Composition for recovery from fatigue, or for improvement of exercise performance ability comprising Lactobacillus gasseri strain and rice germ extract as active ingredients

Abstract

The present invention relates to a composition for relieving fatigue or improving exercise performance comprising a Lactobacillus gasseri strain and a rice germ extract as active ingredients. The composition according to the present invention contains Lactobacillus gasseri strain and rice germ extract as active ingredients, thereby helping to recover from muscle fatigue by reducing serum GOT, GPT, LDH, CPK, and LAC production levels, as well as BUN and ammonia concentrations, which increase during exercise. Additionally, it can improve exercise performance by regulating the expression of genes involved in glycolysis or electron transport chain metabolism within muscle tissue, and the expression levels of proteins involved in regulating energy metabolism. Furthermore, since the Lactobacillus gasseri strain and rice germ extract of the present invention are natural products, they can be used safely without side effects and can be usefully employed in the manufacture of pharmaceuticals, food, or animal feed.

Description

Technology Field

[0001] The present invention relates to a composition for relieving fatigue or improving exercise performance comprising a Lactobacillus gasseri strain and a rice germ extract as active ingredients. Background Technology

[0002] In general, if muscles are not exercised continuously, muscle function deteriorates with aging, and a decrease in muscle mass and neuromuscular junctions (motor units) occurs, leading to easy fatigue and lethargy, which reduces vitality in daily life and causes a rapid decline in quality of life.

[0003] When the signal of fatigue appears, the body needs time to rest and recover; however, in today's busy society, it is difficult to properly maintain this cycle of fatigue and recovery. The accumulation of fatigue due to overwork can lead to chronic fatigue and cause many diseases such as peptic ulcers, hypertension, and diabetes. Furthermore, cancer, stroke, and heart disease are the three major causes of death for modern people, and overwork is a significant contributing factor to these conditions.

[0004] The expression "accumulated fatigue" refers to a situation where the functions of the mind and body are not operating smoothly. Generally, fatigue can be described as a state in which the strength required for muscle contraction is not fully exerted—in other words, a state of reduced exercise performance. In contrast to physical fatigue, stress can be understood as an imbalance in the body's rhythm caused by mental overload. Therefore, fatigue in a broad sense is a concept that encompasses both fatigue and stress, and can be defined as a decrease in the ability to perform physical or mental activities. Specifically, fatigue refers to a state where work efficiency declines due to physical exhaustion, while stress refers to a state where homeostasis is disrupted due to mental fatigue.

[0005] To prevent this, it is recommended to consistently perform exercises such as resistance training and to combine this with an appropriate diet. Recently, due to the well-being trend, the importance of exercise is being highlighted for enjoying leisure time and for the prevention and treatment of various adult diseases. As such, regular exercise is necessary to improve the quality of life, and there is a trend to require more energy and endurance in daily life not only for athletes but also for the general public. Accordingly, research on supplements, functional foods, and food compositions to enhance physical performance has been ongoing for a long time, and it is known that taking compounds such as steroids and caffeine actually increases athletic ability; however, the use of these drugs is extremely restricted because they can be accompanied by fatal side effects.

[0006] As it has been revealed that plants existing in nature contain large quantities of functional components with bio-regulatory functions, such as disease prevention and anti-aging, research on natural food materials is being actively conducted. Recently, research aimed at developing functional supplements using natural products with guaranteed safety, such as plant extracts, is actively underway.

[0007] Accordingly, the inventors continued research on Lactobacillus gasseri strains and rice germ extracts, and confirmed that the consumption of these compounds increases exercise performance and inhibits the accumulation of fatigue factors in the blood, thereby completing the present invention. Prior art literature

[0008] KR 10-2016-0009345 A The problem to be solved

[0009] The objective of the present invention is to provide a food composition for relieving fatigue or improving exercise performance, comprising (i) one or more selected from the group consisting of a Lactobacillus gasseri strain, a crushed liquid thereof, a culture medium thereof, an extract of the culture medium, a concentrate of the culture medium, and a dried product of the culture medium; and (ii) a rice germ extract as an active ingredient.

[0010] Another objective of the present invention is to provide a feed composition for fatigue recovery or improvement of exercise performance comprising (i) one or more selected from the group consisting of a Lactobacillus gasseri strain, a crushed liquid thereof, a culture medium thereof, an extract of the culture medium, a concentrate of the culture medium, and a dried product of the culture medium; and (ii) a rice germ extract as an active ingredient.

[0011] Another objective of the present invention is to provide a pharmaceutical composition for relieving fatigue or improving exercise performance, comprising (i) one or more selected from the group consisting of a Lactobacillus gasseri strain, a lysate thereof, a culture solution thereof, an extract of the culture solution, a concentrate of the culture solution, and a dried product of the culture solution; and (ii) a rice germ extract as an active ingredient.

[0012] Another objective of the present invention is to provide a pharmaceutical composition for the prevention or treatment of diseases related to fatigue or reduced exercise performance, comprising (i) one or more selected from the group consisting of a Lactobacillus gasseri strain, a lysate thereof, a culture solution thereof, an extract of the culture solution, a concentrate of the culture solution, and a dried product of the culture solution; and (ii) a rice germ extract as an active ingredient. means of solving the problem

[0013] To achieve the above objective, the present invention provides a food composition for relieving fatigue or improving exercise performance, comprising (i) one or more selected from the group consisting of a Lactobacillus gasseri strain, a crushed liquid thereof, a culture medium thereof, an extract of the culture medium, a concentrate of the culture medium, and a dried product of the culture medium; and (ii) a rice germ extract as an active ingredient.

[0014] According to one embodiment of the present invention, the strain may be a live strain or a dead strain.

[0015] According to one embodiment of the present invention, the rice germ extract may be extracted with water, a lower alcohol having 1 to 4 carbon atoms, or a mixed solvent thereof.

[0016] According to one embodiment of the present invention, the mixed solvent may be 20 to 80 volume% methanol, ethanol, butanol, or propanol.

[0017] According to one embodiment of the present invention, the improvement of exercise performance may include strengthening muscle strength, improving physical strength, delaying muscle fatigue, improving endurance, preventing muscle damage, or inhibiting muscle atrophy.

[0018] To achieve the other objectives mentioned above, the present invention (i) Lactobacillus gasseri ( Lactobacillus gasseri ) one or more selected from strains, crushed liquids thereof, culture solutions thereof, extracts of culture solutions, concentrates of culture solutions, and dried culture solutions; and (ii) a feed composition for fatigue recovery or exercise performance improvement comprising rice germ extract as an active ingredient.

[0019] To achieve the other objectives mentioned above, the present invention (i) Lactobacillus gasseri ( Lactobacillus gasseri) one or more selected from the group consisting of a strain, a crushed liquid thereof, a culture medium thereof, an extract of the culture medium, a concentrate of the culture medium, and a dried product of the culture medium; and (ii) a pharmaceutical composition for relieving fatigue or improving exercise performance, comprising a rice germ extract as an active ingredient.

[0020] To achieve the other objectives mentioned above, the present invention (i) Lactobacillus gasseri ( Lactobacillus gasseri (ii) one or more selected from a strain, a lysate thereof, a culture solution thereof, an extract of the culture solution, a concentrate of the culture solution, and a dried product of the culture solution; and (ii) a pharmaceutical composition for the prevention or treatment of diseases related to fatigue or reduced exercise performance, comprising a rice germ extract as an active ingredient. Effects of the invention

[0021] The composition according to the present invention contains Lactobacillus gasseri strain and rice germ extract as active ingredients, thereby helping to recover from muscle fatigue by reducing serum GOT, GPT, LDH, CPK, and LAC production levels, as well as BUN and ammonia concentrations, which increase during exercise. Additionally, it can improve exercise performance by regulating the expression of genes involved in glycolysis or electron transport chain metabolism within muscle tissue, and the expression levels of proteins involved in regulating energy metabolism. Furthermore, since the Lactobacillus gasseri strain and rice germ extract of the present invention are natural products, they can be used safely without side effects and can be usefully employed in the manufacture of pharmaceuticals, food, or animal feed. Brief explanation of the drawing

[0022] FIG. 1 is a schematic diagram briefly illustrating an animal experiment design according to one embodiment of the present invention. Figure 2 is a graph showing the treadmill test results (changes in time taken until exhaustion and distance run) of the NC group (normal group), PC group (positive control group), and test groups (RGL group, RGM group, and RGH group) administered a sample containing LGA1 strain and rice germ extract according to one embodiment of the present invention. *, ** indicate that there is a significant difference at p<0.05 and p<0.01 compared to the NC group (normal group). FIG. 3a shows the H&E staining results for calf muscle tissues of each hind leg extracted from the NC group (normal group), PC group (positive control group), and test groups (RGL group, RGM group, and RGH group) administered a sample containing LGA1 strain and rice germ extract according to one embodiment of the present invention, and FIG. 3b shows the cross-sectional area (CSA) results quantitatively observed and measured from the H&E staining results. *** indicates a significant difference at p<0.001 compared to the NC group (normal group). Figure 4 shows the results of measuring serum SOD, GPx, and CAT activities of the NC group (normal group), PC group (positive control group), and test groups (RGL group, RGM group, and RGH group) administered a sample containing LGA1 strain and rice germ extract after a treadmill test according to one embodiment of the present invention. *, **, *** indicate that there is a significant difference at p<0.05, p<0.01, and p<0.001 compared to the NC group (normal group). Figure 5 shows the results of measuring the serum GOT and GPT production levels of the NC group (normal group), PC group (positive control group), and test groups (RGL group, RGM group, and RGH group) administered a sample containing LGA1 strain and rice germ extract after a treadmill test according to one embodiment of the present invention.**, *** indicates that there is a significant difference at p<0.01 and p<0.001 compared to the NC group (normal group). Figure 6 shows the results of measuring the serum LDH, CPK, and LAC production levels of the NC group (normal group), PC group (positive control group), and test groups (RGL group, RGM group, and RGH group) administered a sample containing LGA1 strain and rice germ extract after a treadmill test according to one embodiment of the present invention. *, **, *** indicate that there is a significant difference at p<0.05, p<0.01, and p<0.001 compared to the NC group (normal group). Figure 7 shows the results of measuring serum BUN and ammonia production in the NC group (normal group), PC group (positive control group), and test groups (RGL group, RGM group, and RGH group) administered a sample containing LGA1 strain and rice germ extract after a treadmill test according to one embodiment of the present invention. *, *** indicate a significant difference at p<0.05 and p<0.001 compared to the NC group (normal group). Figure 8 shows the results of measuring the mRNA expression levels of GLUT4, MCT1, MCT4, and PDK in gastrocnemius muscle tissue of the NC group (normal group), PC group (positive control group), and test groups (RGL group, RGM group, and RGH group) administered a sample containing LGA1 strain and rice germ extract after a treadmill test according to one embodiment of the present invention. *, **, *** indicate that there is a significant difference at p<0.05, p<0.01, and p<0.001 compared to the NC group (normal group). Figure 9 shows the results of measuring the mRNA expression levels of ACC and CPT 1 in gastrocnemius muscle tissue of the NC group (normal group), PC group (positive control group), and test groups (RGL group, RGM group, and RGH group) administered a sample containing LGA1 strain and rice germ extract after a treadmill test according to one embodiment of the present invention. *, **, *** indicate that there is a significant difference at p<0.05, p<0.01, and p<0.001 compared to the NC group (normal group). Figure 10 shows the results of measuring the mRNA expression levels of PK, PFK, HK 1, and HK2 in gastrocnemius muscle tissue of the NC group (normal group), PC group (positive control group), and test groups (RGL group, RGM group, and RGH group) administered a sample containing LGA1 strain and rice germ extract after a treadmill test according to one embodiment of the present invention. *, **, *** indicate that there is a significant difference at p<0.05, p<0.01, and p<0.001 compared to the NC group (normal group). Figure 11 shows the results of measuring the mRNA expression levels of Complex I, Complex II, Complex III, Complex IV, and ATP synthase in gastrocnemius muscle tissue of the NC group (normal group), PC group (positive control group), and test groups (RGL group, RGM group, and RGH group) administered a sample containing LGA1 strain and rice germ extract after a treadmill test according to one embodiment of the present invention. *, **, *** indicate that there is a significant difference at p<0.05, p<0.01, and p<0.001 compared to the NC group (normal group). Figure 12 shows the results of measuring the protein expression levels of AMPK, PGC1α, SIRT1, and PPARγ in gastrocnemius muscle tissue of the NC group (normal group), PC group (positive control group), and test groups (RGL group, RGM group, and RGH group) administered a sample containing LGA1 strain and rice germ extract after a treadmill test according to one embodiment of the present invention. Figure 12a is the result of Western blot analysis, and Figure 12b is a graph showing the relative intensity of each protein band quantified from Figure 12a. *, **, and *** indicate that there is a significant difference compared to the NC group (normal group) at p<0.05, p<0.01, and p<0.001. Specific details for implementing the invention

[0023] In this specification, the term 'fatigue (fatigue, exhaustion, tiredness, languidness, languor, lassitude, listlessness)' may mean a state or symptom of reduced physical and / or mental function, specifically including all of physical fatigue, mental fatigue, or muscle fatigue, and may include, without limitation, any other category of fatigue.

[0024] In this specification, the term 'fatigue recovery' may be used interchangeably with 'fatigue improvement' or 'anti-fatigue,' and specifically, may mean the prevention, alleviation, improvement, reduction, suppression, elimination, and / or treatment of fatigue, and / or fatigue recovery.

[0025] In this specification, the terms “exercise performance” or “exercise ability” refer to the degree to which physical movements seen in daily life or sports are visually classified into running, jumping, throwing, swimming, etc., and the ability to perform said movements quickly, strongly, accurately, for a long time, and skillfully. The ability to perform said movements is defined by factors such as muscle strength, sense of balance, motor coordination, agility, and endurance.

[0026] In this specification, the term 'improvement of exercise performance' may mean an increase in the duration, etc. of exercise (e.g., running, walking, cycling, jumping rope, hiking, swimming, aerobics, various ball or combat sports, various strength training exercises, etc.).

[0028] The present invention will be described in detail below.

[0029] One aspect of the present invention is (i) Lactobacillus gasseri ( Lactobacillus gasseri (ii) a strain, a crushed liquid thereof, a culture medium thereof, an extract of the culture medium, a concentrate of the culture medium, and a dried product of the culture medium; and (ii) a food composition for relieving fatigue or improving exercise performance, comprising a rice germ extract as an active ingredient.

[0030] In one embodiment, the composition of the present invention includes (i) one or more selected from the group consisting of a Lactobacillus gasseri strain, a lysate of the same, a culture medium of the same, an extract of the culture medium, a concentrate of the culture medium, and a dried product of the culture medium (hereinafter referred to as 'Lactobacillus gasseri strain'); and (ii) a rice germ extract as active ingredients, thereby exhibiting excellent effects in terms of fatigue recovery or improvement of exercise performance, and when the Lactobacillus gasseri strain and the rice germ extract are each included alone, the effects of fatigue recovery or improvement of exercise performance are shown, but are relatively smaller.

[0031] In one embodiment, the strain may be a Lactobacillus gasseri strain and is not particularly limited, but it is more preferable that it be the Lactobacillus gasseri CBT LGA1 strain deposited under accession number KCTC 12936BP in terms of efficacy for fatigue recovery or improvement of exercise performance.

[0032] In one embodiment, the strain may be a live bacterium or a dead bacterium. The dead bacterium may be a dead bacterium obtained by freeze-drying or heat treatment.

[0033] In this specification, the term “lysate” may refer to a product obtained by breaking the cell wall of the strain itself by chemical or physical force.

[0034] In this specification, the term “culture medium” may be used interchangeably with “culture supernatant” or “culture filtrate,” and may refer to the entire medium containing said strain, its metabolites, excess nutrients, etc., obtained by culturing said strain for a certain period in a medium capable of supplying nutrients so that the Lactobacillus gasseri strain can grow and survive in a test tube. Additionally, said culture medium may refer to a culture medium from which the cells have been removed from a cell culture medium obtained by culturing the strain. Meanwhile, the liquid from which the cells have been removed from said culture medium is also referred to as the “supernatant,” which may be obtained by leaving the culture medium undisturbed for a certain period to take only the liquid from the upper layer excluding the part that settled at the bottom, by removing the cells through filtration, or by centrifuging the culture medium to remove the lower precipitate and taking only the upper liquid. The “cells” refer to the strain of the present invention itself and include the strain itself isolated and selected from Korean feces or fermented foods, etc., or the strain isolated from the culture medium by culturing said strain. The above-mentioned bacterial cells can be obtained by centrifuging the culture medium and taking the portion that settles in the lower layer, or by letting them sit for a certain period of time and then removing the liquid from the top, as they sink to the lower layer of the culture medium due to gravity.

[0035] The above culture medium may include the culture medium itself obtained by culturing the strain, its concentrate or freeze-dried product, or the culture supernatant or culture filtrate obtained by removing the strain from the culture medium, its concentrate or freeze-dried product.

[0036] The above culture medium may be obtained by culturing the above Lactobacillus gasseri strain in a suitable medium (e.g., MRS medium, TSA medium, or R2A medium) at a temperature greater than 10°C or less than 40°C for a certain period of time, e.g., 4 to 50 hours. The above MRS medium may comprise any one selected from the group consisting of peptone, beef extract, yeast extract, glucose, sodium acetate, polysorbate 80, dipotassium hydrogen phosphate, ammonium citrate, magnesium sulfate, manganese sulfate, agar, and distilled water, a combination of two or more of these, or all of these. The concentrations of the components in the above-mentioned medium may be appropriately changed, and the term MRS medium may encompass all commercially available media referred to as MRS.

[0037] In one embodiment, the culture supernatant or culture filtrate of the strain may be obtained by removing the strain from the strain culture through centrifugation or filtration.

[0038] In this specification, the term “extract of a culture medium” means an extract obtained from said culture medium or its concentrate, and may include an extract, a diluted or concentrated extract, a dried product obtained by drying the extract, or a modified or purified product thereof, or a fraction obtained by fractionating the same.

[0039] In one embodiment, the rice germ or rice embryo is the embryonic part of rice and contains 60 to 70% of the total functional components of rice. The rice germ is rich in inositol (a water-soluble vitamin B complex), which provides nutrition to brain cells, helps in getting a good night's sleep, has therapeutic effects on depression and panic disorder, reduces sudden fear, and has been reported to have effects in preventing dementia and relieving fatty liver. It has also been reported to help the body utilize fat and cholesterol, prevent arteriosclerosis, and reduce belly fat. In addition, the rice germ contains a large amount of gamma oryzanol, which is a powerful antioxidant with anticancer and anti-aging effects, helps with recovery after exercise, and reduces pain.

[0040] In one embodiment, the rice germ may be an embryo portion separated from non-glutinous rice.

[0041] In one specific example, the variety of the non-glutinous rice may be one or more selected from Chucheong, Hangadeuk, Sindongjin, Ilpum, Koshihikari, Goami, Onnuri, Odae, Dongjin, Junam, Samgwang, Gopum, Ungwang, Cheongdam, Cheonga, Chilbo, and Hopum, but Chucheong and Hangadeuk varieties are preferable in terms of efficacy for fatigue recovery or improvement of exercise performance. The Chucheong variety is a type of Japonica rice that was introduced to Korea from Japan in the 1960s and began to be cultivated instead of Tongilbyeo. The Hangadeuk variety is a domestic variety that is gradually becoming widely cultivated in Gimpo and other regions. In addition to these varieties, there may be varieties containing 0.27 mg / g or more of ferulic acid and 0.394 mg / g or more of gamma-oryzanol.

[0042] In this specification, “rice germ extract” refers to a product obtained by extracting rice germ with a suitable solvent, and includes all forms such as an extract, a diluted or concentrated extract, a dried product obtained by drying the extract, or a modified or purified product thereof. Accordingly, in a broad sense, the rice germ extract of the present invention includes processed rice germ products formulated for administration to animals, such as rice germ powder.

[0043] In one embodiment, the rice germ extract of the present invention can be prepared by mixing rice germ powder with an extraction solvent in a weight ratio of 1:10 to 200 and then extracting at 60 to 100°C. If the weight ratio of the rice germ to the extraction solvent falls outside the above range, the active ingredients of the rice germ may be extracted in a small amount in the extract.

[0044] The extraction solvent for extracting the above extract may be water, a lower alcohol having 1 to 4 carbon atoms, or a mixture thereof. Although the above extraction solvent is not particularly limited, an extract obtained with 20 to 80 volume% methanol, ethanol, butanol, or propanol, preferably 20 to 80 volume% ethanol, shows excellent effects in terms of efficacy for fatigue recovery or improvement of exercise performance.

[0045] The rice germ extract of the present invention may be prepared using conventional extraction methods in the art, such as heat extraction, cold maceration extraction, ultrasonic extraction, high-pressure extraction, and reflux extraction. For example, it may be obtained by extracting the rice germ under ultra-high pressure conditions of 100 MPa or more, preferably 100 MPa to 1000 MPa. If necessary, it may be prepared by additionally including filtration and concentration steps according to methods known in the art. The rice germ may be purchased from commercially available sources, or it may be collected from nature or separated from cultivated rice.

[0046] Meanwhile, in this specification, the term "containing as an active ingredient" means containing an amount sufficient to achieve the efficacy or activity of the Lactobacillus gasseri strain and the rice germ extract. For example, the composition of the present invention contains 1 × 10⁶ Lactobacillus gasseri strain. 8 Up to 1×10 12 It may be included in CFU / g. In addition, the rice germ extract may be included at a concentration of 10 to 2000 mg / g. Since the Lactobacillus gasseri strain and the rice germ extract are natural products and do not cause adverse effects on the human body even when administered in excess, the quantitative upper limit of the active ingredients included in the composition of the present invention may be selected and implemented by a person skilled in the art within an appropriate range.

[0047] In a specific embodiment of the present invention, the results of a treadmill test on mice showed that mice administered the Lactobacillus gasseri strain and rice germ extract of the present invention (RGM group and RGH group) had a significantly increased time and distance taken until exhaustion compared to the NC group (normal group) (Fig. 2).

[0048] In a specific embodiment of the present invention, as a result of measuring the serum LDH, CPK, and LAC levels of each test group after a treadmill test, it can be confirmed that the serum LDH, CPK, and LAC levels of mice (RGL group, RGM group, and RGH group) administered with the Lactobacillus gasseri strain and rice germ extract of the present invention are significantly lower than those of the NC group (Fig. 6).

[0049] From the above results, it can be seen that mice administered with the Lactobacillus gasseri strain and rice germ extract of the present invention have a significantly improved effect in fatigue recovery or exercise performance compared to the normal group.

[0050] The food composition of the present invention includes all forms such as functional food, health functional food, nutritional supplement, health food, and food additives. Food compositions of the above types can be prepared in various forms according to conventional methods known in the industry.

[0051] In the present invention, the food composition may be a health functional food composition.

[0052] The term “health functional food” used in the present invention refers to a food manufactured and processed using raw materials or ingredients having functional properties useful to the human body in accordance with Article 6727 of the Health Functional Foods Act, and the term “functional properties” means consuming for the purpose of obtaining useful effects for health purposes, such as regulating nutrients or physiological actions on the structure and function of the human body.

[0053] The above health functional food composition may be formulated into one selected from the group consisting of tablets, pills, powders, granules, powders, capsules, and liquid formulations, including one or more of a carrier, a diluent, an excipient, and an additive.

[0055] Another aspect of the present invention is (i) Lactobacillus gasseri ( Lactobacillus gasseri (ii) a strain, a crushed liquid thereof, a culture solution thereof, an extract of the culture solution, a concentrate of the culture solution, and a dried product of the culture solution; and (ii) a feed composition for relieving fatigue or improving exercise performance, comprising a rice germ extract as an active ingredient.

[0056] The descriptions of the above “Lactobacillus gasseri strain,” “rice germ extract,” “fatigue recovery,” and “exercise performance” are omitted to avoid excessive duplication.

[0057] In the present invention, the term "feed" refers to any natural or artificial prescribed food, single meal, etc., or a component of said single meal, intended for or suitable for animals to eat, consume, and digest. Feed containing the composition for preventing or improving muscle disease according to the present invention as an active ingredient can be manufactured in various forms of feed known in the art, and preferably may include concentrated feed, roughage, and / or special feed, but is not limited thereto.

[0058] Concentrated feeds include, but are not limited to, seed grains such as wheat, oats, and corn; bran, which is a byproduct obtained by refining grains and includes rice bran, wheat bran, and barley bran; oilseed meal, which is a byproduct obtained by extracting oil from soybeans, rapeseed, sesame, flaxseed, and coconut; residues such as residual starch, which is the main component of starch residue remaining after removing starch from sweet potatoes and potatoes; fish meal, fish residue; fish soluble, which is a concentrated fresh liquid obtained from fish; meat meal; blood meal; feather meal; skim milk powder; dried whey, which is the residue obtained when making cheese from milk or casein from skim milk; yeast, Chlorella, and seaweed.

[0059] Roughage includes raw grass feeds such as wild grass, pasture grass, and green cuts; root vegetables such as feed turnips, feed beets, and a type of turnip called lutea bearger; silage, which is a stored feed made by filling a silo with raw grass, green cut crops, and grains and fermenting them with lactic acid; hay made by cutting and drying wild grass and pasture grass; straw of livestock breeding crops; and leaves of legumes, but is not limited thereto. Special feeds include mineral feeds such as oyster shells and rock salt; urea feeds such as urea or its derivatives such as diuretic isobutane; feed additives, which are substances added in trace amounts to compound feed to supplement components that are prone to being deficient when only natural feed ingredients are mixed, or to improve the shelf life of the feed; and dietary supplements, but are not limited thereto.

[0060] The feed composition for the prevention or improvement of muscle diseases according to the present invention can be prepared by adding Lactobacillus gasseri strain and rice germ extract in an appropriate effective concentration range according to various feed manufacturing methods known in the art.

[0061] The feed composition according to the present invention can be applied without limitation to any individual intended for the prevention or improvement of muscle diseases. For example, it can be applied to any individual, such as non-human animals like cattle, horses, pigs, goats, sheep, dogs, cats, rabbits, etc., as well as birds and fish.

[0063] Another aspect of the present invention is (i) Lactobacillus gasseri ( Lactobacillus gasseri (ii) a strain, a crushed liquid thereof, a culture medium thereof, an extract of the culture medium, a concentrate of the culture medium, and a dried product of the culture medium; and (ii) a pharmaceutical composition for relieving fatigue or improving exercise performance, comprising a rice germ extract as an active ingredient.

[0064] The descriptions of the above “Lactobacillus gasseri strain,” “rice germ extract,” “fatigue recovery,” and “exercise performance” are omitted to avoid excessive duplication.

[0065] Pharmaceutically acceptable carriers may additionally include, for example, carriers for oral administration or carriers for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, etc. Additionally, carriers for parenteral administration may include water, suitable oils, saline solution, aqueous glucose, and glycol, etc. Additionally, stabilizers and preservatives may additionally be included. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite, or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben, and chlorobutanol. For other pharmaceutically acceptable carriers, reference may be made to the following literature (Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).

[0066] The pharmaceutical composition of the present invention can be administered to mammals, including humans, by any method. For example, it can be administered orally or parenterally, and parenteral administration methods may include, but are not limited to, intravenous, intramuscular, intra-arterial, intramedullary, intradural, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical, sublingual, or rectal administration.

[0067] The pharmaceutical composition of the present invention may be formulated into an oral or parenteral administration formulation according to the administration route described above. When formulating, it may be prepared using one or more buffers (e.g., saline solution or PBS), antioxidants, bacteriostatic agents, chelating agents (e.g., EDTA or glutathione), fillers, extenders, binders, adjuvants (e.g., aluminum hydroxide), suspenders, thickeners, wetting agents, disintegrants or surfactants, diluents or excipients.

[0068] Solid dosage forms for oral administration include tablets, pills, powders, granules, liquids, gels, syrups, slurries, suspensions, or capsules, and such solid dosage forms may be prepared by mixing at least one excipient, for example, starch (including corn starch, wheat starch, rice starch, potato starch, etc.), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol, maltitol, cellulose, methyl cellulose, sodium carboxymethylcellulose and hydroxypropylmethylcellulose, or gelatin, with the pharmaceutical composition of the present invention. For example, a tablet or a sugar tablet may be obtained by combining an active ingredient with a solid excipient, grinding the mixture, adding a suitable auxiliary agent, and processing it into a granular mixture.

[0069] In addition to simple excipients, lubricants such as magnesium styrate and talc are also used. Liquid formulations for oral administration include suspensions, oral liquids, emulsions, or syrups, and may contain various excipients, such as humectants, sweeteners, flavorings, or preservatives, in addition to commonly used simple diluents like water or liquid paraffin.

[0070] In addition, cross-linked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may be added as a disintegrant depending on the case, and may additionally include anticoagulants, lubricants, wetting agents, fragrances, emulsifiers, and preservatives.

[0071] When administered parenterally, the pharmaceutical composition of the present invention may be formulated in the form of an injectable, a transdermal agent, and a nasal inhalant with a suitable parenteral carrier according to methods known in the art. The injectable must be sterile and protected from contamination by microorganisms such as bacteria and fungi. Examples of suitable carriers for the injectable may be, but are not limited to, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), mixtures thereof, and / or solvents or dispersion media containing vegetable oils. More preferably, suitable carriers may include Hanks' solution, Ringer's solution, PBS (phosphate buffered saline) containing triethanolamine, sterile water for injection, isotonic solutions such as 10% ethanol, 40% propylene glycol, and 5% dextrose. To protect the above-mentioned injectable from microbial contamination, various antimicrobial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. may be additionally included. In addition, the above-mentioned injectable may, in most cases, additionally include isotonic agents such as sugars or sodium chloride.

[0072] Transdermal formulations include forms such as ointments, creams, lotions, gels, topical solutions, pastes, liniments, and aerosols. In the above, 'transdermal administration' means administering a pharmaceutical composition topically to the skin so that an effective amount of the active ingredient contained in the pharmaceutical composition is delivered into the skin.

[0073] The pharmaceutical composition of the present invention can provide desirable effects of fatigue recovery or improvement of exercise performance when containing an effective amount of Lactobacillus gasseri strain and rice germ extract. In this specification, "effective amount" refers to an amount that exhibits a response greater than that of a normal group, and preferably refers to an amount sufficient to improve fatigue recovery or exercise performance. The pharmaceutical composition of the present invention may contain Lactobacillus gasseri strain and rice germ extract in an amount of 0.01 to 99.99%, preferably 0.01 to 50% by weight, more preferably 0.1 to 20% by weight, more preferably 0.2 to 10% by weight, and even more preferably 0.2 to 5% by weight, and the remainder may be occupied by a pharmaceutically acceptable carrier. The effective amount of Lactobacillus gasseri strain and rice germ extract included in the pharmaceutical composition of the present invention will vary depending on the form in which the composition is manufactured into a product, etc.

[0074] The total effective amount of the pharmaceutical composition of the present invention may be administered to a patient as a single dose, or administered via a fractionated treatment protocol involving multiple doses administered over a long period. The content of the active ingredient in the pharmaceutical composition of the present invention may vary depending on the severity of the disease. However, since the effective dosage for a patient is determined by considering various factors such as the patient's age, weight, health status, gender, severity of the disease, diet, and excretion rate, as well as the administration route and frequency of treatment of the pharmaceutical composition, a person of ordinary knowledge in the art would be able to determine an appropriate effective dosage of the Lactobacillus gasseri strain and rice germ extract for specific uses, such as fatigue recovery or improvement of exercise performance, in light of these points. The pharmaceutical composition according to the present invention is not particularly limited in its formulation, administration route, and administration method as long as it exhibits the effects of the present invention.

[0075] The pharmaceutical composition of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, or biological response modifiers.

[0076] The pharmaceutical composition of the present invention can also be provided in the form of an external preparation containing a Lactobacillus gasseri strain and a rice germ extract as active ingredients.

[0077] When the pharmaceutical composition of the present invention is used as a topical skin preparation, it may additionally contain adjuvants commonly used in the field of dermatology, such as fatty substances, organic solvents, solvents, thickeners and gelling agents, emollients, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, surfactants, water, ionic emulsifiers, nonionic emulsifiers, fillers, metal ion chelating agents, chelating agents, preservatives, vitamins, blockers, humectants, essential oils, dyes, pigments, hydrophilic activators, lipophilic activators, or lipid vesicles. Furthermore, said ingredients may be introduced in amounts commonly used in the field of dermatology.

[0078] When the pharmaceutical composition of the present invention is provided as a topical skin preparation, it may be in the form of an ointment, patch, gel, cream, or spray, but is not limited thereto.

[0080] Another aspect of the present invention is (i) Lactobacillus gasseri ( Lactobacillus gasseri (ii) one or more selected from a strain, a crushed liquid thereof, a culture solution thereof, an extract of the culture solution, a concentrate of the culture solution, and a dried product of the culture solution; and (ii) a rice germ extract as an active ingredient, and a pharmaceutical composition for the prevention or treatment of diseases related to fatigue or reduced exercise performance.

[0081] The descriptions of the above “Lactobacillus gasseri strain,” “rice germ extract,” and “pharmaceutical composition” are omitted to avoid excessive duplication.

[0082] The pharmaceutical composition of the present invention can be used for the prevention or treatment of diseases related to fatigue or reduced exercise performance.

[0083] In this specification, the term 'diseases related to fatigue or reduced exercise performance' encompasses all diseases and / or symptoms in which fatigue or reduced exercise performance is a direct or indirect cause, and may include, but is not limited to, muscle pain (muscle fatigue) (due to fatigue), reduced muscle function, muscle diseases resulting from muscle wasting or muscle degeneration, muscle wasting, reduced explosiveness, reduced endurance, mitochondrial disorders, degenerative diseases, lethargy, body aches, digestive disorders, sleep deprivation or sleep disorders, chronic fatigue syndrome, etc.

[0084] Furthermore, the pharmaceutical composition of the present invention may be used for the prevention or treatment of diseases caused by the deterioration of motor skills. Examples of related diseases include degenerative diseases, mitochondrial disorders, decreased endurance, decreased explosiveness, lethargy, muscle wasting, and depression. The composition of the present invention has an effect of improving motor performance and does not limit the form or type of exercise. The composition of the present invention has an effect of improving motor performance and does not limit the form or type of exercise.

[0086] The present invention will be described in detail below by way of examples, but the present invention is not limited by the following examples.

[0088] <Example>

[0089] Preparation Example 1: Preparation of Lactobacillus gasseri strain (LGA1)

[0090] Lactobacillus gasseri CBT LGA1 strain (accession number KCTC 12936BP), isolated from Korean breast milk by Cell Biotech Co., Ltd., was inoculated into De Man, Rogosa, and Sharpe medium (BD Difco, USA) to achieve an absorbance value of 1.0 at 610 nm, and aerobic cultured at 37 ℃ for 24 hours. After the culture was completed, the culture medium was centrifuged (4,255 xg, 10 min) to isolate viable cells, which were then freeze-dried.

[0092] Preparation Example 2: Preparation of Rice Germ Extract (RGE)

[0093] 100 times the weight of 50% (w / w) ethanol was added to the rice germ powder of the Chucheong variety, and the extract was obtained by extracting at 80°C for 6 hours. The obtained extract was filtration and vacuum concentration, and then powdered by freeze-drying for use.

[0095] <Test Example>

[0096] Test method

[0097] Preparation of laboratory animals

[0098] Male 6-week-old ICR mice were purchased from Saeron Bio and used in this experiment, which was conducted with the approval of the Animal Ethics Committee of Gachon University (GU1-2024-IA0033-M1). After the animals were received, an acclimatization period of one week was observed to confirm that no adverse reactions occurred in any of the individuals. The rearing environment was maintained at a temperature of 20-25℃ and a humidity of 50-55% with a 12-hour light-dark period, and solid feed and water were provided freely. After the acclimatization period, body weight was measured, and the test groups were separated using a randomization method.

[0100] Classification of experimental groups and sample administration

[0101] The experimental group consisted of a normal control (NC), a positive control (PC) administered 50 mg / kg of oxymetholone, and 1 x 10 of the LGA1 strain according to Preparation Example 1. 9 CFU / head, and sample low-concentration administration group (RGL) administered 100 mg / kg of rice germ extract according to Preparation Example 2, LGA1 strain 1x10 according to Preparation Example 1 9 CFU / head and medium concentration administration group (RGM) of samples administered 200 mg / kg of rice germ extract according to Preparation Example 2, LGA1 strain 1x10 according to Preparation Example 1 9The samples were classified into a total of 5 groups, including a high-concentration administration group (RGH) administered 400 mg / kg of rice germ extract according to Preparation Example 2 and CFU / head. Each test group was orally administered each sample at around 10:00 AM every day for a total of 6 weeks, and body weight and feed intake were measured once a week (Fig. 1).

[0102] [Test Group Classification]

[0103] Normal group (NC): Saline solution (0.9% NaCl)

[0104] Positive control (PC): Administration of oxymetholone 50 mg / kg

[0105] Low-concentration sample administration group (RGL): LGA1 strain 1x10 9 Administration of CFU / head and 100 mg / kg of rice germ extract

[0106] Medium-concentration sample administration group (RGM): LGA1 strain 1x10 9 Administration of CFU / head and 200 mg / kg of rice germ extract

[0107] High-concentration sample administration group (RGH): LGA1 strain 1x10 9 Administration of CFU / head and 400 mg / kg of rice germ extract

[0109] Treadmill Test - Measuring the time it takes to burn out

[0110] Before measuring the time to exhaustion, treadmill adaptation training was performed on all animals, and the treadmill adaptation and training were conducted by modifying the method proposed by Dougherty (2016). Adaptation training was carried out over 3 days by gradually increasing the speed and time, and the time to exhaustion was measured after the adaptation training ended. Specifically, each mouse was placed on a conveyor belt and made to run while maintaining a speed of 15 m / min and a constant incline. When the animal became exhausted and could no longer run because it could not handle the high speed and incline—that is, when it remained on the electric shock grid for more than 7 seconds—it was immediately removed from the treadmill, the time at which this occurred was recorded, and the distance run was calculated. In addition, biomarkers related to the improvement of exercise performance were measured after having the animals run on the treadmill until exhaustion for 60 minutes 24 hours prior to sacrifice.

[0112] Treatment of experimental animals

[0113] After the rearing period ended, the experimental animals were fasted for 12 hours. On the day of sacrifice, blood was collected by cardiac hemolysis after treatment with CO2 gas, and serum was obtained by centrifugation at 2,000 xg for 15 minutes at 4 ℃. Liver and muscle tissues were excised immediately after blood collection and weighed using a microbalance. All samples were stored in a deep freezer at -80 ℃ until analysis.

[0115] Serum biochemical analysis

[0116] Serum levels of GOT (Glutamic oxaloacetic transminase), GPT (Glutamic pyruvic transaminase), LDH (Lactate dehydrogenase), CPK (Creatine phosphokinase), lactic acid, and BUN (Blood urea nitrogen) were measured using an automated biochemical analyzer (Mindray-BC 5000vet). Additionally, serum ammonia levels were analyzed using an Aammonia Assay kit (Abcam, London, UK), followed by fluorescence measurement using a GloMax multimode plate reader (Promega, Madison, WI, USA). Antioxidant enzyme activity was analyzed using SOD (superoxide dismutase) ELISA kit (LSBio, WA, USA), CAT (catalase) ELISA kit (LSBio), and GPx (glutathione peroxidase) ELISA kit (Novus Biologicals, CO, USA), and absorbance was measured using a Microplate Spectrophotometer (BioTek Inc., VT, USA).

[0118] Histological analysis

[0119] Hematoxylin and eosin (H&E) staining was performed for the pathological analysis of muscle tissue. First, muscles from both hind legs of the animals were excised, and portions of the tissue from both sides were fixed in 10% neutral buffered formalin (Sigma-Aldrich, St. Louis, MO, USA). Then, paraffin blocks were prepared and sectioned to a thickness of 4 μm. After removing the paraffin with xylene and alcohol, the slides were stained with Hematoxylin solution (StatLab, McKinney, TX) and Eosin solution (Sigma-Aldrich), and images were taken using an Olympus Provis AX70 microscope (Olympus, Tokyo, Japan).

[0121] Measurement of mRNA expression levels in muscle tissue

[0122] To analyze the mRNA expression levels of biomarkers for exercise performance, total RNA was isolated from gastrocnemius muscle tissue using an RNA Extraction kit (iNtRON Biotechnology, Gyeonggi-do, Korea) according to the manufacturer's instructions. Subsequently, 50 ng of RNA was synthesized into cDNA using GoScript™ Reverse Transcriptase (Promega, Madison, WI, USA) and TaKaRa PCR Thermal Cycler Dice® Touch (Takara Bio Inc., Kusatsu, Shiga, Japan). Real-time RT-PCR was performed using SYBR Green Master Mix (TaKaRa Bio) and ABI QuantStudio 3 (Applied Biosystems, Foster City, USA), and the primer sequences used in the experiment are shown in Table 1 below.

[0123] Gene Name Symbol direction nucleotide sequence (5'-3') Sequence number GLUT4 Slc2a4 F ATGGCTGTCGCTGGTTTCTC 1 R ACCCATGCCGACAATGAAGT 2 PK Pkm F CGAGCCTCCAGTCACTCCAC 3 R GTGAGCACTCCTGCCAGA 4 PFK Pfkm F GGAGTGCGTGCAGGTGACCAAA 5 R ATCACGGCCACTGTGTGCAACC 6 HK1 Hk1 F TCGGAGGAACGAATTTCCGAGT 7 R ACAATGTGATCAAACAGCTCATCC 8 HK2 Hk2 F TCCAGACGGTACAGAGAAAGGA 9 R TCTCTACGCCCCTTCGCTTG 10 PDK4 Pdk4 F CACATGCTCTTCGAACTCTTCAAG 11 R TGATTGTAAGGTCTTCTTTTCCCAAG 12 MCT1 Slc16a1 F TTGTCTGTCTGGTTGCGGCTTGATCG 13 R GCCCAAGACCTCCAATAACACCAATGC 14 MCT4 Slc16a3 F TGCCACAGCCACACAATAGCCCA 15 R GTCCAGCCTACTCGTCTCTCTCCACA 16 ACC Acaca F GCGTCGGGTAGATCCAGTT 17 R CTCAGTGGGGCTTAGCTCTG 18 CPT1 Cpt1a F GCTGGAGGTGGCTTTGGT 19 R GCTTGGCGGATGTGGTTC 20 Complex I Ndufab1 F GGACCGAGTTCTGTATGTCTTG 21 R AAACCCAAATTCGTCTTCCATG 22 Complex II Sdhd F CTTGAATCCCTGCTCTGTGG 23 R AAAGCTGAGAGTGCCAAGAG 24 Complex III Uqcrc1 F ATCAAGGCACTGTCCAAGG 25 R TCATTTTCCTGCATCTCCCG 26 Complex IV Cox4i1 F ACCCTAATCTAGTCCCGTCC 27 R CAGCCAAAACCAGATGACAG 28 Complex V Atp5f1a F CATTGGTGATGGTATTGCGC 29 R TCCCAAACACGACAACTCC 30 GAPDH Gapdh F AGGTCGGTGTGAACGGATTT 31 R TGTAGACCATGTAGTTGAGG 32

[0125] Measurement of protein expression levels

[0126] Approximately 30 mg of gastrocnemius muscle tissue from experimental animals was homogenized in RIPA buffer (iNtRON Biotechnology) supplemented with protease inhibitors (Sigma-Aldrich) and phosphatase inhibitors (Thermo Scientific, Waltham, MA, USA), centrifuged at 13,000 xg for 10 minutes, and the supernatant was collected. Protein concentration was quantified using the TaKaRa BCA Protein Assay Kit (Takara Bio Inc.), and 30 μg of protein was subjected to electrophoresis on a sodium dodecyl sulfate-polyacrylamide gel. The isolated proteins were transferred to a polyvinylidene difluoride (PVDF) membrane, blocked with 5% skim milk (BD Difco, Sparks, MD, USA), and incubated overnight at 4°C with primary antibodies (AMPK, phospho-AMPK, PGC1α, PPARγ, SIRT1, GAPDH; Cell signaling technology, MA, USA) diluted in 5% bovine serum albumin, followed by incubation at room temperature for 1 hour with horseradish peroxidase-conjugated secondary antibody (Promega). Three TBS-T washes were performed between each step, and the protein bands were reacted with ECL (iNtRON Biotechnology) and analyzed using an ImageQuant™ LAS 500 system (GE Healthcare Life Sciences, Little Chalfont, UK).

[0128] Statistical analysis

[0129] Statistical analysis was performed using Graph Pad Prism 10 software (Graph Pad Software Inc., San Diego, CA, USA). One-way ANOVA was used to analyze statistical significance, and Tukey's post hoc test was conducted for post-hoc analysis. All values ​​were expressed as mean ± standard deviation, and a p-value of less than 0.05 was considered statistically significant.

[0131] Test Example 1: Measurement of body weight and feed intake

[0132] The body weight and feed intake of each test group were measured and are shown in Table 2 below.

[0133] division Body weight (g) Weight gain (BA) Feed intake (g) Week 0 (A) Week 6 (B) NC 33.6±1.8 38.2±0.8 4.2±1.8 33.0±1.2 PC 32.5±1.5 37.7±1.8 5.6±2.0 33.7±1.9 RGL 33.9±1.1 38.8±1.7 4.7±1.2 31.2±2.7 RGM 33.6±1.0 38.1±2.2 4.1±1.6 30.7±0.8 RGH 32.6±1.4 36.5±1.7 5.6±2.0 33.6±1.0

[0134] As shown in Table 2 above, each test group had similar body weights (32.5±1.4–33.6±1.8 g) at the start of the experiment (Week 0), and after the end of the experiment (Week 6), the body weights were 38.2±0.8 g for the NC group, 37.7±1.8 g for the PC group, 38.8±1.7 g for the RGL group, 38.1±2.2 g for the RGM group, and 36.5±1.7 g for the RGH group, and there were no significant differences between the groups.

[0135] During the rearing period, the body weight gain was 4.2±1.8 g for the NC group, 5.6±2.0 g for the PC group, 4.7±1.2 g for the RGL group, 4.1±1.6 g for the RGM group, and 5.6±2.0 g for the RGH group. The PC and RGH groups showed the highest body weight gain, but there were no significant differences between the groups.

[0136] As a result of measuring feed intake during the rearing period, the NC group was measured at 33.0±1.2 g, the PC group at 33.7±1.9 g, the RGL group at 31.2±2.7 g, the RGM group at 30.7±0.8 g, and the RGH group at 33.6±1.0 g. Although the PC and RGH groups had the highest feed intake, there were no significant differences between the groups. Given that the PC and RGH groups, which had high feed intake, showed the highest body weight gain, it appears that diet induced body weight gain.

[0138] Test Example 2: Measurement of organ and muscle weight changes

[0139] After the rearing period ended, the weight of the organ (liver) and each muscle of each test group was measured and is shown in Table 3 below.

[0140] division Weight (mg / g bw) liver quadriceps calf muscles Splenic muscle Tibialis anterior muscle long extensor muscles NC 32.0±2.1 6.72±0.57 4.50±0.37 0.26±0.02 1.60±0.16 0.29±0.03 PC 30.9±2.4 6.72±0.46 4.62±0.39 0.30±0.03 1.67±0.17 0.30±0.03 RGL 30.8±2.4 6.65±0.64 4.44±0.15 0.29±0.04 1.59±0.11 0.31±0.05 RGM 32.6±4.9 7.21±0.54 * 4.73±0.28 0.32±0.04 ** 1.68±0.08 0.32±0.04 RGH 32.7±1.7 7.13±0.40 4.80±0.33 0.30±0.07 1.70±0.10 0.32±0.06

[0141] As shown in Table 3 above, after the animals were raised, the liver weights were 32.0±2.1 g for the NC group, 30.9±2.4 g for the PC group, 30.8±2.4 g for the RGL group, 32.6±4.9 g for the RGM group, and 32.7±1.7 g for the RGH group. Although there were differences between the groups, they were not statistically significant.

[0142] In addition, the weight of the quadriceps was 6.72±0.57 g for the NC group, 6.72±0.46 g for the PC group, 6.65±0.64 g for the RGL group, 7.21±0.54 g for the RGM group, and 7.13±0.40 g for the RGH group, and the weight of the soleus was 0.26±0.02 g for the NC group, 0.30±0.03 g for the PC group, 0.29±0.04 g for the RGL group, 0.32±0.04 g for the RGM group, and 0.30±0.07 g for the RGH group, showing a significant increase in the RGM group compared to the NC group. The gastrocnemius muscle was 4.50±0.37 g for the NC group, 4.62±0.39 g for the PC group, 4.44±0.15 g for the RGL group, 4.73±0.28 g for the RGM group, and 4.80±0.33 g for the RGH group; the tibialis anterior muscle was 1.60±0.16 g for the NC group, 1.67±0.17 g for the PC group, 1.59±0.11 g for the RGL group, 1.68±0.08 g for the RGM group, and 1.70±0.10 g for the RGH group; and the extensor digitorum longus muscle was 0.29±0.03 g for the NC group, 0.30±0.03 g for the PC group, 0.31±0.05 g for the RGL group, and 0.32±0.04 g for the RGM group. The RGH group was 0.32±0.06g, and although the weight of the three muscles increased in the test group administered the sample of the present invention, no significance was observed.

[0144] Test Example 3: Effect of fatigue recovery or improvement of exercise performance

[0145] After the rearing period ended, the fatigue recovery or exercise performance (treadmill test) of each test group was measured (Fig. 2).

[0146] Looking at Figure 2, it can be seen that in the treadmill test, the PC, RGM, and RGH groups showed a significant increase in the time taken to exhaustion (Total running time) and a significant increase in the distance run to exhaustion (Running distance) compared to the NC group.

[0148] Test Example 4: Histopathology Examination

[0149] After the rearing period ended, hind leg muscles of each test group were excised, and changes in gastrocnemius muscle fibers and cross-sectional area (CSA) were observed through H&E staining (Figs. 3a and 3b).

[0150] Looking at Figure 3a, it can be seen that the PC, RGL, RGM, and RGH groups have increased muscle fiber size compared to the NC group.

[0151] Also, looking at Figure 3b, it can be seen that the CSA in the PC, RGL, RGM, and RGH groups significantly increased compared to the NC group.

[0153] Test Example 5: Serum Antioxidant Enzyme SOD, GPx, CAT Activity

[0154] After the treadmill test, serum SOD, GPx, and CAT activities were measured for each test group to evaluate the effects of fatigue recovery or improvement in exercise performance (Fig. 4).

[0155] Looking at Figure 4, it can be seen that the SOD and CAT enzyme activities of the PC, RGL, RGM, and RGH groups are significantly higher than those of the NC group. Additionally, it can be seen that the GPx enzyme activities of the PC, RGM, and RGH groups are significantly higher than those of the NC group. In particular, the serum SOD, GPx, and CAT enzyme activities of the RGH group, which was administered a high concentration of the sample, tended to be higher than those of the positive control group, the PC group.

[0157] Test Example 6: Serum Indicator Analysis

[0158] 6-1: GOT, GPT Measurement

[0159] After the treadmill test, serum GOT and GPT levels were measured to evaluate the effects of fatigue recovery or exercise performance improvement in each test group (Fig. 5). For reference, GOT (glutamic oxaloacetic transaminase) and GPT (glutamic pyruvic transaminase) are amino acid synthases present in most organs, particularly in large quantities in liver cells. Since they leak out of cells when cells or specific organs are damaged due to external stimuli or stress, they are used as indicators of muscle tissue damage and stimulation.

[0160] Looking at Figure 5, it can be seen that the serum production of GOT and GPT in the RGM and RGH groups was significantly reduced compared to the NC group.

[0161] From the above results, it can be seen that the sample of the present invention reduced serum GOT and GPT concentrations, which can increase due to muscle damage and stimulation from running on a treadmill until exhaustion. In other words, it appears that the sample of the present invention improved exercise performance by alleviating muscle fatigue that occurs during exercise.

[0162] 6-2: Measurement of LDH, CPK, and LAC

[0163] To evaluate the effects of fatigue recovery or exercise performance improvement in each test group after the treadmill test, the production of LDH (lactate dehydrogenase), CPK (creatine phosphokinase), and LAC (lactic acid) in the serum was measured (Fig. 6). For reference, the blood concentrations of LDH, CPK, and LAC increase after exercise, and in particular, LAC is one of the direct indicators of fatigue immediately after exercise.

[0164] Looking at Figure 6, it can be seen that the PC, RGL, RGM, and RGH groups have significantly lower levels of LDH, CPK, and LAC in their serum compared to the NC group.

[0165] 6-3: BUN, Ammonia Measurement

[0166] After the treadmill test, the amounts of BUN (blood urea nitrogen) and ammonia produced by protein metabolism were measured to evaluate the effects of fatigue recovery or exercise performance improvement in each test group (Fig. 7). For reference, BUN and ammonia are substances produced by protein catabolism after exercise and are substances that cause muscle fatigue.

[0167] Looking at Figure 7, the serum BUN production in the PC, RGL, RGM, and RGH groups was measured to be lower than that of the NC group, and in particular, the RGM and RGH groups showed a significant difference from the NC group. In addition, the serum ammonia production in the PC, RGL, RGM, and RGH groups was measured to be lower than that of the NC group, and in particular, the PC, RGM, and RGH groups showed a significant difference from the NC group.

[0169] Test Example 7: Analysis of mRNA expression levels in muscle tissue

[0170] 7-1: Changes in GLUT4, MCT1, MCT4, and PDK mRNA expression levels

[0171] To evaluate the effects of fatigue recovery or exercise performance improvement in each test group after the treadmill test, mRNA expression levels of GLUT4 (glucose transporter), MCT1 (Monocarboxylate transporter 1), MCT4 (Monocarboxylate transporter 4), and PDK (pyruvate dehydrogenase kinase) in the calf muscle tissue of each test group were measured (Fig. 8). For reference, GLUT4 is a glucose transporter, MCT1 is involved in intracellular lactate transport, MCT4 is involved in transporting lactate out of the cell, and PDK induces the accumulation of pyruvate.

[0172] Looking at Figure 8, it can be seen that the expression levels of GLUT4 mRNA in muscle tissue of the PC, RGL, RGM, and RGH groups were significantly higher than those of the NC group. Additionally, the mRNA expression levels of the lactate transporters MCT1 and MCT4 in the RGM and RGH groups were found to be significantly higher than those of the NC group. Furthermore, the mRNA expression levels of PDK in muscle tissue of the PC, RGM, and RGH groups were found to be significantly higher than those of the NC group.

[0173] From the above results, it can be seen that the higher the concentration of the sample administered according to the present invention, the higher the mRNA expression levels of GLUT4, MCT1, MCT4, and PDK in the muscle tissue tend to be.

[0174] 7-2: Changes in ACC and CPT mRNA expression levels

[0175] To evaluate the effects of fatigue recovery or improvement in exercise performance in each test group after the treadmill test, the mRNA expression levels of ACC (Acetyl-CoA carboxylase) and CPT 1 (carnitine palmitoyl transferase 1), enzymes involved in fatty acid oxidation synthesis in the calf muscle tissue of each test group, were measured (Fig. 9).

[0176] Looking at Figure 9, it can be seen that the mRNA expression levels of ACC in the muscle tissue of the PC, RGM, and RGH groups are significantly lower than those of the NC group. In addition, it can be seen that the mRNA expression levels of CPT 1 in the muscle tissue of the PC, RGM, and RGH groups are significantly higher than those of the NC group.

[0177] These results suggest that the administration of the sample of the present invention inhibits fatty acid synthesis and promotes fatty acid oxidation, thereby metabolizing fatty acids to be used as an energy source during exercise.

[0178] 7-3: Changes in PK, PFK, and HK mRNA expression levels

[0179] To evaluate the effects of fatigue recovery or improvement in exercise performance in each test group after the treadmill test, the mRNA expression levels of PK (pyruvate kinase), PFK (phosphofructokinase), HK 1 (hexokinase 1), and HK 2 (hexokinase 2), which are enzymes involved in glycolysis in the calf muscle tissue of each test group, were measured (Fig. 10).

[0180] Looking at Figure 10, it can be seen that the mRNA expression levels of PK in muscle tissue in the RGM and RGH groups were significantly higher than those in the NC group. Additionally, it can be seen that the mRNA expression levels of PFK in muscle tissue in the RGL, RGM, and RGH groups were significantly higher than those in the NC group. Furthermore, when measuring the mRNA expression levels of HK 1 and HK 2, which have broad specificity for hexoses and regulate the production of only the amount of ATP required by cells using glucose as an energy source, HK 1 was found to be significantly higher in the RGL, RGM, and RGH groups compared to the NC group, and HK 2 was found to be significantly higher in the PC, RGM, and RGH groups compared to the NC group.

[0181] 7-4: Changes in mRNA expression levels of enzymes involved in the electron transport chain

[0182] To evaluate the effects of fatigue recovery or improvement in exercise performance in each test group, the mRNA expression levels of Complex I (NADH dehydrogenase), Complex II (succinate dehydrogenase), Complex III (cytochrome c-oxidoreductase), Complex IV (cytochrome c oxidase), and ATP synthase, which are enzymes involved in electron transport chain metabolism within the calf muscle tissue of each test group, were measured (Fig. 11). For reference, the electron transport chain consists of four complexes located in the inner mitochondrial membrane and ATP synthase, and as electrons are transferred to the complexes, protons move from the mitochondrial matrix into the intermembrane space. As the concentration of these protons increases, ATP is generated.

[0183] Looking at Figure 11, it can be seen that the mRNA expression levels of enzyme complexes I–IV and ATP synthase involved in electron transport chain metabolism in the sample administration groups of the present invention (RGL, RGM, RGH) are significantly higher than those of the NC group.

[0185] Test Example 8: Analysis of AMPK, PGC1α, SIRT1, and PPARγ Protein Expression Levels in Muscle Tissue

[0186] To evaluate the effects of fatigue recovery or exercise performance improvement in each test group, the protein expression levels of AMPK, PGC1α, SIRT1, and PPARγ, which play an important role in regulating energy metabolism in the calf muscle tissue of each test group, were measured (Figs. 12a and 12b).

[0187] Looking at Figures 12a and 12b, it can be seen that the sample administration groups of the present invention (RGL, RGM, RGH) have significantly higher expression of p-AMPK, PGC1α, SIRT1, and PPARγ proteins involved in energy metabolism regulation compared to the NC group.

[0189] In conclusion, it is believed that the administration of a composition comprising the LGA1 strain (Preparation Example 1) and rice germ extract (Preparation Example 2) of the present invention exhibits a muscle-enhancing effect, helps in the recovery of muscle fatigue by reducing the levels of GOT, GPT, LDH, CPK, and LAC, as well as BUN and ammonia concentrations in the serum that increase during exercise, and improves exercise performance by regulating the expression of genes involved in glycolysis or electron transport chain metabolism within muscle tissue, and the expression levels of proteins involved in regulating energy metabolism. This suggests the possibility of developing the composition of the examples into a functional material for fatigue recovery or improving exercise performance.

[0191] Although the present invention has been described as a preferred embodiment mentioned above, various modifications and variations are possible without departing from the essence and scope of the invention. Furthermore, the appended claims include such modifications and variations that fall within the essence of the invention.

Claims

Claim 1 (i) Lactobacillus gasseri ( Lactobacillus gasseri ) one or more selected from a strain, a crushed liquid thereof, a culture solution thereof, an extract of the culture solution, a concentrate of the culture solution, and a dried product of the culture solution; and (ii) a food composition for muscle fatigue recovery or exercise performance improvement comprising a rice germ extract as an active ingredient. Claim 2 A food composition according to claim 1, characterized in that the strain is a live or dead strain. Claim 3 A food composition according to claim 1, characterized in that the rice germ extract is extracted with water, a lower alcohol having 1 to 4 carbon atoms, or a mixed solvent thereof. Claim 4 A food composition according to claim 3, characterized in that the mixed solvent is 20 to 80 volume% methanol, ethanol, butanol, or propanol. Claim 5 A food composition according to claim 1, characterized in that the improvement of exercise performance includes strengthening muscle strength, enhancing physical strength, delaying muscle fatigue, improving endurance, preventing muscle damage, or inhibiting muscle atrophy. Claim 6 (i) Lactobacillus gasseri ( Lactobacillus gasseri ) one or more selected from the group consisting of a strain, a crushed liquid thereof, a culture solution thereof, an extract of the culture solution, a concentrate of the culture solution, and a dried product of the culture solution; and (ii) a feed composition for muscle fatigue recovery or exercise performance improvement comprising a rice germ extract as an active ingredient. Claim 7 delete Claim 8 delete Claim 9 delete

Images