A microorganism introduced with exogenous NAD-dependent isocitrate dehydrogenase, and method for producing L-amino acid using the same

Abstract

The present application relates to a microorganism of the genus Corynebacterium having the ability to produce L-amino acids, into which a NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans or a polynucleotide encoding the same has been introduced; a method for producing L-amino acids comprising the step of culturing said microorganism in a medium; a composition for producing L-amino acids comprising said microorganism, said microorganism culture, said microorganism fermented product, or a combination of two or more of these; and a use of said microorganism for producing L-amino acids.

Description

Technology Field

[0001] The present application relates to a microorganism of the genus Corynebacterium having the ability to produce L-amino acids, into which a NAD-dependent isocitrate dehydrogenase derived from Streptococcus mutans or a polynucleotide encoding the same has been introduced; a method for producing L-amino acids comprising the step of culturing said microorganism in a medium; a composition for producing L-amino acids comprising said microorganism, said microorganism culture, said microorganism fermented product, or a combination of two or more of these; and a use of said microorganism for producing L-amino acids. Background Technology

[0003] Various studies have been conducted on the process of producing target substances (e.g., amino acids) from microorganisms as an environmentally friendly and safe production method; among these, research aimed at producing target substances in large quantities from microorganisms of the genus Corynebacterium has been continuously carried out. Corynebacterium ( Corynebacterium Microorganisms of the genus sp., especially Corynebacterium glutamicum ( Corynebacterium glutamicum ) is a Gram-positive microorganism widely used in the production of L-amino acids and other useful substances.

[0004] L-amino acids are the basic building blocks of proteins and are used as important materials for pharmaceutical raw materials, food additives, animal feed, nutritional supplements, insecticides, and fungicides. Various studies are being conducted to develop high-efficiency production microorganisms and fermentation process technologies to produce L-amino acids and other useful substances. For example, target substance-specific approaches are mainly used, such as increasing the expression of genes encoding enzymes involved in L-tryptophan biosynthesis or removing genes unnecessary for biosynthesis (US 8945907 B2).

[0005] L-tryptophan is one of the essential amino acids and has been widely used as a feed additive, a raw material for pharmaceuticals such as intravenous fluids, and a material for health foods. Although it can be produced through chemical synthesis, enzymatic reactions, and fermentation methods, direct fermentation using microorganisms is currently the most commonly used method. According to previous studies, actual cellular quantitative analysis has proven that tryptophan biosynthesis requires the highest level of energy among the 20 amino acids (Proc. Natl. Acad. Sci. USA (2002) V99, pp3695-3700). Therefore, research to effectively increase L-tryptophan production capacity is still necessary.

[0006] L-histidine is one of the 20 standard amino acids and is classified as an essential amino acid for growing children. L-histidine is involved in important physiological processes such as antioxidant activity and immune regulation, and is used in the medical industry as a raw material for gastrointestinal ulcer treatments, cardiovascular drugs, and amino acid intravenous fluids. Since histidine is particularly abundant in hemoglobin, it is primarily produced through protein hydrolysis extraction using blood meal; however, this method has disadvantages such as low efficiency and environmental pollution. Meanwhile, while it is possible to produce L-histidine through microbial fermentation, large-scale industrialization has not yet been achieved. Therefore, research to effectively increase L-histidine production capacity remains necessary. The problem to be solved

[0008] One aspect of the present application provides a microorganism of the genus Corynebacterium having L-amino acid production capability, into which a NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans or a polynucleotide encoding the same has been introduced.

[0009] In one embodiment, the L-amino acid may be one or more selected from the group consisting of L-tryptophan and L-histidine.

[0010] In another embodiment, the NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans may comprise the amino acid sequence of SEQ ID NO. 1 or an amino acid sequence having at least 80% sequence identity with respect to it.

[0011] In another embodiment, the NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans is icd It may be coded by genes.

[0012] In another embodiment, the polynucleotide encoding the NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans may comprise the base sequence of SEQ ID NO. 2.

[0013] In another embodiment, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.

[0014] As a microorganism according to any one of the aforementioned embodiments, the microorganism of the genus Corynebacterium may have an increased L-amino acid production capacity compared to a non-modified microorganism.

[0015] Another aspect of the present application provides a method for producing L-amino acids, comprising the step of culturing a microorganism of the genus Corynebacterium having L-amino acid production capability in a medium into which a NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans or a polynucleotide encoding the same has been introduced.

[0016] In one embodiment, the L-amino acid may be one or more selected from the group consisting of L-tryptophan and L-histidine.

[0017] In another embodiment, the method may additionally include the step of recovering L-amino acids from the cultured microorganism, the culture of the microorganism, the fermented product of the microorganism, or the culture medium.

[0018] Another aspect of the present application provides a composition for producing L-amino acids comprising: a microorganism of the genus Corynebacterium having the ability to produce L-tryptophan, into which a NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans or a polynucleotide encoding the same has been introduced; a culture of said microorganism, a fermented product of said microorganism, or a combination of two or more of these.

[0019] In one embodiment, the L-amino acid may be one or more selected from the group consisting of L-tryptophan and L-histidine. means of solving the problem

[0021] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application may be applied to other descriptions and embodiments. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application should not be considered limited by the specific descriptions provided below. Additionally, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated by reference into this specification in their entirety to more clearly explain the level of the art to which this application pertains and the content of this application.

[0023] definition

[0025] As used in the specification and appended claims of this application, singular articles (“a,” “an,” and “the”) may include plural objects unless otherwise noted. Also, unless otherwise noted, singular terms may include plural forms, and plural terms may include singular forms. Additionally, in the specification and appended claims of this application, unless otherwise noted, the use of “or” may be used to include “and / or”.

[0027] In this application, the term "about" may be placed before a specific numerical value. As used in this application, the term "about" includes not only the exact number specified after the term, but also a range that is approximately that number or close to that number. Whether the number is close to or nearly that specific number may be determined by considering the context in which the number is presented. For example, the term "about" may refer to a range of -10% to +10% of a numerical value. For another example, the term "about" may refer to a range of -5% to +5% of a given numerical value. However, it is not limited thereto.

[0029] In this application, terms such as “first, second, third,” “i), ii), iii),,” or “(a), (b), (c), (d),,” may be used to distinguish each configuration. When such terms are used in relation to steps of a method, use, or analysis, these terms do not imply that they are performed continuously or in sequence, for example, there may be no time interval between these steps, they may be performed simultaneously, or they may be performed sequentially, in reverse order, or randomly with intervals of seconds, minutes, hours, days, or months.

[0031] In this application, the term “consisting of” means that the proportion of the specific feature, step, component, or other component(s) described below the term is 100%. The feature, step, component, or other component described below the term “consisting of” may be essential or mandatory. For example, any other feature, step, component, or other component, or non-essential feature, step, component, or other component, in addition to the feature, step, component, or other component described below the term “consisting of,” may be excluded.

[0032] In this application, the term “consisting essentially of” means that one or more unspecified features, steps, components, or other components may be present, where the features, steps, components, or other components of the subject matter claimed in this application are not substantially affected by the presence of said unspecified features, steps, components, or other components.

[0033] In this application, the term "comprising" means the presence of the features, steps, components, or other components described below the above term, and does not exclude the presence of one or more additional features, steps, components, or other components. The features, steps, components, or other components described below the "comprising" in this application may be essential or mandatory, but some embodiments may further include other optional or non-essential features, steps, components, or other components.

[0035] Protein, polypeptide

[0037] In this application, the terms "protein" or "polypeptide" refer to a polymer or oligomer of a sequence of amino acid residues. In this application, "polypeptide," "protein," and "peptide" may be used interchangeably.

[0039] In this application, the term "mature polypeptide or mature protein" refers to a polypeptide or protein in a form that lacks a signal sequence or a propeptide sequence. A mature polypeptide or mature protein may be a functional form of a polypeptide or protein. A mature polypeptide or mature protein refers to a polypeptide in its final form after translation; and / or after posttranslational modification. For example, examples of such posttranslational modification may include, but are not limited to, N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, removal of a leader sequence, etc.

[0041] In this application, amino acid sequences are described in an N-terminal → C-terminal orientation unless otherwise indicated.

[0042] With respect to amino acid sequences in this application, it is evident that polypeptides or proteins "comprising" the amino acid sequence described by a specific sequence number, polypeptides or proteins "consisting" of the amino acid sequence described by a specific sequence number, or polypeptides or proteins "having" the amino acid sequence described by a specific sequence number may include polypeptides or proteins in which some amino acid(s) are deleted, modified, substituted, or added, provided that they have the same or corresponding activity as the polypeptide or protein composed of the amino acid sequence of the said sequence number. For example, polypeptides or proteins may also include polypeptides or proteins having additions or deletions of amino acid(s) that do not alter the function of the protein, naturally occurring mutations, silent mutations, or conservative substitutions within or before and after (N-terminus or C-terminus) the polypeptide or protein, provided that they have the same or corresponding activity.

[0043] In addition, for example, a polypeptide or protein conjugated with an N-terminal signal (or leader) sequence involved in the co-translational or post-translational translocation of a protein (polypeptide), or a polypeptide or protein conjugated with another sequence or linker to enable identification, purification, or synthesis of the polypeptide or protein, may also be included within the range of the polypeptide or protein of the amino acid sequence described by the specific sequence number.

[0044] In this application, the term "conservative substitution" means substituting an amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. For example, arginine, lysine, and histidine for positively charged (basic) amino acids; glutamic acid and aspartic acid for negatively charged (acidic) amino acids; glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline for amino acids having nonpolar side chains (nonpolar amino acids); Amino acids with polar or hydrophilic side chains (polar amino acids) can be classified to include serine, threonine, cysteine, tyrosine, asparagine, and glutamine. As another example, they can be classified into electrically charged amino acids with charged side chains (arginine, lysine, histidine, glutamic acid, and aspartic acid) and uncharged amino acids (also referred to as neutral amino acids) with uncharged side chains (glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. As another example, phenylalanine, tryptophan, and tyrosine can be classified as aromatic amino acids. As another example, valine, leucine, and isoleucine can be classified as branched amino acids.As another example, the 20 amino acids can be classified by size into five groups, starting with the group of amino acids with the smallest volume: glycine, alanine, serine; cysteine, proline, threonine, aspartic acid, asparagine; valine, histidine, glutamic acid, glutamine; isoleucine, leucine, methionine, lysine, arginine; and phenylalanine, tryptophan, and tyrosine. However, this is not necessarily limited to these groups. Typically, conservative substitutions have little to no effect on the activity of polypeptides or proteins.

[0046] Gene, polynucleotide

[0048] In this application, the term "gene" means, in a narrow sense, a polynucleotide encoding a functional molecule, and in a broad sense, a polynucleotide comprising the polynucleotide encoding the functional molecule and the regions preceding and following the polynucleotide. In one embodiment, the functional molecule may be RNA or a protein, and the gene may have a sequence (intron) inserted between each coding region (exon).

[0050] In this application, the terms “polynucleotide,” “nucleic acid,” or “nucleic acid molecule” refer to a polymer of nucleotides in which nucleotide monomers are linked together in a long chain by covalent bonds, and which is a strand of DNA (e.g., cDNA or genomic DNA) or RNA (e.g., mRNA) of a certain length or longer. In this application, “polynucleotide,” “nucleic acid,” and “nucleic acid molecule” may be used interchangeably.

[0052] Identity, homology

[0054] In this application, the terms “identity” or “homology” refer to the degree of similarity between two given amino acid or base sequences and may be expressed as a percentage. In this application, “homology” and “identity” may often be used interchangeably.

[0055] The sequence homology or identity of a conserved polynucleotide or polypeptide is determined by a standard arrangement algorithm, and a default gap penalty established by the program used may be used together.

[0056] Whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity can be determined using a known computer algorithm, such as the “FASTA” program, using default parameters as in, for example, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, it can be determined by comparing sequence information using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later), or by using GAP computer programs such as the Smith-Waterman algorithm (Smith and Waterman, Adv. Appl. Math (1981) 2:482) (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ed.,] Academic Press, San Diego, 1994, and [CARILLO et al .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST from the National Biotechnology Information Database Center or ClustalW.

[0058] Additionally, whether any two polynucleotide sequences have homology, similarity, or identity can be determined by Southern hybridization experiments under appropriate hybridization conditions, and said appropriate hybridization conditions can be determined by methods well known to those skilled in the art within the scope of the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York), but are not limited thereto. For example, homologous or identical polynucleotide sequences can generally be hybridized under stringent conditions along the entire sequence or at least about 50%, 60%, 70%, 80%, or 90% of the total length.

[0059] In this application, the term “stringent condition” means a condition that enables specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8). For example, the conditions may include hybridizing polynucleotides with high homology or identity with each other, having homology or identity of 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more, and not hybridizing polynucleotides with lower homology or identity, or washing conditions equivalent to the washing conditions of normal southern hybridization, such as 60°C, 1 χSSC, 0.1% SDS, specifically 60°C, 0.1 χSSC, 0.1% SDS, more specifically 68°C, 0.1 χSSC, 0.1% SDS, and washing once, specifically two to three times, at a salt concentration and temperature equivalent to the washing conditions of normal southern hybridization.

[0060] The above hybridization may occur between nucleotides having bases of mutually complementary sequences, but hybridized polynucleotides may contain some mismatch between bases depending on the degree of hybridization. The term “complementary” is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, with respect to DNA, adenosine is complementary to thymine, and cytosine is complementary to guanine. Accordingly, the polynucleotides of the present application may include not only substantially similar base sequences but also isolated nucleic acid fragments that are complementary to the entire sequence.

[0061] For example, a polynucleotide having homology or identity with the polynucleotide of the present application can be detected by hybridizing at a Tm value of 55°C. Additionally, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and can be appropriately adjusted by a person skilled in the art.

[0062] The appropriate strictness for hybridizing the above polynucleotides depends on the length and degree of complementarity of the polynucleotides, and the variables are well known in the art (e.g., J. Sambrook et al., i.e.).

[0064] Nucleic acid constructs, vectors, transformations

[0066] In this application, the term “nucleic acid construct” refers to an artificially designed single or double-stranded nucleic acid molecule contained in a vector that can be used to incorporate a target genetic material into a suitable host or host cell. For example, the nucleic acid construct may include a transgent delivered via a transformation vector that causes the insertion sequence to be replicated and / or expressed in the host cell. For example, the transgent may be replicated from an existing sequence or artificially synthesized.

[0068] As used in this application, the term "vector" refers to a DNA product for delivering a target polynucleotide into a suitable host or host cell.

[0069] For example, a vector may comprise a sequence of nucleotides of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (or expression control sequence) to enable the expression of the target polypeptide within a suitable host. The expression control region may comprise a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence coding for a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After being transformed into a suitable host cell (microorganism), the vector may replicate or function independently of the host genome, or it may be integrated into the genome itself to replicate or function.

[0070] In addition, as an example, the vector of the present application may include a sequence for inserting a target polynucleotide into a chromosome. The insertion of the polynucleotide into the chromosome using said vector may be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto.

[0071] The vectors used in this application are not particularly limited, and any vector known in the art may be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pDZ-based, pDC-based, pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors may be used as plasmid vectors. As an example, pDZ, pDC, pDC24, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors may be used.

[0072] The above vector may additionally include a selection marker to determine whether the vector has been transformed into a host cell or further inserted into a chromosome within the host cell. The selection marker is intended to select cells transformed by the vector or to confirm whether a target polynucleotide has been inserted into a chromosome, and markers conferring selectable phenotypes, such as drug resistance, nutritional requirements, resistance to cytotoxic agents, or the expression of surface polypeptides, may be used. Since only cells expressing the selection marker survive or exhibit other phenotypic traits in an environment treated with a selective agent, the transformed cells can be selected.

[0073] In this application, the term "transformation" refers to the introduction of a target polynucleotide, or a vector containing the same, into a host cell (microorganism) to alter the genetic traits of the host cell (microorganism). The transformed polynucleotide may be inserted into the chromosomes of the host cell (microorganism) or located outside the chromosomes. Additionally, the polynucleotide may contain DNA or RNA. The polynucleotide may be introduced in an appropriate form depending on the purpose of introduction. For example, a polynucleotide for expressing a target polypeptide may be introduced into the host cell (microorganism) in the form of an expression cassette, which is a genetic structure containing all the elements necessary for self-expression. The expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal operably linked to the coding sequence of the target polypeptide. The expression cassette may be in the form of a self-replicating expression vector. In addition, the above polynucleotide may be introduced into a host cell (microorganism) in its own form and operably linked to a sequence required for expression in the host cell (microorganism), but is not limited thereto.

[0074] In this application, the term "operably linked" refers to a configuration in which a regulatory sequence is positioned at an appropriate location so that the regulatory sequence controls the expression of a coding sequence. Accordingly, "operably linked" includes a regulatory region of a functional domain having known or desired activity, such as a promoter, terminator, signal sequence, or enhancer region, being attached to or linked to a target (gene or polypeptide) so as to regulate the expression, secretion, or function of the target according to said known or desired activity. For example, it may mean that a promoter sequence and a polynucleotide sequence are functionally linked to initiate and mediate the transcription of a polynucleotide encoding a polypeptide.

[0075] In this application, the term "expression" includes, but is not limited to, any step involved in the generation of a polypeptide, e.g., transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0076] In this application, the term “expression vector” means a linear or circular nucleic acid molecule comprising a target polynucleotide sequence and a regulatory sequence operably linked for the expression thereof. For example, it may comprise a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression regulatory region (or expression regulatory sequence) so as to enable the expression of the target polypeptide within a suitable host.

[0077] In this application, the term "regulatory sequence" refers to a polynucleotide sequence required for the regulation of the expression of a target polynucleotide sequence. Each regulatory sequence may be a natural (of the same origin) or foreign (derived from a different gene) sequence with respect to the coding sequence, a variant thereof, or another artificial sequence. Examples of the regulatory sequences include a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal peptide sequence, an operator sequence, a sequence coding for a ribosome binding site, and a sequence regulating transcription and translation termination. The minimum unit of the regulatory sequence may include a promoter, a transcription and translation termination sequence.

[0079] In this application, the term "genetic recombination" refers to a natural or artificial process in which elements constituting a gene, such as DNA or RNA, are altered from their original sequences during the process of disassembly and reassembly.

[0080] In this application, the term "recombinant gene" refers to a gene having a new genomic composition resulting from genetic recombination, such as chemical synthesis or genetic engineering technology. In this application, the terms "recombinant gene," "recombinant DNA," and "recombinant polynucleotide" may be used interchangeably. For example, the recombinant gene may include an artificial combination of nucleic acid fragments, such as regulatory sequences, that are not found together in nature.

[0081] In this application, the term "recombinant protein" refers to a protein produced as a result of genetic recombination.

[0083] microorganism

[0085] In this application, the term “microorganism (or strain)” includes both wild-type microorganisms and prokaryotic or eukaryotic microorganisms that have undergone natural or artificial genetic modification. It may be a microorganism in which specific mechanisms are weakened or enhanced due to causes such as the insertion of external genes or the increase or inactivation of the activity of endogenous genes, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein, or product. In this application, the terms “microorganism,” “strain,” “host,” and “host cell” may be used interchangeably.

[0086] In this application, the term “recombinant microorganism” refers to a microorganism that is genetically modified to exhibit a different genotype and / or phenotype compared to a naturally occurring microorganism (e.g., when the genetic modification affects the nucleic acid sequence coding of the microorganism), and may include both offspring and potential offspring of said microorganism. In this application, the terms “recombinant microorganism,” “genetically modified microorganism,” “recombinant host cell,” “recombinant cell,” and “recombinant strain” may be used interchangeably. The recombinant microorganism may, for example, express a gene not found in its natural (non-recombinant) form; not express a gene expressed in its natural form; or express a natural gene in a manner different from that expressed in its natural form.

[0087] For example, the microorganism of the present application may be a microorganism into which a NAD-dependent isocitrate dehydrogenase protein or a polynucleotide encoding the same has been introduced (e.g., a recombinant microorganism), but is not limited thereto.

[0088] In this application, the term "microorganism having L-amino acid production capability" refers to a microorganism capable of producing L-amino acids within a living organism, and may include both microorganisms that inherently lack L-amino acid production capability but are endowed with L-amino acid production capability, and microorganisms that inherently possess L-amino acid production capability. L-amino acid production capability may be endowed or enhanced through species improvement.

[0089] In this application, the term "non-modified microorganism (strain)" does not exclude microorganisms (strains) containing naturally occurring mutations, and may refer to wild-type microorganisms (strains) or natural-type microorganisms (strains) themselves, or microorganisms (strains) prior to genetic mutations caused by natural or artificial factors. In this application, the term "non-modified microorganism (strain)" may be used interchangeably with "pre-modification microorganism (strain)," "non-mutated microorganism (strain)," "parent microorganism," "parent strain," "wild-type microorganism (strain)," "reference microorganism (strain)," or "standard microorganism (strain)." In this application, "non-modified microorganism" may refer to a microorganism (strain) in which the NAD-dependent isocitrate dehydrogenase protein of this application or the polynucleotide encoding it has not been introduced, or prior to such introduction, but is not limited thereto. In addition, the non-modified microorganism in this application may be a microorganism that does not contain a polypeptide composed of SEQ ID NO. 1 or a polynucleotide composed of SEQ ID NO. 2, but is not limited thereto.

[0091] Increase in protein (polypeptide) activity

[0093] In this application, the term “increase” of protein (polypeptide) activity means that the activity of a protein (polypeptide) within a host cell (microorganism) increases relative to its intrinsic activity. The increase may be used interchangeably with terms such as activation, up-regulation, overexpression, and enhancement. The host cell (microorganism) may be a prokaryotic or eukaryotic microorganism.

[0094] The increase in the above protein (polypeptide) activity may include both the occurrence of protein (polypeptide) activity that the host cell (microorganism) did not inherently possess, and the occurrence of protein (polypeptide) activity that is enhanced compared to the inherent activity or activity prior to modification.

[0095] For example, the above "exhibiting protein (polypeptide) activity that was not inherently possessed" or exhibiting enhanced protein (polypeptide) activity may be due to the "introduction of protein (polypeptide)," but is not limited thereto.

[0096] In this application, the term "introduction" of a protein (polypeptide) refers to the manifestation of activity of a specific protein as a result of a gene that was not originally possessed by the microorganism being expressed within the microorganism, or the enhancement, increase, or improvement of polypeptide activity compared to the intrinsic activity of the said protein or activity prior to modification. For example, this may be due to the introduction of a gene encoding the said protein (polypeptide) into a host cell (microorganism). For example, a polynucleotide encoding a specific protein (polypeptide) may be introduced into a chromosome within the host cell (microorganism), or a vector containing a polynucleotide encoding a specific protein (polypeptide) may be introduced into the host cell (microorganism) to manifest or improve its activity.

[0097] The above "intrinsic activity" refers to the activity of a specific protein (polypeptide) originally possessed by the host cell (microorganism) prior to transformation or the non-transformed host cell (microorganism) when a trait changes due to genetic variation caused by natural or artificial factors. This term may be used interchangeably with "pre-transformation activity."

[0098] An increase in the activity of a protein (polypeptide) relative to its intrinsic activity means that the activity and / or concentration (expression level) of the protein (polypeptide) in the host cell (microorganism) has been enhanced compared to the activity and / or concentration (expression level) of the said protein (polypeptide) originally possessed by the host cell (microorganism) prior to transformation or the non-transformed host cell (microorganism).

[0099] For example, the above increase may be that the activity of the corresponding protein (polypeptide) was absent, or that the activity or concentration thereof is increased to approximately 1% or more, approximately 10% or more, approximately 25% or more, approximately 50% or more, approximately 75% or more, approximately 100% or more, approximately 150% or more, approximately 200% or more, approximately 300% or more, approximately 400% or more, or approximately 500% or more, up to approximately 1000% or approximately 2000% or more, based on the activity or concentration in the host cell (microorganism) before transformation or in the non-transformed host cell (microorganism), but is not limited thereto.

[0100] An increase in the activity of the above protein (polypeptide) can be achieved by introducing an exogenous protein (polypeptide) or by increasing the activity of the intrinsic protein (polypeptide). Whether the activity of the above protein (polypeptide) has increased can be confirmed from an increase in the degree of activity, expression amount, or amount of product attributable to the activity of the said protein (polypeptide).

[0101] Increased activity of the above protein (polypeptide) can be achieved by various methods well known in the art, and is not limited to, as long as the activity of the target protein (polypeptide) can be increased compared to that of the host cell (microorganism) before modification. Specifically, it may be, but is not limited to, gene engineering and / or protein engineering known to a person skilled in the art, which are routine methods of molecular biology (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0102] Specifically, the increase in the activity of the protein (polypeptide) of the present application is

[0103] 1) Increase in the intracellular copy number of polynucleotides encoding proteins (polypeptides);

[0104] 2) Modification of a gene expression regulatory region on a chromosome encoding a protein (polypeptide) (e.g., introduction of a mutation within the expression regulatory region, replacement with a sequence having greater activity, or insertion of a sequence having greater activity);

[0105] 3) A modification of the nucleotide sequence encoding the start codon or the 5'-UTR region of a gene transcript encoding a protein (polypeptide);

[0106] 4) Modification of the amino acid sequence of the protein (polypeptide) to increase protein (polypeptide) activity;

[0107] 5) Modification of the polynucleotide sequence encoding the protein (polypeptide) to increase the activity of the protein (polypeptide) (e.g., modification of the polynucleotide sequence of the protein (polypeptide) coding gene to code for a modified protein (polypeptide) to increase the activity of the protein (polypeptide);

[0108] 6) Introduction of a foreign protein (polypeptide) exhibiting protein (polypeptide) activity or a foreign polynucleotide encoding the same;

[0109] 7) Codon optimization of polynucleotides encoding proteins (polypeptides);

[0110] 8) Analyze the tertiary structure of the protein (polypeptide) to select and modify or chemically alter the exposed sites

[0111] 9) Regulation of the cellular localization of proteins (polypeptides); or

[0112] 10) It may be based on two or more combinations selected from 1) to 9) above, but is not specifically limited thereto.

[0113] for example,

[0114] The increase in the intracellular copy number of the polynucleotide encoding the protein (polypeptide) described in 1) above may be achieved by introducing a vector containing the polynucleotide encoding the protein (polypeptide) operably linked to an appropriate regulatory sequence into a host cell (microorganism). Alternatively, one or more copies of the polynucleotide encoding the protein (polypeptide) operably linked to an appropriate regulatory sequence may be introduced into the chromosomes within the host cell (microorganism). The introduction into the chromosomes may be performed by introducing a vector capable of inserting the polynucleotide into the chromosomes within the host cell (microorganism), but is not limited thereto. The vector is as described above. The regulatory sequence may be a natural form (of the same origin) or a foreign sequence (derived from a different gene) with respect to the polynucleotide sequence, a variant of these, or another artificial sequence, and may induce the expression of the polynucleotide within the host cell (microorganism).

[0115] The replacement of a gene expression regulatory region (or expression regulatory sequence) on a chromosome encoding a protein (polypeptide) in the above 2) with a sequence having greater activity may, for example, involve introducing a sequence variation by deletion, insertion, substitution, or a combination thereof to further increase the activity of the expression regulatory region, or by replacing it with a sequence having greater activity. The expression regulatory region may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, the original promoter may be replaced with a potent promoter, but is not limited thereto.

[0116] Examples of known strong promoters include, but are not limited to, cj1 to cj7 promoters (US Patent No. 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13(sm3) promoter (US Patent No. 10584338 B2), O2 promoter (US Patent No. 10273491 B2), tkt promoter, and yccA promoter.

[0117] The above 3) modification of the nucleotide sequence of the region coding for the start codon or 5'-UTR of the gene coding for the protein (polypeptide) may be, for example, a modification that codes for another start codon with a higher protein (polypeptide) expression rate compared to the intrinsic start codon, or an RBS sequence with a higher protein (polypeptide) expression rate compared to the intrinsic RBS (ribosome binding site) sequence, but is not limited thereto.

[0118] The modification of the amino acid sequence or polynucleotide sequence of the protein (polypeptide) in 4) and 5) above may be the introduction of a sequence variation by deletion, insertion, substitution, or a combination thereof to the amino acid sequence of the protein (polypeptide) or the polynucleotide sequence encoding the protein (polypeptide) to increase the activity of the protein (polypeptide), or the replacement with an amino acid sequence or polynucleotide sequence modified to increase activity, but is not limited thereto. The replacement may be performed, for example, by inserting the polynucleotide into the chromosome by homologous recombination, but is not limited thereto.

[0119] The introduction of an exogenous polynucleotide exhibiting the activity of the protein (polypeptide) described in 6) above may be the introduction into a host cell (microorganism) of an exogenous polynucleotide encoding a protein (polypeptide) that exhibits the same or similar activity as the protein (polypeptide). As long as the exogenous polynucleotide exhibits the same or similar activity as the protein (polypeptide), there are no restrictions on its origin or sequence. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the protein (polypeptide) may be produced and its activity increased by the expression of the introduced polynucleotide within the host cell.

[0120] The above 7) codon optimization of a polynucleotide encoding a protein (polypeptide) may be a codon optimization of the endogenous polynucleotide so that transcription or translation increases within the host cell (microorganism), or a codon optimization of the exogenous polynucleotide so that optimized transcription and translation occur within the host cell (microorganism).

[0121] 8) Analyzing the tertiary structure of the protein (polypeptide) above to select an exposed site for modification or chemical modification may, for example, involve determining a template protein candidate based on the degree of sequence similarity by comparing the sequence information of the protein (polypeptide) to be analyzed with a database in which sequence information of known proteins is stored, and confirming the structure based on this to select an exposed site to modify or chemically modify.

[0122] The above 9) regulation of the intracellular localization of a protein (polypeptide) may involve targeting the protein (polypeptide) to a specific intracellular organelle or a specific intracellular space. For example, it may involve targeting to the periplasm or cytoplasm through the addition or removal of a leader sequence that functions for the targeting of the protein (polypeptide), but is not limited thereto.

[0123] Such an increase in protein (polypeptide) activity may be an increase in the activity or concentration of the corresponding protein (polypeptide) relative to the activity or concentration of the protein (polypeptide) expressed in the wild-type or pre-modification host cell (microorganism), or an increase in the amount of products attributable to the activity of the said protein (polypeptide), but is not limited thereto.

[0125] Modification of part or all of the polynucleotides in the host cells (microorganisms) of the present application may be induced by (a) a method using homologous recombination using a chromosome insertion vector or genome editing using engineered nucleases (e.g., CRISPR-Cas9) and / or (b) treatment by light and / or chemicals such as ultraviolet rays and radiation, but is not limited thereto.

[0127] culture

[0129] In this application, the term "culture" means growing microorganisms under appropriately controlled environmental conditions. The culture process may be carried out according to suitable media and culture conditions known in the art. Such a culture process can be easily adjusted and used by those skilled in the art depending on the microorganism selected. Specifically, the culture may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0130] In this application, the term "medium" refers to a substance mixed with nutrients as the main component required for culturing microorganisms, and supplies nutrients and growth factors, including water, which is indispensable for survival and growth. Specifically, any medium and other culture conditions used for culturing the microorganisms of this application may be used without special limitations as long as they are media used for culturing microorganisms in general. For example, the microorganisms of this application may be cultured under aerobic conditions while controlling the temperature, pH, etc., in a conventional medium containing a suitable carbon source, nitrogen source, phosphorus, inorganic compounds, amino acids, and / or vitamins. For example, culture media for microorganisms of the genus Corynebacterium can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981)].

[0131] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvate, lactic acid, citric acid, etc.; and amino acids such as glutamic acid, methionine, lysine, etc. Additionally, natural organic nutrient sources such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane residue, and corn steeping liquid may be used. Specifically, carbohydrates such as glucose and sterilized pre-treated molasses (i.e., molasses converted into reducing sugars) may be used, and other carbon sources in appropriate amounts may be used in various ways without limitation. These carbon sources may be used individually or in combination of two or more types, but are not limited thereto.

[0132] The above nitrogen sources may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; and organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc., peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquid, casein hydrolysate, fish or its decomposition products, defatted soybean cake or its decomposition products, etc. These nitrogen sources may be used alone or in combination of two or more types, but are not limited thereto.

[0133] The above ingredients may include monopotassium phosphate, dipotassium phosphate, or corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc., and may also include amino acids, vitamins, and / or suitable precursors. These components or precursors may be added to the medium in a batch or continuous manner. However, they are not limited thereto.

[0134] In addition, during the cultivation of the microorganism of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc., may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during cultivation, an antifoaming agent such as fatty acid polyglycol ester may be used to suppress the formation of bubbles. Furthermore, to maintain an aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection to maintain an anaerobic and microaerobic state, but is not limited thereto.

[0135] In the culture of the present application, the culture temperature can be maintained at 20 to 45°C, specifically 25 to 40°C, and culture can be performed for about 10 to 160 hours, but is not limited thereto.

[0136] In this application, the term "culture" means a culture solution, concentrated culture solution, dried culture solution, culture filtrate, concentrated culture filtrate, or dried culture filtrate obtained by culturing a specific microorganism in a culture medium, wherein the culture solution means containing the specific microorganism, and the culture filtrate means not substantially containing the specific microorganism (wherein, substantially means excluding the specific microorganism separated by filtration, etc., and does not mean that the microorganism is completely excluded from the filtrate). The formulation of the culture is not limited and may be, for example, a liquid, an emulsion, or a solid.

[0137] In this application, the term "fermentation" refers to a process in which microorganisms decompose organic matter using their own enzymes, excluding putrefaction. Although fermentation and putrefaction proceed through similar processes, if useful substances are produced as a result of the decomposition, it is called fermentation, whereas if foul odors are emitted or harmful substances are produced, it is called putrefaction.

[0138] In this application, the method for obtaining a fermented product from the microorganism is not particularly limited and can be obtained according to methods commonly used in the relevant technical field or similar fields.

[0139] In this application, the term "fermented product" includes not only the fermented substance itself, but also all types of substances containing a fermented product generated from said microorganisms, such as a substance containing a fermented microorganism, a culture produced from a fermented microorganism, a fermented product of a culture, a concentrated fermented product, a dried product of a fermented product, a filtrate of a fermented product, a filtrate of a concentrated fermented product, or a dried product of a filtrate of a fermented product, an extract of a fermented product, or a diluted solution of a fermented product.

[0141] Specific description of the present application

[0143] The following is a more detailed description of the specific embodiments of the present application.

[0144] One aspect of the present application is Streptococcus mutans ( Streptococcus mutans Provides a microorganism of the genus Corynebacterium having L-amino acid production capability, into which a NAD-dependent isocitrate dehydrogenase protein derived from ) or a polynucleotide encoding it has been introduced.

[0146] In this application, the term "NAD-dependent isocitrate dehydrogenase (ICD)" refers to a NAD-dependent enzyme among isocitrate dehydrogenases, which are enzymes that catalyze oxidative decarboxylation to produce alpha-ketoglutarate and CO2. The NAD-dependent isocitrate dehydrogenase of this application may be used interchangeably with ICD.

[0147] Specifically, the NAD-dependent isocitrate dehydrogenase protein of the present application icd It may be a protein having NAD-dependent isocitrate dehydrogenase activity encoded by a gene, but is not particularly limited to that type as long as it has activity corresponding to NAD-dependent isocitrate dehydrogenase. icd NAD-dependent isocitrate dehydrogenase proteins encoded by genes are known in the art, and the amino acid and polynucleotide sequences of said NAD-dependent isocitrate dehydrogenase proteins can be obtained from known databases, examples of which include, but are not limited to, GenBank of NCBI.

[0148] For example, the above Streptococcus mutans ( Streptococcus mutansA NAD-dependent isocitrate dehydrogenase protein derived from ) may include the amino acid sequence of SEQ ID NO. 1 or an amino acid sequence having 60% or more homology or identity therewith, but is not limited thereto as long as it has NAD-dependent isocitrate dehydrogenase activity. Specifically, even if it includes a sequence in which some sequences of the amino acid sequence of SEQ ID NO. 1 are deleted, modified, substituted, or added, if it is a protein that exhibits efficacy corresponding to the NAD-dependent isocitrate dehydrogenase, it may be included in the NAD-dependent isocitrate dehydrogenase protein. In addition, if a protein has an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with the amino acid sequence of SEQ ID NO. 1, includes, is composed of, or is essentially composed of, the amino acid sequence, and exhibits an efficacy corresponding to the NAD-dependent isocitrate dehydrogenase, it may be included in the NAD-dependent isocitrate dehydrogenase protein.

[0150] Additionally, the sequence of a polynucleotide encoding a NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans having an amino acid sequence having 60% or more homology or identity with the above-mentioned sequence No. 1 or an amino acid sequence having 60% or more homology or identity therewith can be obtained, for example, based on codon information known in the art. As an example, the above-mentioned NAD-dependent isocitrate dehydrogenase protein may be encoded by a polynucleotide having or including a sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity with the sequence No. 2, or which may be composed of or essentially composed of said sequence, but is not limited thereto. In addition, the nucleotide sequence of SEQ ID NO. 2 above can be obtained from known databases, such as NCBI’s GenBank, but is not limited thereto.

[0151] In this application, the polynucleotide (gene) comprising the nucleotide sequence of SEQ ID NO. 2 is a polynucleotide (gene) having the nucleotide sequence of SEQ ID NO. 2, a polynucleotide (gene) composed of the nucleotide sequence of SEQ ID NO. 2, or icd It can be used in combination with genes.

[0152] The polynucleotide of the present application may have various modifications made to its coding region within the scope of not altering the amino acid sequence of the NAD-dependent isocitrate dehydrogenase protein of the present application, due to codon degeneracy or by considering the preferred codons in organisms intended to express the NAD-dependent isocitrate dehydrogenase protein of the present application. Therefore, it is obvious that the polynucleotide of the present application may also include a polypeptide consisting of the amino acid sequence of the NAD-dependent isocitrate dehydrogenase protein of the present application, or a polypeptide having homology or identity therewith, due to codon degeneracy. For example, the polynucleotide of the present application may be SEQ ID NO. 2 or its degenerated sequence.

[0153] In another example, the polynucleotide of the present application may have or include a base sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity with SEQ ID NO. 2, or may be composed of or essentially composed of a base sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity with SEQ ID NO. 2, but is not limited thereto.

[0154] In addition, the polynucleotide of the present application may include, without limitation, a probe that can be prepared from a known gene sequence, for example, a sequence encoding the NAD-dependent isocitrate dehydrogenase protein of the present application by hybridizing under strict conditions with a sequence complementary to all or part of the polynucleotide sequence of the present application.

[0156] The microorganisms of the genus Corynebacterium in this application have the ability to produce L-amino acids.

[0157] In the present application, the L-amino acid may specifically be L-tryptophan or L-histidine.

[0158] For the purposes of this application, the microorganisms of this application may include all microorganisms capable of producing a desired L-amino acid by introducing a NAD-dependent isocitrate dehydrogenase protein or a polynucleotide encoding it. For example, the microorganisms of this application may be genetically modified microorganisms or recombinant microorganisms in which the L-amino acid production capacity is increased by introducing a NAD-dependent isocitrate dehydrogenase protein or a polynucleotide encoding it. Specifically, the recombinant microorganisms with increased L-amino acid production capacity may be microorganisms in which the L-amino acid production capacity is increased compared to natural wild-type microorganisms or non-modified microorganisms that possess or lack the intrinsic activity of NAD-dependent isocitrate dehydrogenase, but are not limited thereto.

[0160] For example, microorganisms having L-amino acid production capability are prokaryotic or eukaryotic microorganisms capable of producing L-amino acids within an organism, and may include both microorganisms that inherently possess L-amino acid production capability and microorganisms that lack L-amino acid production capability but are conferred L-amino acid production capability due to the activity of the NAD-dependent isocitrate dehydrogenase protein introduced in this application. L-amino acid production capability may be conferred or enhanced by species improvement.

[0161] The microorganisms of the present application may include all microorganisms into which a NAD-dependent isocitrate dehydrogenase protein or a polynucleotide encoding the same has been introduced by various known methods.

[0163] For example, the recombinant microorganism having the ability to produce L-amino acids according to the present application may be a microorganism capable of producing L-amino acids by transforming through a vector and introducing an exogenous gene encoding the NAD-dependent isocitrate dehydrogenase protein of the present application, specifically, an exogenous gene encoding the NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans.

[0165] For example, the microorganism producing the L-amino acid may be a microorganism to which a polynucleotide sequence is introduced that codes for a protein comprising the amino acid sequence of SEQ ID NO. 1, or a protein comprising an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more of homology or identity with the amino acid sequence of SEQ ID NO. 1.

[0166] For example, the microorganism producing the L-amino acid may be a microorganism to which the above-mentioned L-amino acid-producing microorganism is introduced, wherein the microorganism may have a polynucleotide capable of encoding a protein comprising an amino acid sequence having at least 80% homology with the amino acid sequence of SEQ ID NO. 1; or a polynucleotide comprising the base sequence of SEQ ID NO. 2, or a base sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity with the base sequence of SEQ ID NO. 2.

[0168] For example, the microorganism with increased L-amino acid production capacity of the present application may be a microorganism with increased L-amino acid production capacity compared to a non-modified microorganism, but is not limited thereto. For example, the non-modified microorganism, which is the target strain for comparing whether the L-amino acid production capacity is increased, may be the CM05-9157 or CA14-0737 strain, but is not limited thereto.

[0169] For example, the above-mentioned microorganism with increased L-amino acid production capacity may be increased by about 1% or more compared to the L-amino acid production capacity of the parent microorganism (parent strain) or non-modified microorganism before mutation, specifically about 1% or more, about 2.5% or more, about 5% or more, about 6% or more, about 7% or more, about 8% or more, about 9% or more, about 10% or more, about 15% or more, about 20% or more, about 25% or more, or about 26% or more (there is no special limit on the upper limit value, for example, it may be about 200% or less, about 150% or less, about 100% or less, about 50% or less, about 45% or less, about 40% or less, or about 35% or less), but is not limited thereto as long as it has a positive increase amount compared to the production capacity of the parent microorganism (parent strain) or non-modified microorganism before mutation. In another example, the recombinant strain with increased L-amino acid production capacity may have an L-amino acid production capacity that is increased by about 1.1 times or more, about 1.15 times or more, about 1.2 times or more, about 1.25 times or more, or about 1.26 times or more compared to the parent microorganism (parent strain) or non-modified microorganism before mutation (there is no special limitation on the upper limit, for example, it may be about 10 times or less, about 5 times or less, about 3 times or less, about 2 times or less, about 1.5 times or less, about 1.4 times or less, or about 1.35 times or less), but is not limited thereto.

[0171] For example, the microorganism having the ability to produce L-amino acids according to the present application may be either a prokaryotic or a eukaryotic cell, but specifically may be a prokaryotic cell. Among the said prokaryotic cells, for example, the genus Escherichia ( Escherichia sp.), genus Erwinia ( Erwinia sp.), Serratia genus ( Serratia sp.), genus Providencia ( Providencia sp.), genus Corynebacterium ( Corynebacteria sp.), genus Pseudomonas ( Pseudomonas sp.), genus Leptospira ( Leptospira sp.), Salmonella genus ( Salmonella sp.), genus Brevibacteria ( Brevibacteria sp.), Hypomonas genus ( Hypomononas sp.), genus Chromobacterium ( Chromobacterium sp.) and the genus Nocardia ( Norcardia Microorganisms belonging to sp.) may be included, but are not limited thereto. Specifically, they may be microorganisms of the genus Escherichia or Corynebacterium. More specifically, Corynebacterium ( Corynebacterium It could be a microorganism.

[0172] As a microorganism according to any one of the prior embodiments, the microorganism of the present application is Corynebacterium ( Corynebacterium It could be a microorganism.

[0173] Corynebacterium Corynebacterium Microorganisms of the genus Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis( Corynebacterium crudilactis ), Corynebacterium deserti( Corynebacterium deserti ), Corynebacterium epiphysiens( Corynebacterium efficiens ), Corynebacterium calunae( Corynebacterium callunae ), Corynebacterium stationaryis( Corynebacterium stationis ), Corynebacterium singulare( Corynebacterium singulare ), Corynebacterium halotolerans( Corynebacterium halotolerans ), Corynebacterium striatum ( Corynebacterium striatum ), Corynebacterium ammoniagenes( Corynebacterium ammoniagenes ), Corynebacterium pollatisoli ( Corynebacterium pollutisoli ), Corynebacterium imitans( Corynebacterium imitans ), Corynebacterium testudinoris( Corynebacterium testudinoris ) or Corynebacterium flavescens ( Corynebacterium flavescens It may be. More specifically, the microorganism of the present application is Corynebacterium glutamicum ( Corynebacterium glutamicum It may be, but is not limited to.

[0174] Meanwhile, the microorganisms of the genus Corynebacterium having L-amino acid production ability of the present application may include the natural wild-type microorganism itself, a microorganism of the genus Corynebacterium that has acquired enhanced L-amino acid production ability by increasing or decreasing the activity of genes related to the L-amino acid production mechanism, or a microorganism of the genus Corynebacterium that has acquired enhanced L-amino acid production ability by introducing or increasing the activity of external genes.

[0176] Another aspect of the present application provides a method for producing L-amino acids, comprising the step of culturing a microorganism of the genus Corynebacterium having L-amino acid production capability in a medium into which the NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans of the present application or a polynucleotide encoding the same has been introduced.

[0177] In the method of the present application, any culture conditions and methods known in the art may be used for the culture of microorganisms. Such a culture process can be easily adjusted and used by a person skilled in the art depending on the microorganism selected.

[0178] The L-amino acid produced by the culture of the present application may be secreted into the culture medium or remain within the cell.

[0180] In one embodiment, the method for producing L-amino acid of the present application may additionally include the step of preparing a microorganism of the present application, the step of preparing a medium for culturing said strain, or a combination thereof (in any order), for example, prior to the culturing step.

[0181] The method for producing L-amino acids according to the present application may further include a step of recovering a target substance, specifically L-amino acids, from the cultured microorganism, the culture of the microorganism, the fermented product of the microorganism, or the culture medium. The recovery step may be additionally included after the culture step.

[0182] The above recovery may involve collecting the desired L-amino acid using a suitable method known in the art according to the culture method of the microorganism of the present application, such as a batch, continuous, or fed-batch culture method. For example, various chromatographic methods such as centrifugation, filtration, treatment with a crystallizing protein precipitating agent (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC, or a combination thereof may be used, and the target substance, specifically L-amino acid, can be recovered from the culture medium or microorganism using a suitable method known in the art.

[0183] In addition, the method for producing L-amino acids according to the present application may additionally include a purification step. The purification may be performed using a suitable method known in the art. In one example, where the method for producing L-amino acids according to the present application includes both a recovery step and a purification step, the recovery step and the purification step may be performed continuously or discontinuously regardless of the order, or simultaneously or integrated into a single step, but are not limited thereto.

[0184] In the method of the present application, the NAD-dependent isocitrate dehydrogenase, the introduction and L-amino acid, etc. are as described in the other embodiments above.

[0186] Another aspect of the present application provides a composition for producing L-amino acids comprising a microorganism of the genus Corynebacterium having the ability to produce L-amino acids into which a NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans of the present application or a polynucleotide encoding the same has been introduced, a culture of said microorganism, a fermented product of said microorganism, or a combination of two or more of these.

[0187] The composition of the present application may further include any suitable excipients commonly used in compositions for producing L-amino acids, and such excipients may be, for example, preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers, or isotonic agents, but are not limited thereto.

[0188] In one specific example, each component present in the composition of the present application may be included in a microbiologically effective amount or in an amount that can be appropriately present in a composition for production.

[0189] In the composition of the present application, the NAD-dependent isocitrate dehydrogenase, the introduction, and the L-amino acid, etc., are as described in the other embodiments above.

[0191] Another aspect of the present application provides for the production of L-amino acids by a microorganism of the genus Corynebacterium having L-amino acid production capability, into which a NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans of the present application or a polynucleotide encoding the same is introduced.

[0192] In the use of the present application, NAD-dependent isocitrate dehydrogenase, introduction, and L-amino acid, etc. are as described in the other embodiments above. Effects of the invention

[0195] A microorganism of the genus Corynebacterium having L-amino acid production capability, into which the NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans or the polynucleotide encoding it is introduced in the present application, can produce L-amino acids in high yield and can be usefully utilized for the industrial production of L-amino acids. Specific details for implementing the invention

[0197] The present application will be explained in more detail below through examples. However, the following examples are merely preferred embodiments for illustrating the present application and are therefore not intended to limit the scope of the rights of the present application. Meanwhile, technical matters not described in this specification can be fully understood and easily implemented by a person skilled in the art who is proficient in the technical field of the present application or a similar technical field.

[0199] Example 1. NAD-dependent isocitrate dehydrogenase (ICD) gene screening and screening

[0201] To select organisms possessing NAD-dependent isocitrate dehydrogenase (icd), a BLAST search based on the NCBI and Kegg databases was conducted using the amino acid sequence of the endogenous isocitrate dehydrogenase of Corynebacterium glutamicum as the query sequence. As a result, considering the biosafety level applicable to production strains and availability, three species of organisms expected to possess NAD-dependent isocitrate dehydrogenase were selected as shown in Table 1 below.

[0202] order strain Protein registration number Biosafety 1 Streptococcus mutans WP_002276545.1 1 2 Streptococcus sp. 'caviae' WP_075346121.1 1 3 Streptococcus varani WP_093650533.1 1

[0204] Example 2. Production of an L-tryptophan-producing microorganism by introducing an exogenous NAD-dependent isocitrate dehydrogenase

[0206] Example 2-1. Construction of a plasmid for gene substitution

[0208] In the chromosomes of Corynebacterium glutamicum icd Using plasmid pDC24 (SEQ No. 86) as the parent vector for gene substitution, intrinsic icd The coding sequence of a gene is foreign icd A plasmid capable of being substituted with the coding sequence of a gene was constructed.

[0209] Specifically, using Corynebacterium glutamicum ATCC13869 chromosomal DNA as a template, the upstream region where chromosomal homologous recombination occurs was amplified using the primer pair of SEQ ID NO. 7 and SEQ ID NO. 8, and the downstream region was amplified using the primer pair of SEQ ID NO. 9 and SEQ ID NO. 10; subsequently, PCR was performed to obtain each gene fragment. The PCR was performed by Solg TM The amplification was performed using Pfu-X DNA polymerase (SolGent co.) under the following conditions: denaturation at 95°C for 4 minutes, followed by 27 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 50 seconds, followed by polymerization at 72°C for 5 minutes. The primer sequences used are shown in Table 2 below.

[0210] Sequence number Sequence(5'→ 3') Sequence number 7 TTCTATTGACTTATTTATAGAGTCTCTTCACAAAAAGCGC Sequence number 8 TCGACTCTAGAGGATCCCCGGTTTGGGATTCGTTGTAATC Sequence number 9 AATTCGAGCTCGGTACCCTGCTGAATATATGGGTGG Sequence number 10 CTTACTTTTTCTGCCATGAGTCTCCTTGGTTGATGG

[0211] A recombinant plasmid was obtained by cloning the upstream fragment and downstream fragment of the region of homologous recombination occurring on the chromosomes amplified by the above PCR, and the chromosomal transformation vector pDC24 cut with smaI restriction enzyme, using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix), and named pDC24△icd (13869).

[0213] Example 2-2. Streptococcus mutans Production of tryptophan-producing Corynebacterium microorganisms by introducing derived NAD-dependent isocitrate dehydrogenase

[0215] Selected in Example 1 Streptococcus mutansThe derived NAD-dependent isocitrate dehydrogenase has the amino acid sequence of SEQ ID NO. 1. Information regarding the gene encoding the said NAD-dependent isocitrate dehydrogenase and surrounding nucleotide sequences was obtained from the National Institutes of Health (NIH) GenBank, and based on this, using the gene synthesis service of Bionics Co., Ltd. Streptococcus mutans Codon optimized from origin icd A gene was synthesized (Sequence No. 2). Using the synthesized gene as a template to insert it into the genomic DNA of Corynebacterium glutamicum,

[0216] PCR was performed using the primer pair of SEQ ID NO. 11 and SEQ ID NO. 12 to amplify. The polymerase was Solg TM Pfu-X DNA polymerase was used, and the PCR amplification conditions were performed by denaturation at 95°C for 2 minutes, followed by denaturation at 95°C for 20 seconds, annealing at 60°C for 40 seconds, and polymerization at 72°C for 1 minute, repeated 27 times, followed by polymerization at 72°C for 5 minutes. The primer sequences used are shown in Table 3 below.

[0217] Sequence number Sequence(5'→ 3') Sequence number 11 CCCATCAACCAAGGAGACTCATGGCAGAAAAAGTAAGTTTTG Sequence No. 12 AGCGCTTTTGTGAAGAGACTCTATAAATAAGTCAATAGAACTTC

[0218] Next, amplified from the above Streptococcus mutans A recombinant plasmid was obtained by cloning the derived NAD-dependent isocitrate dehydrogenase gene fragment and the chromosomal transformation vector pDC24△icd (13869) constructed in Example 2-1, which was cleaved with SmaI restriction enzyme, using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix), and this was named pDC24△icd(13869)-icd(S.mu). Cloning was performed by mixing the Gibson assembly reagent, the gene fragment, and the cleaved vector in calculated moles and incubating at 50°C for 1 hour.

[0219] After transforming the above-described pDC24△icd(13869)-icd(S.mu) vector into the tryptophan-producing strain CM05-9157 (US Patent Published, US 2023-0134555 A1) by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), the intrinsic on the chromosome was subjected to a secondary crossing-over process. icd The coding sequence of the gene Streptococcus mutans origin icd A strain was obtained that was substituted with the coding sequence of the gene. The strain was identified by PCR and genome sequencing using primers of SEQ ID NO. 13 and SEQ ID NO. 14, which are capable of amplifying the external regions of the upstream and downstream regions of the homologous recombination site of the gene substituted location, respectively. The primer sequences used are shown in Table 4 below.

[0220] Sequence number Sequence(5'→ 3') Sequence number 13 CATTCGTCGATCTCTAGT Sequence No. 14 CAATTCCTTGTCGGTGTC

[0221] The strain obtained by the above method was named CM05-9157ⅿicd::icd(S.mu).

[0223] Example 2-3. Streptococcus sp. 'caviae' Production of tryptophan-producing Corynebacterium microorganisms by introducing derived NAD-dependent isocitrate dehydrogenase

[0225] Selected in Example 1 Streptococcus sp. 'caviae' The derived NAD-dependent isocitrate dehydrogenase has the amino acid sequence of SEQ ID NO. 3. Information regarding the relevant gene and surrounding nucleotide sequences was obtained from the National Institutes of Health (NIH) GenBank, and based on this, using the gene synthesis service of Bionics Co., Ltd. Streptococcus sp. 'caviae' A codon-optimized icd gene derived from the source was synthesized (SEQ No. 4). To insert this into the genomic DNA of Corynebacterium glutamicum, PCR was performed using the synthesized gene as a template and the primer pair of SEQ No. 15 and SEQ No. 16 in the same manner as in Example 2-2. The primer sequences used are shown in Table 5 below.

[0226] Sequence number Sequence (5'→ 3') Sequence number 15 CCCATCAACCAAGGAGACTCatggcggaaaaaaattcgctttg Sequence number 16 AGCGCTTTTTGTGAAGAGACTcaggttatccgccagcactttc

[0227] Next, amplified from the above Streptococcus sp. 'caviae' A recombinant plasmid was obtained by cloning the derived NAD-dependent isocitrate dehydrogenase gene fragment and the chromosomal transformation vector pDC24△icd (13869) constructed in Example 2-1, which was cleaved with SmaI restriction enzyme, using the Gibson assembly method, and this was named pDC24△icd (13869)-icd (S.ca). Cloning was performed by mixing the Gibson assembly reagent, the gene fragment, and the cleaved vector in calculated moles and then standing at 50°C for 1 hour.

[0228] After transforming the above-described pDC24△icd(13869)-icd(S.ca) vector into the tryptophan-producing strain CM05-9157 via electroporation, and undergoing a secondary crossing-in process, the intrinsic on the chromosome icd The coding sequence of the gene Streptococcus sp. 'caviae' origin icd A strain was obtained that was substituted with the coding sequence of the gene. The strain was identified through PCR and genome sequencing using primers of SEQ ID NO. 13 and SEQ ID NO. 14 of Table 4, which are capable of amplifying the external regions of the homologous recombination upstream and downstream regions of the gene substituted location, respectively.

[0229] The strain obtained by the above method was named CM05-9157ⅿicd::icd(S.ca).

[0231] Examples 2-4. Streptococcus varani Production of tryptophan-producing Corynebacterium microorganisms by introducing derived NAD-dependent isocitrate dehydrogenase

[0233] Selected in Example 1 Streptococcus varani The derived NAD-dependent isocitrate dehydrogenase has the amino acid sequence of SEQ ID NO. 5. Information regarding the relevant gene and surrounding nucleotide sequences was obtained from the National Institutes of Health (NIH) GenBank, and based on this, using the gene synthesis service of Bionics Co., Ltd. Streptococcus varaniA codon-optimized icd gene derived from the source was synthesized (SEQ No. 6). To insert this into the genomic DNA of Corynebacterium glutamicum, PCR was performed using the synthesized gene as a template and the primer pair of SEQ No. 17 and SEQ No. 18 in the same manner as in Example 2-2. The primer sequences used are shown in Table 6 below.

[0234] Sequence number Sequence (5'→ 3') Sequence number 17 CCCATCAACCAAGGAGACTCatggcggaaaaaaattgtgc Sequence No. 18 AGCGCTTTTTGTGAAGAGACTgcgttcgccaatgctatcaatc

[0235] Next, amplified from the above Streptococcus varani A recombinant plasmid was obtained by cloning the derived NAD-dependent isocitrate dehydrogenase gene fragment and the chromosomal transformation vector pDC24△icd (13869) prepared in Example 2-1, which was cut with SmaI restriction enzyme, using the Gibson assembly method, and this was named pDC24△icd (13869)-icd (S.va). Cloning was performed by mixing the Gibson assembly reagent, the gene fragment, and the cut vector in calculated moles and then standing at 50°C for 1 hour.

[0236] After transforming the above-described pDC24△icd(13869)-icd(S.va) vector into the tryptophan-producing strain CM05-9157 via electroporation, and undergoing a secondary crossing-in process, the intrinsic on the chromosome icd The coding sequence of the gene Streptococcus varani origin icd A strain was obtained that was substituted with the coding sequence of the gene. The strain was identified by PCR and genome sequencing using primers of SEQ ID NO. 13 and SEQ ID NO. 14, which can respectively amplify the external regions of the homologous recombination upstream and downstream regions of the gene substituted location.

[0237] The strain obtained by the above method was named CM05-9157ⅿicd::icd(S.va).

[0239] Example 3. Evaluation of L-tryptophan production capacity of tryptophan-producing Corynebacterium microorganisms into which an exogenous NAD-dependent isocitrate dehydrogenase gene was introduced

[0241] To confirm the L-tryptophan production ability of the strains CM05-9157ㅿicd::icd(S.mu), CM05-9157ㅿicd::icd(S.ca), and CM05-9157ㅿicd::icd(S.va) produced in Examples 2-2, 2-3, and 2-4, respectively, and the parent strain CM05-9157, into which no foreign gene was introduced, they were cultured in the following manner.

[0242] Each strain was inoculated into a 250 mL corner-baffle flask containing 25 mL of seed medium and cultured at 30 °C for 20 hours with shaking at 200 rpm. Then, 1 mL of seed culture was inoculated into a 250 mL corner-baffle flask containing 25 mL of production medium and cultured at 30 °C for 24 hours with shaking at 200 rpm. After the culture was completed, the production of L-tryptophan was measured by HPLC. The composition of the seed medium and production medium is as follows, and the concentration of L-tryptophan in the culture medium for each strain tested is shown in Table 7 below.

[0244] <Seed medium (pH 7.0)>

[0245] Glucose 20g, Peptone 10g, Yeast extract 5g, Urea 1.5g, KH2PO44g, K2HPO48g, MgSO47H2O 0.5g, Biotin 100µg, Thiamine HCl 1000µg, Calcium-Pantothenic Acid 2000µg, Nicotinamide 2000µg (based on 1 liter of distilled water)

[0247] Production Medium (pH 7.0)

[0248] Glucose 30g, (NH4)2SO4 15g, MgSO4 7H2O 1.2g, KH2PO4 1g, yeast extract 5g, biotin 900µg, thiamine hydrochloride 4500µg, calcium-pantothenic acid 4500µg, CaCO3 30g (based on 1 liter of distilled water).

[0250] Tryptophan production (g / L) Tryptophan yield (%) CM05-9157 1.83 6.27 CM05-9157ㅿicd::icd(S.mu) 2.32 7.94 CM05-9157ㅿicd::icd(S.ca) 1.77 6.05 CM05-9157ㅿicd::icd(S.va) 1.82 6.21

[0251] As a result, as shown in Table 7 above, Streptococcus mutans The CM05-9157ⅿicd::icd(S.mu) strain into which the derived gene was introduced produced a final 2.32 g / L of L-tryptophan in flask culture. This confirmed that the fermentation yield was improved by approximately 26.6% compared to the parent strain CM05-9157, which produced 1.83 g / L.

[0252] the other side, Streptococcus sp. 'caviae' Origin and Streptococcus varani The CM05-9157ⅿicd::icd(S.ca) and CM05-9157ⅿicd::icd(S.va) strains into which the derived gene was introduced produced 1.77 g / L and 1.82 g / L of L-tryptophan, respectively, and it was confirmed that the yield decreased by 3.4% and 0.9%, respectively, compared to the parent strain CM05-9157.

[0253] These results indicate that among foreign NAD-dependent isocitrate dehydrogenases in microorganisms of the genus Corytebacterium Streptococcus mutans This means that only when the NAD-dependent isocitrate dehydrogenase gene derived from the source is introduced can L-tryptophan production capacity be specifically and significantly increased.

[0255] Example 4. Production of an L-histidine-producing microorganism by introducing an exogenous NAD-dependent isocitrate dehydrogenase

[0257] Example 4-1. Preparation of histidine-producing Corynebacterium microorganisms

[0259] To evaluate L-histidine production capacity, a strain CA14-0114 was constructed using wild-type Corynebacterium glutamicum ATCC13032 as the starting microorganism, with enhanced genes for the histidine biosynthetic pathway.

[0260] Specifically, to resolve the feedback inhibition of HisG protein, the first enzyme of the L-histidine biosynthetic pathway, a protein (SEQ No. 19) in which the 233rd and 235th amino acids from the N-terminus of HisG are simultaneously substituted with histidine from glycine and glutamine from threonine, respectively, is expressed (ACS Synth. Biol., 2014, 3 (1), pp 21-29). hisGThe gene codons were modified. Also, hisG Existing within an operon such as hisE To enhance gene activity, the start codon was substituted from GTG to ATG. Additionally, to enhance the L-histidine biosynthetic pathway, the biosynthetic gene hisN , hisH , hisD , hisA and hisB The promoter of was replaced with a strong promoter, and hisE(g1a)G(G233H / T235Q) Operon and hisD The pathway was strengthened by introducing additional gene copy numbers.

[0262] Example 4-1-1. Production of a histidine-producing microorganism with resolved feedback limitation

[0264] To construct a histidine-producing strain with resolved feedback limitation, PCR was performed using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template and the primer pairs of SEQ ID NOs. 20 and 21 and SEQ ID NOs. 22 and 23. PCR was then performed using the two amplified DNA fragments as templates and the primers of SEQ ID NOs. 20 and 23 in the same manner as in Example 2, ' hisE(g1a)G(G233H / T235Q) Gene fragments were obtained. In addition, PCR was performed using primers of SEQ ID NOs. 71 and 72 with ATCC13032 chromosomal DNA as a template. hisE The upstream region of the gene was obtained.

[0265] Sequence number Sequence (5'→3') Sequence number 20 gaggagatcaaaacaGTGAAGACATTTGAC Sequence number 21 ACACCAAGCTTGATGGATACCTCTACTGCA Sequence number 22 CAGTAGAGGTATCCATCAAGCTTGGTGTC Sequence number 23 ACTCTAGAGGATCCCCCTAGATGCGGGC Sequence number 71 TCGAGCTCGGGTACCCACCGAACTCCTGACAGAGT Sequence number 72 acatgaagcgccTCGGTACATTCTTCCACA Sequence number 25 AAGAATGTACCGAggcgcttcatgtcaaca Sequence number 26 CAAAATGTCTTCATtgttttgatctcctcca Sequence number 27 ACTGCCTGGTACCACCAGA Sequence number 28 CTGCCTCTCACAAGTTGAAG

[0266] In order to replace with a strong promoter, PCR was performed in the same manner as in Example 1 using primers of SEQ ID NO. 25 and SEQ ID NO. 26 with the synthetic promoter Pspl13 promoter (SEQ ID NO. 24, Korean Patent No. 10-1783170) as a template.

[0267] After treating the pDC24 vector with the restriction enzyme Sma1, the amplified hisEUpstream DNA fragment of the gene, Pspl13 promoter and ' hisE(g1a)G(G233H / T235Q) A recombinant plasmid was obtained by cloning the gene fragment using the Gibson assembly method and was named pDC24△Pn_hisEG:: Pspl13_hisE(g1a)G(G233H / T235Q). Gibson cloning was performed in the same manner as in Example 1.

[0268] After transforming Corynebacterium glutamicum ATCC13032 with the constructed pDC24△Pn_hisEG:: Pspl13_hisE(g1a)G(G233H / T235Q) vector via electroporation and undergoing a secondary crossing process, the existing hisG By introducing a mutation into the gene, the feedback limitation is resolved, and hisE By substituting the start codon of the gene hisE A strain with enhanced activity was obtained. The genetic modification was confirmed through PCR using primers of SEQ ID NO. 27 and SEQ ID NO. 28 and genome sequencing. The strain obtained in this way was named CJ-HIS1.

[0270] Example 4-1-2. Production of a histidine-producing microorganism with an enhanced biosynthetic pathway through promoter replacement

[0271] Next, the biosynthetic gene hisN, hisH, hisD, hisA and hisB To enhance the activity of each gene, a plasmid was constructed to replace the wild-type promoter with a strong promoter.

[0272] Specifically, PCR was performed in the same manner as in Example 2 using primers of SEQ ID NOs. 29 and 30, SEQ ID NOs. 31 and 32, SEQ ID NOs. 33 and 34, SEQ ID NOs. 35 and 36, and SEQ ID NOs. 37 and 38 with Corynebacterium glutamicum ATCC13032 chromosomal DNA as a template, and hisN , hisH , hisD , hisA and hisB The upstream region of the gene was obtained.

[0273] In addition, using Corynebacterium glutamicum ATCC13032 chromosomal DNA as a template, primers of SEQ ID NOs 73 and 74, SEQ ID NOs 75 and 76, SEQ ID NOs 77 and 78, SEQ ID NOs 79 and 80, and SEQ ID NOs 81 and 82 were used, the above hisN , hisH , hisD , hisA and hisB The downstream regions of the genes were each obtained.

[0274] Sequence number Sequence (5'→3') Sequence number 29 TCGAGCTCGGGTACCCATTGGTGCTCGGCGC Sequence number 30 tgggatgtttctGTGTTGTTAGTCTAGTG Sequence number 31 TCGAGCTCGGTACCCAACCAAGTTTAGATGCGCC Sequence No. 32 gctgggatgtttctGCCGATAGTTTATGTCA Sequence number 33 TCGAGCTCGGTACCCGGTGACAGCTCGCGCCGCAT Sequence No. 34 gcgctgggatgtttctGGCGAAAAGTTCTCCC Sequence number 35 TCGAGCTCGGGTACCCTTGATGCCTGCATGAAGG Sequence number 36 tgacatgaagcgccGAATATTGATCCTATCT Sequence number 37 TTCGAGCTCGGTACCCACCTTCAGCAACCACTC Sequence number 38 tgacatgaagcgccGAAAAATTCTTCTCT Sequence number 73 aaaggaaacactcATGAGCAAATATGCAGACG Sequence number 74 CTAGAGGATCCCCCAGCCGGAGAGGGA Sequence number 75 aaaaggaacactcATGACCAAAACTGTCGC Sequence number 76 CTAGAGGATCCCCACCTCTGGAGGGCGTGGTC Sequence number 77 cgaaaggaaacactcATGTTGAATGTCACTGACC Sequence number 78 CTAGAGGATCCCCCCGTGCTCAGCCTGAGGAG Sequence number 79 ggagatcaaaacaATGACCTTCACTATTCTTCC Sequence number 80 CTAGAGGATCCCACGAAACGTGCACAACCTT Sequence number 81 gagatcaaaacaATGACTGTCGCACCA Sequence number 82 CTAGAGGATCCCCGGGTCGCGGCCGTAGTGGC

[0275] hisN , hisH and hisD In order to replace the intrinsic promoter of the gene with the strong promoter Pcj7 promoter (Sequence No. 39, Patent Registration No. 10-0620092), PCR was performed in the same manner as in Example 2 using primers of Sequence No. 40 and 41, Sequence No. 42 and 43, and Sequence No. 83 and 84, using Corynebacterium ammoniagenes genomic DNA as a template.

[0276] Sequence number Sequence (5'→3') Sequence number 40 ACTAGACTAACAAACACagaaacatcccagcgc Sequence number 41 TCTGCATATTTGCTCATgagtgtttccttt Sequence No. 42 ACATAAACTATCGGCagaaacatcccagcgcta Sequence No. 43 GACAGTTTTGGTCATgagtgtttcctttcg Sequence number 83 GAGAACTTTTCGCCagaaacatcccagcgct Sequence number 84 AGTGACATTCAACATgagtgtttcctttcg

[0277] also, hisA and hisB In order to replace the intrinsic promoter of the gene with the strong promoter Pspl13 promoter (Sequence No. 24, Korean Patent No. 10-1783170), PCR was performed in the same manner as in Example 2 using primers of Sequence No. 44 and Sequence No. 45, and Sequence No. 46 and Sequence No. 85 with the Pspl13 promoter as a template.

[0278] Sequence number Sequence (5'→3') Sequence No. 44 AGGATCAATATTCggcgcttcatgtcaac Sequence number 45 GAATAGTGAAGGTCATtgttttgatctcct Sequence number 46 GAGAAGAATTTTTCggcgcttcatgtcaa Sequence number 85 TGGTGCGACAGTCATtgttttgatctcct

[0279] After treating the pDC24 vector with the restriction enzyme Sma1, the amplified hisN , hisH and hisD Upstream DNA fragment of the gene, Pcj7 promoter fragment, hisN , hisH and hisD Recombinant plasmids were obtained by cloning the downstream DNA fragments of the genes using the Gibson assembly method, and were named pDC24△Pn::Pcj7_hisN, pDC24△Pn::Pcj7_hisH, and pDC24△Pn::Pcj7_hisD. In addition, after treating the pDC24 vector with the restriction enzyme Sma1, the amplified hisA and hisB Upstream DNA fragment of the gene, Pspl13 promoter fragment, hisA and hisB Recombinant plasmids were obtained by cloning the downstream DNA fragments of the genes using the Gibson assembly method, and were named pDC24△Pn::Pspl13_hisA and pDC24△Pn::Pspl13_hisB. Gibson cloning was performed in the same manner as in Example 2.

[0282] After transforming the constructed pDC24△Pn::Pcj7_hisN vector into CJ-HIS1 constructed in Example 4-1-1 by electroporation and performing a secondary crossover process, a strain with the corresponding gene was obtained by replacing the promoter of the existing hisN gene. The genetic modification was confirmed through PCR using primers of SEQ ID NO. 47 and SEQ ID NO. 48 and genome sequencing. The strain obtained in this way was named CJ-HIS2.

[0284] Sequentially, the constructed pDC24△Pn::Pcj7_hisH vector was transformed into the above-mentioned CJ-HIS2 by electroporation, and a secondary crossover process was performed to replace the promoter of the existing hisH gene, thereby obtaining a strain with the corresponding gene strengthened. The genetic modification was confirmed through PCR using primers of SEQ ID NO. 49 and SEQ ID NO. 50 and genome sequencing. The strain obtained in this way was named CJ-HIS3.

[0286] Sequentially, the constructed pDC24△Pn::Pcj7_hisD vector was transformed into the above-mentioned CJ-HIS3 by electroporation, and a secondary crossover process was performed to replace the promoter of the existing hisD gene, thereby obtaining a strain with the corresponding gene strengthened. The genetic modification was confirmed through PCR using primers of SEQ ID NO. 51 and SEQ ID NO. 52 and genome sequencing. The strain obtained in this way was named CJ-HIS4.

[0288] Sequentially, the constructed pDC24△Pn::Pspl13_hisA vector was transformed into the above-mentioned CJ-HIS4 by electroporation, and a secondary crossover process was performed to replace the promoter of the existing hisA gene, thereby obtaining a strain with the corresponding gene strengthened. The genetic modification was confirmed through PCR using primers of SEQ ID NO. 53 and SEQ ID NO. 54 and genome sequencing. The strain obtained in this way was named CJ-HIS5.

[0290] Sequentially, the constructed pDC24△Pn::Pspl13_hisB vector was transformed into the above-mentioned CJ-HIS5 by electroporation, and a secondary crossover process was performed to replace the promoter of the existing hisB gene, thereby obtaining a strain with the corresponding gene strengthened. The genetic modification was confirmed through PCR using primers of SEQ ID NO. 55 and SEQ ID NO. 56 and genome sequencing. The strain obtained in this way was named CJ-HIS6.

[0291] Sequence number Sequence (5'→3') 47 GAGCATGCATCAAAG 48 AGAAATTTGATCCTTATAA 49 TTGAGAGATGCTTATCG 50 CACTTCAGTGCGGATTCCAA 51 AGCGGGTTTAATTCAGG 52 GTGGGTAAGGGTTTTCGT 53 CACGAAAATGATCGTTTTG 54 TATGGGATTCGATGGCCA 55 TGTGGGAATCGCTGGGCAC 56 CGGTCGCCCGCATCTG

[0293] Example 4-1-3. Production of a histidine-producing microorganism with an enhanced biosynthetic pathway through gene insertion

[0295] Next, using NCgl1021, known as the transposon-coding gene in Corynebacterium glutamicum, as the insertion site hisE(g1a)G(G233H / T235Q) Operon and hisDGenes were additionally inserted. Specifically, to construct NCgl1021 deletion and target gene insertion vectors, PCR was performed in the same manner as in Example 2 using primer pairs of SEQ ID NO. 57 and SEQ ID NO. 58 and SEQ ID NO. 59 and SEQ ID NO. 60 with the chromosome of ATCC13032 as a template to amplify the left homologous cancer region of NCgl1021 and the right homologous cancer region of NCgl1021.

[0296] Sequence number Sequence (5'→3') Sequence number 57 TTCGAGCTCGGTACCCATGAAGTCTACCGGC Sequence number 58 gacatgaagcgccGACATCTAATAACCGGG Sequence number 59 CCGACGAGGCCTAAGAACTCATTCCTTCTGCT Sequence number 60 CTCTAGAGGATCCCCTTAGAGTGCATTGATC

[0297] PCR was performed in the same manner as in Example 2 using the vector pDC24△Pn ::Pspl13_hisE(g1a)G(G233H / T235Q) constructed in Example 4-1-1 as a template and primers of SEQ ID NO. 61 and SEQ ID NO. 62, and ' Pspl13_hisE(g1a)G(G233H / T235Q) Gene fragments were obtained.

[0298] In addition, PCR was performed in the same manner as in Example 2 using primers of SEQ ID NO. 63 and SEQ ID NO. 64 with the vector pDC24△Pn ::Pcj7_hisD constructed in Example 4-1-2 as a template, and the 'Pcj7_hisD' gene fragment was obtained.

[0300] Sequence number Sequence (5'→3') Sequence number 61 CCGGTTATTAGATGTCggcgcttcatgtca Sequence number 62 ggatgtttctCTAGATGCGGGCGAT Sequence number 63 GCCCGCATCTAGagaaacatcccagcgct Sequence number 64 AGAAGGAATGAGTTCTTAGGCCTCGTCGG

[0301] After treating the pDC24 vector with the restriction enzyme Sma1, the left homologous cancer site, the right homologous cancer site, of the amplified NCgl1021, ' Pspl13_hisE(g1a)G(G233H / T235Q) ' and ' Pcj7_hisDA recombinant plasmid was obtained by cloning a gene fragment using the Gibson assembly method and named 'pDC24△NCgl1021::Pspl13_hisE(g1a)G(G233H / T235Q)-Pcj7_hisD'. Gibson cloning was performed in the same manner as in Example 2. The constructed 'pDC24-Pspl13_hisE(g1a)G(G233H / T235Q)-Pcj7_hisD' vector was transformed into CJ-HIS6 constructed in Example 4-1-2 by electroporation, and a secondary crossover process was performed to obtain a strain with an enhanced histidine biosynthetic pathway through the additional insertion of genes. The genetic modification was confirmed through PCR using primers of SEQ ID NO. 65 and SEQ ID NO. 66 and genome sequencing. The strain obtained in this way was named CA10-0114.

[0302] Sequence number Sequence (5'→3') Sequence number 65 CTTTCAGCTTTCCCTCCCG Sequence number 66 GCTGTACTTTTAGTACA

[0304] Example 4-2. Construction of a plasmid for gene substitution

[0306] In Example 3, the tryptophan production capacity is excellent Streptococcus mutans A plasmid was constructed to introduce NAD-dependent isocitrate dehydrogenase derived from the source into the chromosome of a histidine-producing Corynebacterium glutamicum strain. In this case, using plasmid pDC24 as the parent vector, the intrinsic icd Foreign coding sequence of a gene under natural promoter icd A plasmid capable of being substituted with the coding sequence of a gene was constructed.

[0307] Specifically, using Corynebacterium glutamicum ATCC13032 chromosomal DNA as a template, the upstream region where chromosomal homologous recombination occurs was amplified using the primer pair of SEQ ID NO. 67 and SEQ ID NO. 68, and the downstream region was amplified using the primer pair of SEQ ID NO. 69 and SEQ ID NO. 70; subsequently, PCR was performed to obtain each gene fragment. The PCR was performed by SolgTM The amplification was performed using Pfu-X DNA polymerase (SolGent co.) under the following conditions: denaturation at 95°C for 4 minutes, followed by 27 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 50 seconds, followed by polymerization at 72°C for 5 minutes. The primer sequences used are shown in Table 16 below.

[0308] Sequence number Sequence (5'→ 3') Sequence number 67 GAATTCGAGCTCGGTACCCCTCATTTTTCCCAACCCC Sequence number 68 ttcttcaaaacttactttttctgccatGAGTCTCCTTGGTTGATG Sequence number 69 ttctattgacttatttatagAGTCTCTTCACAAAAAGCGC Sequence number 70 CCTGCAGGTCGACTCTAGAGGATCCCCTTGAGTTAGTCCACGCCC

[0309] A recombinant plasmid was obtained by cloning the upstream fragment and downstream fragment of the region of homologous recombination occurring on the chromosomes amplified by the PCR above, and the chromosomal transformation vector pDC24 cut with SmaI restriction enzyme, using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix), and named pDC24△icd (13032).

[0311] Example 4-3. Streptococcus mutans Production of histidine-producing Corynebacterium microorganisms by introducing derived NAD-dependent isocitrate dehydrogenase

[0313] To the Corynebacterium glutamicum strain that produces histidine, the one selected in Example 1 Streptococcus mutans To introduce the gene encoding the derived NAD-dependent isocitrate dehydrogenase (SEQ No. 1), as described in Example 2-2 S. mutans of icd PCR was performed using the gene (SEQ No. 2) as a template and the primers SEQ No. 11 and SEQ No. 12 of Table 3 above. The polymerase was Solg TM Pfu-X DNA polymerase was used, and the PCR amplification conditions were performed by denaturing at 95°C for 2 minutes, followed by denaturation at 95°C for 20 seconds, annealing at 60°C for 40 seconds, and polymerization at 72°C for 1 minute, repeated 27 times, followed by polymerization at 72°C for 5 minutes.

[0314] Next, amplified from the above Streptococcus mutans A recombinant plasmid was obtained by cloning the derived NAD-dependent isocitrate dehydrogenase gene fragment and the chromosomal transformation vector pDC24△icd(13032) constructed in Example 2-1, which was cleaved with SmaI restriction enzyme, using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix), and this was named pDC24△icd(13032)-icd(S.mu). Cloning was performed by mixing the Gibson assembly reagent, the gene fragment, and the cleaved vector in calculated moles and incubating at 50°C for 1 hour.

[0315] After transforming the histidine-producing strain CA14-0114 prepared in Example 4-1 with the constructed pDC24△icd(13032)-icd(S.mu) vector by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and undergoing a secondary crossing-in process, the intrinsic on the chromosome icd The gene's coding sequence is derived from Streptococcus mutans icd A strain was obtained that was substituted with the coding sequence of the gene. The strain was identified through PCR and genome sequencing using primers of SEQ ID NO. 13 and SEQ ID NO. 14 of Table 4, which are capable of amplifying the external regions of the homologous recombination upstream and downstream regions of the gene substituted location, respectively.

[0316] The strain obtained by the above method was named CA14-0114ⅿicd::icd(S.mu).

[0318] Example 5. Evaluation of L-histidine production capacity of Corynebacterium microorganisms into which an exogenous NAD-dependent isocitrate dehydrogenase gene was introduced

[0320] To confirm the L-histidine production ability of the CA14-0114ⅿicd::icd (S.mu) strain prepared in Example 4 above and the parent strain CA14-0114 without introduced foreign genes, they were cultured in the following manner.

[0321] Each strain was inoculated into a 250 mL corner-baffle flask containing 25 mL of seed medium and cultured at 30 °C for 48 hours with shaking at 200 rpm. Then, 1 mL of seed culture was inoculated into a 250 mL corner-baffle flask containing 25 mL of production medium and cultured at 30 °C for 24 hours with shaking at 200 rpm. After the culture was completed, the production of L-histidine was measured by HPLC. The composition of the seed medium and production medium is as follows, and the concentration of L-histidine in the culture medium for each strain tested is shown in Table 17 below.

[0322] <Seed medium (pH 7.0)>

[0323] Glucose 5%, Bactopeptone 1%, Sodium Chloride 0.25%, Yeast Extract 1%, Urea 0.4% (based on 1 liter of distilled water)

[0325] Production Medium (pH 7.0)

[0326] Raw sugar 6%, ammonium sulfate 2%, dipotassium phosphate 0.1%, magnesium sulfate heptahydrate 0.05%, CSL (corn steep extract) 2.0%, biotin 200 µg / L, calcium carbonate 30 g / L (per 1 liter of distilled water)

[0328] Histidine production (g / L) Histidine production (%) CA14-0114 4.6 100 CA14-0114ㅿicd::icd(S.mu) 6.2 134.8

[0330] As a result, as shown in Table 17 above, Streptococcus mutans The CA14-0114ⅿicd::icd(S.mu) strain, into which the derived NAD-dependent isocitrate dehydrogenase gene was introduced, produced a final L-histidine of 6.2 g / L in flask culture, which was confirmed to be an improvement of approximately 34.8% in fermentation yield compared to the parent strain CA14-0114, which produced 4.6 g / L.

[0331] These results are for microorganisms of the genus Corytebacterium Streptococcus mutans This means that the introduction of the derived NAD-dependent isocitrate dehydrogenase gene has the effect of increasing not only the production capacity of L-tryptophan but also the production capacity of L-histidine, as confirmed in Example 3.

[0333] From the foregoing description, those skilled in the art to which this application pertains will understand that this application may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of this application should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.

Claims

Claim 1 Streptococcus mutans ( Streptococcus mutans A microorganism of Corynebacterium glutamicum having L-amino acid production capability into which a NAD-dependent isocitrate dehydrogenase protein derived from ) or a polynucleotide encoding the same has been introduced, wherein the L-amino acid is one or more selected from the group consisting of L-tryptophan and L-histidine. Claim 2 delete Claim 3 The microorganism Corynebacterium glutamicum according to claim 1, wherein the NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans comprises the amino acid sequence of SEQ ID NO.

1. Claim 4 In claim 1, the NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans is of Streptococcus mutans icd The microorganism Corynebacterium glutamicum, which is encoded by a gene. Claim 5 The microorganism Corynebacterium glutamicum according to claim 1, wherein the polynucleotide encoding the NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans comprises the nucleotide sequence of SEQ ID NO.

2. Claim 6 delete Claim 7 A Corynebacterium glutamicum microorganism according to any one of claims 1, 3 to 5, wherein the Corynebacterium glutamicum microorganism has increased L-amino acid production capacity compared to a non-modified microorganism. Claim 8 A method for producing L-amino acids, comprising the step of culturing a Corynebacterium glutamicum microorganism having the ability to produce L-amino acids in a medium into which a NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans or a polynucleotide encoding the same has been introduced, wherein the L-amino acid is one or more selected from the group consisting of L-tryptophan and L-histidine. Claim 9 delete Claim 10 A method for producing L-amino acids according to claim 8, further comprising the step of recovering L-amino acids from the cultured microorganism, the culture of the microorganism, the fermented product of the microorganism, or the culture medium. Claim 11 A composition for producing L-amino acids comprising a Corynebacterium glutamicum microorganism having the ability to produce L-amino acids into which a NAD-dependent isocitrate dehydrogenase protein derived from Streptococcus mutans or a polynucleotide encoding the same has been introduced, a culture of said microorganism, a fermented product of said microorganism, or a combination of two or more of these, wherein the L-amino acid is one or more selected from the group consisting of L-tryptophan and L-histidine. Claim 12 delete

Images