Microorganism having increased activity of pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase and method for producing L-amino acid using the same

Abstract

The present application relates to a microorganism with increased activity of the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase and a method for producing L-amino acids using the same.

Description

Technology Field

[0001] The present application relates to a microorganism with increased activity of the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase and a method for producing L-amino acids using the same. Background Technology

[0003] Microorganisms of the genus Corynebacterium are Gram-positive microorganisms widely used in the production of L-amino acids.

[0004] Various studies are being conducted to develop high-efficiency production microorganisms for the production of L-amino acids and other useful substances. For example, for the production of L-amino acids, target-substance-specific approaches are mainly used, such as increasing the expression of genes encoding enzymes mainly involved in L-amino acid biosynthesis in Corynebacterium strains or removing genes unnecessary for L-amino acid biosynthesis (US 9644009 B2).

[0005] However, there is still a growing need for research on methods to efficiently produce L-amino acids with high yields. The problem to be solved

[0007] One aspect of the present application provides a microorganism with increased activity of pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase (AceF).

[0008] In one embodiment, the microorganism is a microorganism that produces L-amino acid.

[0009] In another embodiment, the microorganism has increased activity of pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase (AceF) compared to its intrinsic activity.

[0010] As a microorganism according to any one of the preceding embodiments, the L-amino acid comprises a glutamate derivative, O-acetylhomoserine, homoserine, and methionine.

[0011] As a microorganism according to any one of the aforementioned embodiments, the L-amino acid is one or more selected from glutamine, glutamate, ornithine, citrulline, arginine, proline, O-acetylhomoserine, homoserine, and methionine.

[0012] As a microorganism according to any one of the aforementioned embodiments, the microorganism may be a microorganism of the genus Corynebacterium.

[0013] As a microorganism according to any one of the aforementioned embodiments, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.

[0014] As a microorganism according to any one of the aforementioned embodiments, the pyruvate dehydrogenase complex dihydrolipoylysin-residue acetyltransferase may be derived from Corynebacterium glutamicum.

[0015] As a microorganism according to any one of the preceding embodiments, the pyruvate dehydrogenase complex dihydrolipolysin-residue acetyltransferase may comprise the amino acid sequence of SEQ ID NO. 1 or SEQ ID NO. 32.

[0016] As a microorganism according to any one of the preceding embodiments, the pyruvate dehydrogenase complex dihydrolipoyllysin-residue acetyltransferase may be encoded by the polynucleotide of SEQ ID NO. 2 or SEQ ID NO. 33.

[0017] As a microorganism according to any one of the aforementioned embodiments, the microorganism may have an increased L-amino acid production capacity compared to a non-modified microorganism.

[0018] As a microorganism according to any one of the aforementioned embodiments, the microorganism may be a microorganism in which the activity of the pyruvate dehydrogenase complex subunit E1 is increased compared to the intrinsic activity.

[0019] As a microorganism according to any one of the preceding embodiments, the pyruvate dehydrogenase complex subunit E1 may comprise the amino acid sequence of SEQ ID NO. 10.

[0020] As a microorganism according to any one of the preceding embodiments, the pyruvate dehydrogenase complex subunit E1 may be encoded by the polynucleotide of SEQ ID NO. 11 or SEQ ID NO. 39.

[0021] Another aspect of the present application provides a method for producing L-amino acids, comprising the step of culturing a microorganism in a medium having increased activity of the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase.

[0022] In one embodiment, the method may additionally include the step of recovering L-amino acids from the cultured microorganism, the culture of the microorganism, the fermented product of the microorganism, or the culture medium.

[0023] Another aspect of the present application provides a composition for producing L-amino acids comprising a microorganism having increased pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase activity relative to its intrinsic activity, a culture of said microorganism, a fermented product of said microorganism, or a combination of two or more of these. means of solving the problem

[0025] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application may be applied to other descriptions and embodiments. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application should not be considered limited by the specific descriptions provided below. Additionally, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated by reference into this specification in their entirety to more clearly explain the level of the art to which this application pertains and the content of this application.

[0027] definition

[0029] As used in the specification and appended claims of this application, singular articles (“a,” “an,” and “the”) may include plural objects unless otherwise noted. Also, unless otherwise noted, plural terms may include singular forms. Additionally, in the specification and appended claims of this application, unless otherwise noted, the use of “or” may be used to include “and / or” unless otherwise noted.

[0030] In this application, the term "about" may be placed before a specific numerical value. As used in this application, the term "about" includes not only the exact number specified after the term, but also a range that is approximately that number or close to that number. Whether the number is close to or nearly that specific number may be determined by considering the context in which the number is presented. For example, the term "about" may refer to a range of -10% to +10% of a numerical value. For another example, the term "about" may refer to a range of -5% to +5% of a given numerical value. However, it is not limited thereto.

[0032] In this application, terms such as “first, second, third…”, “i), ii), iii)…” or “(a), (b), (c), (d)…” are used to distinguish each configuration, and when said terms are used in relation to steps of a method, use or analysis, these terms are not limited to being performed continuously or in sequence, for example, there may be no time interval between these steps, they may be performed simultaneously, or they may be performed with intervals of seconds, minutes, hours, days, or months.

[0034] In this application, the term "consisting essentially of" means that said unspecified component may be present in such a case that the features of the subject matter claimed in this application are not substantially affected by the presence of said unspecified component.

[0035] In this application, the term “consisting of” means that the proportion of the specific component(s) described below the term is 100% of the total. The component or feature described below the term “consisting of” may be essential or mandatory. In some embodiments, any other component or feature, or a non-essential component or feature, may be excluded in addition to the component or feature described below the term “consisting of”.

[0036] In this application, the term "comprising" means the presence of the features, steps, or components described below the above term, and does not exclude the presence of one or more additional features, steps, or components. In this application, the components or features described below "comprising" may be essential or mandatory, but some embodiments may further include other optional or non-essential components or features.

[0038] Protein, polypeptide

[0040] In this application, the terms "protein" or "polypeptide" refer to a polymer or oligomer of a sequence of amino acid residues. In this application, "polypeptide," "protein," and "peptide" may be used interchangeably with "amino acid sequence."

[0041] In some cases, an active protein, polypeptide, or peptide may be referred to as an "enzyme." In this application, amino acid sequences are described in an N-terminal → C-terminal orientation unless otherwise indicated.

[0042] In this application, the term "mature polypeptide" refers to a polypeptide in a form that lacks a signal sequence or a propeptide sequence. A mature protein / polypeptide / peptide may be a functional form of a protein / polypeptide / peptide. A mature polypeptide may be a final form after translation or a final form that has undergone post-translational modification. Examples of post-translational modification include, but are not limited to, N- or C-terminal modification, glycosylation, phosphorylation, and removal of a leader sequence.

[0044] With respect to amino acid sequences in this application, it is evident that polypeptides or proteins "containing" the amino acid sequence described by a specific sequence number, polypeptides or proteins "composed" of the amino acid sequence described by a specific sequence number, or polypeptides or proteins "having" the amino acid sequence described by a specific sequence number may include polypeptides or proteins in which some amino acid(s) are deleted, modified, substituted, conservatively substituted, or added, provided that they have the same or corresponding activity as the polypeptide or protein composed of the amino acid sequence of the said sequence number. For example, polypeptides or proteins may also include sequence additions or deletions that do not alter the function of the protein, naturally occurring mutations, their silent mutations, or conservative substitutions within or before and after (N-terminus or C-terminus) the polypeptide or protein sequence, provided that they have the same or corresponding activity.

[0045] As a specific example, a polypeptide (protein) conjugated with an N-terminal signal (or leader) sequence involved in the co-translational or post-translational translocation of a polypeptide (protein), or a polypeptide (protein) conjugated with another sequence or linker to identify, purify, or synthesize the polypeptide (protein), may also be included in the range of polypeptides of amino acid sequences described by the specific sequence number.

[0046] In this application, the term "conservative substitution" means substituting one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. For example, positively charged (basic) amino acids are arginine, lysine, and histidine; negatively charged (acidic) amino acids are glutamic acid and aspartic acid; amino acids having a nonpolar side chain (nonpolar amino acids) are glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline; Amino acids with polar or hydrophilic side chains (polar amino acids) can be classified to include serine, threonine, cysteine, tyrosine, asparagine, and glutamine. As another example, they can be classified into electrically charged amino acids with side chains (arginine, lysine, histidine, glutamic acid, and aspartic acid) and uncharged amino acids (also referred to as neutral amino acids) with side chains (glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. As another example, phenylalanine, tryptophan, and tyrosine can be classified as aromatic amino acids. As another example, valine, leucine, and isoleucine can be classified as branched amino acids.As another example, the 20 amino acids can be classified by size into five groups, starting with the group of amino acids with the smallest volume: glycine, alanine, serine; cysteine, proline, threonine, aspartic acid, asparagine; valine, histidine, glutamic acid, glutamine; isoleucine, leucine, methionine, lysine, arginine; and phenylalanine, tryptophan, and tyrosine. However, this is not necessarily limited to these groups. Typically, conservative substitutions have little to no effect on the activity of polypeptides.

[0048] polynucleotide

[0050] In this application, the term "gene" means a polynucleotide coding for a polypeptide and a polynucleotide comprising regions before and after the coding region. In some embodiments, the gene may have a sequence (intron) inserted between each coding region (exon).

[0052] In this application, the term “polynucleotide, nucleic acid or nucleic acid molecule” refers to a polymer of nucleotides in which nucleotide monomers are linked together in a long chain by covalent bonds, and means a strand of DNA (e.g., cDNA or genomic DNA) or RNA (e.g., mRNA) of a certain length or longer.

[0054] Homology, identity

[0056] In this application, the terms “homology” or “identity” refer to the degree of similarity between mutually corresponding sequences in two given amino acid or base sequences and may be expressed as a percentage. The terms homology and identity may often be used interchangeably.

[0057] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard arrangement algorithms, and a default gap penalty established by the program used may be utilized. Substantially, homologous or identical sequences can generally be hybridized under moderate or high stringent conditions along the entire sequence or at least about 50%, 60%, 70%, 80%, or 90% of the total length. It is evident that hybridization also involves polynucleotides containing common codons or codons that account for codon degeneracy.

[0058] Whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity can be determined using a known computer algorithm, such as the “FASTA” program, using default parameters as in, for example, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, it can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, and [CARILLO et al .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST from the National Biotechnology Information Database Center or ClustalW.

[0059] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information using GAP computer programs, such as those disclosed in, for example, Smith and Waterman, Adv. Appl. Math (1981) 2:482, and, for example, Needleman et al. (1970), J Mol Biol. 48:443. In summary, a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). The default parameters for a GAP program are (1) unitary matrices (containing values ​​of 1 for identity and 0 for non-identity), the PAM Matrix (see contents disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation (1978)), and Gribskov et al. (1986) Nucl. Acids Res. 14: A weighted comparison matrix of 6745 (or an EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0060] In addition, whether any two polynucleotide sequences have homology, similarity, or identity can be determined by comparing the sequences through Southern hybridization experiments under defined strict conditions, and the defined appropriate hybridization conditions may be determined by methods within the scope of the art and well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York), but are not limited thereto.

[0061] In this application, the term “stringent condition” means a condition that enables specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8). For example, the conditions may include hybridizing polynucleotides with high homology or identity with each other, having homology or identity of 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more, and not hybridizing polynucleotides with lower homology or identity, or washing once, specifically two to three times, at a salt concentration and temperature equivalent to the washing conditions of conventional southern hybridization, such as 60°C, 1 χSSC, 0.1% SDS, specifically 60°C, 0.1 χSSC, 0.1% SDS, more specifically 68°C, 0.1 χSSC, 0.1% SDS.

[0062] The above hybridization requires that two nucleotides have complementary sequences, even though a mismatch between bases may be possible depending on the degree of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, regarding DNA, adenosine is complementary to thymine, and cytosine is complementary to guanine. Accordingly, the polynucleotides of the present application may also include isolated nucleic acid fragments that are complementary to the entire sequence, as well as substantially similar base sequences.

[0063] For example, a polynucleotide having homology or identity with the polynucleotide of the present application can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. Additionally, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and can be appropriately adjusted by a person skilled in the art according to the purpose.

[0064] The appropriate strictness for hybridizing the above polynucleotides depends on the length and degree of complementarity of the polynucleotides, and the variables are well known in the art (e.g., J. Sambrook et al., i.e.).

[0066] Nucleic acid constructs, vectors, transformations

[0068] In this application, the term "nucleic acid construct" refers to a single or double-stranded nucleic acid molecule comprising one or more regulatory sequences, which is artificially synthesized, manipulated to include a specific sequence in a manner not found in nature, or isolated from nature.

[0070] As used in this application, the term "vector" refers to a DNA product for delivering a target polynucleotide into a suitable host or host cell. For example, it may comprise a base sequence of a polynucleotide encoding said target polypeptide operably linked to a suitable expression control region (or expression control sequence) to enable the expression of said target polypeptide within a suitable host. The expression control region may comprise a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence coding for a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After being transformed into a suitable host cell, the vector may replicate or function independently of the host genome and may be incorporated into the genome itself.

[0071] The vectors used in this application are not particularly limited, and any vector known in the art may be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pDZ-based, pDC-based, pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors may be used as plasmid vectors. For example, vectors such as pDZ, pDC, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, and pDCM2(WO2021-187781 A1) can be used.

[0072] For example, a target polynucleotide can be inserted into a chromosome using a vector for intracellular chromosome insertion. The insertion of the polynucleotide into the chromosome may be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker may be additionally included to confirm whether the chromosome insertion has occurred. The selection marker is intended to select cells transformed by the vector, that is, to confirm whether the target nucleic acid molecule has been inserted, and markers conferring selectable phenotypes such as drug resistance, nutritional requirements, resistance to cytotoxic agents, or expression of surface polypeptides may be used. Since only cells expressing the selection marker survive or exhibit other phenotypes in an environment treated with a selective agent, the transformed cells can be selected.

[0073] In this application, the term "transformation" refers to the introduction of a vector containing a target polynucleotide into a host cell to alter the genetic traits of the host cell. The transformed polynucleotide may be inserted into or located outside the chromosomes of the host cell. Additionally, the polynucleotide may contain DNA or RNA. The polynucleotide may be introduced in an appropriate form depending on the purpose of introduction. For example, a polynucleotide for expressing a target polypeptide may be introduced into the host cell in the form of an expression cassette, which is a genetic structure containing all elements necessary for self-expression. The expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal operably linked to the polynucleotide. The expression cassette may be in the form of a self-replicating expression vector. Additionally, the polynucleotide may be introduced into the host cell in its own form and operably linked to a sequence necessary for expression in the host cell, but is not limited thereto.

[0074] In this application, the term "operably linked" refers to a configuration in which a regulatory sequence is positioned at an appropriate location so that the regulatory sequence controls the expression of a coding sequence. Accordingly, "operably linked" includes a regulatory region of a functional domain having known or desired activity, such as a promoter, terminator, signal sequence, or enhancer region, being attached to or linked to a target (gene or polypeptide) so as to regulate the expression, secretion, or function of the target according to said known or desired activity. For example, it means that a promoter sequence and a polynucleotide sequence are functionally linked to initiate and mediate the transcription of a polynucleotide encoding a polypeptide.

[0075] In this application, the term "expression" includes, but is not limited to, any step involved in the generation of a polypeptide, e.g., transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0076] In this application, the term "expression vector" means a linear or circular nucleic acid molecule comprising a target polynucleotide sequence and a regulatory sequence operably linked for the expression thereof.

[0077] In this application, the term "regulatory sequence" refers to a polynucleotide sequence required for the regulation of the expression of a target polynucleotide sequence. Each regulatory sequence may be a natural (of the same origin) or foreign (derived from a different gene) sequence with respect to the coding sequence, a variant thereof, or another artificial sequence. Examples of the regulatory sequences include a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal peptide sequence, an operator sequence, a sequence coding for a ribosome binding site, and a sequence regulating transcription and translation termination. The minimum unit of the regulatory sequence may include a promoter, a transcription and translation termination sequence.

[0079] With respect to cells, polynucleotides, polypeptides, or vectors, the term “recombinant” in this application means that a cell, polynucleotide, polypeptide, or vector has been modified by the introduction of a heterologous nucleic acid or polypeptide or by a modification of a natural polynucleotide or polypeptide, or that a cell is derived from a cell so modified. Thus, for example, a recombinant cell may express a gene not found in the natural (non-recombinant) form of the cell, or may express a natural gene that is expressed, not expressed at all, or otherwise abnormally expressed.

[0081] microorganism

[0083] In this application, the term "microorganism (or strain)" includes both wild-type microorganisms and prokaryotic or eukaryotic microorganisms that have undergone natural or artificial genetic modification. It refers to a microorganism in which specific mechanisms are weakened or enhanced due to causes such as the insertion of external genes or the increase or inactivation of the activity of endogenous genes, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein, or product. In this application, "microorganism" and "strain" may be used interchangeably without limitation as having the same meaning.

[0084] For example, the microorganism of the present application may be a microorganism (e.g., a recombinant strain) in which the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase activity is increased relative to the intrinsic activity, but is not limited thereto.

[0085] In this application, the term "microorganism having L-amino acid production capability" refers to a microorganism capable of producing L-amino acids within a living organism, and may include both microorganisms that inherently lack L-amino acid production capability but are endowed with L-amino acid production capability, and microorganisms that inherently possess L-amino acid production capability. L-amino acid production capability may be endowed or enhanced through species improvement.

[0086] In this application, the term "non-mutated microorganism (strain)" does not exclude microorganisms (strains) containing naturally occurring mutations, and may refer to wild-type microorganisms (strains) or natural-type microorganisms (strains) themselves, or microorganisms (strains) prior to changes in traits caused by genetic mutations due to natural or artificial factors. The term "non-mutated microorganism (strain)" may be used interchangeably with "pre-mutation microorganism (strain)," "non-mutated microorganism (strain)," "parent microorganism," "parent strain," "wild-type microorganism (strain)," "reference microorganism (strain)," or "standard microorganism (strain)." In this application, "non-mutated microorganism" may refer to a microorganism in which the activity of the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase of this application has not increased compared to its intrinsic activity, or is prior to such increase, but is not limited thereto.

[0087] Additionally, in the present application, the non-modified microorganism may be a microorganism comprising an amino acid sequence consisting of SEQ ID NO. 1 or 32; or a polynucleotide consisting of SEQ ID NO. 2 or SEQ ID NO. 33, but is not limited thereto.

[0089] Increase in polypeptide activity

[0091] In this application, the term “increase” of polypeptide activity means that the activity of the polypeptide within a host cell increases relative to its intrinsic activity. The increase may be used interchangeably with terms such as activation, up-regulation, overexpression, and enhancement. The host may be a prokaryotic or eukaryotic microorganism.

[0092] The increase in polypeptide activity described above may include both the manifestation of polypeptide activity that the host microorganism did not inherently possess, and the manifestation of polypeptide activity that is enhanced compared to the inherent activity or the activity prior to modification.

[0093] For example, the above "exhibiting activity that was not originally possessed" may be due to the "introduction of polypeptides (proteins)," but is not limited thereto. The introduction of polypeptides (proteins) means that as a gene that was not originally possessed by the microorganism is expressed within the microorganism, the activity of a specific polypeptide (protein) is exhibited, or that the activity is increased or enhanced compared to the intrinsic activity or pre-modification activity of the said polypeptide (protein). For example, a polynucleotide encoding a specific polypeptide (protein) may be introduced into the chromosome of the microorganism, or a vector containing a polynucleotide encoding a specific polypeptide (protein) may be introduced into the microorganism, and its activity may be exhibited.

[0094] The above “intrinsic activity” refers to the activity of a specific polypeptide originally possessed by the microorganism prior to the phenotypic change or by the non-modified microorganism when the phenotypic change occurs due to genetic variation caused by natural or artificial factors. This term may be used interchangeably with “pre-modification activity.”

[0095] An increase in polypeptide activity relative to intrinsic activity means that it has been enhanced compared to the activity and / or concentration (expression level) of a specific polypeptide originally possessed by the microorganism before transformation or the non-transformed microorganism.

[0096] For example, the above increase may be that the activity of the corresponding protein / polypeptide is absent, or that the activity or concentration is increased to approximately 1%, approximately 10%, approximately 25%, approximately 50%, approximately 75%, approximately 100%, approximately 150%, approximately 200%, approximately 300%, approximately 400%, or approximately 500%, up to approximately 1000% or approximately 2000% or more based on the activity or concentration in the initial microbial strain, but is not limited thereto.

[0097] An increase in the activity of the above polypeptide can be achieved by introducing an exogenous polypeptide or by increasing the activity of the intrinsic polypeptide. Whether the activity of the above polypeptide has increased can be confirmed by an increase in the degree of activity, expression amount, or amount of product attributable to the activity of the said polypeptide.

[0098] The increase in the activity of the above polypeptide may be achieved by applying various methods well known in the art, and is not limited to, as long as the activity of the target polypeptide can be increased compared to the microorganism before modification. Specifically, it may be, but is not limited to, gene engineering and / or protein engineering known to a person skilled in the art, which are routine methods of molecular biology (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0099] Specifically, the increase in the activity of the polypeptide of the present application is

[0100] 1) Increase in the intracellular copy number of polynucleotides encoding polypeptides;

[0101] 2) Modification of a gene expression regulatory region on a chromosome encoding a polypeptide (e.g., occurrence of a mutation within the expression regulatory region, replacement with a sequence having greater activity, or insertion of a sequence having greater activity);

[0102] 3) A modification of the nucleotide sequence encoding the start codon or the 5'-UTR region of the gene transcript encoding the polypeptide;

[0103] 4) Modification of the amino acid sequence of the polypeptide to increase polypeptide activity;

[0104] 5) Modification of the polynucleotide sequence encoding the polypeptide to increase polypeptide activity (e.g., modification of the polynucleotide sequence of the polypeptide gene to code for a polypeptide modified to increase polypeptide activity);

[0105] 6) Introduction of an exogenous polypeptide exhibiting polypeptide activity or an exogenous polynucleotide encoding the same;

[0106] 7) Codon optimization of polynucleotides encoding polypeptides;

[0107] 8) Analyze the tertiary structure of the polypeptide to select and modify or chemically modify the exposed sites; or

[0108] 9) It may be a combination of two or more selected from 1) to 8) above, but is not specifically limited thereto.

[0109] for example,

[0110] The increase in the intracellular copy number of the polynucleotide encoding the polypeptide described in 1) above may be achieved by introducing a vector containing the polynucleotide encoding the polypeptide operably linked to an appropriate regulatory sequence into a host cell. The vector may be capable of replicating and functioning independently of the host. Alternatively, one or more copies of the polynucleotide encoding the polypeptide operably linked to an appropriate regulatory sequence may be introduced into a chromosome within the host cell. The introduction into the chromosome may be performed by introducing a vector capable of inserting the polynucleotide into the chromosome within the host cell, but is not limited thereto. The vector is as described above. The regulatory sequence may be a natural form (of the same origin) or a foreign sequence (derived from a different gene) with respect to the polynucleotide sequence, a variant thereof, or another artificial sequence, and may induce the expression of the polynucleotide within the host cell.

[0111] Replacing the gene expression regulatory region (or expression regulatory sequence) on the chromosome encoding the polypeptide mentioned in 2) above with a sequence having potent activity may, for example, involve a sequence mutation caused by deletion, insertion, substitution, or a combination thereof to further increase the activity of the expression regulatory region, or a replacement with a sequence having stronger activity. The expression regulatory region may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, the original promoter may be replaced with a potent promoter, but is not limited thereto.

[0112] Examples of known strong promoters include, but are not limited to, cj1 to cj7 promoters (US Patent No. 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13(sm3) promoter (US Patent No. 10584338 B2), O2 promoter (US Patent No. 10273491 B2), tkt promoter, and yccA promoter.

[0113] The above 3) sequence modification of the start codon or 5'-UTR region of the gene encoding the polypeptide may, for example, be a substitution with another start codon that has a higher polypeptide expression rate compared to the intrinsic start codon, but is not limited thereto.

[0114] The modification of the amino acid sequence or polynucleotide sequence of the polypeptide in 4) and 5) above may involve the occurrence of sequence mutations by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to increase the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence modified to have stronger activity or an amino acid sequence or polynucleotide sequence modified to increase activity, but is not limited thereto. Specifically, the replacement may be performed by inserting the polynucleotide into the chromosome by homologous recombination, but is not limited thereto. The vector used in this case may additionally include a selection marker to confirm whether chromosome insertion has occurred. The selection marker is as described above.

[0115] The introduction of an exogenous polynucleotide exhibiting the activity of the polypeptide mentioned in 6) above may be the introduction into a host cell of an exogenous polynucleotide encoding a polypeptide that exhibits the same or similar activity as the polypeptide. As long as the exogenous polynucleotide exhibits the same or similar activity as the polypeptide, there are no restrictions on its origin or sequence. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the polypeptide may be generated and its activity increased by the expression of the introduced polynucleotide within the host cell.

[0116] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be a codon optimization of the intrinsic polynucleotide such that transcription or translation increases within the host cell, or a codon optimization of the extrinsic polynucleotide such that optimized transcription or translation occurs within the host cell.

[0117] 8) Analyzing the tertiary structure of the polypeptide above to select and modify or chemically modify an exposed site may, for example, involve determining a template protein candidate based on the degree of sequence similarity by comparing the sequence information of the polypeptide to be analyzed with a database in which sequence information of known proteins is stored, and confirming the structure based on this to select and modify or chemically modify an exposed site.

[0118] Such an increase in polypeptide activity may be an increase in the activity or concentration of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-modification microorganism, or an increase in the amount of product produced from said polypeptide, but is not limited thereto.

[0120] Modification of part or all of the polynucleotides in the microorganisms of the present application may be induced by (a) a method using homologous recombination using a vector for chromosome insertion within the microorganism or genome editing using engineered nucleases (e.g., CRISPR-Cas9) and / or (b) treatment by light and / or chemicals such as ultraviolet rays and radiation, but is not limited thereto.

[0122] culture

[0124] In this application, the term "culture" means growing microorganisms under appropriately controlled environmental conditions. The culture process may be carried out according to suitable media and culture conditions known in the art. Such a culture process can be easily adjusted and used by those skilled in the art depending on the microorganism selected. Specifically, the culture may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0125] In this application, the term "medium" refers to a substance mixed with nutrients as the main component required for culturing microorganisms, and supplies nutrients and growth factors, including water, which is indispensable for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganisms of this application may be any medium used for culturing ordinary microorganisms without special limitations; however, the microorganisms of this application may be cultured under aerobic conditions while controlling temperature, pH, etc., in a conventional medium containing a suitable carbon source, nitrogen source, phosphorus, inorganic compounds, amino acids, and / or vitamins. For example, culture media for microorganisms of the genus Corynebacterium can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981)].

[0126] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvate, lactic acid, citric acid, etc.; and amino acids such as glutamic acid, methionine, lysine, etc. Additionally, natural organic nutrient sources such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane residue, and corn steeping liquid may be used. Specifically, carbohydrates such as glucose and sterilized pre-treated molasses (i.e., molasses converted into reducing sugars) may be used, and other carbon sources in appropriate amounts may be used in various ways without limitation. These carbon sources may be used individually or in combination of two or more types, but are not limited thereto.

[0127] The above nitrogen sources may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; and organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc., peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquid, casein hydrolysate, fish or its decomposition products, defatted soybean cake or its decomposition products, etc. These nitrogen sources may be used alone or in combination of two or more types, but are not limited thereto.

[0128] The above ingredients may include monopotassium phosphate, dipotassium phosphate, or corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc., and may also include amino acids, vitamins, and / or suitable precursors. These components or precursors may be added to the culture medium in a batch or continuous manner. However, they are not limited thereto.

[0129] In addition, during the cultivation of the microorganism of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc., may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during cultivation, an antifoaming agent such as fatty acid polyglycol ester may be used to suppress the formation of bubbles. Furthermore, to maintain an aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection to maintain an anaerobic and microaerobic state, but is not limited thereto.

[0130] In the culture of the present application, the culture temperature may be maintained at 20 to 45°C, specifically 25 to 40°C, and culture may be carried out for about 10 to 160 hours, but is not limited thereto.

[0131] In this application, the term "culture" refers to a culture solution, concentrated culture solution, dried culture solution, culture filtrate, concentrated culture filtrate, or dried culture filtrate obtained by culturing a specific microorganism in a culture medium, wherein the culture solution means containing the specific microorganism, and the culture filtrate means not substantially containing the specific microorganism (wherein, substantially means excluding the specific microorganism separated by filtration, etc., and does not mean that the microorganism is completely excluded from the filtrate). The form of the culture is not limited and may be, for example, a liquid, an emulsion, or a solid.

[0132] In this application, the term "fermentation" refers to a process in which microorganisms decompose organic matter using their own enzymes, excluding putrefaction. Although fermentation and putrefaction proceed through similar processes, if useful substances are produced as a result of the decomposition, it is called fermentation, whereas if foul odors are emitted or harmful substances are produced, it is called putrefaction.

[0133] In this application, the method of obtaining a fermented product from the microorganism is not particularly limited and can be obtained according to methods commonly used in the relevant technical field or similar fields.

[0134] In this application, the term "fermented product" includes not only the fermented substance itself, but also all types of substances including a culture medium of microorganisms in which microorganisms and cultures coexist, a fermented product obtained by filtering microorganisms from said culture medium, a fermented product obtained by sterilizing microorganisms from said culture medium and filtering them, an extract obtained by extracting said fermented product or a culture medium containing said fermented product, a diluted solution obtained by diluting said fermented product or its extract, a concentrate obtained by drying said fermented product or its extract, a lysate obtained by capturing and crushing said microbial cells, etc.

[0136] Specific description of the present application

[0138] The following is a more detailed description of the specific embodiments of the present application.

[0140] One aspect of the present application provides a microorganism in which the activity of the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase is increased relative to the intrinsic activity.

[0141] As an example of the present application, the microorganism of the present application may have the ability to produce L-amino acids.

[0142] The above-mentioned increased pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase activity may be defined as, but is not limited to, the increased L-amino acid production capacity of the microorganism of the present application compared to the production capacity of a natural wild-type microorganism or an unmodified microorganism (e.g., a microorganism expressing a polypeptide having wild-type pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase activity (e.g., the polypeptide of SEQ ID NO. 1 or SEQ ID NO. 32) or a microorganism in which the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase activity of the present application is not increased relative to its intrinsic activity or is not yet increased).

[0143] For example, the activity of the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase may be measured by measuring the L-amino acid production capacity or yield, but is not limited thereto.

[0145] In this application, the term "pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase" may be a component of the pyruvate dehydrogenase complex that has dehydrolipoylysin-residue acetyltransferase activity, that is, the activity of transferring an acetyl group to CoA.

[0146] The pyruvate dehydrogenase complex dihydrolipoyllysin-residue acetyltransferase of the present application may be used interchangeably with "AceF". The above-mentioned pyruvate dehydrogenase complex dihydrolipoyllysin-residue acetyltransferase is known in the art, and specifically aceF It may be coded by, but is not limited to. The amino acid and polynucleotide sequences of the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase can be obtained from known databases, examples of which include, but are not limited to, GenBank of NCBI.

[0147] For example, the above-mentioned pyruvate dehydrogenase complex dehydrolipolysin-residue acetyltransferase may include the amino acid sequence of SEQ ID NO. 1 or an amino acid sequence having 60% or more homology or identity therewith. However, it is not limited thereto as long as it possesses pyruvate dehydrogenase complex dehydrolipolysin-residue acetyltransferase activity. Specifically, even if the amino acid sequence of SEQ ID NO. 1 includes a sequence in which some sequences are deleted, modified, substituted, or added, a protein exhibiting efficacy corresponding to the above-mentioned pyruvate dehydrogenase complex dehydrolipolysin-residue acetyltransferase may be included in the above-mentioned pyruvate dehydrogenase complex dehydrolipolysin-residue acetyltransferase. In addition, a protein having the amino acid sequence of SEQ ID NO. 1 or SEQ ID NO. 32, or an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with said sequence, or containing said amino acid sequence, or consisting of said amino acid sequence, or essentially consisting of said amino acid sequence, and exhibiting efficacy corresponding to said pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase, may be included in said pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase. For example, the above-mentioned pyruvate dehydrogenase complex dehydrolipolysin-residue acetyltransferase may be an exogenous protein or a protein inherently present in microorganisms of the genus Corynebacterium or Corynebacterium glutamicum, but is not limited thereto; specifically, it may be a pyruvate dehydrogenase complex dehydrolipolysin-residue acetyltransferase composed of the amino acid sequence of SEQ ID NO. 1 or SEQ ID NO. 32 inherently present in microorganisms of the genus Corynebacterium or Corynebacterium glutamicum, but is not limited thereto. For example, NCBI Reference No.Examples include WP_011014958.1, WP_060564822.1, WP_074492848.1, etc.

[0148] For example, AceF of the present application may exhibit the activity of 2-oxoglutarate dehydrogenase, E2 component, and dihydrolipoamide succinyltransferase, a pyruvate dehydrogenase complex dehydrolipolysin-residue acetyltransferase. For example, the gene encoding AceF of the present application may be a gene named sucB. However, it is not limited thereto.

[0150] In addition, a polynucleotide encoding a pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase having an amino acid sequence of SEQ ID NO. 1 or an amino acid sequence having 60% or more homology or identity therewith may be prepared based on codon information known in the art. For example, the protein may be encoded by a polynucleotide having, but not limited to, the sequence of SEQ ID NO. 2 or SEQ ID NO. 33, or a sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% homology or identity with the sequence of SEQ ID NO. 2 or SEQ ID NO. 33, or composed of said sequence, or essentially composed of said sequence. In addition, the nucleotide sequences of SEQ ID NO. 2 or SEQ ID NO. 33 can be obtained from known databases, such as GenBank of NCBI, but are not limited thereto.

[0151] In the present application, a gene comprising a base sequence described by a specific sequence number may be used in combination with a polynucleotide comprising a base sequence described by a specific sequence number.

[0152] The polynucleotides of this application may have various modifications made to their coding regions within the scope of not altering the amino acid sequence of the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase of this application, due to codon degeneracy or in consideration of the preferred codons in organisms intended to express the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase of this application. Therefore, it is evident that polynucleotides that can be translated into a polypeptide consisting of the amino acid sequence of the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase of this application, or a polypeptide having homology or identity therewith, due to codon degeneracy, may also be included in the polynucleotides of this application. For example, the polynucleotide of the present application may be SEQ ID NO. 2, SEQ ID NO. 33, or a degenerated sequence thereof.

[0153] In another example, the polynucleotide of the present application may have or include a base sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% homology or identity with SEQ ID NO. 2, or may be composed of or essentially composed of a base sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% homology or identity with SEQ ID NO. 2, but is not limited thereto.

[0154] In addition, the polynucleotide of the present application may include, without limitation, a probe that can be prepared from a known gene sequence, for example, a sequence encoding the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase of the present application by hybridizing under strict conditions with a sequence complementary to all or part of the polynucleotide sequence of the present application.

[0156] In this application, the term "L-amino acid" includes both proteinaceous and non-proteinaceous amino acids. In this application, the L-amino acid may include glutamate derivatives, O-acetylhomoserine, homoserine, and methionine.

[0157] In this application, the term "glutamate-based product" may include all L-amino acids that can be biosynthesized using glutamate as a precursor, including glutamate. Examples of L-amino acids that can be produced through the ornithine cycle using glutamate as a precursor include ornithine, citrulline, arginine, and proline. Another example is glutamine, which can be converted using glutamate as a precursor. In addition, any L-amino acid that can be biosynthesized using glutamate as a precursor may be included within the scope of the glutamate-based products of this application.

[0158] In one embodiment, the L-amino acid of the present application may be one or more selected from glutamine, glutamate, ornithine, citrulline, arginine, proline, O-acetylhomoserine, homoserine, and L-methionine. In one embodiment, the L-amino acid of the present application may be one or more selected from ornithine, citrulline, arginine, proline, O-acetylhomoserine, homoserine, and L-methionine.

[0160] For the purposes of this application, the microorganisms of this application may include all microorganisms capable of producing the desired L-amino acid by increasing the activity of the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase relative to its intrinsic activity. For example, the microorganisms of this application are characterized by increased L-amino acid production capacity resulting from increased activity of the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase relative to its intrinsic activity, and may be genetically modified microorganisms or recombinant microorganisms, but are not limited thereto. Specifically, the recombinant microorganism with increased L-amino acid production capacity may be a natural wild-type microorganism or a non-modified microorganism having the intrinsic activity of the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase, but is not limited thereto.

[0161] For example, microorganisms having L-amino acid production ability are prokaryotic or eukaryotic microorganisms capable of producing L-amino acids within an organism, and may include both microorganisms that inherently have L-amino acid production ability and microorganisms that are not inherently capable of L-amino acid production ability but have been endowed with L-amino acid production ability. L-amino acid production ability may be endowed or enhanced by the increased pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase activity of the present application or by species improvement.

[0162] For example, the recombinant microorganism having L-amino acid production capability of the present application may include any microorganism capable of producing L-amino acids by being transformed through a vector and having increased activity of the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase of the present application.

[0163] For example, the microorganism producing the L-amino acid may be a microorganism that inherently contains a protein composed of the amino acid sequence of SEQ ID NO. 1 or SEQ ID NO. 32, or a protein composed of an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more homology or identity with SEQ ID NO. 1 or SEQ ID NO. 32.

[0164] For example, the microorganism producing the L-amino acid may be a microorganism that inherently contains a polynucleotide sequence capable of encoding a protein comprising an amino acid sequence having at least 60% homology with SEQ ID NO. 1 or SEQ ID NO. 32, a nucleotide sequence of SEQ ID NO. 2 or SEQ ID NO. 33, or a nucleotide sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, or 98% or more homology or identity with the nucleotide sequence of SEQ ID NO. 2 or SEQ ID NO. 33.

[0166] The microorganisms of the present application may include all microorganisms in which the activity of the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase is increased relative to the intrinsic activity by various known methods.

[0167] In one specific example, the microorganism in which the activity of the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase of the present application is increased relative to the intrinsic activity may be a microorganism in which the activity is increased by increasing protein expression through the substitution of a sequence regulating the expression of the sequence encoding the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase with another sequence, modification of the nucleotide sequence encoding the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase, or substitution of the start codon, but is not limited thereto. In one specific example, the microorganism of the present application having increased activity of the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase compared to its intrinsic activity may be a microorganism in which the protein expression is increased and activity is increased by replacing the sequence regulating the expression of the sequence encoding the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase with a sequence that is more active than the intrinsic expression regulating sequence. However, it is not limited thereto.

[0169] For example, the microorganism with increased L-amino acid production capacity of the present application may be a microorganism with increased L-amino acid production capacity compared to a non-modified microorganism, but is not limited thereto. For example, the non-modified microorganism used to compare the increase in L-amino acid production capacity may be the ATCC13032 or ATCC13869 strain, but is not limited thereto.

[0170] For example, the microorganism with increased L-amino acid production capacity may be increased by about 1% or more, specifically about 1% or more, about 2.5% or more, or about 5% or more compared to the L-amino acid production capacity of the parent microorganism (parent strain) or non-modified microorganism before mutation, but is not limited thereto as long as it has a positive increase amount compared to the production capacity of the parent microorganism (parent strain) or non-modified microorganism before mutation. In another example, the recombinant microorganism with increased L-amino acid production capacity may be increased by about 1.01 times or more, 1.02 times or more, 1.03 times or more, 1.04 times or more, 1.05 times or more, 1.06 times or more, 1.07 times or more, 1.08 times or more, 1.09 times or more, or about 1.1 times or more compared to the parent microorganism (parent strain) or non-modified microorganism before mutation, but is not limited thereto.

[0172] For example, the microorganism having the ability to produce L-amino acids may be either a prokaryotic or a eukaryotic cell, but specifically may be a prokaryotic cell. The prokaryotic cell is, for example, of the genus Escherichia ( Escherichia sp.), genus Erwinia ( Erwinia sp.), Serratia genus ( Serratia sp.), genus Providencia ( Providencia sp.), genus Corynebacterium ( Corynebacteria sp.), genus Pseudomonas ( Pseudomonas sp.), genus Leptospira ( Leptospira ), Salmonella genus( Salmonella sp.), genus Brevibacteria ( Brevibacteria sp.), Hypomonas genus ( Hypomononas sp.), genus Chromobacterium ( Chromobacterium sp.) and the genus Nocardia ( Norcardia It may include microbial strains belonging to the fungi or yeasts, or sp.), or fungi. Specifically, microbial strains of the genera Escherichia, Corynebacterium, and Leptospira, and yeasts. More specifically, Corynebacterium ( Corynebacterium It may be a microbial strain of the genus ).

[0173] As a microorganism according to any one of the aforementioned embodiments, the microorganism of the present application may be a microorganism of the genus Corynebacterium.

[0174] As an example of the present application, the microorganism of the present application is Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis( Corynebacterium crudilactis ), Corynebacterium deserti( Corynebacterium deserti ), Corynebacterium epiphysiens( Corynebacterium efficiens ), Corynebacterium calunae( Corynebacterium callunae ), Corynebacterium stationaryis( Corynebacterium stationis ), Corynebacterium singulare( Corynebacterium singulare ), Corynebacterium halotolerans( Corynebacterium halotolerans ), Corynebacterium striatum ( Corynebacterium striatum ), Corynebacterium ammoniagenes( Corynebacterium ammoniagenes ), Corynebacterium pollatisoli ( Corynebacterium pollutisoli ), Corynebacterium imitans( Corynebacterium imitans ), Corynebacterium testudinoris( Corynebacterium testudinoris ) or Corynebacterium flavescens ( Corynebacterium flavescens ) may be. Specifically, the microorganism of the present application is a microorganism of the genus Corynebacterium, more specifically Corynebacterium glutamicum ( Corynebacterium glutamicum It may be, but is not limited to.

[0175] The microorganisms of the genus Corynebacterium having L-amino acid production ability of the present application may include the natural wild-type microorganism itself, a microorganism of the genus Corynebacterium that has acquired enhanced L-amino acid production ability by increasing or decreasing the activity of genes related to the L-amino acid production mechanism, or a microorganism of the genus Corynebacterium that has acquired enhanced L-amino acid production ability by introducing or increasing the activity of external genes.

[0177] The microorganism having L-amino acid production capability of the present application may additionally have increased activity of Pyruvate Dehydrogenase Complex subunit E1 compared to its intrinsic activity.

[0178] In the present application, "Pyruvate Dehydrogenase Complex subunit E1" may be a polypeptide comprising an E1 active site that converts pyruvate into acetyl-CoA and CO2 in pyruvate dehydrogenase, as a component of the pyruvate dehydrogenase complex.

[0179] The pyruvate dehydrogenase complex subunit E1 of the present application may be used interchangeably with "aceE". The pyruvate dehydrogenase complex subunit E1 is known in the art and, specifically, may be encoded by aceE, but is not limited thereto. The amino acid and polynucleotide sequences of the pyruvate dehydrogenase complex subunit E1 can be obtained from known databases, examples of which include, but are not limited thereto, GenBank of NCBI.

[0180] For example, the above-mentioned pyruvate dehydrogenase complex subunit E1 may include the amino acid sequence of SEQ ID NO. 10 or an amino acid sequence having 60% or more homology or identity with it. However, it is not limited thereto as long as it has the same activity as the pyruvate dehydrogenase complex subunit E1. Specifically, even if the amino acid sequence of SEQ ID NO. 10 includes a sequence in which some sequences are deleted, modified, substituted, or added, a protein exhibiting efficacy corresponding to the above-mentioned pyruvate dehydrogenase complex subunit E1 may be included in the above-mentioned pyruvate dehydrogenase complex subunit E1. In addition, a protein having the amino acid sequence of SEQ ID NO. 10, or an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with said sequence, or containing said amino acid sequence, or consisting of said amino acid sequence, or essentially consisting of said amino acid sequence, and exhibiting efficacy corresponding to said pyruvate dehydrogenase complex subunit E1, may be included in said pyruvate dehydrogenase complex subunit E1. For example, the above-mentioned pyruvate dehydrogenase complex subunit E1 may be an exogenous protein or a protein inherently present in a microorganism of the genus Corynebacterium or Corynebacterium glutamicum, but is not limited thereto. Specifically, it may be a pyruvate dehydrogenase complex subunit E1 composed of the amino acid sequence of SEQ ID NO. 10 inherently present in a microorganism of the genus Corynebacterium or Corynebacterium glutamicum, but is not limited thereto. Examples include NCBI Reference No. WP_011014985.1.

[0181] In addition, a polynucleotide encoding pyruvate dehydrogenase complex subunit E1 having an amino acid sequence of SEQ ID NO. 10 or an amino acid sequence having 60% or more homology or identity therewith may be prepared based on codon information known in the art. For example, the protein may be encoded by a polynucleotide having, but not limited to, a sequence of SEQ ID NO. 11 or SEQ ID NO. 39, or a sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% homology or identity with the sequence of SEQ ID NO. 11 or SEQ ID NO. 39, or composed of said sequence, or essentially composed of said sequence. In addition, the nucleotide sequences of SEQ ID NO. 11 or SEQ ID NO. 39 can be obtained from known databases, such as GenBank of NCBI, but are not limited thereto.

[0183] The microorganism having L-amino acid production capability of the present application may further include modifications that further increase the desired L-amino acid production capability.

[0184] For example, the microorganism of the present application may be a microorganism in which the activity of the arginine repressor (ArgR) is weakened. For example, the microorganism of the present application may be a microorganism in which the entire or part of the argR gene is additionally deleted. For example, the microorganism of the present application may be a microorganism in which the methionine at position 54 of acetylglutamate kinase (ArgB) is substituted with valine.

[0185] For example, the microorganism of the present application may be a microorganism in which the activity of N-acetyl-gamma-glutamyl-phosphate reductase (hereinafter ArgC) is increased compared to the intrinsic activity.

[0186] For example, the microorganism of the present application may be a microorganism in which the activity of argininosuccinate synthetase (ArgG) is weakened. For example, the microorganism of the present application may be a microorganism in which all or part of the argG gene is additionally deleted.

[0187] For example, the microorganism of the present application may be a microorganism in which the activity of the L-lysine excretor LysE is weakened. For example, it may be a microorganism in which all or part of the lysE gene encoding the L-lysine excretor is deleted.

[0188] For example, the microorganism of the present application may be a microorganism with weakened carbamoyl phosphate synthase activity. For example, it may be a microorganism with weakened carbamoyl phosphate synthase small subunit (CarA) and / or carbamoyl phosphate synthase large subunit (CarB) activity.

[0189] For example, the microorganism of the present application may be a microorganism in which the activity of carbamoyltransferase F (ArgF: ornithine carbamoyltransferase F) is weakened. For example, the microorganism of the present application may be a microorganism in which all or part of the argF gene is deleted.

[0190] For example, the microorganism of the present application may be a microorganism into which an exogenous ornithine-releasing protein has been introduced. For example, it may be a microorganism into which a membrane protein derived from a microorganism of the genus Shewanella has been introduced. For example, it may be a microorganism into which a membrane protein derived from Shewanella oneidensis has been introduced.

[0191] For example, the microorganism of the present application may include a modification of the inner membrane protein YjeH. This may be referenced by the contents of WO2021-125896 A1.

[0192] For example, the microorganism of the present application may be a microorganism in which the activity of O-acetyl-homoserine transferase (MetX) is increased compared to the intrinsic activity.

[0193] For example, the microorganism of the present application may include a variant in which the expression enhancement of aspartokinase (LysC) and / or feedback inhibition is released. For this, reference may be made to the contents of US 10662450 B2.

[0194] For example, the microorganism of the present application may be a microorganism in which the activity of cystathionine gamma-synthase is weakened. For example, the microorganism of the present application may be a microorganism in which the activity of the metB gene encoding cystathionine gamma-synthase is weakened. For example, the microorganism may be a microorganism in which all or part of the metB gene is deleted.

[0195] For example, the microorganism of the present application may be a microorganism in which the activity of O-acetylhomoserine (thiol)-lyase is weakened. For example, the microorganism of the present application may be a microorganism in which the activity of the metY gene encoding O-acetylhomoserine (thiol)-lyase is weakened. For example, the microorganism may be a microorganism in which all or part of the metY gene is deleted.

[0196] For example, the microorganism of the present application may be a microorganism in which the activity of the intrinsic protein Ncgl0616 is weakened. For example, it may be a microorganism in which part or all of the gene encoding said Ncgl0616 is deleted.

[0198] Another aspect of the present application provides a method for producing L-amino acids, comprising the step of culturing a microorganism in a medium in which the activity of the pyruvate dehydrogenase complex of the present application, the dihydrolipoylysin-residue acetyltransferase, is increased relative to the intrinsic activity.

[0199] In the method of the present application, any culture conditions and methods known in the art may be used for the culture of microorganisms. Such a culture process can be easily adjusted and used by a person skilled in the art depending on the selected strain.

[0200] The L-amino acid produced by the culture of the present application may be secreted into the culture medium or remain within the cell.

[0202] In one embodiment, the method for producing L-amino acid of the present application may additionally include the step of preparing a microorganism of the present application, the step of preparing a medium for culturing said strain, or a combination thereof (in any order), for example, prior to the culturing step.

[0203] The method for producing L-amino acids according to the present application may further include a step of recovering a target substance, specifically L-amino acids, from the cultured microorganism, the culture of the microorganism, the fermented product of the microorganism, or the culture medium. The recovery step may be additionally included after the culture step.

[0204] The above recovery may involve collecting the desired L-amino acid using a suitable method known in the art according to the culture method of the microorganism of the present application, such as a batch, continuous, or fed-batch culture method. For example, various chromatographic methods such as centrifugation, filtration, treatment with a crystallizing protein precipitating agent (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC, or a combination thereof may be used, and the target substance, specifically L-amino acid, can be recovered from the culture medium or microorganism using a suitable method known in the art.

[0205] In addition, the method for producing L-amino acids according to the present application may additionally include a purification step. The purification may be performed using a suitable method known in the art. In one example, where the method for producing L-amino acids according to the present application includes both a recovery step and a purification step, the recovery step and the purification step may be performed continuously or discontinuously regardless of the order, or simultaneously or integrated into a single step, but are not limited thereto.

[0206] In the method of the present application, the increase in pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase activity and L-amino acids, etc., are as described in the other embodiments above.

[0208] Another aspect of the present application provides a composition for producing L-amino acids comprising a microorganism in which the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase activity of the present application is increased relative to the intrinsic activity, a culture of said microorganism, a fermented product of said microorganism, or a combination of two or more of these.

[0209] The composition of the present application may further include any suitable excipients commonly used in compositions for producing L-amino acids, and such excipients may be, for example, preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers, or isotonic agents, but are not limited thereto.

[0210] In one specific example, each component present in the composition of the present application may be included in a microbiologically effective amount or in an amount that can be appropriately present in a composition for production.

[0211] In the composition of the present application, the increase in pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase activity and L-amino acids, etc., are as described in the other embodiments above.

[0213] Another aspect of the present application provides for the use of the pyruvate dehydrogenase complex of the present application for L-amino acid production in microorganisms in which the activity of the dihydrolipoylysin-residue acetyltransferase is increased relative to the intrinsic activity.

[0214] In the use of the present application, the increase in pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase activity and L-amino acids, etc., are as described in the other embodiments above.

[0216] Another aspect of the present application provides a method for producing an L-amino acid-producing microorganism comprising modifying the microorganism to increase the activity of the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase of the present application relative to its intrinsic activity.

[0217] In the method for producing microorganisms of the present application, the increase in the activity of the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase and L-amino acids, etc., is as described in the other embodiment above. Effects of the invention

[0219] L-amino acids can be produced in high yield using the microorganism of the present application. Specific details for implementing the invention

[0221] The present application will be explained in more detail below through examples and experimental examples. However, these examples and experimental examples are intended to illustrate the present application, and the scope of the present application is not limited to these examples and experimental examples.

[0223] Example 1. Construction of a plasmid for enhancing the activity of the pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase

[0225] Example 1-1: Plasmid fabrication for promoter replacement

[0226] Corynebacterium glutamicum ( Corynebacterium glutamicumTo determine the validity of the gene (NCBI registry number BBD29_RS10495_hereinafter aceF) encoding the pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase (NCBI registry number WP_060564822.1), a reinforcement vector was constructed using BBD29_RS10495 (sequence number 2) derived from gene number Corynebacterium glutamicum ATCC13869. Specifically, to construct a pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase enhancing vector, a plasmid enhancing aceF activity was constructed by replacing the wild-type promoter of the aceF gene with Pcj7 using the Pcj7 promoter (US 7662943 B2) (SEQ No. 3), which is known as a strong promoter.

[0227] The upstream and downstream regions of the aceF gene were obtained. Specifically, to construct a strain into which aceF containing the Pcj7 promoter was introduced, PCR was performed on gene fragments of the upstream region of the aceF gene using primers of SEQ ID NO. 4 and SEQ ID NO. 5, and the downstream region of the aceF gene using primers of SEQ ID NO. 6 and SEQ ID NO. 7, respectively, using the chromosomal DNA of Corynebacterium glutamicum ATCC13869 as a template. In addition, Pcj7 promoter fragments were obtained using SEQ ID NO. 8 and SEQ ID NO. 9 as the pDCM2-Pcj7 template. The primer sequences used to perform each of the above PCRs are shown in Table 1 below.

[0228] Sequence number designation order 4 aceF-5'-F GTGAATTCGAGCTCGGTACCCCGAGCTTTTTGTTCCTCACGC 5 aceF -5'-R TAGTAGCGCTGGGATGTTTCTTATTTTAAGACTCCTCGCAAG 6 aceF -3'-F ACCCAACGAAAGGAAACACTCATGGGCTTTCTCCGTAGAGATG 7 aceF -3'-R GGTCGACTCTAGAGGATCCCCCGTCTACTTCGACGGTGTCGC 8 Pcj7-F AGAAACATCCCAGCGCTACTAATAGGGAGCGTTG 9 Pcj7-R ATGGGATACGTACCCAACGAAAGGAAACACTC

[0229] PfuUltra™ high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction. The PCR conditions were denaturation at 95°C for 30 seconds; denaturation at 55°C for 30 seconds; and polymerization at 72°C for 1 minute; these cycles of denaturation, annealing, and polymerization were repeated 28 times. As a result, a 318 bp DNA fragment of the Pcj7 promoter region, a 526 bp DNA fragment of the Corynebacterium glutamicum ATCC13869 aceF upstream region, and a 529 bp DNA fragment of the downstream region were obtained, respectively. PCR was performed using primers of SEQ ID NO. 4 and SEQ ID NO. 7 with the amplified promoter and DNA fragments as templates. The PCR conditions were denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 30 seconds; and annealing at 55°C for 30 seconds; After repeating polymerization at 72°C for 2 minutes 28 times, a polymerization reaction was performed at 72°C for 5 minutes. The two fragments obtained above underwent DNA purification, and then fusion cloning was performed using the In-Fusion® HD Cloning Kit (Clontech) to obtain a plasmid by cloning the pDCM2 vector (WO2021-187781 A1) treated with SmaI restriction enzyme according to the provided manual. The resulting vector was named pDCM2-Pcj7_aceF.

[0231] Examples 1-2: Construction of a plasmid to enhance the activity of Pyruvate Dehydrogenase Complex subunit E1

[0232] A vector was constructed to enhance the activity of Pyruvate Dehydrogenase Complex subunit E1 (NCBI Reference No. _ BBD29_RS10685_ hereinafter aceE). Specifically, to construct a vector to enhance Pyruvate Dehydrogenase Complex subunit E1 (BBD29_RS10685, SEQ No. 11), a plasmid was constructed to enhance aceE activity by replacing the wild-type promoter of the aceE gene with Pcj7 using the Pcj7 promoter (US 7662943 B2) (SEQ No. 3), which is known as a strong promoter.

[0233] The upstream and downstream regions of the aceE gene were obtained. Specifically, to construct a strain into which aceE containing the Pcj7 promoter was introduced, PCR was performed using the chromosomal DNA of Corynebacterium glutamicum ATCC13869 as a template to amplify gene fragments of the upstream region of the aceE gene using primers of SEQ ID NO. 12 and SEQ ID NO. 13, and the downstream region of the aceE gene using primers of SEQ ID NO. 14 and SEQ ID NO. 15. Additionally, Pcj7 promoter fragments were obtained using SEQ ID NO. 8 and SEQ ID NO. 9 with the pDCM2-Pcj7 template. The primer sequences used to perform each of the above PCRs are shown in Table 2 below.

[0235] Sequence number designation order 12 aceE -5'-F GTGAATTCGAGCTCGGTACCCCACTGGCCAGCGATTAACTTT 13 aceE -5'-R TAGTAGCGCTGGGATGTTTCTTTCCACACCTCCTGTTGGAAT 14 aceE -3'-F CCAACGAAAGGAAACACTCATGGCCGATCAAGCAAAACTT 15 aceE -3'-R GGTCGACTCTAGAGGATCCCCCCTGGAAGAAGATCTGGTCGC

[0238] PfuUltra™ high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction. The PCR conditions were denaturation at 95°C for 30 seconds; denaturation at 55°C for 30 seconds; and polymerization at 72°C for 1 minute; these cycles of denaturation, annealing, and polymerization were repeated 28 times. As a result, a 318 bp DNA fragment of the Pcj7 promoter region, a 526 bp DNA fragment of the Corynebacterium glutamicum ATCC13869 aceE upstream region, and a 527 bp DNA fragment of the downstream region were obtained, respectively. PCR was performed using primers of SEQ ID NO. 12 and SEQ ID NO. 15 with the amplified promoter and DNA fragments as templates. The PCR conditions were denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 30 seconds; and annealing at 55°C for 30 seconds; After repeating polymerization at 72°C for 2 minutes 28 times, a polymerization reaction was performed at 72°C for 5 minutes. The two fragments obtained above underwent DNA purification, and then fusion cloning was performed using the In-Fusion® HD Cloning Kit (Clontech) to obtain a plasmid by cloning the pDCM2 vector (WO2021-187781 A1) treated with SmaI restriction enzyme according to the provided manual. The resulting vector was named pDCM2-Pcj7_aceE.

[0241] Example 2: Production of microorganisms with enhanced pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase activity and evaluation of L-amino acid production capacity

[0243] Example 2-1. Preparation of Corynebacterium glutamicum CJR2 strain

[0245] Corynebacterium glutamicum strain CR2 was constructed to evaluate the production capacity of L-arginine, citrulline, and ornithine.

[0246] This involves introducing a mutation (△argR, argB(M54V)) into wild-type Corynebacterium glutamicum ATCC13869. (Ikeda, Masato et al., Applied and environmental microbiology 75(6)1635-41, 2009)

[0247] First, vectors for introducing argR deletion and argB (M54V) mutations were constructed. Using the genomic DA of Corynebacterium glutamicum ATCC13869 as a template, PCR was performed using the primer pairs in Table 3 (SEQ NOs. 16 and 17, SEQ NOs. 18 and 19), and overlapping PCR was performed using the primer pair of SEQ NOs. 16 and 19 to obtain homologous recombination fragments containing the argR deletion mutation sequence. Similarly, to prepare homologous recombination fragments containing the argB (M54V) mutation, PCR was performed using the primer pairs in Table 3 (SEQ NOs. 20 and 21, SEQ NOs. 22 and 23), and overlapping PCR was performed using SEQ NOs. 20 and 23. The PCR reaction consisted of denaturation at 95 °C for 30 seconds; annealing at 55 °C for 30 seconds; and the extension process at 72°C for 2 minutes was repeated 30 times. The linearized pDCM2 vector and each homologous recombination fragment were fusion cloned in the same manner as in Example 2. The constructed vectors (recombination plasmids) were named pDCM2-ΔargR and pDCM2-argB(M54V), respectively.

[0248] Next, an argR deletion mutation was introduced into wild-type Corynebacterium glutamicum ATCC13869. Transformation was performed using the electro-pulse method with the above-constructed pDCM2-ΔargR plasmid (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Subsequently, secondary recombination was performed on solid plate media containing 4% sucrose, and PCR was performed on the transformed strain after secondary recombination using primer pairs (SEQ Nos. 16 and 19) to confirm that the deletion mutation had been introduced into the chromosomal argR gene. The PCR reaction was performed by repeating the following steps 30 times: denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and extension at 72°C for 2 minutes. The transformed strain was named CJR1.

[0250] Compound Plate Medium (pH 7.0)

[0251] Glucose 10 g, Peptone 10 g, Beef extract 5 g, Yeast extract 5 g, Brain Heart Infusion 18.5 g, NaCl 2.5 g, Urea 2 g, Sorbitol 91 g, Agar 20 g (based on 1 liter of distilled water)

[0253] Next, the argB(M54V) mutation was introduced into the above Corynebacterium glutamicum CJR1 using the same method as above. The above-described pDCM2-argB(M54V) plasmid was used, and PCR was performed on the transformed line after the second recombination was completed using primer pairs (sequence numbers 20 and 23) to confirm that the M54V mutation was introduced into the chromosomal argB gene, and the transformed line was named CJR2.

[0255] Sequence number designation order Sequence No. 16 argR-5'-F tgaattcgagctcggtaccccactggtgaactccttgtcc Sequence No. 17 argR-5'-R ttgaactagggcgctttaaaagttttccggtgttgacgg Sequence No. 18 argR-3'-F ccgtcaacacccggaaaacttttaaagcgcccctagttcaa Sequence No. 19 argR-3'-R gtcgactctagaggatcccccgttgaactgcttgccagcc Sequence No. 20 argB-5'-F tgaattcgagctcggtaccctgcggctcgcacggttgctc Sequence No. 21 argB-5'-R acggtgcgcaagaagaccacgtcggcagcaaaagcagcct Sequence No. 22 argB-3'-F ggctgcttttgctgccgacgtggtcttcttgcgcaccgtg Sequence No. 23 argB-3'-R gtcgactctagaggatccccctcttatcaggccaatcggt

[0257] Example 2-2. Preparation of Corynebacterium glutamicum CJR100 strain

[0259] Based on the CJR2 strain produced in Example 2-1, we intended to produce a CJR100 strain with an enhanced N-acetyl-gamma-glutamyl-phosphate reductase (hereinafter argC) gene.

[0260] To enhance the activity of N-acetyl-gamma-glutamyl-phosphoriphosphate reductase argC (SEQ No. 25_NCBI Registration No. BBD29_RS07530), a plasmid enhancing argC activity was constructed by replacing the wild-type promoter of the argC gene with Po2 using the Po2 promoter (US 10273491 B2), which is known as a strong promoter. The upstream and downstream regions of the argC gene were obtained. Specifically, to construct a strain of argC introduced with a Po2 promoter, PCR was performed using the chromosomal DNA of Corynebacterium glutamicum ATCC13869 as a template to amplify gene fragments of the upstream region of the argC gene using primers of SEQ ID NO. 26 and SEQ ID NO. 27, and the downstream region of the argC gene using primers of SEQ ID NO. 28 and SEQ ID NO. 29. Additionally, Po2 promoter fragments were obtained using SEQ ID NO. 30 and SEQ ID NO. 31 as the pDCM2-Po2 template. PfuUltra™ high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and the PCR conditions were denaturation at 95°C for 30 seconds; denaturation at 55°C for 30 seconds; and polymerization at 72°C for 1 minute; and these denaturation, annealing, and polymerization steps were repeated 28 times. As a result, an 86bp DNA fragment of the Po2 promoter region, a 610bp DNA fragment of the upstream Corynebacterium glutamicum ATCC13869 argC, and a 1086bp DNA fragment of the downstream region were obtained, respectively. PCR was performed using primers of SEQ ID NO. 26 and SEQ ID NO. 29 with the amplified promoter and DNA fragments as templates. Under the PCR conditions, denaturation at 95°C for 5 minutes was followed by denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 2 minutes, repeated 28 times, followed by polymerization at 72°C for 5 minutes.After DNA purification, the two fragments obtained above were fused with a pDCM2 plasmid treated with SmaI restriction enzyme using the In-Fusion® HD Cloning Kit (Clontech). The resulting vector was named pDCM2-Po2-argC.

[0261] Next, the CJR2 strain prepared in Example 2-1 was transformed by the electro-pulse method using the prepared pDCM2-Po2-argC plasmid (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Subsequently, secondary recombination was performed on a solid plate medium containing 4% sucrose, and PCR was performed on the transformed strain after secondary recombination using a primer pair (SEQ Nos. 26 and 31) to confirm that the chromosomal argC gene was reinforced to the Po2 promoter. The PCR reaction was performed by repeating the process of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and extension at 72°C for 2 minutes 30 times. The transformed strain was named CJR100.

[0263] Compound Plate Medium (pH 7.0)

[0264] Glucose 10 g, Peptone 10 g, Beef extract 5 g, Yeast extract 5 g, Brain Heart Infusion 18.5 g, NaCl 2.5 g, Urea 2 g, Sorbitol 91 g, Agar 20 g (based on 1 liter of distilled water)

[0266] The sequences and details of the primers used in this example are listed in Table 4.

[0268] Sequence number designation order Sequence No. 26 argC-5'-F GTGAATTCGAGCTCGGTACCCGCCCCGAAAAGCCGTTAAAAG Sequence No. 27 argC-5'-R tgccaaaattcacgattattgCTCGAGTCTAGAGACGGGTTA Sequence No. 28 argC-3'-F ttatggagaggagatcaaaacaATGACAATCAAGGTTGCAATC Sequence No. 29 argC-3'-R CAGGTCGGCGTCGCACCTTAAGGGGATCCTCTAGAGTCGACC Sequence No. 30 Po2-F caataatcgtgaattttggca Sequence No. 31 Po2-R tgttttgatctcctccaataa

[0270] Example 2-3. Preparation of strains with enhanced activity of pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase and pyruvate dehydrogenase complex subunit E1, and evaluation of arginine, citrulline, and ornithine production capacity

[0272] Based on the CJR100 strain prepared in Example 2-2, the strain was transformed by the electro-pulse method using the pDCM2-Pcj7_aceF plasmid prepared in Example 1 (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Subsequently, secondary recombination was performed on solid plate media containing 4% sucrose, and PCR was conducted on the transformed strain after secondary recombination using primer pairs (SEQ Nos. 4 and 9) to confirm that the pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase was enhanced as the Pcj7 promoter. At this time, the PCR reaction was performed as follows: denaturation at 95 °C for 30 seconds; annealing at 55 °C for 30 seconds; and the elongation process at 72°C for 2 minutes was repeated 30 times. The transformed strain was named CJR101 (CJR100-Pcj7_aceF).

[0273] In addition, the CJR101 strain enhanced with aceF was transformed by the electro-pulse method using the pDCM2-Pcj7_aceE plasmid constructed in Examples 1-2 (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Subsequently, secondary recombination was performed on solid plate media containing 4% sucrose, and PCR was performed on the transformed strain after secondary recombination using primer pairs (SEQ Nos. 12 and 19) to confirm that the chromosomal Pyruvate Dehydrogenase Complex subunit E1 was enhanced as the Pcj7 promoter. At this time, the PCR reaction was performed by repeating the process of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and extension at 72°C for 2 minutes 30 times. The above-mentioned transgenic strain was named CJR103 (CJR101-Pcj7_aceE).

[0275] The parent strain Corynebacterium glutamicum CJR2 and the strains CJR101, CJR102, and CJR103 prepared in Examples 2-3 above were inoculated into a 250 mL corner-baffle flask containing 25 mL of the following production medium, and cultured at 30 °C for 44 hours with shaking at 200 rpm. The composition of the production medium is as follows.

[0277] Compound Plate Medium (pH 7.0)

[0278] Glucose 10 g, Peptone 10 g, Beef extract 5 g, Yeast extract 5 g, Brain Heart Infusion 18.5 g, NaCl 2.5 g, Urea 2 g, Sorbitol 91 g, Agar 20 g (based on 1 liter of distilled water)

[0280] Production Medium (pH 7.2)

[0281] Sucrose 50g, ammonium sulfate 57g, magnesium sulfate heptahydrate 2g, beet molasses 5g, calcium chloride 1mg, cobalt chloride 1mg, monopotassium phosphate 2g, biotin 0.01mg, thiamine-HCl 0.1mg, calcium pantothenate 2mg, nicotinamide 3mg, ferrous sulfate 10mg, manganese sulfate 10mg, zinc sulfate 0.02mg, copper sulfate 0.5mg, calcium carbonate 30g (based on 1 liter of distilled water)

[0283] After the culture was finished, the production capacity (concentration) of L-arginine was analyzed using HPLC (Waters 2478), and the analyzed concentrations of L-arginine and L-citrulline and the improvement in L-arginine yield are shown in Table 5 below.

[0285] Arginine, citrulline, and ornithine production capacity strain L-arginine (g / ℓ) L-citrulline (g / ℓ) Ornithine (g / ℓ) 3BT average Improvement 3BT average 3BT average control group CJR2 5.1 - 1.0 0.1 control group CJR100 5.9 - 1.0 0.2 AceF Enhancement CJR101 6.37 108% 1.3 0.4 AceF + AceE Enhancement CJR103 7.00 110% 1.7 0.7

[0287] As a result, it was confirmed that strain CJR101, in which aceF is reinforced with a Pcj7 promoter, showed an 8–10% improvement in L-arginine production capacity compared to the parent strain CJR100, which is not reinforced. In addition, it was confirmed that strain CJR103, in which aceE within the aceF-reinforced CJR101 strain is reinforced with a Pcj7 promoter, showed a 110% improvement in L-arginine production capacity compared to the parent strain CJR101, and a 118% improvement compared to CJR100.

[0288] In addition, it was confirmed that the CJR101 and CJR103 strains showed improved L-citrulline and L-ornithine production capabilities compared to the control strains (CJR2, CJR100). The above results indicate that in L-arginine-producing strains of the genus Corynebacterium, enhancement of the pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase is effective for L-arginine production, and additionally, enhancement of the pyruvate dehydrogenase complex subunit E1 is effective for arginine production. Furthermore, it can be seen that it is effective for the production of citrulline and ornithine as well as arginine.

[0290] Example 3: Development of a citrulline-producing strain with enhanced activity of pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase and pyruvate dehydrogenase complex subunit E1, and evaluation of citrulline production capacity

[0292] Example 3-1. Preparation of a Citrulline-Producing Strain

[0293] A strain was prepared to be used as a control group in the citrulline production capacity evaluation experiment.

[0294] A vector was constructed that replaces the glutamic acid located at position 47 of the argR(ANU33619.1) protein sequence with a stop codon. Wild type C. glutamicum Using the genome of ATCC 13869 as a template, a homologous recombinant A arm was amplified using the primer pair of SEQ ID NOs 40 and 41, and a homologous recombinant B arm was amplified using the primer pair of SEQ ID NOs 42 and 43. Subsequently, a plasmid was obtained in the same manner as in Example 1 above, and this plasmid was named pDCM2-argR(E47*).

[0295] To construct a microorganism with enhanced L-citrulline production capacity, a vector was constructed by replacing the phenylalanine located at protein sequence 68 of argG (ANU33620.1) with a stop codon. Using the genome of C. glutamicum ATCC13869 as a template, the homologous recombinant A arm was amplified using primers SEQ ID NOs 44 and 45, and the homologous recombinant B arm was amplified using primers SEQ ID NOs 46 and 47. Subsequently, a plasmid was obtained using the method described above, and this plasmid was named pDCM2-argG(F68*).

[0296] The primer sequences used here are as shown in Table 6 below.

[0297] Sequence number Sequence(5' -> 3') 40 CGGTACCCGGGGATCCCTCGTGCGGAATTCGTGGAG 41 ATCCAGCAGCAATTCAGACA 42 CTGAATTGCTGCTGGATTAAGGCATCGATATCACCCA 43 ATGCCTGCAGGTCGACCCTTCATTTTAAGTTCCTTG 44 CGGTACCCGGGGATCCTTCATCGATAGGGTGGG 45 GTACTCCTCAGCTTACTCATCCTTTGCATCAACA 46 AGTAAGCTGAGGAGTACTGCCTGCCAACCATCAA 47 ATGCCTGCAGGTCGACCGACTGGCTTGCCACCCT

[0299] Using the generated pDCM2-argR(E47*) vector, the wild type C. glutamicum After transforming ATCC 13869 by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), a strain was obtained through a secondary crossover process in which the 139th nucleotide sequence of argR was replaced from guanine (g) to thymine (t) and the 47th protein sequence was replaced with a stop codon. PCR and sequencing analysis were performed using primer pairs of SEQ ID NOs 40 and 43, which can amplify adjacent regions including the site where the gene was inserted, and the genetic manipulation was confirmed. The microorganism obtained in this way was named C. gl::argR*.

[0300] To construct a microorganism with enhanced citrulline production from C. gl::argR*, the microorganism was obtained using the pDCM2-argG(F68*) vector in the manner described above. PCR and sequencing analysis were performed using the primer pair SEQ ID NOs 44 and 47, which can amplify adjacent regions including the site where the gene was inserted, and the genetic modification was confirmed. The microorganism obtained in this way was named C. gl::argR*_argG*.

[0302] Example 3-2. Production of a citrulline-producing strain with enhanced activity of pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase and pyruvate dehydrogenase complex subunit E1

[0303] In order to determine whether there is an effect of increasing citrulline production capacity in a strain with enhanced pyruvate dehydrogenase complex activity in a Corynebacterium glutamicum strain capable of producing L-citrulline, a strain with enhanced aceF activity was prepared from C. gl::argR*_argG*, an L-citrulline producing strain prepared in Example 3-1.

[0304] Specifically, the vector pDCM2-Pcj7_aceF plasmid prepared in Example 1 above was used to transform the L-citrulline producing strain C. gl::argR*_argG* by the electro-pulse method (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). The transformed strain was named C. gl::argR*_argG*-Pcj7_aceF.

[0306] Based on the above C. gl::argR*_argG*-Pcj7_aceF strain, a strain with further enhanced aceE activity was constructed. Specifically, the L-citrulline producing strain C. gl::argR*_argG*_Pcj7_aceF was transformed by the electro-pulse method using the vector pDCM2-Pcj7_aceE plasmid constructed in Examples 1-2 above (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). The transformed strain was named C. gl::argR*_argG*-Pcj7_aceF-Pcj7_aceE.

[0308] Example 3-3. Evaluation of Citrulline Production Capacity of Strains with Enhanced Pyruvate Dehydrogenase Complex Dihydrolipoyllysine-Residue Acetyltransferase and Pyruvate Dehydrogenase Complex Subunit E1 Activity

[0310] Flask evaluations were performed to compare the citrulline production capabilities of the citrulline-producing strains Corynebacterium glutamicum C. gl::argR*_argG*, C. gl::argR*_argG*-Pcj7_-aceF, and C. gl::argR*_argG*-Pcj7_aceF-Pcj7_aceE. First, each strain was inoculated into a 250 ml corner-barfel flask containing 25 ml of inoculum medium and cultured at 30°C for 20 hours with shaking at 200 rpm. 1 ml of inoculum was inoculated into a 250 ml corner-barfel flask containing 24 ml of production medium and cultured at 33°C for 42 hours with shaking at 200 rpm. After the culture was completed, the production of L-citrulline was measured by HPLC, and the results are shown in Table 6 below.

[0312] <Seed medium (pH 7.0)>

[0314] Glucose 20 g, Peptone 10 g, Yeast extract 5 g, Urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4·7H2O 0.5 g, Biotin 0.1 mg, Thiamine HCl 1 mg, Calcium-Pantothenic Acid 22 mg, Nicotinamide 2 mg (based on 1 liter of distilled water)

[0316] Production Medium (pH 7.2)

[0318] Raw sugar 50 g, (NH4)2SO4 30 g, yeast extract 1 g, KH2PO4 1.1 g, MgSO4·7H2O 1.2 g, L-arginine 0.2 g, biotin 1 mg, thiamine hydrochloride 5 mg, calcium-pantothenic acid 5 mg, nicotinamide 15 mg, MnSO4 10 mg, FeSO4 10 mg, ZnSO4 0.5 mg, CuSO4 0.5 mg, CaCO3 30 g (based on 1 liter of distilled water)

[0321] strain L-Citrulline (g / ℓ) 3BT average Improvement control group C.gl::argR*_argG* 3.5 - C.gl::argR*_argG*-Pcj7_aceF 3.8 108% C.gl::argR*_argG*-Pcj7_aceF-Pcj7_aceE 4.1 110%

[0323] As shown in Table 7 above, compared to the parent strain, the citrulline-producing strain C. gl::argR*_argG*, the C. gl::argR*_argG*-Pcj7_aceF strain, in which the pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase is enhanced by the Pcj7 promoter, showed a 108% improvement in citrulline production capacity, and the C. gl::argR*_argG*-Pcj7_aceF-Pcj7_aceE strain, in which the pyruvate dehydrogenase complex subunit E1 within the C. gl::argR*_argG*-Pcj7_aceF strain is enhanced by the Pcj7 promoter, compared to the parent strain C. It was confirmed that citrulline production capacity was improved by 110% compared to the gl::argR*_argG*-Pcj7_aceF strain. In the case of the C. gl::argR*_argG*-Pcj7_aceF-Pcj7_aceE strain, it was confirmed that citrulline production capacity was improved by 117% compared to the C. gl::argR*_argG* strain.

[0325] The above results indicate that infusion of the pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase is effective for citrulline production in citrulline-producing strains of the genus Corynebacterium, and additionally, infusion of the pyruvate dehydrogenase complex subunit E1 is effective for citrulline production.

[0327] Example 4: Preparation of an ornithine-producing strain with enhanced activity of pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase and pyruvate dehydrogenase complex subunit E1, and evaluation of ornithine production capacity

[0329] Example 4-1. Preparation of an ornithine-producing strain

[0330] A strain for use in evaluating ornithine production capacity was prepared as follows.

[0331] Example 4-1-1. Introduction of Shewanella onaidensis membrane protein and production of lysE-deficient strain

[0332] Example 4-1-1-1. Construction of Shewanella onaidensis membrane protein introduction plasmid

[0333] First, LysE / ArgO family amino acid transporter (WP_011072781.1) (SEQ No. 48), a membrane protein derived from Shewanella oneidensis MR-1 and a protein with high L-ornithine efflux activity, was selected, and a plasmid was constructed to introduce the Shewanella oneidensis membrane protein.

[0334] To amplify the nucleotide sequence of the gene encoding the above protein, information (NC_004347.2) regarding the gene encoding the above membrane protein and surrounding nucleic acid sequences was obtained from the National Institutes of Health GenBank. DNA synthesis was performed based on the sequence information (Cosmo genetech, Korea).

[0335] A vector was constructed to introduce the above-selected membrane protein derived from Shewanella onaidensis MR-1 into an L-ornithine producing strain.

[0336] ANU34435.1, one of the transposases present in the genome of wild-type Corynebacterium glutamicum ATCC 13869 (NZ_CP016335.1), was used as the insertion site. Using the genome of wild-type Corynebacterium glutamicum ATCC 13869 as a template, the homologous recombinant A arm was amplified using the primer pair of SEQ ID NOs 49 and 50, and the homologous recombinant B arm was amplified using the primer pair of SEQ ID NOs 51 and 52.

[0337] To obtain a gene fragment encoding a membrane protein derived from Shewanella onaidensis MR-1 (sequence number 48), PCR was performed using the primer pair of sequence numbers 53 and 54 with the synthesized DNA as a template.

[0338] To obtain the gapA promoter, genomic DNA (NC_006958.1) of wild-type Corynebacterium glutamicum ATCC 13032 was used as a template, and PCR was performed using primer pairs of sequence numbers 55 and 56, followed by denaturation at 95°C for 2 minutes, denaturation at 95°C for 1 minute, annealing at 55°C for 1 minute, and polymerization at 72°C for 1 minute, repeated 25 times, followed by polymerization at 72°C for 5 minutes. Solg™ Pfu-X DNA polymerase was used for the PCR.

[0339] The amplified gapA promoter region, the gene fragment encoding a membrane protein derived from Shewanella onaidensis MR-1, the homologous recombinant arm gene fragment, and the vector pDCM2 (WO2021-187781 A1) cleaved with SalI and BamHI restriction enzymes were ligated using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix), transformed into E. coli DH5α, and plated on LB solid medium conjugated with kanamycin (25 mg / l).

[0340] PCR was performed using the primer pair of SEQ ID NOs. 57 and 58 to select colonies transformed with a vector containing a gene encoding a membrane protein derived from Shewanella onaidensis MR-1. Plasmids were extracted from the selected colonies using a plasmid prep kit (QIAGEN) and named pDCM2-PgapA-Son.

[0341] The primer information used is as shown in Table 8 below.

[0343] Sequence number Sequence(5' -> 3') 49 CGGTACCCGGGGATCCTTTTAGATTCCCAGTGCAG 50 CGCGTGGGCTTTGGGCTGAG 51 TGCATTGGTGGAGCTAGCTG 52 ATGCCTGCAGGTCGACGCTATGCAGTGGAGATGTC 53 CTTTAGAGGAGACACAACATGCAAACGGCGTTTATTC 54 TAGCTCCACCAATGCATTAAATTGCGGCAAGGTAT 55 GCCCAAAGCCCACGCGAACGACCGAGCCTATTGGG 56 GTTGTGTCTCCTCTAAAGATTG 57 TATTACGCCAGCTGGCGAAA 58 GCTTTACACTTTATGCTTCC

[0345] Example 4-1-1-2. Preparation of lysE deletion plasmid

[0346] Next, a plasmid to delete lysE was constructed.

[0347] To construct a vector that deletes the open reading frame (ORF) of wild-type Corynebacterium glutamicum LysE (ANU33473.1) (SEQ ID 59), the genome of wild-type Corynebacterium glutamicum ATCC13869 was used as a template to amplify the homologous recombinant A arm using the primer pair of SEQ ID 68 and 69, and the homologous recombinant B arm using the primer pair of SEQ ID 70 and 71. The homologous recombinant arm gene fragments were cloned identically to 4-1-1-1 into the vector pDCM2, which had been cleaved with SalI and BamHI restriction enzymes, and transformed into E. coli DH5α. PCR was then performed using the primer pair of SEQ ID 57 and 58 to select the transformed colonies. A plasmid was extracted from selected colonies using a plasmid prep kit (QIAGEN), and this plasmid was named pDCM2-ΔlysE.

[0348] The primer information used is as follows.

[0349] Sequence number Sequence(5' -> 3') 68 CGGTACCCGGGGATCCATTGCCTCACCAAAACCTTC 69 CGTGACCTATGGAAGTACTTAAG 70 GTACTTCCATAGGTCACGTTAGTTTTCGCGGGTTTTAG 71 ATGCCTGCAGGTCGACGTTTTGGTGGTTCCCGAAAG

[0351] Example 4-1-1-3. Preparation of argF* plasmid

[0352] To construct an L-ornithine-producing strain, a vector was constructed by replacing the serine located at the 55th position from the N-terminus of the amino acid sequence of ArgF (ANU33618.1) (SEQ ID No. 64) derived from wild-type Corynebacterium glutamicum with a stop codon. Using the genome of wild-type Corynebacterium glutamicum ATCC 13869 as a template, the homologous recombinant A arm was amplified using the primer pair of SEQ ID No. 60 and 61, and the homologous recombinant B arm was amplified using the primer pair of SEQ ID No. 62 and 63. Subsequently, a plasmid was obtained in the same manner as in Example 4-1-1-1 above, and this plasmid was named pDCM2-argF(S55*).

[0354] Example 4-1-1-4. Preparation of C. gl::argF*_argR*_PgapA-Son and C. gl::argF*_argR*_ΔlysE_PgapA-Son strains

[0355] After transforming wild-type Corynebacterium glutamicum ATCC 13869 using the pDCM2-argF(S55*) vector via electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), a strain was obtained in which the serine at the 55th position from the N-terminus of the ArgF amino acid sequence was replaced with a stop codon through a secondary crossover process. PCR and sequencing analysis were performed using primer pairs of SEQ ID NOs 60 and 63, which can amplify the adjacent region including the insertion site of the gene, and the genetic modification was confirmed and named C. gl::argF*.

[0356] C. gl::argF* was transformed with the pDCM2-argR(E47*) vector prepared in Example 3-1 to obtain a strain in which the glutamate located at the 47th position from the N-terminus of the ArgR amino acid sequence was substituted with a stop codon using the same method as above. PCR and sequencing analysis were performed using the primer pair of SEQ ID NOs 40 and 43, which can amplify the adjacent region including the site where the gene was inserted, and the genetic modification was confirmed. The strain obtained in this way was named C. gl::argF*_argR*.

[0357] After transforming C. gl::argF*_argR* with the pDCM2-ΔlysE plasmid prepared in Example 4-1-1-2 by electroporation, a strain with a deletion of the gene encoding LysE (lysE) was obtained through a secondary crossover process. PCR and sequencing analysis were performed using the primer pair of SEQ ID NOs 68 and 71, which can amplify the adjacent region including the site where the gene was inserted, and the genetic modification was confirmed. The strain obtained in this way was named C. gl::argF*_argR*_ΔlysE.

[0358] The primer information used is as follows.

[0359] Sequence number Sequence(5' -> 3') 60 CGGTACCCGGGATCCTGACCCCAGGCAAGCACGG 61 GAAGCGAGTACGAGTTTAAGTCTTATC 62 AAACTCGTACTCGCTTCTCC 63 ATGCCTGCAGGTCGACCGGCGCCGGCAACCTCGTC

[0361] The pDCM2-PgapA-Son vector constructed in Example 4-1-1-1 above was transformed into C. gl::argF*_argR* and the lysE-deficient strain C. gl::argF*_argR*_ΔlysE, respectively, by electroporation, and then strains with PgapA-Son inserted were obtained through a secondary crossover process. PCR and sequencing analysis were performed using the primer pair of SEQ ID NOs 68 and 71, which can amplify adjacent regions including the site where the gene was inserted, and the genetic manipulation was confirmed.

[0362] The strains obtained in this way were named C. gl::argF*_argR*_PgapA-Son and C. gl::argF*_argR*_ΔlysE_PgapA-Son.

[0364] Example 4-1-2. Preparation of a strain with weakened carbamoyl phosphate synthase activity

[0365] Example 4-1-2-1. Vector generation for carAB promoter substitution

[0366] A vector was constructed to replace the promoter of the carA gene encoding the carbamoyl phosphate synthase small subunit (CarA). Information on the carAB gene (sequence number 67) encoding CarA (ANU33813.1, sequence number 65) and surrounding nucleic acid sequences (NZ_CP016335.1) was obtained from the National Institutes of Health GenBank, and using this information, a vector was constructed to replace the promoter region of carA with the promoter of betP (ANU33153.1) (sequence number 72).

[0367] DNA fragments were obtained by amplifying the betP promoter using the primer pair of SEQ ID NOs 77 and 78, the homologous recombinant A arm using the primer pair of SEQ ID NOs 79 and 80, and the homologous recombinant B arm using the primer pair of SEQ ID NOs 81 and 82 via PCR (Sol™ Pfu-X DNA polymerase), using the genome of wild-type C. glutamicum ATCC 13869 as a template.

[0368] A vector was constructed by cloning the above-mentioned promoter and recombinant arm gene fragments into the vector pDCM2 (Korean Patent Publication No. 10-2020-0136813), which had been cleaved with SalI and BamHI restriction enzymes, using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix). The constructed vector was transformed into E. coli DH5α and plated on LB solid medium containing kanamycin (25 mg / l). To select colonies transformed with the above vector, PCR was performed using the primer pair of SEQ ID NOs. 83 and 84, and a plasmid was obtained from the selected colonies using a commonly known plasmid extraction method. The obtained plasmid was named pDCM2-PbetP-carA.

[0369] The primer information used is as follows.

[0370] Sequence number Sequence(5' -> 3') 77 GGCACAAGATGGGGTGCTGGCGAGATCACCGTT 78 TATCGGTTTCGAATTTGGGTCAGATGTAGTCATA 79 CGGTACCCGGGGATCCCAAGAAGGCGCTTCTCG 80 GCACCCCATCTTGTGCCGGTGACTGTTGTCGCCT 81 CAAATTCGAAACCGATAGTGAGTAAAGACACCAC 82 ATGCCTGCAGGTCGACGAGACCTCAACGGAGAG 83 TATTACGCCAGCTGGCGAAA 84 GCTTTACACTTTATGCTTCC

[0372] Example 4-1-2-2. Vector construction for carA start codon mutation

[0373] A vector was constructed to replace the start codon gtg of the gene carA with ttg. Using the genome of wild-type C. glutamicum ATCC 13869 as a template, the homologous recombinant A arm was amplified using the primer pair of SEQ ID NOs 79 and 85, and the homologous recombinant B arm was amplified using the primer pair of SEQ ID NOs 82 and 86. Subsequently, a plasmid was obtained using the same method as above and named pDCM2-carA(g1t).

[0374] The primer information used is as follows.

[0375] Sequence number Sequence(5' -> 3') 85 GGTGACTGTTGTCGCCTTTCGTGTGTCTGTC 86 GGCGACAACAGTCACCTTGAGTAAAGACACCAC

[0377] Example 4-1-2-3. Vector construction for carB start codon mutation

[0378] A vector was constructed to replace the start codon atg of the gene carB with ttg. Information on the carAB gene (SEQ No. 67) encoding the carbamoyl phosphate synthase large subunit (SEQ No. 66) and surrounding nucleic acid sequences (NZ_CP016335.1) was obtained from the National Institutes of Health Gene Bank. Using the genome of wild-type C. glutamicum ATCC 13869 as a template, the homologous recombinant A arm was amplified using the primer pair of SEQ No. 73 and 74, and the homologous recombinant B arm was amplified using the primer pair of SEQ No. 75 and 76. Subsequently, a plasmid was obtained using the same method as above and named pDCM2-carB(a1t).

[0379] The primer information used is as follows.

[0380] Sequence number Sequence(5' -> 3') 73 CGGTACCCGGGGATCCCCCACGTCGTTTCTCTGCAC 74 GTTATTTATGCGCCTTTCTTC 75 GAAAGGCGCATAAATAACTTGCCAAAGCGTTCAGATAT 76 ATGCCTGCAGGTCGACGCCACCCATAGTGAAGGATG

[0382] Example 4-1-2-4. Preparation of a strain with weakened carbamoyl phosphate synthase activity

[0383] The pDCM2-PbetP-carA and pDCM2-carA(g1t) vectors prepared in Examples 4-1-2-1 to 4-1-2-2 were transformed by electroporation into wild-type C. glutamicum ATCC 13869, and C. gl::argF* and C. gl::argF*_argR* prepared in 4-1-1-3, respectively, and strains were obtained through a secondary crossover process. PCR and sequencing analysis were performed using the primer pair of SEQ ID NOs 78 and 81, and the corresponding genetic manipulation was confirmed. The strains obtained in this way were named in order as C. gl::PbetP-carA, C. gl::carA(g1t), C. gl::argF*_PbetP-carA, C. gl::argF*_carA(g1t), C. gl::argF*_argR*_PbetP-carA, and C. gl::argF*_argR*_carA(g1t).

[0384] To construct strains with substituted promoters and start codons of carB, wild-type C. glutamicum ATCC 13869, C. gl::argF*, and C. gl::argF*_argR* were transformed by electroporation using the plasmid vector pDCM2-carB(a1t) obtained in Example 4-1-2-3, respectively, and strains were obtained through a secondary crossover process. PCR and sequencing analysis were performed using the primer pair of SEQ ID NOs 87 and 90, which can amplify adjacent regions including the site where the gene was inserted, and the genetic modification was confirmed. The strains obtained in this way were named C. gl::carB(a1t), C. gl::argF*_carB(a1t), and C. gl::argF*_argR*_carB(a1t), respectively.

[0386] Example 4-2. Preparation of an ornithine-producing strain with enhanced activity of pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase and pyruvate dehydrogenase complex subunit E1

[0388] In order to determine whether there is an effect of increasing the production capacity of the activity-enhanced strain in the Corynebacterium glutamicum strain having L-ornithine production ability, strains with enhanced aceF activity were prepared from the Corynebacterium glutamicum L-ornithine producing strains prepared in Example 4-1, namely strains C.gl::argF*_argR*_PgapA-Son and C.gl::argF*_argR*_ΔlysE_PgapA-Son, C.gl::argF*_argR*_carA(g1t) and C.gl::argF*_argR*_carB(a1t).

[0389] Specifically, the vector pDCM2-Pcj7_aceF constructed in Example 1 above was transformed into Corynebacterium glutamicum C.gl::argF*_argR*_PgapA-Son and C.gl::argF*_argR*_ΔlysE_PgapA-Son, C.gl::argF*_argR*_carA(g1t) and C.gl::argF*_argR*_carB(a1t), respectively, by chromosomal homologous recombination (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999).

[0390] The above recombinant strains were named C.gl::argF*_argR*_PgapA-Son-Pcj7_aceF, C.gl::argF*_argR*_ΔlysE_PgapA-Son-Pcj7_aceF, C.gl::argF*_argR*_carA(g1t)-Pcj7_aceF, and C.gl::argF*_argR*_carB(a1t)-Pcj7_aceF.

[0391] In addition, the vector pDCM2-Pcj7_aceE constructed in Examples 1-2 based on the aceF-enhanced strain was transformed into Corynebacterium glutamicum C.gl::argF*_argR*_PgapA-Son-Pcj7_aceF, C.gl::argF*_argR*_ΔlysE_PgapA-Son-Pcj7_aceF, C.gl::argF*_argR*_carA(g1t)-Pcj7_aceF, and C.gl::argF*_argR*_carB(a1t)-Pcj7_aceF, respectively, by chromosomal homologous recombination (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). The above recombinant strains were named C.gl::argF*_argR*_PgapA-Son-Pcj7_aceF-Pcj7_aceE, C.gl::argF*_argR*_ΔlysE_PgapA-Son-Pcj7_aceF-Pcj7_aceE, C.gl::argF*_argR*_carA(g1t)-Pcj7_aceF-Pcj7_aceE, and C.gl::argF*_argR*_carB(a1t)-Pcj7_aceF-Pcj7_aceE.

[0393] Example 4-3. Evaluation of the production capacity of an ornithine strain with enhanced pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase and pyruvate dehydrogenase complex subunit E1 activity

[0395] A flask evaluation was performed to compare the ornithine production capacity of the ornithine-producing strains prepared in Example 4-2. First, each strain was inoculated into a 250 ml corner-barfle flask containing 25 ml of inoculum and cultured at 30°C for 20 hours with shaking at 200 rpm. 1 ml of inoculum was inoculated into a 250 ml corner-barfle flask containing 24 ml of production medium and cultured at 33°C for 42 hours with shaking at 200 rpm. After the culture was completed, the production of L-ornithine was measured by HPLC, and the results are shown in Table 14 below.

[0397] <Seed medium (pH 7.0)>

[0398] Glucose 20 g, Peptone 10 g, Yeast extract 5 g, Urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4·7H2O 0.5 g, Biotin 0.1 mg, Thiamine HCl 1 mg, Calcium-Pantothenic Acid 22 mg, Nicotinamide 2 mg (based on 1 liter of distilled water)

[0400] Production Medium (pH 7.0)

[0401] Raw sugar 50 g, (NH4)2SO4 25 g, yeast extract 1 g, KH2PO4 0.55 g, MgSO4·7H2O 0.6 g, L-arginine 0.2 g, biotin 0.9 mg, thiamine hydrochloride 4.5 mg, calcium-pantothenic acid 4.5 mg, nicotinamide 30 mg, MnSO4 9 mg, FeSO4 9 mg, ZnSO4 0.45 mg, CuSO4 0.45 mg, CaCO3 30 g (based on 1 liter of distilled water)

[0403] strain L-ornithine (g / ℓ) 3BT average Improvement C. glutamicum WT 0 - C.gl::argF*_argR* 17.2 - C.gl::argF*_argR*_PgapA-Son 20.3 - C.gl::argF*_argR*_ΔlysE_PgapA-Son 19.1 - C.gl::argF*_argR*_PbetP-carA 20.9 - C.gl::argF*_argR*_carA(g1t) 20.1 - C.gl::argF*_argR*_carB(a1t) 20.5 - C.gl::argF*_argR*_PgapA-Son-Pcj7_aceF 22.7 112% C.gl::argF*_argR*_ΔlysE_PgapA-Son-Pcj7_aceF 21.6 113% C.gl::argF*_argR*_PbetP-carA-Pcj7_Pcj7_aceF 24.0 115% C.gl::argF*_argR*_carA(g1t)-Pcj7_Pcj7_aceF 22.7 113% C.gl::argF*_argR*_carB(a1t)-Pcj7_aceF 24.6 112% C.gl::argF*_argR*_carB(a1t)-Pcj7_aceF-Pcj7_aceE 25.4 112% C.gl::argF*_argR*_PgapA-Son-Pcj7_ aceF -Pcj7_aceE 23.9 111% C.gl::argF*_argR*_ΔlysE_PgapA-Son-Pcj7_ aceF -Pcj7_aceE 27.3 114% C.gl::argF*_argR*_PbetP-carA-Pcj7_aceE-Pcj7_aceE 25.4 112% C.gl::argF*_argR*_carA(g1t)-Pcj7_ aceF - Pcj7_aceE 27.5 112%

[0405] As shown in Table 14 above, it was confirmed that the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase (aceF) in the L-ornithine producing strain increased by approximately 112–115% compared to the parent strain. In addition, it was confirmed that in an L-ornithine producing strain with additional pyruvate dehydrogenase complex subunit E1 (aceE) based on a strain with enhanced pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase (aceF), the levels increased by 111% to 114% compared to the parent strain with enhanced pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase (aceF), and increased by 125% to 134% compared to the parent strain.

[0406] The above results indicate that in the L-arginine-producing strain of Corynebacterium, enhancement of the pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase is effective for L-ornithine production, and additionally, enhancement of the activity of the pyruvate dehydrogenase complex subunit E1 is also effective for L-ornithine production.

[0408] Example 5: Preparation of O-acetylhomoserine and homoserine-producing strains with enhanced activity of pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase and pyruvate dehydrogenase complex subunit E1, and evaluation of production capacity

[0410] Example 5-1. Preparation of O-acetyl homoserine and homoserine-producing strains

[0411] Example 5-1-1. metB defect

[0412] Through PCR using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template, encoding cystathionine gamma-synthase of the O-acetylhomoserine degradation pathway metB Genes were obtained from the National Institutes of Health (NIH) GenBank. metB The nucleotide sequence information of the gene (NCBI registry number Ncgl2360, sequence number 91) was obtained, and based thereon, metB Primers containing the N-terminal portion of the gene and the linker portion (SEQN NOs 87 and 88), and primers containing the C-terminal portion and the linker portion (SEQN NOs 89 and 90) were synthesized. The primer sequences are listed in Table 15 below.

[0414] Sequence number Ranking name order 87 metB_N_del F GGCTTCGGAGTTGGAGCG 88 metB_N_del R GCCAAATAGTTTcccgggGGTAGATCAACTCCTGTAATCA 89 metB_C_del F CAGGAGTTGATCTACCcccgggAACTATTTGGCGGCAAG 90 metB_C_del R TCGCGTCTGGGTGCGCATC

[0416] PCR was performed using the chromosomal DNA of ATCC13032 as a template and the primers of SEQ ID NOs. 87 and 88 and SEQ ID NOs. 89 and 90. PfuUltra™ high-reliability DNA polymerase (Stratagene) was used as the polymerase, and the PCR conditions were performed by repeating 30 cycles of denaturation at 96°C for 30 seconds, annealing at 53°C for 30 seconds, and polymerization at 72°C for 1 minute. As a result, an amplified gene of 558 bp containing the N-terminal and linker portions of the metB gene and an amplified gene of 527 bp containing the C-terminal and linker portions of the metB gene were obtained, respectively.

[0417] PCR was performed using the two amplified genes obtained above as templates. The PCR conditions involved denaturation at 96°C for 60 seconds, annealing at 50°C for 60 seconds, and polymerization at 72°C for 1 minute, repeated 10 times; then, SEQ ID NOs 92 and 95 were added, and the polymerization reaction was repeated 20 more times. As a result, a 1064 bp inactivated cassette containing the N-terminal-linker-C-terminal of the metB gene was obtained.

[0418] The pDCM2 vector was treated with SmaI, and the PCR product (1064 bp) obtained above was fusion-cloned with the SmaI restriction enzyme-treated pDCM2 vector using the In-Fusion® HD Cloning Kit (Clontech). The cloned vector was transformed into E. coli DH5α, and the transformed E. coli were plated on LB solid medium containing 25 mg / L of kanamycin. After selecting colonies transformed with the plasmid from the LB medium, the plasmid extraction method (U.S. Register) US 5981235 A) A plasmid was obtained using, and finally metB A pDCM2-ΔmetB recombinant vector containing a cloned gene deletion cassette was constructed.

[0419] The constructed pDCM2-ΔmetB vector was transformed into the ATCC13032ΔNCgl2335::PCJ7-yjeH(eco,F351L) (KCCM12634P; WO2021-125896 A1) strain by electro-pulse, and after a secondary crossing-in process, on the chromosome metB ATCC13032ΔNCgl2335::PCJ7-yjeH(eco,F351L)ΔmetB with the gene inactivated was obtained. metB Whether the gene is inactivated is determined after PCR using primers of SEQ ID NOs 87 and 90 metB It was finally confirmed by comparison with ATCC13032, in which the gene was not inactivated.

[0421] Example 5-1-2. metY defect

[0422] Through PCR using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template, encoding O-acetylhomoserine (thiol)-lyase of the O-acetylhomoserine degradation pathway metY Genes were obtained from the National Institutes of Health (NIH) GenBank. metY The nucleotide sequence information of the gene (NCBI registration number Ncgl0625, sequence number 92) was obtained, and based thereon, metY Primers containing the N-terminal portion of the gene and the linker portion (Sequence Nos. 93 and 94), and primers containing the C-terminal portion and the linker portion (Sequence Nos. 95 and 96) were synthesized. The primer sequences were as shown in Table 16 below.

[0424] Sequence number Ranking name order 93 metY_N_del F CCAAAGACAAGGAGACCA 94 metY_N_del R AGTCTATTTAAAGcccgggTTGGAGGTCCTTAAGAGTTTT 95 metY_C_del F TAAGGACCTCCAAcccgggCTTTAAATAGACTCACCCCAG 96 metY_C_del R ATGCCGAGTGCGTCGAGG

[0426] PCR was performed using the chromosomal DNA of ATCC13032 as a template and the primers of SEQ ID NOs. 93 and 94 and SEQ ID NOs. 95 and 96. The polymerase used was PfuUltra TMHigh-reliability DNA polymerase (Stratagene) was used, and the PCR conditions consisted of 30 cycles of denaturation at 96°C for 30 seconds, annealing at 53°C for 30 seconds, and polymerization at 72°C for 1 minute. As a result, metY A 548bp amplified gene including the N-terminal and linker portions, and metY A 550 bp amplified gene containing the C-terminal and linker regions was obtained. PCR was performed using the two amplified genes obtained above as templates; the PCR conditions consisted of denaturation at 96°C for 60 seconds, annealing at 50°C for 60 seconds, and polymerization at 72°C for 1 minute, repeated 10 times, after which SEQ ID NOs 97 and 100 were added and the polymerization reaction was repeated 20 more times. As a result metY A 1077 bp inactivation cassette containing the N-terminal-linker-C-terminal of the gene was obtained.

[0427] The pDCM2 vector was fusion-cloned using the In-Fusion® HD Cloning Kit (Clontech) with the SmaI restriction enzyme-treated pDCM2 vector obtained above after SmaI treatment. The cloned vector was transformed into E. coli DH5α, and the transformed E. coli were plated on LB solid medium containing 25 mg / L of kanamycin. After selecting colonies transformed with the plasmid from the LB medium, the plasmid was obtained using the plasmid extraction method (US Publication US 5981235 A), and finally metY A pDCM2-ΔmetY recombinant vector containing a cloned gene deletion cassette was constructed.

[0428] The constructed pDCM2-ΔmetY vector was transformed into ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetB by electropulse, and ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetB ΔmetY, in which the metY gene was further inactivated on the chromosome, was obtained through a second crossing process. metY Gene inactivation was determined after PCR using primers of SEQ ID NOs 93 and 96 metY It was finally confirmed by comparison with ATCC13032, in which the gene was not inactivated.

[0430] Example 5-1-3. Introduction of lysC(L377K)

[0431] To construct a vector containing the lysC gene variant (US 10662450 B2) for enhancing the expression of the lysC gene and unlocking feedback inhibition for L-lysine and L-threonine, a pair of primers (SEQNs 98 and 99) for amplifying the 5' upside region centered around the mutation site and a pair of primers (SEQNs 100 and 101) for amplifying the 3' downside region were designed. The primer sequences are as shown in Table 17 below.

[0432] Sequence number Ranking name order 98 lysC_L377K_5 F CAGAAGCTGGAAAAGCTCA 99 lysC_L377K_5 R ATCTCAGAGGTGGGAAATCttTTCGATGTTCACGTTGACAT 100 lysC_L377K_3 F TGTCAACGTGAACATCGAAaaGATTTCCACCTCTGAGATT 101 lysC_L377K_3 R TCCTTGTCGGAAGGGTTCA

[0434] PCR was performed using the ATCC13032 chromosome as a template and primers SEQ NOs 98, 99, 100, and 101. The PCR conditions involved denaturation at 95°C for 5 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 30 seconds, followed by polymerization at 72°C for 7 minutes. As a result, a 512 bp DNA fragment from the 5' upstream region and a 522 bp DNA fragment from the 3' downstream region were obtained, centered around the mutation in the lysC gene.

[0435] PCR was performed using two amplified DNA fragments as templates and primers of SEQ ID NO. 98 and SEQ ID NO. 101. The PCR conditions were denaturation at 95°C for 5 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 60 seconds, followed by polymerization at 72°C for 7 minutes. As a result, a 1011 bp DNA fragment containing the variant lysC(L377K) gene encoding an aspartokinase variant in which the 377th leucine is substituted with lysine was amplified.

[0436] The pDCM2 vector was fusion-cloned using the In-Fusion® HD Cloning Kit (Clontech) with the SmaI restriction enzyme-treated pDCM2 vector and the PCR product (1011 bp) obtained above. The cloned vector was transformed into E. coli DH5α, and the transformed E. coli were plated on LB solid medium containing 25 mg / ℓ of kanamycin. After selecting colonies transformed with the plasmid from the LB medium, the plasmid was obtained using the plasmid extraction method (US Publication US 5981235 A), and finally, a pDCM2-lysC(L377K) recombinant vector was constructed in which a cassette with the lysC(L377K) gene substituted was cloned.

[0437] The constructed pDCM2-lysC(L377K) vector was transformed into the strain ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetB ΔmetY using electro-pulse, and through a secondary crossover process, Corynebacterium glutamicum ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetB ΔmetY lysC(L377K) with a nucleotide mutation introduced into the lysC gene on the chromosome was obtained. The introduction of the nucleotide mutation was finally confirmed by comparing the sequence with the wild-type lysC gene sequence through post-sequencing of PCR using primers of SEQ ID NOs 98 and 101.

[0439] Example 5-1-4. NCgl0616 defect

[0440] Corynebacterium glutamicum ( Corynebacterium glutamicum A vector was constructed to delete the intrinsic gene NCgl0616 (sequence number 38) in ATCC13032.

[0441] Specifically, a pair of primers (sequence numbers 102 and 103) for amplifying the 5' upper region centered on the NCgl0616 gene location of sequence number 38 and a pair of primers (sequence numbers 104 and 105) for amplifying the 3' lower region were devised.

[0442] Sequence number Ranking name order 102 0616 _del up F TCGAGCTCGGGTACCCAGCATAATTCCATACTCCCAC 103 0616 _del up R GGTAGCGCTTGGGCTGCAGTACTCTCGACGGCGTGCTCAATT 104 0616 _del down F AATTGAGCACGCCGTCGAGAGTACTGCAGCCCAAGCGCTACC 105 0616 _del down R CTCTAGAGGATCCCCCTACGACGCTACTGCGCAG

[0445] PCR was performed using the ATCC13032 wild-type (WT) chromosome as a template and primers SEQ NOs 102, 103, 104, and 105. The PCR conditions involved denaturation at 95°C for 5 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 30 seconds, followed by polymerization at 72°C for 7 minutes. As a result, a 701 bp DNA fragment from the 5' upstream region and a 699 bp DNA fragment from the 3' downstream region were obtained, centered around the deletion site of the NCgl0616 gene.

[0446] PCR was performed using two amplified DNA fragments as templates and primers of SEQ ID NO. 102 and SEQ ID NO. 105. The PCR conditions were denaturation at 95°C for 5 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 90 seconds, followed by polymerization at 72°C for 7 minutes. As a result, a 1410 bp DNA fragment containing a region capable of deleting the NCgl0616 gene was amplified.

[0447] The pDCM2 vector was fusion-cloned using the In-Fusion® HD Cloning Kit (Clontech) with the SmaI restriction enzyme-treated pDCM2 vector, and the PCR product (2912 bp DNA fragment) obtained above was treated with SmaI. The cloned vector was transformed into E. coli DH5α, and the transformed E. coli were plated on LB solid medium containing 25 mg / ℓ of kanamycin. After selecting colonies transformed with the plasmid from the LB solid medium, the plasmid was obtained using the plasmid extraction method (US 5981235 A), and finally, the pDCM2-ΔNCgl0616 recombinant vector containing the NCgl0616 deletion cassette was constructed.

[0449] Sequence number Ranking name order 106 0616 _del F GGCTTCCAACTGTAATGG 107 0616 _del R TAGAACACCCAGCTAACA

[0451] The constructed pDCM2-ΔNCgl0616 vector was transformed into a strain with increased O-acetyl homoserine production capacity using the electro-pulse method, and ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetB ΔmetY lysC(L377K) ΔNCgl0616, in which the NCgl0616 gene was deleted on the chromosome, was obtained through a secondary crossover process.

[0452] The inactivation of the NCgl0616 gene was finally confirmed by comparing it with ATCC13032, in which the NCgl0616 gene was not inactivated, after PCR using primers of sequence numbers 106 and 107.

[0454] Example 5-2. Production of O-acetylhomoserine and homoserine-producing strains with enhanced pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase and pyruvate dehydrogenase complex subunit E1 activity

[0456] To determine whether there is an effect of increasing the production capacity of the activity-enhancing strain in the Corynebacterium glutamicum strain having the ability to produce O-acetylhomoserine and homoserine, the Corynebacterium glutamicum O-acetylhomoserine and homoserine-producing strain ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetB ΔmetY lysC(L377K)ΔNCgl0616 constructed in Example 5-1 was subjected to pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase (NCBI Registration No. NCgl2126, hereinafter NCgl2126. Sequence No. 32) gene number Corynebacterium glutamicum A strain with enhanced activity of NCgl2126 (sequence number 33) derived from ATCC13032 was produced and its efficacy was evaluated.

[0457] Specifically, to construct a pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase enhancing vector, a plasmid enhancing NCgl2126 activity was constructed by replacing the wild-type promoter of the aceF gene with Pcj7, a promoter known as a strong promoter (US 7662943 B2) (Sequence No. 3). PCR was performed to obtain the upstream and downstream regions of the NCgl2126 gene. Specifically, to construct a strain into which the Pcj7 promoter was introduced, PCR was performed to amplify gene fragments of the upstream region of the NCgl2126 gene using primers of SEQ ID NO. 4 and SEQ ID NO. 5, and the downstream region of the NCgl2126 gene using primers of SEQ ID NO. 6 and SEQ ID NO. 34, respectively, using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template. In addition, Pcj7 promoter fragments were obtained using SEQ ID NO. 8 and SEQ ID NO. 9 as the pDCM2-Pcj7 template.

[0458] PfuUltra™ high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction. The PCR conditions were denaturation at 95°C for 30 seconds; denaturation at 55°C for 30 seconds; and polymerization at 72°C for 1 minute; these cycles of denaturation, annealing, and polymerization were repeated 28 times. As a result, a 318 bp DNA fragment of the Pcj7 promoter region, a 526 bp DNA fragment of the Corynebacterium glutamicum ATC13032 NCgl2126 upstream region, and a 529 bp DNA fragment of the downstream region were obtained, respectively. PCR was performed using the amplified promoter and DNA fragments as templates with primers of SEQ ID NO. 4 and SEQ ID NO. 34. The PCR conditions were denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 30 seconds; After repeating annealing at 55°C for 30 seconds and polymerization at 72°C for 2 minutes 28 times, a polymerization reaction was performed at 72°C for 5 minutes. The two fragments obtained above underwent DNA purification, and then fusion cloning was performed using the In-Fusion® HD Cloning Kit (Clontech) to obtain a plasmid by cloning the pDCM2 vector (WO2021-187781 A1) treated with SmaI restriction enzyme according to the provided manual. The resulting vector was named pDCM2-Pcj7_NCgl2126, and the sequences and details of the primers used in this example are listed in Table 20.

[0460] Sequence number Ranking name order 34 NCgl2126-3'-R GGTCGACTCTAGAGGATCCCACCTTGTCGGTGGAGACCTCAA

[0462] The above-described pDCM2-Pcj7_NCgl2126 vector was transformed into the Corynebacterium glutamicum strain ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetB ΔmetY lysC(L377K)ΔNCgl0616 by chromosomal homologous recombination (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). The above-described recombinant strain ATCC13032ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetB ΔmetY lysC(L377K)ΔNCgl0616 -Pcj7_NCgl2126 was named CM04-8000.

[0463] In addition, the vector pDCM2-Pcj7_aceE prepared in Examples 1-2 was transformed into the CM04-8000 strain (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). The recombinant strain (ATCC13032ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetB ΔmetY lysC(L377K)ΔNCgl0616 -Pcj7_NCgl2126-Pcj7_aceE) was named CM04-8002.

[0465] Example 5-3. Evaluation of the production capacity of O-acetylhomoserine and homoserine strains with enhanced pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase and pyruvate dehydrogenase complex subunit E1 activity

[0466] Flask evaluations were performed to compare the production capacity of O-acetyl homoserine and homoserine-producing strains Corynebacterium glutamicum ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetB ΔmetY lysC(L377K)ΔNCgl0616 and CM04-8000, CM04-8002.

[0468] One platinum loop of the strain was inoculated into a 250 mL Corner-Baffle flask containing 25 mL of the following medium, and incubated at 33°C for 20 hours with shaking at 200 rpm. O-acetyl homoserine concentration was analyzed using HPLC, and the analyzed concentrations are as shown in Table 21.

[0470] O-acetyl homoserine production medium (pH 7.2)

[0471] Glucose 30 g, KH2PO4 2 g, Urea 3 g, (NH4)2SO4 40 g, Peptone 2.5 g, CSL(Sigma) 5 g (10 ml), MgSO4.7H2O 0.5 g, CaCO3 20 g (based on 1 liter of distilled water)

[0473] Strains O-AH (g / L) ATCC13032 0.27 ATCC13032ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetB ΔmetY lysC(L377K)ΔNCgl0616 1.73 CM04-8000 (ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetB ΔmetY lysC(L377K)ΔNCgl0616-Pcj7_NCgl2126) 1.90 CM04-8002 (ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetB ΔmetY lysC(L377K)ΔNCgl0616-Pcj7_NCgl2126-Pcj7_aceE) 2.14

[0475] As shown in Table 21 above, it was confirmed that the concentration of O-acetyl homoserine increased by approximately 110–124% in O-acetyl homoserine producing strains with enhanced pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase and pyruvate dehydrogenase complex subunit E1 activities compared to O-acetyl homoserine producing strains.

[0477] Example 5-4. Preparation of O-acetyl homoserine transferase (MetX) introduction plasmid

[0479] To amplify the gene encoding O-acetyl homoserine transferase (MetX), nucleotide sequence information of the metX gene (NCBI registration number NCgl0624, sequence number 35) was obtained from the National Institutes of Health (NIH) GenBank. Based on this, primers (sequence numbers 36 and 37) were designed to amplify from the promoter region (300 bp above the start codon) to the terminator region (100 bp below the stop codon), and BamHI restriction enzyme sites were inserted at both ends of the primer sequences. The PCR conditions were as follows: denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 90 seconds, repeated 30 times, followed by polymerization at 72°C for 7 minutes. As a result, a 1,546 bp DNA fragment of the coding region of the metX gene was obtained. The pECCG117 (KR 10-0057684) vector and the metX DNA fragment were treated with the restriction enzyme BamH I, ligated using DNA conjugation enzyme, and then cloned to obtain a plasmid, which was named pECCG117-metX WT. The primer sequences were as shown in Table 22 below.

[0481] Sequence number Ranking name order Sequence number 36 metX F GGATCCCCTCGTTGTTCACCCAGCAACC Sequence number 37 metX R GGATCCCAAAGTCACAACTACTTATGTTAG

[0483] The prepared pECCG117-metX WT vector was introduced into the strains ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetB ΔmetY lysC(L377K)ΔNCgl0616 and CM04-8000 prepared in Experiment 5-2 by electric pulse method, and then plated on a screening medium containing 25 mg / L of kanamycin to obtain each transformed strain.

[0485] To compare the O-acetyl homoserine production capacity of the strain prepared above, O-acetyl homoserine in the culture medium was analyzed by culturing it according to the following method.

[0487] One inoculation loop of the strain was inoculated into a 250 mL Corner-Baffle flask containing 25 mL of the following medium, and the mixture was cultured at 33°C for 20 hours with shaking at 200 rpm. O-acetyl homoserine concentrations were analyzed using HPLC, and the analyzed concentrations are shown in Table 23.

[0489] O-acetyl homoserine production medium (pH 7.2)

[0490] Glucose 30 g, KH2PO4 2 g, Urea 3 g, (NH4)2SO4 40 g, Peptone 2.5 g, CSL(Sigma) 5 g (10 ml), MgSO4.7H2O 0.5 g, Methionine 400 mg, CaCO3 20 g (based on 1 liter of distilled water)

[0492] Strains O-AH (g / L) ATCC13032ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetB ΔmetY lysC(L377K)ΔNCgl0616 1.73 CM04-8000 (ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetB ΔmetY lysC(L377K)ΔNCgl0616 -Pcj7_NCgl2126) 1.90 CM04-8002 (ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetB ΔmetY lysC(L377K)ΔNCgl0616 -Pcj7_NCgl2126-Pcj7_aceE) 2.14 ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetB ΔmetY lysC(L377K)ΔNCgl0616) / pECCG117-metX WT 2.83 CM04-8000 (ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetB ΔmetY lysC(L377K)ΔNCgl0616 -Pcj7_NCgl2126) / pECCG117-metX WT 3.25 CM04-8002 (ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetB ΔmetY lysC(L377K)ΔNCgl0616 -Pcj7_NCgl2126-Pcj7_aceE) / pECCG117-metX WT 3.68

[0494] As a result, as shown in Table 23 above, when the ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) ΔmetB ΔmetY lysC(L377K) ΔNCgl0616 / pECCG117-metX WT strain was cultured, 2.83 g / L of O-acetyl-L-homoserine was accumulated, and it was confirmed that when CM04-8002 was cultured, the production of O-acetyl-L-homoserine increased by 130% to 3.68 g / L. It was confirmed that O-acetyl-L-homoserine production capacity was increased when the activity of the pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase was enhanced in the O-acetyl-L-homoserine producing strain, and additionally, it was confirmed that O-acetyl-L-homoserine production capacity was also increased when the activity of the pyruvate dehydrogenase complex subunit E1 was enhanced.

[0496] The above results indicate that enhancing the activity of the pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase in O-acetyl-L-homoserine and homoserine-producing strains of the genus Corynebacterium is effective for the production of O-acetyl-L-homoserine and homoserine, and additionally, enhancing the activity of the pyruvate dehydrogenase complex subunit E1 is also effective for the production of O-acetyl-L-homoserine and homoserine.

[0497] From the foregoing description, those skilled in the art to which this application pertains will understand that this application may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of this application should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.

Claims

Claim 1 A microorganism of Corynebacterium glutamicum having the ability to produce one or more L-amino acids selected from ornithine, citrulline, arginine, O-acetylhomoserine, and homoserine, wherein the activity of a pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase (AceF) is increased relative to the intrinsic activity, wherein the L-amino acid is one or more selected from ornithine, citrulline, arginine, O-acetylhomoserine, and homoserine, and the microorganism is Corynebacterium glutamicum. Claim 2 delete Claim 3 delete Claim 4 delete Claim 5 A microorganism producing L-amino acids, wherein the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase is derived from Corynebacterium glutamicum. Claim 6 A microorganism producing L-amino acids according to claim 1, wherein the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase comprises the amino acid sequence of SEQ ID NO. 1 or SEQ ID NO.

32. Claim 7 In claim 6, the microorganism producing L-amino acids, wherein the pyruvate dehydrogenase complex dihydrolipoyllysin-residue acetyltransferase is encoded by the polynucleotide of SEQ ID NO. 2 or SEQ ID NO.

33. Claim 8 In any one of claims 1 and 5 to 7, the microorganism is a microorganism in which the activity of the pyruvate dehydrogenase complex subunit E1 is increased compared to the intrinsic activity. Claim 9 In claim 8, the microorganism wherein the pyruvate dehydrogenase complex subunit E1 comprises the amino acid sequence of SEQ ID NO.

10. Claim 10 In claim 9, the microorganism wherein the pyruvate dehydrogenase complex subunit E1 is encoded by the polynucleotide of SEQ ID NO. 11 or SEQ ID NO.

39. Claim 11 A method for producing L-amino acids comprising the step of culturing a microorganism in a medium having the ability to produce one or more L-amino acids selected from ornithine, citrulline, arginine, O-acetylhomoserine, and homoserine, wherein the activity of a pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase (AceF) is increased relative to the intrinsic activity, wherein the L-amino acid is one or more selected from ornithine, citrulline, arginine, O-acetylhomoserine, and homoserine, and the microorganism is Corynebacterium glutamicum. Claim 12 delete Claim 13 A method for producing L-amino acids according to claim 11, wherein the microorganism has increased activity of Pyruvate Dehydrogenase Complex subunit E1 compared to its intrinsic activity. Claim 14 A method for producing L-amino acids according to claim 11, further comprising the step of recovering L-amino acids from the cultured microorganism, the culture of the microorganism, the fermented product of the microorganism, or the cultured medium. Claim 15 A composition for producing L-amino acids comprising a microorganism of Corynebacterium glutamicum having the ability to produce one or more L-amino acids selected from ornithine, citrulline, arginine, O-acetylhomoserine, and homoserine, wherein the activity of the pyruvate dehydrogenase complex dehydrolipoylysin-residue acetyltransferase is increased relative to the intrinsic activity, a culture of said microorganism, a fermented product of said microorganism, or a combination of two or more of these, wherein said L-amino acids are one or more selected from ornithine, citrulline, arginine, O-acetylhomoserine, and homoserine, and said microorganism is Corynebacterium glutamicum.

Images