, polysorbate 20.
[0130] In various embodiments of the therapeutic methods, uses, and compositions disclosed herein, the anti-FcRn antibody, antigen-binding fragment, or pharmaceutical composition may be administered by various methods known to the public. The route and / or mode of administration may vary depending on the desired result. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered by oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, gastrointestinal, sublingual, or local routes. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered orally or parenterally. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered parenterally, for example, intravenously or subcutaneously (e.g., by injection or infusion). In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered subcutaneously (e.g., by injection or infusion). In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered by one or more subcutaneous injections. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered by a single (i.e., one) subcutaneous injection. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered by two or more (e.g., two) consecutive subcutaneous injections. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is delivered via a syringe, catheter, pump delivery system, or stent. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is delivered via a syringe (e.g., a pre-filled syringe). Depending on the route of administration, the active compound(s), i.e., the anti-FcRn antibody or antigen-binding fragment, may be coated with a material to protect the compound(s) from the action of acids and other natural conditions that may inactivate the compound(s).
[0131] Antibodies, antigen-binding fragments, or pharmaceutical compositions are formulated into various forms such as powders, tablets, capsules, liquids, injections, ointments, or syrups, and / or may be contained in single-dosage or multi-dosage containers such as sealed ampoules, vials, or syringes. In some embodiments, antibodies, antigen-binding fragments, or pharmaceutical compositions are formulated into an injectable form. In some embodiments, antibodies, antigen-binding fragments, or pharmaceutical compositions are formulated as aqueous solutions, suspensions, or emulsions with one or more excipients, diluents, dispersants, surfactants, binders, and / or lubricants. In some embodiments, antibodies, antigen-binding fragments, or pharmaceutical compositions are contained in syringes (e.g., pre-filled syringes). In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is contained in a syringe having a small gauge needle (e.g., a needle larger than about 25 gauge, larger than about 26 gauge, larger than about 27 gauge, larger than about 28 gauge, larger than about 29 gauge and / or larger than about 30 gauge) and / or compatible syringe.
[0132] In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is formulated to prevent or minimize physical and / or chemical degradation before achieving stability and / or administration. Physical instability may include processes such as denaturation and agglutination, whereas common chemical degradation pathways include, but are not limited to, crosslinking, deamidation, isomerization, oxidation, and fragmentation (see, e.g., Wang et al., J. Pharm. Sci. 91(1): 1-26, 2007). As used herein, the terms “stable” or “stability” mean that when used to describe an antibody or its antigen-binding fragment, the antibody or antigen-binding fragment is maintained in an intact state in a manner that maintains activity (e.g., binding to FcRn) and / or achieves a therapeutic effect. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is formulated with one or more pharmaceutically acceptable carriers (e.g., one or more excipients) to be stable under standard storage conditions. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is formulated with one or more pharmaceutically acceptable carriers (e.g., one or more excipients) to be stable at high concentrations. In some embodiments, the antibody or antigen-binding fragment can be stably concentrated in the formulation up to about 170 mg / mL or more. In some embodiments, the antibody or antigen-binding fragment can be stably concentrated in formulations greater than about 170 mg / mL (e.g., about 180 mg / mL, about 200 mg / mL, about 220 mg / mL or more). In some embodiments, the stably concentrated formulation (e.g., a formulation containing the antibody or antigen-binding fragment at up to about 170 mg / mL or more) maintains a viscosity acceptable for administration via a small gauge needle.In some embodiments, the small gauge needle is larger than about 25 gauge, larger than about 26 gauge, larger than about 27 gauge, larger than about 28 gauge, larger than about 29 gauge and / or larger than about 30 gauge.
[0133] The administration regimen for anti-FcRn antibodies or antigen-binding fragments may be adjusted to provide an optimal desired response (e.g., therapeutic response) either alone or in combination with one or more additional therapeutic agents. For example, a single bolus of anti-FcRn antibodies or antigen-binding fragments may be administered at once, multiple divided doses may be administered over a predetermined period, or the dosage of anti-FcRn antibodies or antigen-binding fragments may be proportionally reduced or increased as indicated by the urgency of the treatment situation. For any specific subject, the specific administration regimen may be adjusted over time based on the individual's needs and the professional judgment of the treating clinician. For example, in some embodiments, the dosage of anti-FcRn antibodies or antigen-binding fragments may be appropriately determined by considering the patient's severity, condition, age, case history, etc.
[0134] Anti-FcRn antibodies or antigen-binding fragments may be formulated into pharmaceutically acceptable dosage forms by traditional methods known to those skilled in the art. For example, parenteral compositions may be formulated into dosage units for ease of administration and uniformity of dosage. As used herein, "dosage unit form" refers to physically separated units suitable as a unit dosage form for a subject to be treated, each unit containing a predetermined amount of active compound calculated to produce a desired therapeutic effect in relation to a pharmaceutically acceptable carrier. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is formulated into dosage units. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is formulated into dosage units for subcutaneous administration. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is formulated into dosage units for administration via one or more subcutaneous injections (e.g., a single subcutaneous injection or two or more (e.g., two) consecutive subcutaneous injections). In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is formulated in the form of a dosing unit (e.g., one or more subcutaneous injections) for self-administration by a patient and / or administration by a treating clinician.
[0135] The dosage value for a composition comprising an anti-FcRn antibody or antigen-binding fragment, an anti-FcRn antibody or antigen-binding fragment and / or any additional therapeutic agent(s) may be selected based on the inherent properties of the active compound(s) and the specific therapeutic effect to be achieved.
[0136] A physician or veterinarian may start a dose of the antibody or antigen-binding fragment at a level lower than that required to achieve the desired therapeutic effect and gradually increase the dose until the desired effect is achieved. A physician or veterinarian may also start a dose of the antibody or antigen-binding fragment at a level higher than that required to achieve the desired therapeutic effect and gradually decrease the dose until the desired effect is achieved. Generally, the effective dose of the antibody or antigen-binding fragment for the treatment of hyperthermia autoimmune hemolytic anemia varies depending on many different factors, including whether the treatment is prophylactic or therapeutic. The selected dose level may also depend on various pharmacokinetic factors, including the activity of the specific composition or its esters, salts, or amides used, the route of administration, the time of administration, the elimination rate of the specific compound used, the duration of treatment, other drugs, compounds, and / or materials used in combination with the specific composition used, age, sex, body weight, condition, the general health and prior medical history of the patient to be treated, and similar factors. In some embodiments, treatment may be administered once or multiple times. Considering the specific patient's condition, the full amount of intermittent and / or chronic (continuous) medication may be applied.
[0137] In some embodiments, a therapeutically effective amount of the anti-FcRn antibody or antigen-binding fragment is applied to the methods, uses, and pharmaceutical compositions of the present disclosure.
[0138] As used herein, the terms “therapeutic effective dose” and “therapeutic effective dosage” are used interchangeably to refer to an amount sufficient to reduce at least one symptom or measurable parameter associated with a disease, disorder, or condition; to normalize bodily function in a disease, disorder, or condition that causes impairment of specific bodily function; and / or to provide improvement in or slow the progression of one or more clinically measured parameters of a disease, disorder, or condition. A therapeutic effective dose may be sufficient, for example, to treat, prevent, reduce the severity, delay onset, and / or reduce the risk of occurrence of one or more symptoms of hyperthermia autoimmune hemolytic anemia. The therapeutic effective dose and the therapeutically effective frequency of administration are measured by methods known in the art and may be discussed herein. In some embodiments of the methods, uses, and compositions described herein, the anti-FcRn antibody or antigen-binding fragment is administered in a therapeutically effective amount when administered as a single agent. In some embodiments, the anti-FcRn antibody or antigen-binding fragment and at least one additional therapeutic agent are each administered in a therapeutically effective amount when the agents are used in combination. In some embodiments, the therapeutically effective amount of the anti-FcRn antibody or antigen-binding fragment is the amount necessary to reduce the level of total serum IgG and / or the level of at least one autoantibody (e.g., at least one IgG) in a patient with or suspected of having hyperthermia autoimmune hemolytic anemia. In some embodiments, the therapeutically effective amount of the anti-FcRn antibody or antigen-binding fragment is the amount necessary to increase the level of hemoglobin in a patient with or suspected of having hyperthermia autoimmune hemolytic anemia.
[0139] In some embodiments, the therapeutically effective amount of the anti-FcRn antibody or antigen-binding fragment is the amount required to reduce the level of total serum IgG and / or at least one autoantibody and / or pathogenic antibody (e.g., at least one IgG) in a patient with hyperthermia autoimmune hemolytic anemia and / or a sample of the patient by at least about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, or about 80% compared to the level before treatment with the anti-FcRn antibody or antigen-binding fragment. In some embodiments, the therapeutically effective amount of the anti-FcRn antibody or antigen-binding fragment is the amount required to reduce the level of total serum IgG and / or at least one autoantibody and / or pathogenic antibody (e.g., at least one IgG) in a patient with hyperthermia autoimmune hemolytic anemia and / or a sample of the patient by at least about 40%, about 50%, about 60%, about 70%, or about 80% compared to the level before treatment with the anti-FcRn antibody or antigen-binding fragment. In some embodiments, the therapeutically effective amount of the anti-FcRn antibody or antigen-binding fragment is the amount required to reduce the serum endogenous IgG concentration in a patient with hyperthermia autoimmune hemolytic anemia and / or a sample of the patient by less than about 40%, about 50%, about 60%, about 70%, or about 80% of the pretreatment value.
[0140] The phrases “total IgG level” or “level of total serum IgG” as used herein refer, for example, to the serum endogenous IgG concentration in a patient or a biological sample of a patient (e.g., a blood sample).
[0141] The phrase “level of at least one autoantibody” as used herein refers, for example, to the serum endogenous concentration of at least one autoantibody in a patient or a biological sample of a patient.
[0142] The phrase “level of at least one IgG” as used in the specification refers, for example, to the serum endogenous concentration of at least one IgG in a patient or a biological sample of a patient. In some embodiments, at least one IgG comprises pathogenic IgG. In some embodiments, at least one IgG comprises serum IgG1. In some embodiments, at least one IgG comprises serum IgG2. In some embodiments, at least one IgG comprises serum IgG3. In some embodiments, at least one IgG comprises serum IgG3. In some embodiments, at least one IgG comprises serum IgG4.
[0143] In some embodiments, the therapeutically effective amount of the anti-FcRn antibody or antigen-binding fragment is the amount required to increase the level of hemoglobin in a patient with hyperthermic autoimmune hemolytic anemia and / or a sample of the patient by at least about 5%, about 10%, about 15%, about 20% (e.g., about 5% to about 30%) compared to the level before treatment with the anti-FcRn antibody or antigen-binding fragment.
[0144] In some embodiments, the therapeutically effective amount of the anti-FcRn antibody or antigen-binding fragment is the amount required to increase the level of hemoglobin in a patient with hyperthermic autoimmune hemolytic anemia and / or a sample of the patient by at least about 10% (e.g., about 10% to about 15%) after administration for about 1 or 2 weeks compared to the level before treatment with the anti-FcRn antibody or antigen-binding fragment.
[0145] In some embodiments, the therapeutically effective amount of the anti-FcRn antibody or antigen-binding fragment is the amount required to increase the level of hemoglobin in a patient with hyperthermic autoimmune hemolytic anemia and / or a sample of the patient by at least about 20% (e.g., about 20% to about 25%) after administration for about 1 or 2 weeks compared to the level before treatment with the anti-FcRn antibody or antigen-binding fragment.
[0146] In some embodiments, an increase in hemoglobin levels in the patient and / or the patient's sample (e.g., an increase of about 10%, about 20%, or more) is maintained for the entire treatment period or part thereof. In some embodiments, an increase in hemoglobin levels in the patient and / or the patient's sample (e.g., an increase of about 10%, about 20%, or more) is maintained for at least 2, 3, or 4 weeks (e.g., 4 weeks or more). In some embodiments, an increase in hemoglobin levels in the patient and / or the patient's sample (e.g., an increase of about 10%, about 20%, or more) is maintained for about 2 to about 6 weeks.
[0147] As used herein with respect to numbers and ranges, the terms “about” or “approximately” refer to numbers or ranges that are close to or near the cited numbers or ranges so that the embodiments may be performed as intended, as will be apparent to those skilled in the art from the teachings contained herein. These terms include values greater than or equal to values due to systematic error. In some embodiments, “about” or “approximately” means ±10% of a numerical amount.
[0148] In various embodiments of the therapeutic methods and uses disclosed herein, the antibody or antigen-binding fragment is administered to a patient at a fixed dosage. In various embodiments of the therapeutic methods and uses disclosed herein, the antibody or antigen-binding fragment is administered to a patient at a weight-based dosage, i.e., a dosage based on the patient's body weight. In various embodiments of the therapeutic methods and uses disclosed herein, the antibody or antigen-binding fragment is administered to a patient at a body surface area-based dosage, i.e., a dosage based on the patient's body surface area (BSA). In various embodiments, the dosage administered to the patient comprises a therapeutically effective amount of the antibody or antigen-binding fragment.
[0149] In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 170 mg to about 1500 mg. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 300 mg to about 800 mg. In some embodiments, the antibody or antigen-binding fragment is administered to the patient, for example, once a week or once every two weeks, at a dosage of about 170 mg, about 200 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1050 mg, about 1100 mg, about 1150 mg, about 1200 mg, about 1250 mg, about 1300 mg, about 1350 mg, about 1400 mg, about 1450 mg, or 1500 mg.
[0150] In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 170 mg to about 300 mg. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 170 mg, about 180 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 260 mg, about 270 mg, about 280 mg, about 290 mg, or about 300 mg.
[0151] In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 300 mg to about 500 mg. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 300 mg, about 310 mg, about 320 mg, about 330 mg, about 340 mg, about 350 mg, about 360 mg, about 370 mg, about 380 mg, about 390 mg, about 400 mg, about 410 mg, about 420 mg, about 430 mg, about 440 mg, about 450 mg, about 460 mg, about 470 mg, about 480 mg, about 490 mg, or about 500 mg.
[0152] In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 300 mg to about 400 mg. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 300 mg, about 310 mg, about 320 mg, about 330 mg, about 340 mg, about 350 mg, about 360 mg, about 370 mg, about 380 mg, about 390 mg, or about 400 mg. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 320 mg, about 330 mg, about 340 mg, about 350 mg, or about 360 mg. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 340 mg. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dose of about 340 mg once a week or once every two weeks. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dose of about 340 mg once a week. In some embodiments, the antibody or antigen-binding fragment is administered to the patient as a single subcutaneous injection at a dose of about 340 mg once a week. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dose of about 340 mg once a week for at least two weeks (e.g., 2, 3, 4, 5, 6, 7, 8, 10, 12 weeks or more). In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dose of about 340 mg once a week for at least four weeks. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dose of about 340 mg once a week for at least 7 weeks. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dose of about 340 mg once a week for at least 12 weeks.
[0153] In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 500 mg to about 700 mg. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 500 mg, about 510 mg, about 520 mg, about 530 mg, about 540 mg, about 550 mg, about 560 mg, about 570 mg, about 580 mg, about 590 mg, about 600 mg, about 610 mg, about 620 mg, about 630 mg, about 640 mg, about 650 mg, about 660 mg, about 670 mg, about 680 mg, about 690 mg, or about 700 mg.
[0154] In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 650 mg to about 750 mg. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 650 mg, about 660 mg, about 670 mg, about 680 mg, about 690 mg, about 700 mg, about 710 mg, about 720 mg, about 730 mg, about 740 mg, or about 750 mg. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 660 mg, about 670 mg, about 680 mg, about 690 mg, or about 700 mg. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 680 mg. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dose of about 680 mg once a week or once every two weeks. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dose of about 680 mg once a week. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dose of about 680 mg once a week by two or more consecutive subcutaneous injections (e.g., two). In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dose of about 680 mg once a week for at least two weeks (e.g., two, three, four, five, six, seven, eight, ten, twelve, or more). In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dose of about 680 mg once a week for at least four weeks. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dose of about 680 mg once a week for at least 7 weeks. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dose of about 680 mg once a week for at least 12 weeks.
[0155] In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 700 mg to about 900 mg. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 700 mg, about 710 mg, about 720 mg, about 730 mg, about 740 mg, about 750 mg, about 760 mg, about 770 mg, about 780 mg, about 790 mg, about 800 mg, about 810 mg, about 820 mg, about 830 mg, about 840 mg, about 850 mg, about 860 mg, about 870 mg, about 880 mg, about 890 mg, or about 900 mg.
[0156] In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 900 mg to about 1100 mg. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 900 mg, about 910 mg, about 920 mg, about 930 mg, about 940 mg, about 950 mg, about 960 mg, about 970 mg, about 980 mg, about 990 mg, about 1000 mg, about 1010 mg, about 1020 mg, about 1030 mg, about 1040 mg, about 1050 mg, about 1060 mg, about 1070 mg, about 1080 mg, about 1090 mg, or about 1100 mg.
[0157] In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 1100 mg to about 1300 mg. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 1100 mg, about 1110 mg, about 1120 mg, about 1130 mg, about 1140 mg, about 1150 mg, about 1160 mg, about 1170 mg, about 1180 mg, about 1190 mg, about 1200 mg, about 1210 mg, about 1220 mg, about 1230 mg, about 1240 mg, about 1250 mg, about 1260 mg, about 1270 mg, about 1280 mg, about 1290 mg, or about 1300 mg.
[0158] In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 1300 mg to about 1500 mg. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 1300 mg, about 1310 mg, about 1320 mg, about 1330 mg, about 1340 mg, about 1350 mg, about 1360 mg, about 1370 mg, about 1380 mg, about 1390 mg, about 1400 mg, about 1410 mg, about 1420 mg, about 1430 mg, about 1440 mg, about 1450 mg, about 1460 mg, about 1470 mg, about 1480 mg, about 1490 mg, or about 1500 mg.
[0159] In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 1 mg / kg to about 2000 mg / kg body weight. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 1 mg / kg to about 200 mg / kg, about 200 mg / kg to about 400 mg / kg, about 400 mg / kg to about 600 mg / kg, about 600 mg / kg to about 800 mg / kg, about 800 mg / kg to about 1000 mg / kg, about 1000 mg / kg to about 1200 mg / kg, about 1200 mg / kg to about 1400 mg / kg, about 1400 mg / kg to about 1600 mg / kg, about 1600 mg / kg to 1800 mg / kg, or about 1800 mg / kg to about 2000 mg / kg. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 1 mg / kg to about 200 mg / kg. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 1 mg / kg, about 10 mg / kg, about 20 mg / kg, about 30 mg / kg, about 40 mg / kg, about 50 mg / kg, about 60 mg / kg, about 70 mg / kg, about 80 mg / kg, about 90 mg / kg, about 100 mg / kg, about 110 mg / kg, about 120 mg / kg, about 130 mg / kg, about 140 mg / kg, about 150 mg / kg, about 160 mg / kg, about 170 mg / kg, about 180 mg / kg, about 190 mg / kg, or about 200 mg / kg. In some embodiments, the antibody or antigen-binding fragment is administered to the patient at a dosage of about 1 mg / kg to about 40 mg / kg.In some embodiments, the antibody or antigen-binding fragment is administered to a patient at a dosage of about 1 mg / kg, about 5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, or about 40 mg / kg.
[0160] The frequency at which the antibody or antigen-binding fragment is administered to the patient as a single agent or in combination with one or more additional therapeutic agents may be one or more times. In some embodiments, the antibody or antigen-binding fragment is administered as a single dose. In some embodiments, the antibody or antigen-binding fragment is administered multiple times. The administration interval may be, for example, daily, weekly, bi-weekly, monthly, or annually. The interval may also be, for example, based on a measurement of the blood concentration of the antibody or antigen-binding fragment in the patient to maintain a relatively consistent plasma concentration of the antibody or antigen-binding fragment to provide a desired therapeutic or prophylactic effect; based on a measurement of the concentration of at least one autoantibody and / or pathogenic antibody (e.g., at least one IgG) to maintain a reduced level of at least one autoantibody and / or pathogenic antibody (e.g., at least one IgG); or based on a measurement of the level of total serum IgG to maintain a reduced level of total serum IgG to provide a desired therapeutic or prophylactic effect; Based on measurements of hemoglobin levels to maintain increased levels of hemoglobin to provide the desired therapeutic or prophylactic effect, the dosage may be irregular. Alternatively, in some embodiments, the antibody or antigen-binding fragment may be administered as a sustained-release formulation, in which case less frequent administration is required. The dosage and interval may vary depending on the half-life of the antibody or antigen-binding fragment in the patient. The dosage and frequency of administration may also vary depending on whether the treatment is prophylactic or therapeutic. In prophylactic applications, a relatively low dosage may be administered over a long period at relatively infrequent intervals. Some patients continue treatment for the rest of their lives. In therapeutic applications, a relatively high dosage at relatively shorter intervals is sometimes required until disease progression is reduced or terminated, preferably until the patient shows partial or complete improvement in one or more symptoms of the disease.After that, the patient may be administered a lower, for example, preventive therapy.
[0161] In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to a patient one or more times over a period of about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 24 months, 30 months, 36 months, or longer.
[0162] In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to a patient once as a single dose.
[0163] In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week for at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 7 weeks, at least 8 weeks, at least 9 weeks, at least 10 weeks, at least 12 weeks, at least 20 weeks, at least 24 weeks, at least 30 weeks, at least 40 weeks, at least 50 weeks, at least 60 weeks, at least 70 weeks, at least 76 weeks, at least 80 weeks, or more. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week for 6 to 76 weeks or any period in between. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week for at least 2 weeks, at least 3 weeks, at least 4 weeks, or at least 6 weeks. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week for at least 4 weeks. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week for at least 7 weeks. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week for at least 12 weeks. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week until sufficient is available for the treatment, prevention, reduction in severity, delay onset, and / or reduction in the risk of occurrence of one or more symptoms of hyperthermia autoimmune hemolytic anemia (e.g., pallor, fatigue, jaundice, splenomegaly).
[0164] In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week as a single (i.e., one) subcutaneous injection. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a week as two or more consecutive subcutaneous injections (e.g., two consecutive subcutaneous injections). As used herein in the context of subcutaneous injection (or other routes of administration), the term “consecutive” refers to two or more subcutaneous injections administered in succession but with sufficient time interval to provide the desired therapeutic or prophylactic effect. In some embodiments, the consecutive subcutaneous injections are administered within about 30 seconds, within about 1 minute, within about 2 minutes, within about 5 minutes, within about 10 minutes, within about 30 minutes, within about 1 hour, within about 2 hours, or within about 5 hours of each other.
[0165] In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once every two weeks (bi-weekly). In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once every two weeks for at least 2 weeks, at least 4 weeks, at least 6 weeks, at least 8 weeks, at least 10 weeks, at least 12 weeks, at least 20 weeks, at least 24 weeks, at least 30 weeks, at least 40 weeks, at least 50 weeks, at least 60 weeks, at least 70 weeks, at least 76 weeks, at least 80 weeks, or more. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once every two weeks for 6 to 76 weeks or any time in between. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once every two weeks for at least 12 weeks. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once every two weeks until sufficient for the treatment, prevention, reduction in severity, delay onset, and / or reduction in the risk of occurrence of one or more symptoms of hyperthermia autoimmune hemolytic anemia. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once every two weeks as a single subcutaneous injection. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once every two weeks as two consecutive subcutaneous injections.
[0166] In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a month. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a month for at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, at least 12 months, at least 18 months, at least 24 months, at least 30 months, at least 36 months, or longer. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a month until treatment, prevention, reduction in severity, delay onset, and / or reduction in the risk of onset of one or more symptoms of hyperthermia autoimmune hemolytic anemia are achieved. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a month as a single subcutaneous injection. In some embodiments, the antibody, antigen-binding fragment, or pharmaceutical composition is administered to the patient once a month by two or more consecutive subcutaneous injections.
[0167] In some embodiments of the therapeutic methods, uses, and compositions disclosed herein, the therapeutically effective amount of the antibody or antigen-binding fragment is about 170 to 1500 mg administered as a single dose. More specifically, in some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 170 mg to about 300 mg administered as a single dose. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 300 mg to about 500 mg administered as a single dose. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 500 mg to about 700 mg administered as a single dose. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 700 mg to about 900 mg administered as a single dose. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 900 mg to about 1100 mg administered as a single dose. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 1100 mg to about 1300 mg administered as a single dose. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 1300 mg to about 1500 mg administered as a single dose.
[0168] In some embodiments of the therapeutic methods, uses, and compositions disclosed herein, the therapeutically effective amount of the antibody or antigen-binding fragment is about 300 mg to about 800 mg administered as a single dose. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 300 mg to about 400 mg administered as a single dose. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 340 mg administered as a single dose. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 450 mg to about 550 mg administered as a single dose. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 500 mg administered as a single dose. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 700 mg to about 800 mg administered as a single dose. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 765 mg administered as a single dose. In some embodiments, treatment reduces the total serum IgG level in the patient by at least about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, or about 50%. In some embodiments, treatment reduces the total serum IgG level in the patient by at least about 25%. In some embodiments, treatment reduces the total serum IgG level in the patient by at least about 35%. In some embodiments, treatment reduces the total serum IgG level in the patient by at least about 45%. In some embodiments, the maximum reduction in the total serum IgG level in the patient occurs about 5 to about 20 days after administration of the antibody or antigen-binding fragment, or a pharmaceutical composition containing the antibody or antigen-binding fragment. In some embodiments, the maximum decrease in total serum IgG levels in the patient occurs about 8 to about 15 days after administration of an antibody or antigen-binding fragment, or a pharmaceutical composition containing an antibody or antigen-binding fragment.In some embodiments, the maximum reduction in total serum IgG levels occurs after about 3 to 5 doses (e.g., after about 4 doses) of the antibody or antigen-binding fragment, or a pharmaceutical composition containing the antibody or antigen-binding fragment. In some embodiments, the treatment increases the patient's hemoglobin level by at least about 5%, about 10%, about 15%, or about 20% (e.g., about 5% to about 30%). In some embodiments, the treatment increases the patient's hemoglobin level by at least about 10% (e.g., about 10% to about 15%). In some embodiments, the treatment increases the patient's hemoglobin level by at least about 20% (e.g., about 20% to about 25%). In some embodiments, the treatment increases the patient's hemoglobin level by more than about 20% (e.g., about 25%, about 30%, or more).
[0169] In some embodiments of the therapeutic methods, uses, and compositions disclosed herein, the therapeutically effective amount of the antibody or antigen-binding fragment is about 170 mg to about 1500 mg administered once weekly. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 170 mg to about 300 mg administered once weekly. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 300 mg to about 500 mg administered once weekly. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 500 mg to about 700 mg administered once weekly. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 700 mg to about 900 mg administered once weekly. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 900 mg to about 1100 mg administered once weekly. In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 1100 mg to about 1300 mg administered once a week. In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 1300 mg to about 1500 mg administered once a week.
[0170] In some embodiments of the therapeutic methods, uses, and compositions disclosed herein, the therapeutically effective amount of the antibody or antigen-binding fragment is about 300 mg to about 800 mg administered once weekly. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 300 mg to about 400 mg administered once weekly. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 340 mg administered once weekly. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 650 mg to about 750 mg administered once weekly. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 680 mg administered once weekly. In some embodiments, treatment reduces the patient's total serum IgG level by at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, or about 80%. In some embodiments, treatment reduces the patient's total serum IgG level by at least about 60%. In some embodiments, treatment reduces the patient's total serum IgG level by at least about 70%. In some embodiments, treatment reduces the patient's total serum IgG level by at least about 80%. In some embodiments, the maximum reduction in the patient's total serum IgG level occurs about 20 to about 30 days after administration of an antibody or antigen-binding fragment, or a pharmaceutical composition containing an antibody or antigen-binding fragment. In some embodiments, the maximum reduction in the patient's total serum IgG level occurs about 24 days after administration of an antibody or antigen-binding fragment, or a pharmaceutical composition containing an antibody or antigen-binding fragment. In some embodiments, the maximum decrease in total serum IgG levels occurs after about 3 to 5 doses (e.g., after about 4 doses) of an antibody or antigen-binding fragment, or a pharmaceutical composition containing an antibody or antigen-binding fragment.In some embodiments, the treatment increases the patient's hemoglobin level by at least about 5%, about 10%, about 15%, or about 20% (e.g., about 5% to about 30%). In some embodiments, the treatment increases the patient's hemoglobin level by more than about 20%. In some embodiments, the treatment increases the patient's hemoglobin level by at least about 10% (e.g., about 10% to about 15%) after weekly administration for about 1 or 2 weeks (e.g., 680 mg once weekly). In some embodiments, the treatment increases the patient's hemoglobin level by at least about 20% (e.g., about 20% to about 25%) after weekly administration for about 1 or 2 weeks (e.g., 680 mg once weekly). In some embodiments, an increase in the patient's hemoglobin level (e.g., an increase of about 10%, about 20%, or more) is maintained for the entire treatment period or for part thereof. In some embodiments, an increase in the patient's hemoglobin level (e.g., an increase of about 10%, about 20%, or more) is maintained for 4 weeks or more (e.g., 4 weeks, 6 weeks, 8 weeks, 10 weeks, 12 weeks, or more).
[0171] In some embodiments of the therapeutic methods, uses, and compositions disclosed herein, the therapeutically effective amount of the antibody or antigen-binding fragment is about 170 mg to about 1500 mg administered once every two weeks. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 300 mg to about 800 mg administered once every two weeks. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 170 mg to about 300 mg administered once every two weeks. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 300 mg to about 500 mg administered once every two weeks. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 500 mg to about 700 mg administered once every two weeks. In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 700 mg to about 900 mg administered once every 2 weeks. In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 900 mg to about 1100 mg administered once every 2 weeks. In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 1100 mg to about 1300 mg administered once every 2 weeks. In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 1300 mg to about 1500 mg administered once every 2 weeks.
[0172] In some embodiments of the therapeutic methods, uses, and compositions disclosed herein, the therapeutically effective amount of the antibody or antigen-binding fragment is about 170 mg to about 1500 mg administered once a month. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 300 mg to about 800 mg administered once a month. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 170 mg to about 300 mg administered once a month. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 300 mg to about 500 mg administered once a month. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 500 mg to about 700 mg administered once a month. In some embodiments, the therapeutically effective amount of the antibody or antigen-binding fragment is about 700 mg to about 900 mg administered once a month. In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 900 mg to about 1100 mg administered once a month. In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 1100 mg to about 1300 mg administered once a month. In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 1300 mg to about 1500 mg administered once a month.
[0173] In some embodiments of the therapeutic methods, uses and compositions disclosed herein, the therapeutically effective amount of the antibody or antigen-binding fragment is about 340 mg or about 680 mg (e.g., about 680 mg) administered once a week.
[0174] In some embodiments, treatment with an antibody, antigen-binding fragment at a dosage of about 340 mg or about 680 mg (e.g., about 680 mg) administered once weekly reduces the level of total serum IgG in the patient and / or sample of the patient by at least about 40% (e.g., about 40% to about 50%) after about 1 or 2 weeks of weekly administration compared to the level of total serum IgG in the patient and / or sample before treatment. In some embodiments, treatment with an antibody, antigen-binding fragment at a dosage of about 340 mg or about 680 mg (e.g., about 680 mg) administered once weekly reduces the level of total serum IgG in the patient and / or sample of the patient by at least about 60% (e.g., about 60% to about 70%) after about 3 weeks of weekly administration compared to the level of total serum IgG in the patient and / or sample before treatment. In some embodiments, treatment with an antibody or antigen-binding fragment at a dosage of about 340 mg or about 680 mg (e.g., about 680 mg) administered once weekly reduces the total serum IgG level in the patient and / or sample by at least about 70% (e.g., about 70% to about 80%) after about 5 weeks of weekly administration compared to the total serum IgG level in the patient and / or sample before treatment. In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 680 mg administered once weekly. In some embodiments, the therapeutically effective dose of the antibody or antigen-binding fragment is about 680 mg administered once weekly for at least 2 weeks (e.g., 2, 3, 4, 5, 6, 7, 8, 10, 12 weeks or more, e.g., 4, 7, 12 weeks or more).
[0175] In some embodiments, treatment with an antibody or antigen-binding fragment at a dosage of about 340 mg or about 680 mg (e.g., about 680 mg) administered once weekly increases the level of hemoglobin in the patient and / or sample of the patient by about 10% (e.g., about 10% to about 15%) after about 1 or 2 weeks of weekly administration compared to the hemoglobin level of the patient and / or sample before treatment. In some embodiments, treatment with an antibody or antigen-binding fragment at a dosage of about 340 mg or about 680 mg (e.g., about 680 mg) administered once weekly increases the level of hemoglobin in the patient and / or sample of the patient by about 20% (e.g., about 20% to about 25%) after about 1 or 2 weeks of weekly administration compared to the hemoglobin level of the patient and / or sample before treatment. In some embodiments, an increase in hemoglobin levels in the patient and / or the patient's sample (e.g., an increase of about 10%, about 20%, or more) is maintained for the entire treatment period or part thereof. In some embodiments, an increase in hemoglobin levels in the patient and / or the patient's sample (e.g., an increase of about 10%, about 20%, or more) is maintained for at least 2, 3, or 4 weeks (e.g., 4 weeks or more). In some embodiments, an increase in hemoglobin levels in the patient and / or the patient's sample (e.g., an increase of about 10%, about 20%, or more) is maintained for about 2 to about 6 weeks. In some embodiments, a therapeutically effective dose of the antibody or antigen-binding fragment is about 680 mg administered once a week for at least 2 weeks (e.g., 2, 3, 4, 5, 6, 7, 8, 10, 12 weeks or more, e.g., 4, 7, 12 weeks or more).
[0176] In various embodiments, the present disclosure provides a kit for use in therapeutic applications described herein. In various embodiments, the present disclosure provides a kit comprising an anti-FcRn antibody or an antigen-binding fragment thereof for use in the treatment or prevention of hyperthermia autoimmune hemolytic anemia. In various embodiments, the kit further comprises, but is not limited to, one or more components including: instructions for use; other agents, e.g., one or more additional therapeutic agents (e.g., one or more standard therapeutic agents); an apparatus, container, or other material for preparing the antibody or antigen-binding fragment for therapeutic administration; a pharmaceutically acceptable carrier (e.g., an excipient); and an apparatus, container, or other material for administering the antibody or antigen-binding fragment to a patient. The instructions for use may include a guide for therapeutic application, for example, including a suggested dosage and / or mode of administration in a patient who has or is suspected of having hyperthermia autoimmune hemolytic anemia. In various embodiments, the kit comprises an anti-FcRn antibody or its antigen-binding fragment and instructions for the use of the antibody or antigen-binding fragment for therapeutic use, e.g., to treat or prevent hyperthermia or autoimmune hemolytic anemia in a patient. In various embodiments, the kit further comprises at least one additional therapeutic agent (e.g., for co-administration with the antibody or antigen-binding fragment). In various embodiments, the antibody or antigen-binding fragment is formulated as a pharmaceutical composition.
[0177] In some embodiments, the anti-FcRn antibody or antigen-binding fragment is produced by expression and purification using a genetic recombination method. In some embodiments, the polynucleotide sequence encoding the variable region of the antibody or antigen-binding fragment is produced by simultaneous expression in individual host cells or in a single host cell.
[0178] As used herein, the term “recombinant vector” refers to an expression vector capable of expressing a target protein in a suitable host cell. The term includes a DNA construct comprising essential regulatory elements operably linked to express a nucleic acid insert.
[0179] As used herein, the term "operably linked" refers to a nucleic acid expression regulatory sequence functionally linked to a nucleic acid sequence encoding a target protein to perform a general function. Operable linkage with a recombinant vector can be performed using gene recombination techniques well known in the art, and site-specific DNA cleavage and ligation can be easily performed using enzymes generally known in the art.
[0180] Suitable expression vectors may include expression regulatory elements such as promoters, operators, start codons, stop codons, polyadenylation signals, and enhancers, as well as signal sequences for membrane targeting or secretion. Start and stop codons are generally considered to be part of a nucleotide sequence encoding an immunogenic target protein, must be functional in the individual to whom the gene construct is administered, and must be within a frame containing the coding sequence. Promoters may generally be constitutive or inductive. Prokaryotic promoters include, but are not limited to, lac, tac, T3, and T7 promoters. Eukaryotic promoters include, but are not limited to, human immunodeficiency virus (HIV) promoters such as the Simian virus 40 (SV40) promoter, the mouse mammary tumor virus (MMTV) promoter, the HIV Long Terminal Repeat (LTR) promoter, the Moloney virus promoter, the cytomegalovirus (CMV) promoter, the Epstein-Barr virus (EBV) promoter, the rous sarcoma virus (RSV) promoter, and promoters of human gene origin such as human β-actin, human hemoglobin, human muscle creatine, and human metallothionein. The expression vector may include a selection marker that enables the selection of a host cell containing the vector. Genes encoding products that confer selectable phenotypes, such as drug resistance, nutritional requirements, or resistance to cytotoxic agents or the expression of surface proteins, can be used as general selection markers. Transformed cells can be selected because only cells expressing the selection marker survive in an environment treated with the selector.Additionally, the replicable expression vector may include a replication origin, which is a specific nucleic acid sequence that initiates replication. Recombinant expression vectors that can be used include various vectors such as plasmids, viruses, and cosmids. The types of recombinant vectors are not limited, and recombinant vectors can function to express desired genes and produce desired proteins in various host cells, such as prokaryotic and eukaryotic cells. In some embodiments, a promoter exhibiting strong activity and a vector capable of producing large amounts of foreign proteins similar to natural proteins with strong expression capacity are used.
[0181] Various expression host / vector combinations may be used to express anti-FcRn antibodies or their antigen-binding fragments. For example, expression vectors suitable for eukaryotic hosts include, but are not limited to, SV40, bovine papillomavirus, adenovirus, adeno-associated virus, cytomegalovirus, and retrovirus. Expression vectors that may be used for bacterial hosts include bacterial plasmids such as pET, pRSET, pBluescript, pGEX2T, pUC, col E1, pCR1, pBR322, pMB9, and their derivatives; plasmids with a broader host range such as RP4; phage DNA represented by various phage lambda derivatives such as gt10, gt11, and NM989; and other DNA phages such as M13 and filamentous single-stranded DNA phages. Expression vectors useful for yeast cells include 2 µm plasmids and their derivatives. The vector useful for insect cells is pVL941.
[0182] In some embodiments, the recombinant better is introduced into a host cell to form a transformant. Host cells suitable for use include prokaryotic cells such as E. coli, Bacillus subtilis, Streptomyces sp., Pseudomonas sp., Proteus mirabilis, and Staphylococcus sp., fungi such as Aspergillus sp., yeasts such as Pichia pastoris, Saccharomyces cerevisiae, Schizosaccharomyces sp., and Neurospora crassa, and other higher eukaryotic cells such as lower eukaryotic cells and insect cells.
[0183] In some embodiments, the host cell is derived from a plant or animal (e.g., mammal), examples thereof include, but are not limited to, monkey kidney cells (COS7), NSO cells, SP2 / 0, Chinese hamster O'Barry (CHO) cells, W138, baby hamster kidney (BHK) cells, MDCK, myeloma cells, HuT 78 cells, and HEK293 cells. In some embodiments, CHO cells are used.
[0184] Transfection or transformation into a host cell may involve any method by which nucleic acid can be introduced into an organism, cell, tissue, or organ, and may be performed using a suitable standard technique selected according to the type of host cell as known in the art. Methods include, but are not limited to, electroporation, protoplast fusion, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, stirring with silicon carbide fibers, and Agarobacterium-, PEG-, dextran sulfate-, lipofectamine-, and drying / inhibition-mediated transformation.
[0185] Anti-FcRn antibodies or antigen-binding fragments can be produced in large quantities by culturing transformants containing recombinant vectors in nutrient media, and the media and culture conditions used can be selected according to the type of host cell. During culture, conditions including temperature, media pH, and culture time can be adjusted to suit cell growth and the large-scale production of proteins. Antibodies or antigen-binding fragments produced by recombinant methods as described herein can be collected from media or cell lysates and can be isolated and purified by traditional biochemical separation techniques (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press (1989); Deuscher, Guide to Protein Purification Methods Enzymology, Vol. 182. Academic Press. Inc., San Diego, CA (1990)). These techniques include, but are not limited to, electrophoresis, centrifugation, gel filtration, precipitation, dialysis, chromatography (e.g., ion exchange chromatography, affinity chromatography, immunosorbent chromatography, size exclusion chromatography, etc.), isoelectric point concentration, and various modifications and combinations thereof. In some embodiments, the antibody or antigen-binding fragment is separated and purified using protein A.
[0186] Examples
[0187] The present invention will be described in more detail below with reference to examples. It will be apparent to those skilled in the art that these examples are for illustrative purposes only and should not be construed as limiting the scope of the present disclosure.
[0188] Example 1: Preparation of an anti-FcRn antibody expression library using transgenic rats
[0189] Immunization was performed using a total of six transgenic rats (OmniRat, OMT). Human FcRn was used as the immunogen. The rats were immunized eight times over 24 days at 3-day intervals with 0.0075 mg of human FcRn (each dose) accompanied by an adjuvant on both paw pads. On day 28, the rats were immunized with 5–10 µg of immunogen diluted in PBS buffer. Rat serum was collected on day 28 to measure antibody titers. On day 31, the rats were euthanized, and the popliteal and inguinal lymph nodes were recovered to fuse with P3X63 / AG8.653 myeloma cells.
[0190] ELISA analysis was performed to measure antibody titers in rat serum. Specifically, human FcRn was diluted in PBS (pH 6.0 or pH 7.4) buffer to prepare a 2 µg / mL solution, and 100 µL of the solution was coated into each well of a 96-well plate and incubated at 4°C for at least 18 hours. Each well was washed three times with 300 µL of washing solution (0.05% Tween 20 in PBS) to remove unbound human FcRn, followed by the addition of 200 µL of blocking buffer and incubation at room temperature for 2 hours. The test serum sample was diluted 1 / 100, and the solution was serially diluted twofold to prepare a total of 10 test samples with dilution ratios ranging from 1 / 100 to 1 / 256,000. After blocking, each well was washed with 300 μL of wash solution, then each test sample was added to each cell and incubated at room temperature for 2 hours. After washing three times, the secondary antibody was diluted to 1:50,000 in PBS buffer, 100 μL was added to each well, and incubated at room temperature for 2 hours. After washing three times again, 100 μL of TMB solution was added to each well and incubated at room temperature for 10 minutes. Then, 50 μL of 1M sulfuric acid-containing stop solution was added to each well to terminate the reaction, and the OD value was measured at 450 nm using a microplate reader. The anti-human FcRn (hFcRn) IgG titer due to immunization was higher than that in the rat serum prior to immunization.
[0191] A total of three hybridoma libraries, A, B, and C, were constructed using polyethylene glycol. Specifically, Hybridoma Library A was constructed using transgenic rats 1 and 5, Hybridoma Library B using rats 2 and 6, and Hybridoma Library C using rats 3 and 4. The fusion mixtures for each hybridoma library were cultured in a medium containing HAT for 7 days to ensure that only cells fused by HAT were selected. Hybridoma cells that survived in the HAT medium were collected and cultured in HT medium for approximately 6 days; subsequently, the supernatant was taken to measure the amount of rat IgG using a rat IgG ELISA kit (RD-biotech). Specifically, each sample was diluted 1:100, 100 μL was added to ELISA plate wells, mixed with peroxidase-conjugated anti-rat IgG, and incubated at room temperature for 15 minutes. 100 μL of TMB solution was added to each well and reacted at room temperature for 10 minutes, after which 50 μL of 1M sulfuric acid-containing reaction termination solution was added to each well to terminate the reaction. Next, the OD value was measured at 450 nm using a microplate reader.
[0192] Example 2: Evaluation of Antigen Binding Ability and IgG Binding Blocking Ability of Anti-hFcRn Antibodies in Hybridoma Library
[0193] To analyze the binding affinity of the antibody to hFcRn, the same ELISA assay (pH 6.0 and pH 7.4) as mentioned above was performed.
[0194] hFcRn binding affinity was evaluated by FACS at 5 ng / mL and 25 ng / mL using the culture supernatant of three hybridoma libraries at pH 6.0 and pH 7.4. HEK293 cells stably expressing human FcRn were detached from flasks and suspended in reaction buffer (PBS containing 0.05% BSA, pH 6.0 or pH 7.4). The suspension was divided into 2 x 10⁶ 6The solution was diluted to a cell density of cells / mL, and 50 μL of the diluent was added to each well of a 96-well plate. Then, 50 μL of hybridoma library culture supernatant, diluted to 10 ng / mL and 50 ng / mL respectively, was added to each well and suspended to conjugate antibodies. The A488 Rabbit anti-IgG goat antibody was diluted 1:200 in the reaction solution, and 100 μL of the diluent was added to each well and mixed with the cell pellet to perform the conjugation reaction; subsequently, 150 μL of reaction buffer was added to each well. Measurements were performed using FACS (BD).
[0195] Evaluation of the human FcRn inhibitory activity of the hybridoma library by FACS was performed at pH 6.0. Specifically, naive HEK293 cells and human FcRn-overexpressing HEK293 cells were suspended in reaction buffer (PBS containing 0.05% BSA, pH 6.0). 1 x 10⁶ 5 Cells were placed in 96-well plates, and each well was treated with the culture supernatant of a 4 nM hybridoma library and a 10-fold diluted supernatant of 0.4 nM. To confirm hIgG binding inhibition, 100 nM A488-hIgG1 was added to each well and incubated on ice for 90 minutes. After the reaction was complete, the cell pellet was washed with 100 μL of reaction buffer, transferred to a U-shaped round-bottom tube, and measured by FACS. The amount of 100 nM A488-hIgG1 remaining in human FcRn-overexpressing stabilized cells was measured, and the binding inhibition (%) was calculated. hIgG1 was used as an isotype control, and the previously developed HL161-1 Ag antibody was used as a positive control to compare and evaluate antibody binding inhibition. Each control group was analyzed at concentrations of 1 μM and 2 μM, and hybridoma library samples were measured at two concentrations of 0.4 nM and 4 nM.
[0196] Example 3: Isolation of hybridoma clones by FACS and acquisition of human antibodies
[0197] Using Hybridoma Library A, which had the highest human FcRn binding affinity and inhibition ability, clones were isolated by FACS (flow cytometry) to obtain a total of 442 single clones. The isolated single clones were cultured in HT medium, and the supernatant was obtained. Antibody-expressing hybridoma clones that bind to hFcRn were selected by FACS.
[0198] RNA was isolated from 100 single clones selected by FACS analysis, and the isolated RNA was sequenced. In the first sequencing, 88 sequences out of the 100 single clones were analyzed and divided into a total of 35 groups (G1–G38) based on amino acid sequences. The culture supernatant of representative clones from 33 groups, excluding two clones (G33 and G35) for which culture medium could not be obtained, was diluted to a concentration of 100 ng / mL, and the binding affinity to hFcRn was evaluated by ELISA.
[0199] In the same manner as above, hFcRn binding strength evaluation using FACS was performed at pH 6.0 and 7.4. The rankings based on the degree of binding strength between clones were similar across pH levels, and binding strengths varied.
[0200] In addition, the hFcRn inhibitory activity of the above 33 clones was evaluated using FACS at pH 6.0. Inhibitory activity (%) was calculated based on the measured MFI values. Based on the results of the inhibitory activity (%) analysis at a concentration of 1667 pM, the clones were divided into the following four groups (Group A: 70-100%; Group B: 30-70%; Group C: 10-30%; and Group D: ≤10%).
[0201] For the kinetic analysis of hybridoma clones by surface plasmon resonance, human FcRn was immobilized, and the hybridoma culture medium was used as the analyte.
[0202] The genes of 18 clones that lacked an N-glycosylation site or free cysteine in the CDR sequence region among the antibody sequences of groups A and B, which were divided according to the results of the analysis of hFcRn inhibition ability among the 5 hybridoma clones, were converted into a complete human IgG sequence.
[0203] Specifically, amino acid sequence homology between 18 selected antibodies and VH and VL of the human germ line antibody group was investigated using the Ig BLAST program on the NCBI web page.
[0204] To clone 18 human antibody genes, restriction enzyme recognition sites were inserted at both ends of the genes in the following manner: EcoRI / Apal was inserted into the heavy chain variable domain (VH), EcoRI / Xhol into the light chain lambda variable domain (VL(λ)), and EcoRI / Nhel into the light chain kappa variable domain (VL(κ)). For the light chain variable domains, during gene cloning, the light chain lambda variable (VL(λ)) gene sequence was linked to the human light chain constant (LC(λ)) region gene, and the light chain kappa variable (VL(κ)) gene sequence was linked to the human light chain constant (LC(κ)) region gene.
[0205] When cloning into pCHOl.O expression vectors for antibody expression in animal cells, light and heavy chain genes were inserted after being cleaved with EcoRV, Pad, AvrII, and BstZl7I restriction enzymes. DNA sequencing was performed to verify whether the 18 selected pCHOl.O expression vectors containing human antibody genes matched the synthesized gene sequences.
[0206] Complete human IgG was expressed using the pCHO1.O expression vector, an animal cell expression system containing all antibody light and heavy chain genes. Human antibodies were obtained by transiently transfecting CHO-S cells with the plasmid DNA of each antibody and purifying the antibodies secreted into the medium using a protein A column.
[0207] Human IgG was injected into hFcRn-expressing Tg32 (hFcRn+ / +, hβ2m+ / +, mFcRn- / -, mβ2m- / -) mice (Jackson Laboratory), and then 18 types of human antibodies converted to the human IgG sequences were administered to investigate whether the antibodies affected the catabolic activity of human IgG.
[0208] Binding affinity to antigen (K D Based on in vitro analysis results, such as the analysis of human FcRn binding affinity and inhibitory ability using FACS, and in vivo analysis of the catabolic activity of human IgG, four types of human anti-FcRn antibody proteins (HL161A, HL161B, HL161C, and HL161D) were obtained (Fig. 1). In addition, the HL161BK antibody, which lacks an N-glycosylation site, was prepared by substituting the asparagine (N) at the 83rd position of the heavy chain variable domain region of the HL161B antibody with lysine (K). Furthermore, the HL161BKN antibody (RVT-1401) was prepared by substituting the lysine (K) at the 238th and 239th positions of the heavy chain (i.e., within the IgG1 heavy chain constant region) of the HL161BK antibody with alanine (A). The nucleotide sequences, amino acid sequences, and CDR sequences of the selected human FcRn antibodies are shown in Tables 1-5.
[0209] Polynucleotide sequences of the heavy and light chain variable domains of selected human FcRn antibodies Antibody name Heavy chain variable domain sequence Light chain variable domain sequence Sequence number. Polynucleotide sequence Sequence number. Polynucleotide sequence HL161A 1 GAAGTGCAGC TGCTGGAATC CGGCGGAGGC CTGGTGCAGC CTGGCGGCTC TCTGAGACTG TCCTGCGCCG CCTCCGAGTT CACCTTCGGC AGCTGCGTGA TGACCTGGGT CCGACAGGCT CCCGGCAAGG GCCTGGAATG GGTGTCCGTG ATCTCCGGCT CCGGCGGCTC CACCTACTAC GCCGACTCTG TGAAGGGCCG GTTCACCATC TCCCGGGACA ACTCCAAGAA CACCCTGTAC CTGCAGATGA ACTCCCTGCG GGCCGAGGAC ACCGCCGTGT ACTACTGCGC CAAGACCCCC TGGTGGCTGC GGTCCCCCTT CTTCGATTAC TGGGGCCAGG GCACCCTGGT GACAGTGTCC TCC 11 TCTTACGTGC TGACCCAGCC CCCCTCCGTG TCTGTGGCTC CTGGCCAGAC CGCCAGAATC ACCTGTGGCG GCAACAACAT CGGCTCCACC TCCGTGCACT GGTATCAGCA GAAGCCCGGC CAGGCCCCCG TGCTGGTGGT GCACGACGAC TCCGACCGGC CTTCTGGCAT CCCTGAGCGG TTCTCCGGCT CCAACTCCGG CAACACCGCC ACCCTGACCA TCTCCAGAGT GGAAGCCGGC GACGAGGCCG ACTACTACTG CCAAGTGCGA GACTCCTCCT CCGACCACGT GATCTTCGGC GGAGGCACCA AGCTGACCGT GCTGGGCCAG CCTAAGGCCG CTCCCTCCGT GACCCTG HL161B 3 CAACTGTTGC TCCAGGAATC CGGTCCTGGT CTTGTAAAGC CATCTGAGAC TCTCTCCCTT ACCTGTACCG TTAGCGGAGG AAGTCTTTCC TCAAGCTTCT CCTACTGGGT GTGGATCAGA CAGCCTCCCG GAAAAGGGTT GGAGTGGATT GGCACAATAT ACTACTCCGG CAACACTTAC TATAACCCCA GCCTGAAGAG CAGGCTGACT ATCTCTGTCG ACACCAGTAA AAATCACTTT TCTCTGAATC TGTCTTCAGT GACCGCAGCC GACACCGCCG TGTATTATTG CGCTCGGCGC GCCGGGATTC TGACAGGCTA TCTGGATTCA TGGGGCCAGG GGACATTGGT TACAGTGTCT AGT 13 TCTTACGTGC TGACCCAGTC CCCCTCCGTG TCCGTGGCTC CTGGCCAGAC CGCCAGAATC ACCTGTGGCG GCAACAACAT CGGCTCCAAG TCCGTGCACT GGTATCAGCA GAAGCCCGGC CAGGCCCCCG TGCTGGTGGT GTACGACGAC TCCGACCGGC CCTCTGGCAT CCCTGAGCGG TTCTCCGCCT CCAACTCCGG CAACACCGCC ACCCTGACCA TCTCCAGAGT GGAAGCCGGC GACGAGGCCG ACTACTACTG CCAAGTGTGG GACTCCTCCT CCGACCACGT GGTGTTCGGC GGAGGCACCA AGCTGACCGT GCTGGGCCAG CCTAAGGCCG CTCCCTCCGT GACCCTG HL161BK(HL161BKN) 5 CAGCTGCTGC TGCAAGAATC CGGCCCTGGC CTGGTGAAAC CCTCCGAGAC ACTGTCCCTG ACCTGCACCG TGTCCGGCGG CTCCCTGTCC TCCAGCTTCT CCTACTGGGT CTGGATCCGG CAGCCCCCTG GCAAGGGCCT GGAATGGATC GGCACCATCT ACTACTCCGG CAACACCTAC TACAACCCCA GCCTGAAGTC CCGGCTGACC ATCTCCGTGG ACACCTCCAA GAACCACTTC AGCCTGAAGC TGTCCTCCGT GACCGCCGCT GACACCGCCG TGTACTACTG TGCCAGAAGG GCCGGCATCC TGACCGGCTA CCTGGACTCT TGGGGCCAGG GCACCCTGGT GACAGTGTCC TCC 15 TCTTACGTGC TGACCCAGTC CCCCTCCGTG TCCGTGGCTC CTGGCCAGAC CGCCAGAATC ACCTGTGGCG GCAACAACAT CGGCTCCAAG TCCGTGCACT GGTATCAGCA GAAGCCCGGC CAGGCCCCCG TGCTGGTGGT GTACGACGAC TCCGACCGGC CCTCTGGCAT CCCTGAGCGG TTCTCCGCCT CCAACTCCGG CAACACCGCC ACCCTGACCA TCTCCAGAGT GGAAGCCGGC GACGAGGCCG ACTACTACTG CCAAGTGTGG GACTCCTCCT CCGACCACGT GGTGTTCGGC GGAGGCACCA AGCTGACCGT GCTGGGCCAG CCTAAGGCCG CTCCCTCCGT GACCCTG HL161C 7 CAGGTGCAGC TCGTGCAGTC CGGCGCAGAG GTCAAAAAGC CTGGTGCATC TGTGAAAGTG AGTTGCAAGG CTAGCGGCTA CACCTTTACC GGATGTTATA TGCATTGGGT ACGCCAAGCC CCCGGACAAG GCTTGGAATG GATGGGGCGT ATCAACCCAA ACTCTGGCGG GACTAATTAC GCCCAGAAGT TTCAGGGAAG GGTGACTATG ACAAGGGACA CATCCATATC CACCGCTTAT ATGGACCTGT CTCGACTGCG GTCTGATGAT ACAGCCGTTT ATTACTGCGC CAGAGACTAC AGCGGATGGA GCTTCGATTA TTGGGGGCAG GGTACTTTGG TCACAGTTTC AAGT 17 GACATCCAGA TGACCCAGTC ACCATCATCC CTTTCCGCAT CTGTCGGAGA TAGAGTGACT ATCACCTGCA GGGCTTCTCA AGGTATTTCC AACTACCTCG CCTGGTTCCA GCAAAAGCCA GGTAAAGCCC CAAAGAGCTT GATCTACGCC GCTTCTAGTC TGCAGATTGGTT AAGTTCCTT GCTCTGGCAG TGGCACAGAT TTTACCTTGA CCATTTCCAG CCTGCAGTCT GAGGATTTCG CTACCTACTA TTGTCAGCAG TATGACAGCT ATCCCCCCAC ATTTGGGGGG GGCACTAAGG TGGAGATAAA ACGGACAGTG GCTGCCCCTT CTGTCTTTAT T HL161D 9 CAGCTGCAGT TGCAGGAGTC AGGCCCCGGT TTGGTTAAGC CTTCTGAAAC CCTTTCTCTC ACATGCACAG TATCCGGTGG CTCCATCTCC AGTTCAAGTT ACTACTGGGG ATGGATCCGG CAACCCCCAG GAAAAGGGCT GGAGTGGATT GATTACTATGCTATGGCCAT TACAACCCTT CCCTGATGAG TAGAGTGACC ATCAGCGTGG ACACAAGCAA AAACCAATTC AGCCTGAAGC TTTCTAGCGT GACCGCTGCC GACACAGCTG TCTATTACTG TGCCCGCCAG CTTAGTTATA ACTGGAATGA TAGGCTGTTT GATTACTGGGGCCAGGTCGTC GTCGAGTC 19 AGCTATGAGC TGACCCAGCC TCTGAGCGTA TCTGTCGCTC TCGGCCAGAC AGCCAGAATT ACCTGTGGCG GCAATAACAT AGGATCCAAA AATGTTCACT GGTATCAGCA AAAACCTGGC CAAGCTCCCG TGCTCGTGAT CTACCGGGAC TCTAACCGAC CCAGTGGAAT CCCCGAACGC TTTAGCGGTT CCAACTCTGG AAATACAGCT ACTCTGACTA TCTCCAGGGC TCAGGCCGGG GATGAGGCCG ATTACTACTG CCAGGTGGG GACTCAAGCA CAGTGGTCTT CGGCGGAGGT ACCAAGTTGA CTGTTCTTGG GCAGCCAAAG GCCGCACCTT CAGTGACCCT G
[0210] Amino acid sequences of the heavy and light chain variable domains of selected human FcRn antibodies Antibody name Heavy chain variable domain sequence Light chain variable domain sequence Sequence number. amino acid sequence Sequence number. amino acid sequence HL161A 2 EVQLLESGGG LVQPGGSLRL SCAASEFTFG SCVMTWVRQA PGKGLEWVSV ISGSGGSTYY ADSVKGRFTI SRDNSKNTLY LQMNSLRAED TAVYYCAKTP WWLRSPFFDY GQGTLVTVSS 12 SYVLTQPPSV SVAPGQTARI TCGGNNIGST SVHWYQQKPG QAPVLVVHDD SDRPSGIPER FSGSNSGNTA TLTISRVEAG DEADYYCQVR DSSSDHVIFG GGTKLTVLGQ PKAAPSVTL HL161B 4 QLLLQESGPG LVKPSETLSL TCTVSGGSLS SSFSYWVWIR QPPGKGLEWI GTIYYSGNTY YNPSLKSRLT ISVDTSKNHF SLNLSSVTAA DTAVYYCARR AGILTGYLDS GQGTLVTVSS 14 SYVLTQSPSV SVAPGQTARI TCGGNNIGSK SVHWYQQKPG QAPVLVVYDD SDRPSGIPER FSASNSGNTA TLTISRVEAG DEADYYCQVW DSSSDHVVFG GGTKLTVLGQ PKAAPSVTL HL161BK(HL161BKN) 6 QLLLQESGPG LVKPSETLSL TCTVSGGSLS SSFSYWVWIR QPPGKGLEWI GTIYYSGNTY YNPSLKSRLT IVDTSKNHF SLKLSSVTAA DTAVYYCARR AGILTGYLDS WGQGTLVTVSS 16 SYVLTQSPSV SVAPGQTARI TCGGNNIGSK SVHWYQQKPG QAPVLVVYDD SDRPSGIPER FSASNSGNTA TLTISRVEAG DEADYYCQVW DSSSDHVVFG GGTKLTVLGQ PKAAPSVTL HL161C 8 QVQLVQSGAE VKKPGASVKV SCKASGYTFT GCYMHWVRQA PGQGLEWMGR INPNSGGTNY AQKFQGRVTM TRDTSISTAY MDLSRLRSDD TAVYYCARDY SGWSFDYWGQ GTLVTVSS 18 DIQMTQSPSS LSASVGDRVT ITCRASQGIS NYLAWFQQKP GKAPKSLIYA ASSLQSGVPS KFSGSGSGTD FTLTISSLQS EDFATYYCQQ YDSYPPTFGG GTKVEIKRTV AAPSVFI HL161D 10 QLQLQESGPG LVKPSETLSL TCTVSGGSIS SSSYYWGWIR QPPGKGLEWI GNIYYSGSTY YNPSLMSRVT ISVDTSKNQF SLKLSSVTAA DTAVYYCARQ LSYNWNDRLF DYWGQGTLVT VSS 20 SYELTQPLSV SVALGQTARI TCGGNNIGSK NVHWYQQKPG QAPVLVIYRD SNRPSGIPER FSGSNSGNTA TLTISRAQAG DEADYYCQVW DSSTVVFGGG TKLTVLGQPK AAPSVTL
[0211]
[0212]
[0213]
[0214]
[0215] Amino acid sequences of the full-length heavy and light chains of selected human FcRn antibodies Antibody name heavy chain sequence Light chain sequence Sequence number. amino acid sequence Sequence number. amino acid sequence HL161BKN 46 QLLLQESGPG LVKPSETLSL TCTVSGGSLS SSFSYWVWIR QPPGKGLEWI GTIYYSGNTY YNPSLKSRLT ISVDTSKNHF SLKLSSVTAA DTAVYYCARR AGILTGYLDS WGQGTLVTVS SASTKGPSVF PLAPSSKSTS GGTAALGCLV KDYFPEPVTV SWNSGALTSG VHTFPAVLQS SGLYSLSSVV TVPSSSLGTQ TYICNVNHKP SNTKVDKRVE PKSCDKTHTC PPCPAPEAAG GPSVFLFPPK PKDTLMISRT PEVTCVVVDV SHEDPEVKFN WYVDGVEVHN AKTKPREEQY NSTYRVVSVL TVLHQDWLNG KEYKCKVSNK ALPAPIEKTI SKAKGQPREP QVYTLPPSRE EMTKNQVSLT CLVKGFYPSD IAVEWESNGQ PENNYKTTPP VLDSDGSFFL YSKLTVDKSR WQQGNVFSCS VMHEALHNHY TQKSLSLSPG 48 SYVLTQSPSV SVAPGQTARI TCGGNNIGSK SVHWYQQKPG QAPVLVVYDD SDRPSGIPER FSASNSGNTA TLTISRVEAG DEADYYCQVW DSSSDHVVFG GGTKLTVLGQ PKAAPSVTLF PPSSEELQAN KATLVCLISD FYPGAVTVAW KADSSPVKAG VETTTPSKQS NNKYAASSYL SLTPEQWKSH RSYSCQVTHE GSTVEKTVAP TECS
[0216] CDR sequences of the heavy and light chain variable domains of selected human FcRn antibodies Antibody name Heavy chain variable domain CDR Light chain variable domain CDR CDR1 CDR2 CDR3 CDR1 CDR2 CDR3 Sequence number. 21 22 23 24 25 26 HL161A scvmt visgsggstyyadsvkg tpwwlrspffdy ggnnigstsvh ddsdrps vrdsssdhvi Sequence number. 27 28 29 30 31 32 HL161B(HL161BK)(HL161BKN) fsywv tiyysgntyynpslks ragiltgylds ggnnigsksvh ddsdrps qvwdsssdhvv Sequence number. 33 34 35 36 37 38 HL161C GCYMH RINPNSGGTNYAQKFQG DYSGWSFDY RASQGISNYLA AASSLQS QQYDSYPPTF Sequence number. 39 40 41 42 43 44 HL161D SYYWG NIYYSGSTYYNPSLMS QLSYNWNDRLFDY GGNNIGSKNVH RDSNRPS QVWDSSTVV
[0217] Example 4: Measurement of Antigen Binding Affinities of HL161A, HL161B, HL161C, and HL161D Antibodies by Surface Plasmon Resonance (SPR)
[0218] The binding affinity of antibodies HL161A, HL161B, HL161C, and HL161D via surface plasmon resonance was measured by immobilizing water-soluble hFcRn as a ligand on a Proteon GLC chip (Bio-Rad). Kinetic analysis was performed using the Proteon XPR36 system. Water-soluble human FcRn (shFcRn) was immobilized on the GLC chip, and sensorogram results were obtained by reacting antibody samples at a concentration of 5. A 1:1 Langmuir binding model was applied for kinetic analysis, and the analysis was repeated six times at pH 6.0 and pH 7.4, respectively, to obtain the average K DValues were calculated. After the immobilization step, the chip was activated under conditions of EDAC / NHS 0.5X, 30 μL / min, and 300 seconds. For immobilization, shFcRn was diluted to a concentration of 2 μg / mL and 250 μL in acetate buffer (pH 5.5), and the diluted solution was flowed onto the chip at a rate of 30 μL / min. The reaction was stopped when the immobilization level reached 200-300 RU. Subsequently, inactivation was carried out using ethanolamine at a rate of 30 μL / min for 300 seconds. Samples were prepared by serially diluting each HL161 antibody to concentrations ranging from 10 nM to 5 nM, 2.5 nM, 1.25 nM, 0.625 nM, and 0.312 nM. Sample dilution was performed using 1X PBST (pH 7.4) or IX PBST (pH 6.0) at each pH. For sample analysis, binding was performed at 50 μL / min for 200 seconds, followed by a dissociation step at 50 μL / min for 600 seconds, and then regeneration was performed using glycine buffer (pH 2.5) at 100 μL / min for 18 seconds. After 6 kinetic analyses per sample, the mean antigen binding strength (K D ) was measured. The kinetic parameters of the antibody resulting from surface plasmon resonance analysis are shown in Table 6 (Figs. 2a to 2h).
[0219] Results of antibody kinetic analysis by human FcRn immobilized surface plasmon resonance antibodies pH 6.0 pH 7.4 k on (M -1 s -1 ) k off (s -1 ) K D (M) k on (M -1 s -1 ) k off (s -1 ) K D (M) HL161A 1.81×10 6 3.26×10 -4 1.80×10 -10 1.32×10 6 3.27×10 -4 2.47×10 -10 HL161B 9.12×10 5 7.35×10 -4 8.07×10 -10 7.10×10 5 1.25×10 -3 1.76×10 -9 HL161C 1.74×10 6 3.32×10 -4 1.91×10 -10 1.36×10 6 3.16×10 -4 2.32×10 -10 HL161D 9.70×10 5 1.38×10 -3 1.43×10 -9 6.99×10 5 1.24×10 -3 1.78×10 -9 hIgG1 3.2×10 5 4.6×10 -4 1.4×10 -9 No combination No combination No combination
[0220] Example 5: Analysis of human FcRn binding of HL161A and HL161B antibodies by FACS
[0221] The degree of binding to FcRn at each pH was analyzed using a FACS system on HEK293 cells stably expressing human FcRn. FcRn binding assays using FACS were performed in reaction buffers at pH 6.0 and pH 7.4. Specifically, 100,000 human FcRn-expressing stabilized HEK293 cells were washed with PBS buffer and centrifuged at 4,500 rpm for 5 minutes on a benchtop microcentrifuge to obtain a cell pellet. Antibodies were added to 100 μL of pH 6.0 or pH 7.4 PBS / 10 mM EDTA. Reaction buffer was added to the remaining cell pellet and mixed, and cell counting was performed. 10 μL of the cell suspension was placed on a slide, and the number of cells was counted using a TC10 system, then 2 x 10 6 The solution was diluted with reaction buffer to a concentration of cell / mL. Each antibody sample was diluted to 500 nM. For analysis at pH 6.0, the solution was diluted to 20 nM in a 96-well v-bottom plate, and 50 μL of the diluted solution was added to each well. For analysis at pH 7.4, the 500 nM antibody sample was diluted using a 3-fold serial dilution method and analyzed at concentrations ranging from 250 nM to 0.11 nM. 2 x 10⁶ 650 μL of cells diluted to cell / mL were added to each well and suspended. The plate was mounted on a rotator at 4° and rotated at 15° and 10 rpm for 90 minutes. After the reaction was complete, the plate was removed and centrifuged at 2000 rpm for 10 minutes to remove the supernatant. The A488 anti-hIgG goat antibody was diluted 1:200 in reaction buffer, and 100 μL of the antibody dilution was added to each well and suspended. Again, the plate was mounted on a rotator at 4° and rotated at 15° and 10 rpm for 90 minutes. After the reaction was complete, the plate was removed from the rotator and centrifuged at 2000 rpm for 10 minutes to remove the supernatant. After performing this washing process once more, 100 μL of reaction buffer was added to each well to loosen the cell pellet, and the plate was transferred to a blue test tube. Next, 200 μL of reaction buffer was added, and measurements were performed using FACS. The FACS measurement conditions were FS 108 volts, SS 426 volts, FL1 324 volts, and FL2 300 volts. These cells were analyzed by FACS using BD FACSDiva™ v6.1.3 software (BD Bioscience). The results were expressed as mean fluorescence intensity (MFI) (Fig. 3). The HL161A and HL161B antibodies showed MFI values of 10.59 and 8.34, respectively, at a concentration of 10 nM and pH 6.0. At pH 7.4 and concentrations of 0.11-250 nM, the antibodies showed EC50 (Effective Concentration 50%) values of 2.46 nM and 1.20 nM, respectively, when analyzed via 4-parameter logistic regression using MFI values.
[0222] Example 6: Analysis of the inhibitory activity of HL161A and HL161B antibodies by FACS
[0223] HL161A and HL161B antibodies (previously analyzed for binding affinity to cell-surface human FcRn) were treated to HEK293 cells expressing hFcRn on the cell surface, and the inhibitory effects of the antibodies were investigated based on the reduction in binding to Alexa-Fluo-488-fluorescently labeled hIgGl. The analysis procedure was performed as follows:
[0224] 2 mL of 1 x TE was added to each of the naive HEK293 cells and human FcRn-overexpressed stabilized HEK293 cells, and incubated for 1 minute in a 37 °C, 5% CO2 incubator. The cells were retrieved from the flask, 8 mL of reaction buffer (pH 6.0) was added, and the cells were transferred to a 50 mL conical tube. The supernatant was removed by centrifugation at 2000 rpm for 5 minutes, and 1 mL of reaction buffer (pH 6.0) was added to each cell pellet. Then, the cell suspension was transferred to a new 1.5 mL Eppendorf tube. The supernatant was removed by centrifugation again at 4000 rpm for 5 minutes. Then, reaction buffer (pH 6.0) was added to the remaining cell pellet, and the number of cells in the suspension was counted. Finally, the cell suspension is 2.5 x 10 6 It was diluted with reaction buffer to a concentration of cell / mL.
[0225] Each antibody sample was diluted to 400 nM and then serially diluted fourfold in a 96-well v-bottom plate. 50 μL of the samples diluted to final analytical concentrations ranging from 200 nM to 0.01 nM was dispensed into each well. Then, 10 μL of Alex488-hIgGl diluted with 1 μM reaction buffer (pH 6.0) was added to each well. Finally, 2.5 x 10 640 μL of cells diluted to cell / mL were added to each well and suspended. The plates were mounted on a rotator at 4°C and rotated at 15° and 10 rpm for 90 minutes. After the reaction was complete, the plates were removed and centrifuged at 2000 rpm for 10 minutes to remove the supernatant. 100 μL of reaction buffer was added to loosen the cell pellet, and it was transferred to a blue test tube. Subsequently, 200 μL of reaction buffer was added, and measurements were performed using FACS. The FACS measurement conditions were FS 108 volts, SS 426 volts, FL1 324 volts, and FL2 300 volts. These cells were analyzed using FACS with BD FACSDiva™ v6.1.3 software (BD Bioscience). The results were expressed as Mean Fluorescence Intensity (MFI). The MFI of the test group was processed by subtracting the MFI value measured through cells alone (background signal). The MFI of the control tubes (Alexa Fluor 488 alone, and no competitors) was converted to 100% to calculate the MFI percentage of the tubes containing competitors.
[0226]
[0227] When the MFI was lower than the MFI of the tube containing the human IgG1 competitor, the competition rate of the competitor antibody was determined to be high, and a four-factor logistic regression analysis was performed based on the inhibitory activity (%) of HL161A and HL161B antibodies under pH 6.0 and concentration conditions of 0.01-200 nM. As a result, it was confirmed that HL161A and HL161B antibodies exhibited IC50 (Inhibitory Concentration 50%) values of 0.92 nM and 2.24 nM, respectively (Fig. 4).
[0228] Example 7: Efficacy test of HL161A and HL161B in mFcRn - / - hFCRN transgenic 32 (Tg32) mice
[0229] After injecting human IgG into human FcRn-expressing Tg32 (hFcRn+ / +, hβ2m+ / +, mFcRn- / -, mβ2m- / -) mice (Jackson Laboratory), HL161A and HL161B were administered to the mice along with human IgG to investigate whether they affect the catabolism of human IgG.
[0230] Antibodies HL161A and HL161B and human IgG (Greencross, IVglobulinS) were prepared and stored at dosages of 5, 10, and 20 mg / kg for 4-day administration. PBS (phosphate buffered saline) buffer (pH 7.4) was used as the vehicle, and a 20 mg / kg IgG1 control was used. Human FcRn Tg32 mice were acclimatized for approximately 7 days and provided with free water and food. Temperature (23 ± 2 ℃), humidity (55 ± 5 %), and the light-dark cycle (12 hours) were automatically controlled. Each animal group consisted of 4 mice. To use human IgG as a tracer, biotin-conjugated hIgG was prepared using a kit (Pierce, Cat #. 21327). At 0 hours, 5 mg / kg of biotin-hIgG and 495 mg / kg of human IgG were administered intraperitoneally to saturate the body's IgG. The drugs were administered intraperitoneally once daily at doses of 5, 10, and 20 mg / kg 24, 48, 72, and 96 hours after the administration of biotin-IgG. Mice were lightly anesthetized with egg-laying fluid (Isoflurane, JW Pharmaceutical), and blood was collected from the orbital venous plexus using a heparinized micro-hematocrit capillary tube (Fisher). Blood collection was performed 24, 48, 72, 96, 120, and 168 hours after the administration of biotin-IgG, and the drugs were administered after blood collection at 24, 48, 72, and 96 hours. After receiving 0.1 mL of whole blood into an Eppendorf tube, the plasma was immediately separated by centrifugation and stored in a -70 ℃ freezer (Thermo) until analysis.
[0231] The amount of biotin-hIgG1 in collected blood was analyzed by ELISA as follows. 100 μL of nutravidin (Pierce, 31000) was injected into a 96-well plate (Costar, Cat. No: 2592) at a concentration of 1.0 μg / mL and immobilized at 4°C for 16 hours. The plate was washed three times with buffer A (0.05% Tween-20, 10 mM PBS, pH 7.4) and then incubated at room temperature for 2 hours with a 1% BSA-containing PBS (pH 7.4) solution. Next, the plate was washed three times with buffer A, and a nutravidin plate was prepared with a 0.5% BSA-containing PBS (pH 7.4) solution to correspond to 1 μg / mL. Blood samples were serially diluted 500–1000-fold in each well using Buffer B (100 mM MES, 150 mM NaCl, 0.5% BSA IgG-free, 0.05% Tween-20, pH 6.0), and 150 μL was injected into each well of the plate. The injected samples were incubated at room temperature for 1 hour. After washing the plates three times with Buffer A, 200 μL of 1 nM HRP-conjugated anti-human IgG goat antibody was injected and incubated at 37 °C for 2 hours. After washing three times with Buffer B cooled with ice, 100 μL of the substrate solution tetramethylbenzidine (RnD, Cat. No:DY999) was injected and incubated at room temperature for 15 minutes. After stopping the reaction by injecting 50 μL of 1.0 M sulfuric acid solution (Samchun, Cat. No: S2129), absorbance was measured at 450 nm. The concentration of biotin-IgG after 24 hours (approximately Tmax of biotin-IgG in mice; the time before the onset of biotin-IgG catabolism) was fixed at 100%, and the percentage of concentration at different time points relative to the concentration at 24 hours was analyzed. The half-lives of the vehicle and the 20 mg / kg IgG1 control were 103 hours and 118 hours, respectively. The IgG half-lives of the HL161A antibody were 30, 23, and 18 hours depending on the administered dose.In addition, the HL161B antibody also showed IgG half-lives of 41, 22, and 21 hours depending on the administered dose (Figs. 5a and 5b).
[0232] Example 8: Efficacy test of HL161A and HL161B in monkeys
[0233] Using cyanomorphic monkeys with 96% homology to human FcRn, the levels of monkey IgG, IgA, IgM, and albumin were analyzed following the administration of HL161A and HL161B antibodies, and the pharmacokinetic (PK) profiles of the antibodies were analyzed.
[0234] 1) Results of analysis of changes in IgG antibodies in monkey blood
[0235] First, changes in monkey IgG were measured by ELISA analysis. 100 μL of anti-human IgG Fc antibody (BethylLab, A80-104A) was loaded into a 96-well plate (Costar, Cat. No: 2592) to a concentration of 4.0 μg / mL and immobilized at 4°C for 16 hours. The plates were washed three times with a wash solution (0.05% Tween-20, 10 mM PBS, pH 7.4) and then incubated with 1% BSA-containing PBS (pH 7.4) solution at room temperature for 2 hours. Monkey IgG was used as a standard at concentrations ranging from 3.9 to 500 ng / mL, and blood samples were diluted 80,000-fold using 1% BSA-containing PBS (pH 7.4) solution, loaded onto the plates, and incubated at room temperature for 2 hours. After washing three times with a washing solution, 100 μL of a 20,000-fold dilution of anti-hIgG antibody (Biorad, 201005) was loaded onto the plate and incubated at room temperature for 1 hour. After washing each plate, 100 μL of substrate solution 3,3',5,5'-tetramethylbenzidine (Rnd, Cat. No: DY999) was injected into the plate and incubated at room temperature for 7 minutes, after which the reaction was stopped by injecting 50 μL of 1.0 M sulfuric acid solution (Samchun, Cat. No: S2129). The results were analyzed by measuring absorbance (OD) using 450 nm and 540 nm absorbance readers (MD, Model: VersaMax). The changes (%) in monkey IgG levels following the administration of HL161A and HL161B antibodies are shown in Table 7 and Figures 6a to 6c.
[0236] Changes in monkey IgG levels (%) due to administration of HL161A and HL161B Day Vehicle HL161A HL161B 5 mg / kg 20 mg / kg 5 mg / kg 20 mg / kg 0 days 100.0±0.0 100.0±0.0 100.0±0.0 100.0±0.0 100.0±0.0 0.5 days 99.0±4.8 81.5±1.8 101.5±9.0 94.3±5.4 96.2±3.0 1 day 97.6±15.9 67.2±2.0 86.2±11.9 83.9±24.7 94.1±7.0 2 days 97.8±6.2 63.0±3.3 74.2±14 73.7±11.3 71.7±5.4 3 days 104.5±13.1 61.8±8.0 59.2±11.0 68.3±9.3 61.3±6.0 4 days 100.9±16.7 55.3±4.1 45.1±4.6 65.5±12.2 44.3±5.6 5 days 103.4±12.5 60.8±8.3 38.8±4.9 65.0±11.9 38.4±3.7 6 days 113.3±8.5 64.9±11.7 39.7±6.4 66.4±11.3 39.0±5.4 7 days 116.9±23.3 58.7±4.7 39.6±5.4 61.4±8.0 37.5±3.2 7.5 days 92.4±10.4 51.2±7.2 38.7±7.8 62.8±8.3 39.3±0.4 8 days 94.6±8.7 48.0±9.3 36.1±5.3 60.7±7.5 39.6±5.9 9th 117.6±14.3 47.1±4.4 33.8±5.0 54.3±6.9 31.0±3.1 10 days 115.1±16.7 49.7±8.9 29.6±5.8 53.6±4.9 32.8±4.3 11th 114.6±18.9 47.7±4.2 30.4±6.5 54.7±4.2 39.9±9.1 12th 109.5±13.1 51.7±3.1 32.9±5.7 56.5±4.7 46.7±9.1 13th 111.1±21.2 52.9±6.4 35.7±9.2 58.7±3.8 45.4±7.6 14th 128.9±17.7 54.7±4.2 37.8±9.6 60.6±4.2 53.8±11.3 17th 95.6±6.6 59.5±10.3 40.2±7.4 56.7±4.4 48.4±10.0 20th 92.5±8.4 62.4±6.7 47.6±8.9 61.8±6.0 54.0±9.5 23rd 107.1±15.2 71.9±6.5 61.8±13.3 64.9±4.4 56.8±6.0 26th 104.0±5.6 77.7±6.8 72.2±22.4 70.8±7.4 62.4±5.8 29th 102.4±8.3 81.4±6.7 77.9±20.5 74.8±5.1 65.4±10.8
[0237] 2) Results of pharmacokinetic profile analysis of HL161A and HL161B in monkey blood
[0238] The blood pharmacokinetic (PK) profiles over time following intravenous administration of HL161A and HL161B were analyzed by competitive ELISA. Specifically, a 2 μg / mL nutravidin solution was prepared, and 100 μL of the solution was coated onto each well of a 96-well plate and incubated at 4°C for 18 hours. The plate was washed three times with 300 μL of wash buffer (0.05% Tween 20 containing 10 mM PBS, pH 7.4), and then each well was incubated at room temperature at 25°C for 2 hours with a 1% BSA-containing PBS (pH 7.4) solution. Biotin-bound hFcRn was diluted to 1 μg / mL with PBS, and 100 μL of the diluted solution was added to each well of the 96-well plate and incubated at 25°C for 1 hour. Next, the plate was washed three times with 300 μL of wash buffer to remove unbound hFcRn, then standard samples (0.156–20 ng / mL) were added to each well and incubated at 25°C for 2 hours. Again, the plate was washed three times with wash buffer, 100 μL of a 1:10,000 dilution of the detection antibody in PBS was added to each well, and incubated at 25°C for 1.5 hours. Finally, the plate was washed three times, 100 μL of TMB solution was added and reacted at room temperature for 5 minutes, after which 50 μL of a 1M sulfuric acid reaction termination solution was added to terminate the reaction. Next, absorbance was measured at 450 nm using an absorbance reader. The analysis results for the pharmacokinetic profiles of HL161A and HL161B at various dosages are shown in Table 8 and Figures 7a and 7b.
[0239] Results of pharmacokinetic profile analysis of HL161A and HL161B by administration dose Ab (Dosage) Day Cmax (mg / ml) AUC (mg / ml.hr) T 1 / 2 (hr) HL161A(5 mg / kg) 0-7 157 ± 31 1,601 ± 501 6.9 ± 0.9 7-14 157 ± 25 1,388 ± 334 10.3 ± 2.8 HL161A(20 mg / kg) 0-7 692 ± 138 13,947 ± 2,459 9.0 ± 0.6 7-14 724 ± 125 12,699 ± 2,114 7.6 ± 1.6 HL161B(5 mg / kg) 0-7 178 ± 56 2,551 ± 1,356 7.9 ± 1.3 7-14 187 ± 9 2,772 ± 466 9.4 ± 0.5 HL161B(20 mg / kg) 0-7 823 ± 38 21,867 ± 1,088 11.7 ± 1.0 7-14 868 ± 66 16,116 ± 1,501 6.8 ± 0.9
[0240] 3) Results of analysis of changes in IgM and IgA antibody levels in monkey blood
[0241] ELISA assays to measure IgG and IgA levels in monkey blood were performed using a method similar to the ELISA method used to measure IgG levels. Specifically, 100 μL of anti-monkey IgM antibody (Alpha Diagnostic, 70033) or IgA antibody (Alpha Diagnostic, 70043) was dispensed into each well of a 96-well plate to a concentration of 2.0 μg / mL, and then immobilized at 4°C for 16 hours. The plates were washed three times with wash buffer (0.05% Tween-20 containing 10 mM PBS, pH 7.4) and then incubated at room temperature for 2 hours with a 1% BSA-containing PBS solution (pH 7.4). Standard monkey IgM was analyzed at concentrations of 7.8–1,000 ng / mL, and IgA at 15.6–2,000 ng / mL. Blood samples were diluted 10,000- or 20,000-fold with 1% BSA-containing PBS (pH 7.4) solution, and the dilutions were added to each well and incubated at room temperature for 2 hours. Next, the plates were washed three times with a wash solution, and then 100 μL of 5,000-fold dilutions of the anti-monkey IgM secondary antibody (Alpha Diagnostic, 70031) and the anti-monkey IgA secondary antibody (KPL, 074-11-011), respectively, were added to each well and incubated at room temperature for 1 hour. Finally, the plates were washed three times, and 100 μL of the substrate solution, 3,3',5,5'-tetramethylbenzidine (RnD, Cat. No: DY999), was injected and incubated at room temperature for 7 minutes. Next, 50 μL of 1.0 M sulfuric acid solution (Samchun, Cat. No: S2129) was injected into each well to stop the reaction. The absorbance of each well was measured using a 450 and 540 nm absorbance reader (MD, Model: VersaMax).
[0242] 4) Results of analysis of changes in albumin levels in monkey blood
[0243] Changes in blood monkey albumin levels were analyzed using a commercial ELISA kit (Assaypro, Cat. No: EKA2201-1). Briefly, the analysis sample, monkey serum, was diluted 4,000-fold, and 25 μL of the diluted solution was dispensed into each well of a 96-well plate immobilized with an antibody capable of binding to monkey albumin. 25 μL of biotin-conjugated monkey albumin solution was added to each well and incubated at 25°C for 2 hours. The plate was washed three times with 200 μL of wash buffer, and then 50 μL of a 1:100 diluted solution of a streptavidin-peroxidase-conjugated antibody was added to each well and incubated at 25°C for 30 minutes. Finally, after washing the plate three times, 50 μL of substrate was added and incubated at room temperature for 10 minutes. Then, 50 μL of reaction termination solution was added to each well, and absorbance was measured at 450 nm. Changes (%) in monkey IgM, IgA, and albumin levels following the administration of HL161A and HL161B are shown in Figures 8a to 8c.
[0244] 5) Results of blood biochemical values and urine component analysis
[0245] Finally, blood biochemical analysis and urine analysis by antibody administration were performed using samples from the 14th day of the test. Blood biochemical markers, including Aspartate aminotransferase (AST), Alanine aminotransferase (ALT), Alkaline phosphatase (ALP), Creatine phosphokinase (CPK), Total bilirubin (TBIL), Glucose (GLU), Total cholesterol (TCHO), Triglyceride (TG), Total protein (TP), Alumine (Alb), Albumin / globulin (A / G), Blood urea nitrogen (BUN), Creatinine (CRE), Inorganic phosphorus (IP), Calcium (Ca), Natrium (Na), Potassium (K), and Chloride (Cl), were analyzed using a Hitachi 7180 instrument, while markers for urine analysis, including Leukocyte (LEU), Nitrate (NIT), Urobilinogen (URO), Protein (PRO), pH, Occult blood (BLO), Specific gravity (SG), Ketone body (KET), Bilirubin (BIL), Glucose (GLU), and Ascorbic acid (ASC), were analyzed using a Mission U120 instrument. Analysis was performed using a device. The measured values were generally identified as falling within the normal range for cyanomorphic monkeys.
[0246] Example 9: Evaluation of RVT-1401 (HL161BKN) in healthy subjects after subcutaneous (SC) or intravenous (IV) administration
[0247] To evaluate the safety, tolerability, pharmacokinetics (PK), pharmacodynamics (PD), and immunogenicity of RVT-1401 (HL161BKN) after single (IV and SC) and multiple (SC) doses, RVT-1401 or placebo was administered to healthy subjects at the following doses (N = RVT-1401:placebo): 0.5 mg / kg SC (N = 3:0); 1.5 mg / kg SC (N = 6:2); 5.0 mg / kg SC (N = 6:2); 340 mg SC (N = 6:2); 500 mg SC (N = 6:2); 765 mg SC (N = 6:2); 0.1 mg / kg IV (N = 4:0); 100 mg IV (N = 6:2); 340 mg IV (N = 6:2); 765 mg IV (N = 6:2); 1530 mg IV (N = 6:2); 340 mg weekly x 4 (N = 8:2); and 680 mg weekly x 4 (N=8:2) (Fig. 9). Subject demographics are shown in Table 9.
[0248] Target population statistics Target population statistics SAD MAD RVT-1401(N=61) Placebo(N=18) RVT-1401(N=16) Placebo (N=4) Average age (yrs)[Range] 36(19-55) 36(18-55) 37(21-48) 36(32-40) Average weight (kg)[Range] 79(52-102) 71(54-94) 76(59-90) 82(74-103) Gender - Male (N%) 57 (93%) 13 (72%) 16 (100%) 4 (100%) Gender - Female (N%) 4 (7%) 5 (28%) 0 (0%) 0 (0%) Race - White (N%) 54 (89%) 15 (83%) 14 (88%) 4 (100%) Race - Black or African American (N%) 5 (8%) 2 (11%) 1 (6%) 0 (0%) Race - Asian (N%) 0 (0%) 1 (6%) 1 (6%) 0 (0%) Race - Other (N%) 2 (3%) 0 (0%) 0 (0%) 0 (0%)
[0249] result -
[0250] Pharmacokinetics (PK): After SC administration, the single-dose PK (Cmax and AUC) increased more significantly than in the dose-proportional manner across the dose range of 1.5 mg / kg (equivalent mean: 127 mg) to 765 mg (fixed dose). A similar trend was observed after 1-hour IV infusion across the dose range of 100 mg to 340 mg. Peak concentrations were observed between 1.5 and 4 days after SC administration of 340 mg and higher doses. After IV infusion, the serum terminal half-life (t 1 / 2 ) increased with dose. The dose-dependent half-life of AUC and the anomalous increase were consistent with the target-mediated drug batch. After subcutaneous administration of doses of 340 mg or higher, dose-dependent changes in half-life were observed, and t 1 / 2The time ranged from 10 to 38 hours across all administered doses. The bioavailability of subcutaneously administered RVT-1401 was 11% and 23.5% after administration of 340 mg and 765 mg, respectively. The mean concentration-time profiles in healthy subjects after single-dose IV and SC administration of RVT-1401 are shown in Figures 10a and 10b. A summary of plasma PK parameters after single-dose administration of RVT-1401 is shown in Tables 10 and 11.
[0251] RVT-1401 was administered as a weekly SC injection of 340 mg or 680 mg for 4 weeks in a multiple-dose cohort. After weekly SC administration of 340 mg, the variability of Cmax and AUC (0-168) after the first administration of RVT-1401 was consistent with the single-dose data. This inter-subject variability around Cmax and AUC (0-168) decreased after subsequent administration. Drug accumulation after weekly administration of 340 mg also showed significant inter-subject variability due to variability after the first administration. Repeated SC administration of 680 mg showed less inter-subject variability in exposure and less accumulation after 4 weeks of administration. Exposure (Cmax and AUC (0-168)) increased more than dose-proportionally when comparing the 340 mg and 680 mg SC doses at week 4. The increasing half-life and the proportional increase in AUC and Cmax with increasing dose were consistent with target-mediated drug predisposition. The mean concentration-time profiles in healthy subjects after weekly SC administration of 340 mg or 680 mg of RVT-1401 are shown in Figures 11a and 11b.
[0252] Summary of PK Parameters [Geometric Mean (%CV)] After Body Weight-Based Single SC Administration of RVT-1401 Dosage (mg / kg) Route of administration N weight 1 (kg) AUC (0-168) (h*ug / mL) C max (ug / mL) T max 1 (Day) Half-life (hour) 1.5 SC 5 2 84(71,102) 5.20(69) 0.08(170) 0.75(0.33,2.00) 46.4(111) 5.0 SC 6 75(59,97) 833(60) 12.8(54) 2.5(2,3) 12.0(21.7)
[0253] 1 Median (Min, Max)
[0254] 2 One subject did not have a measurable concentration after administration of 1.5 mg / kg and was not included in the PK parameter summary.
[0255] Summary of PK Parameters [Geometric Mean (%CV)] After Fixed-Dose Single SC / IV Administration of RVT-1401 Dosage (mg) Route of administration N weight 1 (kg) AUC(0-168) (h*ug / mL) C max (ug / mL) T max 1 (Day) Half-life 2 (hour) 100 IV 6 92(70,101) 211(51) 19.9(25) 0.04(0.04,0.06) 5.30(23) 340 IV 6 71(69,102) 3940(12) 121(16) 0.06(0.04,0.08) 11.2(29) 765 IV 6 76(58,102) 15500(26) 273(22) 1.75(1.5,8) ND 1530 IV 6 77(54,89) 35100(28) 530(25) 1.5(1,6) ND 340 SC 6 83(66,97) 453(333) 7.58(275) 1.5(1.5,3) 14.6 (n=5)(35) 500 SC 6 74(70,91) 323(626) 4.26(661) 2.5(1.5,4) 21.6 (n=5)(56) 765 SC 6 75(52,98) 4110(77) 42.5(57) 3(2,4) 16.1 (n=5)(14.5)
[0256] 1 Median (Min, Max)
[0257] 2 In each of the 340, 500, and 765 mg SC cohorts, there was one subject for whom the final half-life could not be calculated due to a lack of points in the terminal stage.
[0258] ND = Not determined at data cut-off
[0259] Primary Pharmacodynamics (PD):A dose-dependent decrease in IgG compared to baseline was observed after single-dose subcutaneous (SC) and intravenous (IV) administration of RVT-1401. The time to IgG trough was between 7 and 14 days after RVT-1401 administration. Recovery to baseline was generally achieved within 56 days of the last administration. The highest percentage reduction in IgG after a single SC dose was 48% after the 765 mg administration. Cumulative reductions in IgG and albumin concentrations were observed in both the 340 mg and 680 mg cohorts following repeated administration of RVT-1401. After weekly SC administration of 680 mg, troughs for both IgG and albumin occurred in most subjects prior to the last administration, indicating that maximum reduction was achieved by week 4. A 63% maximum reduction in IgG was observed after weekly SC administration of 340 mg for 4 weeks, and 78% was observed after weekly SC administration of 680 mg for 4 weeks. Five weeks after the last administration, the mean (SD) IgG concentration was within 30% of the baseline value, at 8.6(2.5) g / L and 9.0(2.0) g / L for the 340 mg and 680 mg cohorts, respectively. A sustained decrease in IgG (> 35%) was maintained one month after the last administration, and no clinically relevant changes were observed in IgM or IgA. Serum IgG concentration-time profiles in healthy subjects after weekly subcutaneous administration of RVT-1401 at 340 mg or 680 mg are shown in Figure 12. A summary of total IgG PD parameters after a single dose of RVT-1401 is presented in Table 12. A summary of total IgG PD parameters after multiple doses of RVT-1401 is presented in Table 13.
[0260] Summary of Total IgG PD Parameters [Mean (SD)] After Single Dose of RVT-1401 Dosage Route of administration N Baseline (g / L) Minimum concentration (g / L) Maximum decrease (%) from baseline Time to minimum concentration 1 (Day) 1.5 mg / kg SC 6 10.8 (1.2) 9.3 (1.5) 14.0 (5.25) 14(10,28) 5.0 mg / kg SC 6 10.3 (1.8) 7.1 (1.4) 31.3 (5.07) 10 (7.0,10) 340 mg SC 6 11.4 (1.6) 8.2 (2.6) 29.0 (18.3) 10.5 (4,21) 500 mg SC 6 12.0 (1.8) 7.6 (1.1) 36.3 (9.0) 10 (7.0,14) 765 mg SC 6 11.7 (2.1) 6.1 (0.9) 47.8 (5.60) 8.5 (7.0,14) Penalty SC 10 9.9 (1.3) 9.3 (1.1) 6.07 (4.38) 12 (0.0,84) 100 mg IV 6 9.6 (1.1) 8.4 (1.1) 12.8 (4.18) 3.5 (2.0,10) 340 mg IV 6 12.3 (2.5) 7.7 (1.8) 37.3 (3.29) 10 (7.0,10) 765 mg IV 6 14.4 (1.7) 6.2 (0.9) 2 57.3 (0.87) 2 10 (10,10) 2 1530 mg IV 6 11.4 (2.5) 3.8 (1.2) 66.8 (4.48) 10 (10,14) Penalty IV 8 11.9 (3.0) 10.8 (2.4) 8.97 (6.67) 14 (7.0,84)
[0261] 1The time to the lowest point is related to the administration of the first dose; median (minimum, maximum)
[0262] 2 N=4
[0263] Summary of Total IgG PD Parameters [Mean (SD)] After Multiple Doses of RVT-1401 Dosage (mg) N Body weight 2 (kg) Reference (g, / L) Minimum concentration (g / L) Maximum decrease (%) from baseline Time to minimum concentration 2,3 (Day) 340 8 80.8(66.8, 84.4) 11.8(2.7) 4.4 1 (2.2) 62.6 1 (10.7) 24 1 (21,28) 680 8 70.9(59.2, 90.3) 12.6(2.8) 2.8(0.9) 78.4(2.36) 21(21,24) Penalty 4 4 76.1(75.4, 107) 10.5(2.3) 9.3(1.9) 11.2(1.70) 33(21,42)
[0264] 1 N=7 PD due to 1 subject who discontinued before the 4th and final dose for personal reasons.
[0265] 2 Median (Min, Max)
[0266] 3 The time to minimum is relative to the administration of the first dose.
[0267] 4 The placebo group was integrated from subjects who received placebo in both treatment groups.
[0268] Secondary Pharmacodynamics (PD): A dose-dependent decrease in albumin concentration was observed following repeated doses of RVT-1401 at 340 mg or 680 mg. There were no adverse events (AEs) associated with the observed decrease in albumin. In all subjects, mean serum albumin levels remained within the normal range (>3.5 g / dL) after weekly administration of 340 mg. At 680 mg, albumin dropped below the normal range in all subjects, but remained above 3.0 g / dL during the administration period with the exception of one subject (that subject's albumin reached a trough of 2.6 g / dL on days 22 and 25 but did not cause any clinical signs, symptoms, or adverse effects). In all subjects, albumin levels were within the normal range within 4 weeks of the last administration to the 680 mg cohort. On average across the two cohorts, subject albumin levels were within 90% of baseline values 5 weeks after the last administration, which indicates the reversibility of the effect of RVT-1401 on albumin.
[0269] Figure 13a shows the percentage (%) decrease in serum IgG from baseline in healthy subjects after a single IV dose of RVT-1401 (340 mg, 765 mg, 1530 mg) or placebo. Figure 13b shows the percentage (%) decrease in serum IgG from baseline in healthy subjects after a single SC dose of RVT-1401 (340 mg, 765 mg) or placebo. Figure 14a shows the percentage (%) decrease in serum IgG (total) from baseline in healthy subjects after multiple SC doses of RVT-1401 (340 mg, 680 mg) or placebo. Figure 14b shows the percentage (%) decrease in serum IgG1 from baseline in healthy subjects after multiple SC doses of RVT-1401 (340 mg, 680 mg) or placebo. Figure 14c shows the percentage (%) of serum IgG2 reduction from baseline in healthy subjects after multiple subcutaneous administration of RVT-1401 (340 mg, 680 mg) or placebo. Figure 14d shows the percentage (%) of serum IgG3 reduction from baseline in healthy subjects after multiple subcutaneous administration of RVT-1401 (340 mg, 680 mg) or placebo. Figure 14e shows the percentage (%) of serum IgG4 reduction from baseline in healthy subjects after multiple subcutaneous administration of RVT-1401 (340 mg, 680 mg) or placebo. The maximum percentage (%) of serum IgG reduction from baseline for IgG subclasses (IgG1, IgG2, IgG3, and IgG4) is shown in Table 14.
[0270] Maximum serum IgG reduction percentage (%) for IgG subclasses Maximum percentage (%) decrease from the baseline * Treatment Dosage normalized to body weight ** (mg / kg) IgG1 IgG2 IgG3 IgG4 Penalty 0 6.8 (6.8) 6.9 (0.8) 6.8 (2.2) 12.1 (3.1) 340 mg 4.4(4.0, 5.1) 67.4 (8.2) 50.7 (9.6) 72 (9.0) 58.1 (6.9) 680 mg 9.2(7.5, 11.5) 80.4 (2.9) 70.6 (3.7) 85.3 (2.3) 78.7 (5.6)
[0271] * Average(SD); ** Average(Min, Max)
[0272] Safety:RVT-1401 was generally well tolerated, with no deaths or discontinuations due to adverse events (AEs), and all non-severe treatment-emergent adverse events (TEAEs) were mild or moderate. Injection site reactions (erythema and / or edema) were the most frequent TEAEs for both RVT-1401 and placebo after subcutaneous administration (single and multiple doses). Injection site reactions were all mild in intensity and generally resolved within 1–4 hours after administration. The frequency of injection site reactions was not related to the dose and was similar for RVT-1401 and placebo. Other TEAEs observed in three or more subjects treated with single or multiple doses of >340 mg / kg subcutaneous included headache and insomnia. The only TEAEs reported in three or more subjects after IV administration were oropharyngeal pain and headache. All non-severe TEAEs in the IV dose cohort were mild to moderate in severity. Overall, there were no clinically relevant changes from baseline in vital signs, laboratory tests (including liver function tests), or ECGs after RVT-1401 SC or IV administration. No clinical signs or symptoms associated with a decrease in IgG or albumin were reported in the SC or IV cohorts. No headaches were observed after repeated SC injections of RVT-1401 at a dose of 680 mg. Two serious AEs were reported, but neither was associated with RVT-1401.
[0273] Immunogenicity:The development of anti-drug antibodies (ADAs) against RVT-1401 was evaluated across all dose cohorts following single (IV and SC formulations) and multiple (SC formulation) administrations of RVT-1401. Preliminary data showed a treatment-emergent ADA incidence of 10.3% in RVT-1401-treated subjects and 6.7% in placebo-treated subjects across the single escalation dose cohort, consistent with the high sensitivity of the ADA analysis. Titration levels were considered low (< 1:16) and did not affect PK or PD. All ADAs disappeared by the end of the monitoring period. There were no treatment-emergent ADAs in the 340 mg or 680 mg multiple escalation dose (MAD) cohorts.
[0274] Example 10: Non-randomized, open-label study of RVT-1401 for the treatment of patients with hyperthermia autoimmune hemolytic anemia (WAIHA)
[0275] To evaluate the safety, tolerability, PK, PD, and efficacy of RVT-1401 (680 mg and 340 mg weekly) in patients with hyperthermic autoimmune hemolytic anemia (WAIHA), two dosing regimens of RVT-1401 are evaluated in a non-randomized, sequential, open-label study. Both dosing regimens involve a once-weekly subcutaneous (SC) injection: Dosing regimen A (680 mg weekly for 12 weeks) and Dosing regimen B (340 mg weekly for 12 weeks). Dosing regimen A (680 mg weekly) is administered as two SC injections per week, and Dosing regimen B (340 mg weekly) is administered as a single SC injection per week. The study design is illustrated in Figure 15 and described below.
[0276] Research Design :
[0277] Screening-
[0278] Patients were diagnosed and screened against major inclusion / exclusion criteria (Table 15). Additional examples of inclusion / exclusion criteria are disclosed in NCT03226678, NCT04119050, and NCT03764618 (ClinicalTrials.gov), each of which is included herein by reference for the disclosure of these criteria.
[0279] Key Selection / Exclusion Criteria Selection Criteria 1 Male or female aged 18 or older. 2 Primary or secondary WAIHA diagnosis documented by anti-IgG alone or a positive direct antiglobulin test (DAT) specific to anti-IgG + C3d. 3 If no separate treatment is indicated or active management is not expected during the study period, only stage 0 chronic lymphocytic leukemia (CLL) may be included in the second WAIHA. 4 Failure or disallowance of at least one previous WAIHA treatment regimen according to regional standards (e.g., steroids, rituximab, azathioprine, cyclophosphamide, cyclosporine, mycophenolate mofetil (MMF), danazol, or vincristine). 5 Subjects who have undergone splenectomy at least 3 months prior to Day 1 are permitted to have received the latest vaccination (depending on age and local guidelines). 6 Haptoglobin < lower limit of normal (LLN) and lactate dehydrogenase (LDH) > upper limit of normal (ULN). 7 At screening and baseline, the subject's hemoglobin level must be <10 g / dL, and the subject must have documented symptoms associated with anemia (e.g., weakness, dizziness, fatigue, shortness of breath, chest pain). 8 Karnofsky Performance status ≥60. 9 Concurrent treatment of subjects for WAIHA may consist solely of steroids (stable dose maintained for at least 2 weeks prior to Day 1), immunosuppressant therapy (azathioprine, MMF, or cyclosporine) with a stable dose maintained for at least 4 weeks prior to Day 1, or erythropoietin (stable dose maintained for at least 6 weeks prior to Day 1). [Note: The starting dose of WAIHA therapy must be maintained throughout the study, except for rescue drugs in accordance with regional standards for safety. Steroid tapering up to 10 mg daily is permitted for subjects who respond for at least 2 weeks.] Exclusion criteria 1 Subjects with other types of AIHA (e.g., cold antibody AIHA, cold agglutinin syndrome, mixed AIHA, or paroxysmal cold hemoglobinuria). 2 Subjects requiring at least 2 units of RBC per week during the 2 weeks prior to screening and baseline. 3 Use of rituximab, any monoclonal antibody, or proteasome inhibitor for immunomodulation within 3 months prior to screening. 4 Immunoglobulin administered via SC, IV (IVIG), or intramuscular route, or via plasmapheresis / plasma exchange (PE) within 60 days prior to screening. 5 Total IgG level < 6 g / L (at screening). 6 Absolute neutrophil count <1000 cells / mm³ at screening 3 (During screening) 7 Albumin levels <3.5 g / dL in screening. 8 Known progressive liver disease, including a diagnosis of cirrhosis at any stage. Non-alcoholic fatty liver disease (NAFLD), including non-alcoholic steatohepatitis (NASH), is permitted if there is a recent (within 6 months) normal ultrasound, CT, or MRI. If fatty changes are present only by ultrasound, CT, or MRI, subjects may be enrolled if they have a normal-range fibroscan for liver fibrosis. 9 AST or ALT ≥1.5x ULN at screening. Subjects may be enrolled only if they have recently (within 6 months) received an ultrasound, CT, or MRI. If fatty changes are visible only by ultrasound, CT, or MRI, subjects may be enrolled if they have a normal-range fibroscan for liver fibrosis. 10 Subjects with any abnormal test findings (at screening) that are clinically significant, unresolved at baseline, and could jeopardize or impair the subject's ability to participate in the study. 11 Primary immunodeficiency, T-cell, or humoral history including common variable immunodeficiency. 12 Active infection within 8 weeks prior to screening, recent severe infection (i.e., requiring injectable antimicrobial therapy or hospitalization). 13 History or known infection with human immunodeficiency virus (HIV), hepatitis B virus (HBV), or tuberculosis: - Subjects must have negative test results for HBV surface antigen, HBV core antibody, HIV 1 and 2 antibodies, and a negative QuantiFERON-TB Gold test at the time of screening. - Subjects with an inconclusive QuantiFERON-TB Gold test may be allowed one retest; if the retest is not negative, the subject may be excluded. 14 Hepatitis C virus (HCV) infection: - Subjects must have a negative test result for HCV antibodies. - Subjects with a known history of HCV must document evidence of a sustained viral response consistent with treatment for hepatitis C infection. This is defined as undetectable or unquantifiable HCV RNA for at least 12 weeks after discontinuation of HCV treatment (HCV Guidelines: Recommendations for Testing, Management and Treatment of Hepatitis C, 2014-2018, AASLD and IDSA). This must be confirmed by a negative HCV RNA test at the time of screening. 15 History of active malignancy or malignant tumors during the 3 years prior to screening (excluding non-melanoma skin cancer and cervical cancer in situ). 16 Subjects with any medical condition (acute or chronic disease) or psychiatric condition that may jeopardize or impair a subject's ability to participate in the study. 17 Body Mass Index (BMI) ≥ 40 kg / m² at screening 2 . 18 Use of the investigational drug within 60 days or 5 half-lives (whichever is longer) prior to screening. 19 The subject received a live vaccine within 2 weeks prior to the baseline visit; or plans to receive a live vaccine during the course of the study or within 7 weeks after the final administration of the investigational treatment. 20 History of sensitivity to any investigational therapeutic agent or its components, or a history of anaphylaxis (i.e., a life-threatening severe allergic reaction) that prohibits participation. 21 Pregnant or breastfeeding women determined by screening or baseline positive serum or urine human chorionic gonadotropin test. 22 At screening, the QTcF interval was >450 milliseconds for men and >470 milliseconds for women (a single replicate was allowed for eligibility determination). QTcF >480 msec for subjects in each block (Bundle Branch Block). 23 Diagnosis of idiopathic thrombocytopenic purpura (ITP) / Evans syndrome associated with a platelet count <100,000.
[0280] therapy -
[0281] Patients in the two cohorts are enrolled in a non-randomized sequential manner. Patients are first enrolled in Cohort 1 (680 mg per week) and then in Cohort 2 (340 mg per week). Following the initial dose at the baseline visit (Week 1, Day 1), study visits occur weekly during the treatment period. Patients receive RVT-1401 for 12 weeks (680 mg per week or 340 mg per week). The administration regimens were expected to provide sustained total IgG reductions of approximately 75–80% and 65–70% for regimen A and regimen B, respectively. Additionally, the trough IgG reduction was expected to be achieved by the 3rd–5th doses (depending on the study administration regimen) and maintained by the remaining doses before rising back to baseline over the next 6–8 weeks following discontinuation of treatment.
[0282] After the final administration at week 12, visits occur weekly until week 14, followed by weeks 16 and 20. Safety, PK, PD, and clinical evaluations are collected throughout the study. Each patient participates in the study for up to approximately 24 weeks: a screening period of up to 4 weeks, a treatment period of 12 weeks, and a follow-up period of 8 weeks. Primary, secondary, and exploratory endpoint scores were evaluated during and after treatment, up to 20 weeks (Table 16).
[0283] Primary, secondary, and exploratory evaluation variables 1st 1 Week 13 Respondent Rate (defined as Hb levels ≥10g / dL with an increase of at least ≥2g / dL from baseline over the past 2 weeks without rescue therapy or transfusion) 2 Assessment of safety and tolerability through analysis of adverse event (AE) data and baseline changes in vital signs, ECG, and clinical test values 2nd 1 Change in baseline at Hb levels 2 Response time 3 Change in baseline at hematocrit levels 4 Percentage of patients with normal Hb levels at week 13 5 Time taken to reach Hb levels within the normal range 6 Change in baseline (fatigue) in FACIT-F score 7 Baseline change in the MRC (Medical Research Council) dyspnea scale (dyspnea) 8 Change in baseline EQ-5D-3L score (health-related quality of life) 9 Baseline changes at total IgG and IgG subclass (I-IV) levels 10 RVT-1401 Pre-administration Concentration (Ctrough) 11 Baseline changes in LDH, bilirubin, and haptoglobin 12 Immunogenicity determined by changes before administration of anti-RVT-1401 antibody and characterization of anti-RVT-1401 antibody to confirm neutralization potential quest 1 Status of Direct Antiglobulin Test (DAT) by Response 2 Proportion of subjects requiring rescue treatment (e.g., prednisone, dexamethasone and / or blood transfusion) 3 Baseline changes in B cell phenotype 4 Baseline changes in anti-D, anti-Band 3, and / or anti-glycoforin antibodies
[0284] Research evaluation and process :
[0285] Physical examination: A complete physical examination includes an evaluation of the cardiovascular, respiratory, gastrointestinal, and nervous systems, as well as the skin. Height is measured only during screening, and weight is measured and recorded only during screening and baseline. A simple physical examination includes an evaluation of the skin, respiratory and cardiovascular systems, and the abdomen (liver and spleen).
[0286] Vital signs: Vital signs are measured in the supine position and include temperature, systolic and diastolic blood pressure, and pulse oximetry.
[0287] electrocardiogram: The electrocardiogram (ECG) was measured in a supine position. Twelve lead ECGs were obtained during the study using an ECG machine that automatically calculates heart rate and measures PR, QRS, QT, and QTcF intervals.
[0288] Clinical Safety Laboratory Evaluation: Additional parameters to be tested in hematology, clinical chemistry, urinalysis, and the central laboratory are listed in Table 17 below.
[0289]
[0290] Pharmacokinetics (PK): Blood samples for PK analysis of RVT-1401 are collected at the designated time. The actual date and time of each blood sample collection are recorded.
[0291] Anti-drug antibodies (ADA) and neutralizing antibodies (NAb): Blood samples for ADA and NAb analysis are collected at designated times. The actual date and time of each blood sample collection are recorded. Patients who test positive for anti-RVT-1401 antibodies (change from baseline) at Week 20 must revisit for additional samples approximately 6, 9, and 12 months after administration, or until the results are no longer positive. However, participation for the purposes of safety follow-up and database locking ends at the Week 20 visit.
[0292] Pharmacodynamics (PD):Blood samples for PD analysis of RVT-1401 are collected at a designated time. The actual date and time of each blood sample collection are recorded. Pharmacodynamic markers include total IgG and differentiation by class (i.e., IgG subclasses (IgG1, IgG2, IgG3, and IgG4)).
[0293] Exploratory Biomarkers: Blood samples for exploratory biomarker analysis are collected at designated times. The actual date and time of each blood sample collection are recorded. The timing of the samples may change, and / or samples may be obtained at additional times to ensure a thorough biomarker evaluation. Exploratory biomarkers include B cell phenotype, DAT, anti-D antibody, anti-band 3 antibody, and / or anti-glycophorin antibody.
[0294] Midterm evaluation :
[0295] Intermediate clinical safety laboratory evaluation (hemoglobin and immunoglobulin G (IgG)) from two WAIHA patients treated with RVT-1401 (administration regimen A) at a weekly dose of 680 mg is disclosed in Table 18.
[0296] Interim Clinical Safety Laboratory Evaluation - Hemoglobin and IgG Baseline / 1 week 2 weeks 3 weeks 4 weeks 5 weeks 7 weeks 9 weeks 11 weeks 13 weeks Patient 1 Hemoglobin (g / dL) 9.5 11.6 11.4 11.7 12.3 10.8 10.4 9.8 9.5 IgG (g / L) 8.2 4.35 2.95 2.07 2.02 1.88 2.12 2.46 Patient 2 Hemoglobin (g / dL) 6.4 7.1 7.1 7.4 7.8 7.7 IgG (g / L) 12.7 7.5 4.4 3.7 3.4 Not applicable
[0297] Both patients had a history of advanced WAIHA and had failed at least four previous treatments for WAIHA. At the time of initiating open-label treatment with RVT-1401, both patients met all protocol eligibility criteria (Table 15).
[0298] At the time of the interim evaluation, Patient 1 had completed 12 weeks of treatment and Patient 2 had completed 7 weeks of treatment. No injection site reactions were reported in either patient.
[0299] Based on the onset of potent and rapid hemoglobin improvement in Patient 1 (i.e., an increase of more than 2 g / dL observed by week 2 and maintained by week 4 (weeks 2 to 5)), the dose of prednisone and the dose of the second background WAIHA regimen for the patient were both reduced at week 5. Without being bound by theory, this change in background drug dosage may be related to the decrease in hemoglobin levels observed in Patient 1 in the following week, starting at week 7 (Table 18).
[0300] Although the present disclosure has been described in detail with reference to specific features, it will be obvious to those skilled in the art that this description is for illustrative purposes only and does not limit the scope of the present disclosure. Accordingly, the actual scope of the present disclosure will be defined by the appended claims and their equivalents.
Claims
Claim 1 A pharmaceutical composition for the treatment or prevention of hyperthermia autoimmune hemolytic anemia comprising at least one pharmaceutically acceptable carrier and a therapeutically effective amount of an anti-FcRn antibody or an antigen-binding fragment thereof: wherein the antibody or antigen-binding fragment comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 27 (HCDR1), the amino acid sequence of SEQ ID NO: 28 (HCDR2), and the amino acid sequence of SEQ ID NO: 29 (HCDR3); and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 30 (LCDR1), the amino acid sequence of SEQ ID NO: 31 (LCDR2), and the amino acid sequence of SEQ ID NO: 32 (LCDR3); and the therapeutically effective amount of the antibody or antigen-binding fragment is 500 mg to 700 mg. Claim 2 A pharmaceutical composition according to claim 1, wherein the antibody or antigen-binding fragment comprises a heavy chain variable region consisting of the amino acid sequence of SEQ ID NO: 6; and a light chain variable region consisting of the amino acid sequence of SEQ ID NO:
16. Claim 3 A pharmaceutical composition according to claim 1, wherein the antibody or antigen-binding fragment comprises a heavy chain consisting of the amino acid sequence of SEQ ID NO: 46; and a light chain consisting of the amino acid sequence of SEQ ID NO:
48. Claim 4 In claim 1, the antibody or antigen-binding fragment is 0.01 nM to 2 nM of K at pH 6.0 or pH 7.
4. D A pharmaceutical composition that binds to FcRn via (dissociation constant). Claim 5 In paragraph 4, the above K D A pharmaceutical composition measured by surface plasmon resonance (SPR). Claim 6 In claim 1, the pharmaceutical composition is a pharmaceutical composition administered subcutaneously. Claim 7 The pharmaceutical composition of claim 1, wherein the pharmaceutical composition is administered by one or more subcutaneous injections. Claim 8 In claim 7, the pharmaceutical composition is administered without intravenous administration prior to one or more subcutaneous injections. Claim 9 The pharmaceutical composition of claim 1, wherein the pharmaceutical composition is administered once or once a week as a single dose. Claim 10 delete Claim 11 delete Claim 12 delete Claim 13 delete Claim 14 delete Claim 15 delete Claim 16 delete Claim 17 delete Claim 18 delete Claim 19 delete
Citation Information
Patent Citations
Humanized affinity matured Anti-fcrn antibodies
WO2016183352A1
Antibody Binding to FcRn for Treating Autoimmune Diseases
KR1020160145779A