SNP marker for identification of Korean native pig breeds, composition, and identification method using the same

Abstract

The present technology relates to an SNP marker for identifying Korean native pig breeds, a composition, and a method for identification using the same. Three SNPs were discovered within the SYTL2 (Synaptotagmin-like 2) gene, which is uniquely present only in Korean native pigs when compared to the genomes of other existing breeds. By using the above SNPs, native pigs (Gyeongbuk pigs) can be accurately identified among foreign breeds and domestic breeds, making them useful for related industries.

Description

Technology Field

[0001] The present technology relates to an SNP marker for identifying Korean native pig breeds, a composition, and a method for identification using the same. Background Technology

[0002] Pigs, having been domesticated approximately 9,000 years ago, are currently the most consumed animal resource and are known to be highly preferred livestock in the domestic food consumption market. Various breeds of pigs are raised in different countries according to regional characteristics and preferences, and it is estimated that about 100 breeds are raised worldwide. Currently, about 30 breeds are raised in Korea, with Landrace, Yorkshire, Duroc, and Berkshire breeds being primarily raised due to their economical pork production compared to other breeds. Due to their small stature and low productivity, native Korean pigs were improved through indiscriminate crossbreeding with foreign breeds, leading to the emergence of a new breed of black pig.

[0003] Recently, as consumer tastes have become more sophisticated and diversified, consumers are selecting specific pig breeds, and as the differentiated Spanish Iberico pork gains popularity in Korea, many domestic and international research institutions are collecting genetic resources to preserve superior breeds and improve excellent traits in order to create high added value in the pig farming market.

[0004] Pig breeds are generally distinguished based on phenotypes such as coat color and body shape, derived from external characteristics. However, since most native Korean pigs have been crossbred with foreign breeds over a long period, selecting them based on external features has limitations; therefore, research utilizing the genetic characteristics of Korean native pigs is necessary.

[0005] Recognizing the value of preserving and utilizing native livestock as genetic resources, countries around the world have been conducting analytical studies on breed formation, genetic characteristics, genetic diversity, and phylogenetic relationships among different breeds. Research on livestock breed populations has utilized various genetic markers, such as blood proteins, milk proteins, microsatellites, and mitochondrial DNA, and efforts to apply these methods to pig breeds are continuing.

[0006] Currently, research on distinguishing pig breeds is discovering pig breed-specific DNA markers through various DNA analysis techniques such as RAPD (random amplified polymorphic DNA), SSCP (single strand conformation polymorphisms), and AFLP (Amplified fragment length polymorphism), by using PCR to discover SNPs on genes related to pig coat color, back fat thickness, and loin muscle area present in genomic DNA and mitochondrial DNA (mtDNA).

[0007] While conventional SNP analysis using PCR must target genes associated with major traits known in the literature, SNP discovery through next-generation sequencing enables the rapid and accurate identification of native pig-specific DNA markers by detecting SNPs that exist specifically in Korean native pigs within all genes through comparative analysis with a reference genome.

[0008] Accordingly, while researching a method for identifying Korean native pig breeds, the inventors, using a method for discovering SNPs through next-generation sequencing, identified genes that exist specifically in Korean native pigs within all genes by comparing them with the genomes of other breeds. SYTL2(Synaptotagmin-like 2) Three SNPs were discovered within the gene. The present invention was completed by confirming that using the above SNPs, it is possible to accurately distinguish between foreign breeds and domestic breeds, specifically native pigs (Gyeongbuk pigs). The problem to be solved

[0009] The present invention can provide an SNP marker composition for identifying Korean native pig breeds.

[0010] In addition, the present invention can provide a composition for identifying Korean native pig breeds.

[0011] In addition, the present invention can provide a microarray for identifying Korean native pig breeds.

[0012] In addition, the present invention can provide a kit for identifying Korean native pig breeds.

[0013] In addition, the present invention comprises the step of isolating genomic DNA from a pig individual; and

[0014] A method for identifying a Korean native pig breed can be provided, comprising the step of identifying the SNP in the isolated genomic DNA. means of solving the problem

[0015] The present invention SYTL2( Synaptotagmin-like 2) Within the gene,

[0016] A single nucleotide polymorphism (SNP) in which cytosine (C) is mutated to thymine (T) at position Chr9:19646751;

[0017] An SNP in which guanine (G) is mutated to adenine (A) at the Chr9:19646771 location; and

[0018] The present invention provides an SNP marker composition for identifying Korean native pig breeds, comprising one or more selected from a group of SNPs in which thymine (T) is mutated to cytosine (C) at the position Chr9:19646994.

[0019] In addition, the present invention SYTL2( Synaptotagmin-like 2) Within the gene,

[0020] SNP in which cytosine (C) is mutated to thymine (T) at position Chr9:19646751;

[0021] An SNP in which guanine (G) is mutated to adenine (A) at the Chr9:19646771 location; and

[0022] The present invention provides a composition for identifying Korean native pig breeds comprising a preparation capable of detecting one or more SNPs selected from a group of SNPs in which thymine (T) is mutated to cytosine (C) at the Chr9:19646994 position.

[0023] In addition, the present invention provides a microarray for identifying Korean native pig breeds.

[0024] In addition, the present invention provides a kit for identifying Korean native pig breeds.

[0025] In addition, the present invention comprises the step of isolating genomic DNA from a pig individual; and

[0026] A method for identifying a Korean native pig breed is provided, comprising the step of identifying the SNP in the isolated genomic DNA. Effects of the invention

[0027] This technology relates to an SNP marker for identifying Korean native pig breeds, a composition, and a method for identification using the same, wherein the marker is a marker that exists specifically only in Korean native pigs within all genes compared to the genomes of other existing breeds. SYTL2( Synaptotagmin-like 2) Three SNPs were identified within the gene. By using the above SNPs, it is possible to accurately identify native pigs (Gyeongbuk pigs) among foreign breeds and domestic breeds, which can be usefully utilized in related industries. Brief explanation of the drawing

[0028] Figure 1 shows the number of samples held of various pig breeds (Jeju Black Pig (Korea), Landrace (Denmark), and Duroc (USA Yorkshire (UK)) used to discover variants specific to native pigs (Gyeongbuk Pig (Korea)). Figure 2 is a Venn diagram showing specific variations of native pigs (Gyeongbuk pigs) by comparing the genomic data of comparison groups of pig breeds (Jeju Black Pig, Yorkshire, Duroc, Landrace) with the genomic data of native pigs (Gyeongbuk pigs). Figure 3 shows the results of the Principal Component Analysis (PCA) on native pigs (Gyeongbuk pigs) and comparison pig breeds (Jeju Black Pig, Yorkshire, Duroc, Landrace). Figure 4 shows the results of the phylogenetic tree analysis of native pigs (Gyeongbuk pigs) based on detected non-synonymous SNPs. Figure 5 shows the DNA fragment amplified via PCR using the Sanger sequencing method SYTL2 This is a diagram showing the results of identifying some of the three SNPs (Chr9:19646751) in the gene. Figure 6 shows a DNA fragment amplified via PCR using the Sanger sequencing method SYTL2 This is a diagram showing the results of identifying some of the three SNPs (Chr9:19646771) in the gene. Figure 7 shows a DNA fragment amplified via PCR using the Sanger sequencing method SYTL2 This is a diagram showing the results of identifying some of the three SNPs (Chr9:19646994) in the gene. Specific details for implementing the invention

[0029] The terms used in this specification and claims shall not be interpreted as being limited to their dictionary meanings, and in accordance with the principle that the inventor may appropriately define the concepts of the terms to best describe their invention, they shall be interpreted in a meaning and concept consistent with the technical spirit of the invention.

[0030] The exemplary embodiments described in the detailed description, drawings, and claims are not intended to be limiting, and other embodiments may be used, and other modifications are possible without departing from the spirit or scope of the technology disclosed herein.

[0031] Therefore, it should be understood that the embodiments described in this specification and the configurations illustrated in the drawings are merely preferred embodiments of the present invention and do not represent all of the technical ideas of the present invention, and that various equivalents and modifications that can replace them may exist at the time of filing this application.

[0032] Those skilled in the art will readily understand that the components of this disclosure, namely those generally described herein and those depicted in the drawings, can be arranged, configured, combined, and designed in various different configurations, all of which are obviously devised and form part of this disclosure.

[0033] The present invention SYTL2( Synaptotagmin-like 2) Within the gene,

[0034] A single nucleotide polymorphism (SNP) in which cytosine (C) is mutated to thymine (T) at position Chr9:19646751;

[0035] An SNP in which guanine (G) is mutated to adenine (A) at the Chr9:19646771 location; and

[0036] The present invention provides an SNP marker composition for identifying Korean native pig breeds, comprising one or more selected from a group of SNPs in which thymine (T) is mutated to cytosine (C) at the position Chr9:19646994.

[0037] The SNP at the above Chr9:19646751 location is SYTL2 Located at the 4919th position in the gene sequence, the SNP at the above Chr9:19646771 position is SYTL2 Located at the 4939th position in the gene sequence, the SNP at the above Chr9:19646994 position is SYTL2 It may be located at the 4696th position in the gene sequence, but is not limited to this.

[0038] The above pig ( Sus scrofa The genome information of ) can be found in the NCBI database (Accession ID: GCF_000003025.6, GenomeID:84(Susscrofa), AssemblyID:1004191(Sscrofa11.1)).

[0039] The above pig breeds are one or more selected from the group consisting of Gyeongbuk pig, Jeju black pig, Landrace, Duroc, and Yorkshire breeds, and the above Korean native pig breed refers to the Gyeongbuk pig.

[0040] Biological species can generally be identified through morphological and molecular biological methods, and in particular, molecular biological identification or discrimination methods help improve the accuracy of species identification by complementing the limitations of morphological classification.

[0041] The term “nucleotide” refers to a deoxyribonucleotide or ribonucleotide existing in a single-stranded or double-stranded form, and includes analogs of natural nucleotides unless specifically stated otherwise.

[0042] The term “Single Nucleotide Polymorphism (SNP)” refers to a change in a sequence of nucleotides composed of A (Adenine), T (Thymine), G (Guanine), and C (Cytosine) in the genome, where a single nucleotide is altered to a different sequence. Polymorphism refers to the presence of two or more alleles at a single gene locus, and a polymorphic region in which only a single nucleotide differs from individual to individual is called a Single Nucleotide Polymorphism (SNP). A desirable polymorphic marker possesses two or more alleles that exhibit an occurrence frequency of 1% or more in a selected population.

[0043] The term “allele” refers to multiple types of a single gene located at the same locus on homologous chromosomes. The aforementioned alleles may be used to describe polymorphism.

[0044] The term “marker” refers to a nucleotide sequence used as a reference point when identifying genetically unrelated genotypes, and the position of the marker on a gene map can be indicated as a genotype.

[0045] According to one embodiment of the present invention, if any of the bases A, C, G, and T can be included at a specific point within the base sequence of a specific chromosomal position of the Korean native pig described above, it can be described as "n" according to the multiple base description method.

[0046] For example, if the allele is C / G, it can be C or G, so it may be written as “s”. Also, for example, if the allele is T / C, it can be T or C, so it may be written as “y”. Also, for example, if the allele is A / T, it can be A or T, so it may be written as “w”. Also, for example, if the allele is G / A, it can be G or A, so it may be written as “r”. Also, for example, if the allele is A / C, it can be A or C, so it may be written as “m”. Also, for example, if the allele is G / T, it can be G or T, so it may be written as “k”.

[0048] In addition, the present invention SYTL2( Synaptotagmin-like 2) Within the gene,

[0049] SNP in which cytosine (C) is mutated to thymine (T) at position Chr9:19646751;

[0050] An SNP in which guanine (G) is mutated to adenine (A) at the Chr9:19646771 location; and

[0051] The present invention provides a composition for identifying Korean native pig breeds comprising a preparation capable of detecting one or more SNPs selected from a group of SNPs in which thymine (T) is mutated to cytosine (C) at the Chr9:19646994 position.

[0052] The above preparation is a primer set containing the nucleotide sequences of SEQ ID NO. 1 and SEQ ID NO. 2, but is not limited thereto as long as it can identify Korean native pig breeds.

[0053] In the present invention, the term “primer” refers to a short sequence having a short free 3’ hydroxyl group, capable of forming base pairs with a complementary template, and functioning as a starting point for template strand replication. The primer can initiate DNA synthesis in the presence of reagents for polymerization and four different nucleoside triphosphates at an appropriate buffer solution and temperature. When designing the primer, various constraints apply, such as the ratio of A, G, C, and T content in the primer, prevention of primer dimer formation, and prohibition of repeating the same base sequence three or more times. In addition, under single PCR reaction conditions, the amount of template DNA, the concentration of the primer, the concentration of dNTPs, and Mg 2+ Conditions such as the concentration, reaction temperature, and reaction time must be appropriate.

[0054] The primers above may incorporate additional features without changing their basic properties. That is, the nucleic acid sequence may be modified using many means known in the art. Examples of such modifications include methylation, capping, substitution of one or more nucleotides with homologues, and modification of nucleotides to uncharged linkages such as phosphonates, phosphotriesters, phosphoamidates, or carbamates, or charged linkages such as phosphorothioates or phosphorodithioates. In addition, nucleic acids may have one or more additional covalently bonded residues, such as nucleases, toxins, antibodies, signal peptides, proteins such as poly L-lysine, intercalations such as acridine or psoralen, chelating agents such as metals, radioactive metals, iron oxide metals, and alkylating agents.

[0055] Additionally, the primer sequence of the present invention may be modified using a label that can directly or indirectly provide a detectable signal. The primer may include a label that can be detected using spectroscopy, photochemistry, biochemistry, immunochemistry, or chemical means.

[0057] In addition, the present invention provides a microarray for identifying Korean native pig breeds.

[0058] The polynucleotide of the above SNP may be immobilized on a substrate coated with an amino-silane, poly-L-lysine, or aldehyde active group, but is not limited thereto. Methods for immobilizing the polynucleotide on the substrate may include micropipetting using a piezoelectric method or a method using a pin-shaped spotter, but are not limited thereto. Additionally, the substrate may be a silicon wafer, glass, quartz, metal, or plastic, but is not limited thereto.

[0060] In addition, the present invention provides a kit for identifying Korean native pig breeds.

[0061] A breed identification kit according to one embodiment of the present invention can identify Korean native pig breeds by detecting single nucleotide polymorphism (SNP) bases. The breed identification kit may include one or more other components, solutions, devices, etc. suitable for detecting single nucleotide polymorphism bases.

[0062] For example, the variety identification kit of the present invention may be a kit comprising various elements for performing allele-specific polymerase chain reaction (PCR).

[0063] In addition to polynucleotides, primers, probes, etc. specific to the single nucleotide polymorphism (SNP) marker of the present invention, the above various elements may include test tubes, suitable containers, various reagents, reaction buffers, dNTPs (deoxyribonucleotide triphosphate), Taq-polymerase, reverse transcriptase, DNase, RNase inhibitors, DEPC (Diethyl pyrocarbonate) water, sterile water, etc.

[0064] In addition, for example, the variety identification kit of the present invention may additionally include a user guide describing optimal reaction performance conditions. The guide may be a printed document explaining how to use the kit, for example, a method for preparing a buffer solution, or the presented reaction conditions. The guide may include an instruction booklet in the form of a pamphlet or leaflet, a label attached to the kit, or a description of a package containing the kit. Furthermore, the guide may include information disclosed or provided through electronic media such as the Internet.

[0066] In addition, the present invention comprises the step of isolating genomic DNA from a pig individual; and

[0067] A method for identifying a Korean native pig breed is provided, comprising the step of identifying the SNP in the isolated genomic DNA.

[0069] The present invention is to be explained in more detail through the following examples, but the following examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

[0071] Example 1. Selection of native pigs and control group pigs and acquisition of DNA samples

[0072] 1-1. Selection of Native Pigs (Gyeongbuk Pigs)

[0073] Based on the morphological characteristics of Korean native pigs found in academic records, a population of native pigs with morphological characteristics regarding coat color, facial shape (face, snout, ears), body shape, hindquarters, and legs was formed by collecting and selecting black pigs from black pig producing regions nationwide, including Jeju, Namwon, Goseong, and Jirye, starting in 1992. Through crossbreeding over five generations, pedigrees or offspring with different coat colors or those deviating from the characteristics of native pigs were eliminated, thereby constructing a population of native pigs possessing the morphological characteristics of Korean native pigs.

[0075] 1-2. Securing DNA Samples from Native Pigs and Control Group Pigs

[0076] As shown in Figure 1, blood was collected from 10 Gyeongbuk pigs, 4 Jeju black pigs, 14 Landrace pigs, 6 Duroc pigs, and 15 Yorkshire pigs, and DNA was extracted from each. For DNA extraction, blood coagulated at room temperature was vortexed to loosen it, then red blood cells and plasma were separated using a centrifuge, and DNA was extracted from the plasma. The DNA samples for each breed were assigned an ID and stored frozen at -20°C until immediately before use.

[0078] Example 2. Quantitative and qualitative analysis of DNA samples

[0079] For qualitative analysis, absorbance was measured at wavelengths of 260 nm, 280 nm, and 230 nm. The ratios of each wavelength (260 / 280 ratio, 260 / 230 ratio) were determined and based on the electrophoresis pattern results. Absorbance measurements were performed using a Nano-spectrophotometer (Colibri) in accordance with the manufacturer's guidelines. The 260 nm wavelength is the primary absorption wavelength for DNA, while the 280 nm wavelength is the primary absorption wavelength for proteins. The 260 / 280 ratio confirms DNA purity, and a ratio between 1.8 and 2.0 is generally suitable. The 260 nm wavelength is also the absorption wavelength for RNA. The 260 / 230 ratio confirms RNA content, and a ratio of 2.0 or higher is generally suitable.

[0080] Electrophoresis was performed by loading 100 ng of the sample and a 1 Kb marker onto a 1% agarose gel and using a DNA gel imaging system (Bio-rad) to verify images and conduct qualitative analysis. This allows for the verification of the DNA sample size and degree of degradation, as well as the comparison of DNA sample sizes using the 1 Kb marker. For quantitative analysis of the sample, the fluorescence concentration of double-strand DNA was measured using the Quant-iT BR assay kit (Invitrogen). This method specifically stains double-strand DNA using a fluorescent dye and calculates the DNA content by measuring the fluorescence concentration.

[0082] Example 3. Genome comparison, PCA (Principal Component Analysis), and phylogenetic analysis of native pigs (Gyeongbuk pigs) and control group pig breeds

[0083] 3-1. Genome Comparison of Native Pig (Gyeongbuk Pig) and 4 Control Group Pig Breeds

[0084] Even within the same species, genes are not perfectly shared, and there are genes that exist only in each breed or in both. Therefore, genomic data for native pigs (Gyeongbuk pigs) and four comparison pig breeds (Jeju black pigs, Yorkshire, Duroc, and Landrace) were compared to analyze native pig-specific variations.

[0085] As a result, as shown in Figure 2, it was found that the native pig (Gyeongbuk pig) and the four comparison pig breeds (Jeju Black Pig, Yorkshire, Duroc, and Landrace) share 12 genes (CDS, Coding Sequence), and the native pig (Gyeongbuk pig) possesses 122 additional genes compared to the other four comparison pig breeds. In addition, it was confirmed that the Jeju Black Pig contains 146 additional genes, the Landrace 112, the Duroc 105, and the Yorkshire 78.

[0087] 3-2. PCA Comparison of Native Pig (Gyeongbuk Pig) and 4 Control Group Pig Breeds

[0088] Each breed possesses unique genetic characteristics, which confirms through PCA analysis that the breeds form distinct clusters. The distance between clusters represents the degree of genetic difference; a greater distance indicates greater genetic difference. PCA analysis provides useful information for breed classification and identification, and allows for determining which breed a new individual belongs to by projecting its genetic information onto the PCA results. For PCA analysis of native pigs (Gyeongbuk pigs) and four comparison pig breeds (Jeju Black Pig, Yorkshire, Duroc, and Landrace), the data was standardized so that the mean of each variable was 0 and the variance was 1. The covariance matrix was calculated to identify the correlations between the data. Subsequently, the eigenvectors and eigenvalues ​​of the covariance matrix were calculated. Then, eigenvectors with large eigenvalues ​​were selected to extract principal components, and the data was transformed into a new coordinate system based on these principal components.

[0089] As a result, as shown in Figure 3, the distance between the clusters of the native pig (Gyeongbuk pig) and the four comparison pig breeds is large, which means there is a genetic difference, and it was determined that the native pig (Gyeongbuk pig) is clearly classified.

[0091] Example 4. Library Production and Quality Inspection

[0092] 1µg genomic DNA samples from native pigs (Gyeongbuk pigs) and four control group pig breeds were sheared under various conditions using a Covaris instrument, and the size was verified to be approximately 300-400 bp using a 2100 Bioanalyzer (DNA1000). Libraries were constructed by attaching adapters with specific nucleotide sequences to both ends of the DNA, in accordance with the manufacturer's guidelines. Quality control was performed by verifying the size and concentration of the libraries using a Bioanalyzer.

[0093] Specifically, for DNA fragmentation, 1 microgram (µg) of genomic DNA was cleaved using a Covaris instrument under specific conditions. Through this process, DNA fragments of approximately 300-400 bp were obtained, and the DNA was fragmented using ultrasonic energy via the Covaris instrument. To attach adapters, which are essential for DNA sequencing, adapters with specific nucleotide sequences were attached to both ends of the DNA according to the manufacturer's guidelines to provide binding sites for sequencing primers. To construct a library, which is a collection of DNA fragments prepared for sequencing, the DNA fragments attached to the adapters were collected. For quality control, the size and concentration of the library were verified using the 2100 Bioanalyzer (DNA1000), an instrument that measures DNA size and concentration using a DNA chip. It was confirmed that the library size was approximately 300-400 bp and that the concentration was suitable for sequencing. Libraries that passed the quality control underwent the sequencing process to obtain DNA nucleotide sequence information.

[0095] Example 5. Next-generation sequencing and SNP identification

[0096] Libraries that passed quality inspection were synthesized using the cBot (Illumina) cluster synthesis instrument. Clusters, which refer to surfaces on which DNA fragments for sequencing are immobilized, were synthesized at approximately 750-820K and sequencing was performed using the next-generation sequencing instrument of the HiSeq2500 (Illumina) platform to obtain sequence information of the DNA samples.

[0097] The quality of the generated DNA sequencing data was measured using SICKLE, a program designed to evaluate the quality of DNA data and remove low-quality data. Subsequently, only high-quality DNA data was extracted through a filtering process. To align the filtered DNA data and remove duplicates, the data was mapped to an existing porcine reference genome using BWA alignment, a program designed to align DNA data to a reference genome, thereby obtaining positional information of the DNA data. PCR duplication of identical DNA data occurring during the PCR process was removed using Picard, a program providing various utilities for DNA analysis. To discover single nucleotide polymorphisms (SNPs), candidate variants specific to native pigs (Gyeongbuk pigs) were identified through comparative analysis with known reference porcine genomes (Landrace, Duroc, Yorkshire, and Jeju Black Pigs) using The Genome Analysis Toolkit (GATK), a program providing various utilities for SNP discovery and analysis. The results are shown in Table 1.

[0098] No. Sample TotalReads TotalBases (Gb) Ave. Read length mapping_rate(%) ID 1 DNA1 702,828,376 105,424,256,400 105.4 Gb 100 bp 97.59 2 DNA2 763,310,530 114,497,000,000 114.4 Gb 100 bp 97.59 3 DNA3 820,158,384 123,023,757,600 123 Gb 100 bp 97.6 4 DNA4 685,152,866 102,772,929,900 102.7 Gb 100 bp 97.72 5 DNA5 765,897,172 114,884,575,800 114.8 Gb 100 bp 97.62 6 DNA6 726,335,872 108,950,380,800 108.9 Gb 100 bp 97.65 7 DNA7 884,457,572 132,668,635,800 132.6 Gb 100 bp 97.61 8 DNA8 793,551,398 119,032,709,700 119 Gb 100 bp 97.68 9 DNA9 792,372,992 118,855,948,800 118.8 Gb 100 bp 97.16 10 DNA10 828,918,976 124,337,846,400 124.3 Gb 100 bp 97.69 Average 776,298,414 116,444,804,120 116.4 Gb 100 bp 98

[0100] Example 6. Analysis of native pig phylogenetic tree based on non-synonymous SNPs detected via next-generation sequencing

[0101] Through the above Example 5, genomic data was obtained through next-generation sequencing of native pigs (Gyeongbuk pigs), and non-synonymous SNPs that are likely to affect gene (protein) function by causing changes in protein structure through amino acid substitutions among SNPs present in gene regions from the genomic information were selected as tag-SNPs and the phylogenetic tree of native pigs was analyzed.

[0102] As a result, as shown in Figure 4, it was confirmed that the native pig of the present invention (Gyeongbuk pig) is a different lineage from the four pig breeds of the comparison group (Jeju Black Pig, Yorkshire, Duroc, and Landrace), and it was determined that non-synonymous SNPs that cause changes in amino acid sequences due to differences in DNA base sequences between the native pig (Gyeongbuk pig) and the four pig breeds of the comparison group can be selected.

[0104] Example 7. Region-specific primer design and Polymerase Chain Reaction (PCR) for the identification of native pig-specific mutations

[0105] Primers capable of specifically detecting mutations based on the lateral nucleotide sequences of identified native pig-specific mutation candidate regions were selected using the Primer 3 web tool (http: / / bioinfo.ut.ee / primer3-0.4.0 / primer3 / ) based on the porcine reference genome (susScr11) map. Polymerase chain reaction was performed using the designed primers under the conditions of Table 2, and the amplified PCR products were loaded onto a 1% agarose gel along with 100 ng of the sample and a 1 Kb marker. The images were then viewed using a DNA gel imaging system (Bio-rad), and DNA fragments for common mutation identification were amplified and verified.

[0106] As a result, as shown in Table 3, SYTL2( Synaptotagmin-like 2) Three SNPs were identified within the gene, specifically, mutations were observed at positions 19,646,751, 19,646,771, and 19,646,994 of chromosome 9 (Chr9).

[0107] The single nucleotide polymorphism at position 19,646,751 of chromosome 9 (Chr9) is SYTL2 In the gene sequence, the cytosine (C) at position 4919 is mutated to thymine (T), and a single nucleotide polymorphism at position 19,646,771 of chromosome 9 (Chr9) is SYTL2In the gene sequence, guanine (G) at position 4939 is mutated to adenine (A), and a single nucleotide polymorphism at position 19,646,994 of chromosome 9 (Chr9) is SYTL2 It was confirmed that the 4696th thymine (T) in the gene sequence was mutated into cytosine (C).

[0109] temperature hour Cycles Pre-denaturation 95℃ 5 minutes 1 cycles Denaturation 95℃ 30 seconds 30 cycles Annealing 56℃ 30 seconds Extension 72℃ 40 seconds Final extension 72℃ 1 minute 2 seconds 1 cycles Hold 4℃ ∞

[0111] gene Forward primer Reverse primer length SYTL2 AGGGTTGCTCACTTCTGGGC(Sequence No. 1) AGCTGCTCCTGCATTCCATC(Sequence No. 2) 548bp No. location Reference Alateration cDNA change Amino acid change 1 Chr9:19646751 C T c.4939G>A p.Glu1647Lys 2 Chr9:19646771 G A c.4919C>T p.Ser1640Phe 3 Chr9:19646994 T C c.4696A>G p.Thr1566Ala

[0113] Example 8. Sequence analysis using a Sanger sequencing system

[0114] To verify whether the detected variants specific to native pigs actually differ from those of other pig breeds, the nucleotide sequences of the amplified DNA fragments were analyzed using the Sanger sequencing method. SYTL2( Synaptotagmin-like 2) The nucleotide sequences of three SNPs within the gene were identified.

[0115] As a result, as shown in FIGS. 5 to 7, SYTL2 It was confirmed that all three SNPs within the gene were specifically mutated in native pigs, which is a mutation that differs from other pig breeds, suggesting that native pigs are genetically differentiated from other pig breeds.

Claims

Claim 1 An SNP marker composition for distinguishing the Gyeongbuk native pig breed from the Landrace, Duroc, Yorkshire, and Jeju black pig breeds, comprising one or more SNPs selected from the group consisting of: a single nucleotide polymorphism (SNP) in which cytosine (C) is mutated to thymine (T) at position Chr9:19646751 within the SYTL2 (Synaptotagmin-like 2) gene; a SNP in which guanine (G) is mutated to adenine (A) at position Chr9:19646771; and a SNP in which thymine (T) is mutated to cytosine (C) at position Chr9:19646994. Claim 2 An SNP marker composition for distinguishing the Gyeongbuk native pig breed from the Landrace, Duroc, Yorkshire, and Jeju black pig breeds, wherein, in claim 1, the SNP at position Chr9:19646751 is located at the 4919th position in the nucleotide sequence within the SYTL2 gene, the SNP at position Chr9:19646771 is located at the 4939th position in the nucleotide sequence within the SYTL2 gene, and the SNP at position Chr9:19646994 is located at the 4696th position in the nucleotide sequence within the SYTL2 gene. Claim 3 delete Claim 4 delete Claim 5 A composition for distinguishing the Gyeongbuk native pig breed from the Landrace, Duroc, Yorkshire, and Jeju black pig breeds, comprising a preparation capable of detecting one or more SNPs selected from the group consisting of an SNP in which cytosine (C) is mutated to thymine (T) at position Chr9:19646751 within the SYTL2 (Synaptotagmin-like 2) gene, an SNP in which guanine (G) is mutated to adenine (A) at position Chr9:19646771, and an SNP in which thymine (T) is mutated to cytosine (C) at position Chr9:19646994. Claim 6 A composition according to claim 5, wherein the above preparation is a primer set comprising the nucleotide sequences of SEQ ID NO. 1 and SEQ ID NO.

2. Claim 7 A microarray for identifying the Gyeongbuk native pig breed from the Landrace, Duroc, Yorkshire, and Jeju black pig breeds, comprising at least one of a polynucleotide and its cDNA containing one or more SNPs selected from the group consisting of an SNP in which cytosine (C) is mutated to thymine (T) at the Chr9:19646751 position within the SYTL2 (Synaptotagmin-like 2) gene, an SNP in which guanine (G) is mutated to adenine (A) at the Chr9:19646771 position, and an SNP in which thymine (T) is mutated to cytosine (C) at the Chr9:19646994 position. Claim 8 A kit for identifying the Gyeongbuk native pig breed from the Landrace, Duroc, Yorkshire, and Jeju black pig breeds, comprising a composition according to claim 1 or 5. Claim 9 A method for identifying the Gyeongbuk native pig breed from the Landrace, Duroc, Yorkshire, and Jeju black pig breeds, comprising: a step of isolating genomic DNA from a pig individual; and a step of identifying one or more SNPs selected from a group consisting of an SNP in which cytosine (C) is mutated to thymine (T) at position Chr9:19646751, an SNP in which guanine (G) is mutated to adenine (A) at position Chr9:19646771, and an SNP in which thymine (T) is mutated to cytosine (C) at position Chr9:19646994 within the isolated genomic DNA. Claim 10 A composition for distinguishing the Gyeongbuk native pig breed from the Landrace, Duroc, Yorkshire, and Jeju black pig breeds, comprising a primer set containing the nucleotide sequences of SEQ ID NO. 1 and SEQ ID NO. 2, wherein the composition is capable of detecting one or more SNPs selected from the group consisting of an SNP in which cytosine (C) is mutated to thymine (T) at position Chr9:19646751, an SNP in which guanine (G) is mutated to adenine (A) at position Chr9:19646994, and an SNP in which thymine (T) is mutated to cytosine (C) at position Chr9:19646994 within the SYTL2 (Synaptotagmin-like 2) gene.

Images