A method for diagnosing mild cognitive impairment or Alzheimer's dementia using TIMP-3

Abstract

The present invention relates to a composition for diagnosing mild cognitive impairment or Alzheimer's dementia comprising a TIMP-3 protein and / or a gene encoding the same, and a method for providing diagnostic information using the same. More specifically, the invention was completed by confirming that the expression of the TIMP-3 protein in the plasma and cerebrospinal fluid of a patient group with mild cognitive impairment or Alzheimer's dementia is significantly lower than that of a normal control group, and that this can be used for the diagnosis of mild cognitive impairment or Alzheimer's dementia.

Description

Technology Field

[0001] The present invention relates to a biomarker composition for diagnosing mild cognitive impairment or Alzheimer's dementia comprising a TIMP-3 protein and / or a gene encoding the same, a diagnostic kit comprising the same, and a method for providing diagnostic information using the same. Background Technology

[0003] Alzheimer's disease (AD) is a progressive neurodegenerative disease characterized by cognitive impairment preceded by the extracellular deposition of diffuse and insoluble plaques in the brain. It is also one of the most common types of dementia and is known as a major cause of death in the elderly. Since the primary pathological feature of Alzheimer's is the formation of neuritic plaques composed of amyloid-beta (Aβ) peptides, clinical research targeting Aβ is ongoing.

[0004] In recent years, it has been revealed that metalloproteinases (MMPs) and disintegrins and metalloproteinases (ADAMs) play important roles in Alzheimer's disease (Lorenzl S., Albers DS, Relkin N., Ngyuen T., Hilgenberg SL, Chirichigno J., Cudkowicz ME, Beal MF Increased plasma levels of matrix metalloproteinase-9 in patients with Alzheimer's disease. Neurochem. Int. 2003;43:191-196.). ADAM-10 and ADAM-17 have been reported to increase the secretion of soluble amyloid precursor protein (APP) fragments and decrease Aβ production (Kojro E., Fahrenholz F. The non-amyloidogenic pathway: Structure and function of α-secretases. Alzheimer's Dis. 2005;38:105-127.). Recent studies have reported increased fluid levels of ADAM-10 in patients with Alzheimer's disease (Vatanabe IP, Peron R., Grigoli MM, Pelucchi S., De Cesare G., Magalh es T., Manzine P., Balthazar M.F., Di Luca M., Marcello E., et al. ADAM10 Plasma and CSF Levels Are Increased in Mild Alzheimer's Disease. Int. J. Mol. Sci. 2021;22:2416.).

[0005] Tissue inhibitors of metalloproteinases (TIMPs) reversibly inhibit enzymes of the zinc protease superfamily, primarily MMPs and ADAMs. Since the regulation of MMPs can induce cancer, inflammatory diseases, and degenerative diseases, studies targeting TIMPs have also reported that they have a wide range of effects on the pathologies of various diseases (K It has been confirmed that the levels of MMPs (MMP-1, MMP-2, and MMP-9) and TIMPs (TIMP-1 and TIMP-2) in plasma and cerebrospinal fluid (CSF) change in various types of dementia.

[0006] Among the TIMP family, TIMP-3 is the only extracellular matrix (ECM)-binding TIMP and possesses the broadest substrate range, including all MMPs. Furthermore, TIMP-3 is the only TIMP family capable of inhibiting ADAM-10 and ADAM-17. Therefore, TIMP-3 plays an indirect role in regulating the amyloidogenesis pathway and Aβ production. Although many clinical studies have been conducted to investigate the associations with various diseases by targeting TIMP fluid concentrations, the relationship between TIMP-3 and Alzheimer's disease is not yet known.

[0007] Accordingly, the inventors have confirmed that TIMP-3 fluid levels can be altered in patients with mild cognitive impairment and Alzheimer's dementia, and intend to provide an invention regarding a biomarker composition for diagnosing mild cognitive impairment or Alzheimer's dementia containing TIMP-3. Given that the etiology of dementia is highly diverse, there are currently no treatments available, and the best course of action is to delay the onset and progression of dementia through early diagnosis, it is expected that the dementia diagnostic method using the TIMP-3 protein and the gene encoding it as the biomarker of the present invention will not only improve the quality of life for patients and their families but also make a significant socioeconomic contribution. The problem to be solved

[0009] According to various embodiments of the present invention, a biomarker composition for diagnosing mild cognitive impairment or Alzheimer's dementia comprising a TIMP-3 protein and / or a gene encoding the same, and a diagnostic kit comprising the same are provided.

[0010] According to another embodiment of the present invention, a method for providing information for the diagnosis of mild cognitive impairment or Alzheimer's dementia is provided, comprising: a step of measuring the expression level of a TIMP-3 protein and / or a gene encoding it from a biological sample isolated from a subject; and a step of comparing the measured expression level with a level measured from a normal control sample. means of solving the problem

[0012] According to one embodiment of the present invention, a biomarker composition for diagnosing mild cognitive impairment or Alzheimer's dementia is provided, comprising a TIMP-3 (Tissue Inhibitor of Metalloproteinase-3) protein and / or a gene encoding the same.

[0013] According to another embodiment of the present invention, a biomarker composition for diagnosing mild cognitive impairment or Alzheimer's dementia is provided, comprising: a preparation for measuring the expression of TIMP-3 protein in a biological sample isolated from a subject; or a preparation for measuring the expression of a gene encoding TIMP-3 protein.

[0014] According to one aspect, a preparation for measuring the expression level of the protein may be at least one selected from the group consisting of antibodies, oligopeptides, ligands, PNAs, and aptamers that specifically bind to the protein.

[0015] According to one side, a preparation for measuring the expression level of the gene may be at least one selected from the group consisting of a primer, a probe, and an antisense nucleotide that specifically binds to the gene.

[0016] According to one side, the biological sample may be one or more selected from the group consisting of blood, plasma, serum and cerebrospinal fluid.

[0017] According to another embodiment of the present invention, a diagnostic kit for mild cognitive impairment or Alzheimer's dementia is provided, comprising any one of the diagnostic compositions.

[0018] According to one side, the kit may be an ELISA kit, a protein chip kit, a rapid kit, or a MRM (Multiple reaction monitoring) kit.

[0019] According to another embodiment of the present invention, a method for providing information for the diagnosis of mild cognitive impairment or Alzheimer's dementia is provided, comprising the steps of: measuring the expression level of a TIMP-3 protein and / or a gene encoding it from a biological sample isolated from a subject; and comparing the measured expression level with a level measured from a normal control sample.

[0020] According to one side, the method may additionally include a step of determining mild cognitive impairment or Alzheimer's dementia if the expression level of TIMP-3 protein measured in a biological sample is lower than the level measured in a normal control sample.

[0021] According to one side, the method may additionally include the step of determining mild cognitive impairment or Alzheimer's dementia if the expression level of a gene encoding the TIMP-3 protein measured in a biological sample is lower than the level measured in a normal control sample.

[0022] According to one side, the biological sample may be one or more selected from the group consisting of blood, plasma, serum and cerebrospinal fluid. Effects of the invention

[0024] The biomarker composition for diagnosing mild cognitive impairment or Alzheimer's dementia comprising the TIMP-3 protein of the present invention and the gene encoding it is completed as an invention by identifying a biomarker that shows a significantly lower expression level compared to a normal control group, and can diagnose mild cognitive impairment and Alzheimer's dementia more quickly and effectively.

[0025] The effects of the present invention are not limited to those mentioned above, and other unmentioned effects will be clearly understood by a person skilled in the art from the description below. Brief explanation of the drawing

[0027] Figure 1 shows the expression of TIMP-3 in mouse experiments using immunoblotting, fluorescence staining, and plasma levels. Figure 2 shows the relative TIMP-3 mRNA expression levels in iPSC-derived neurons for a normal group and an Alzheimer's patient group. Figure 3 shows the concentration of TIMP-3 in plasma for a normal control group, a mild cognitive impairment group, and a dementia patient group. Figure 4 shows the relative expression levels of TIMP-3 in cerebrospinal fluid for a normal control group, a mild cognitive impairment group, and a dementia patient group. Specific details for implementing the invention

[0028] The terms used in the various embodiments have been selected to be as widely used as possible, taking into account their functions in the present invention; however, these terms may vary depending on the intent of those skilled in the art, case law, the emergence of new technologies, etc. Additionally, in specific cases, terms have been arbitrarily selected by the applicant, and in such cases, their meanings will be described in detail in the relevant description of the invention. Therefore, the terms used in the present invention should be defined not merely by their names, but based on their meanings and the overall content of the invention.

[0029] When a part of a specification is described as "including" a certain component, this means that, unless specifically stated otherwise, it does not exclude other components but may include additional components.

[0030] Below, embodiments of the present invention are described in detail with reference to the attached drawings so that those skilled in the art can easily implement the invention. However, the present invention may be embodied in various different forms and is not limited to the embodiments described herein.

[0032] According to one embodiment of the present invention, a biomarker composition for diagnosing mild cognitive impairment or Alzheimer's dementia is provided, comprising a TIMP-3 (Tissue Inhibitor of Metalloproteinase-3) protein and / or a gene encoding the same.

[0033] As used herein, the term “biomarker” refers to an indicator, such as a gene or protein, that can predict the occurrence, likelihood, or course of a specific disease in a biological sample isolated from a subject. For the purposes of the present invention, said biomarker refers to a biomarker capable of diagnosing neurodegenerative diseases, preferably mild cognitive impairment or Alzheimer's dementia.

[0034] The biomarker containing the above TIMP-3 protein and / or the gene encoding it may have reduced expression in subjects with mild cognitive impairment or Alzheimer's disease relative to a normal control group.

[0035] As used in this specification, the term “subject” refers to an individual whose symptoms, such as the onset or progression of a degenerative neurological disease, are uncertain, and may be an individual with a high probability of being diagnosed with a degenerative neurological disease, but is not limited thereto.

[0036] The term “biological sample” as used in this specification is any substance obtained from or derived from the subject, and for the purposes of the present invention may be any one of blood, serum, plasma and cerebrospinal fluid, most preferably either plasma and cerebrospinal fluid, but is not limited thereto.

[0037] As used herein, the term “protein” includes not only the protein itself but also protein isoforms or protein variants that may be generated by splicing and variable promoters, or by genetic changes such as mutations or polymorphisms.

[0038] Since the expression level of the biomarker of the present invention can change depending on the change in amyloid-beta accumulation and the degree of cognitive decline compared to a normal control group, it is possible to effectively distinguish patients with mild cognitive impairment and Alzheimer's dementia from normal control groups and predict the severity of the disease.

[0039] As used herein, the term “diagnosis” refers to confirming the existence or characteristics of a pathological condition. For the purposes of the present invention, said diagnosis includes all of predicting the onset of, the likelihood of onset, the course of, and the prognosis or effect resulting from treatment of degenerative neurological diseases, including mild cognitive impairment and Alzheimer’s dementia.

[0040] According to one aspect, the composition may include a preparation for measuring the expression of the TIMP-3 protein. The preparation for measuring the expression level of the protein may include any that can measure the amount of protein present in a biological sample, and may be, for example, at least one selected from the group consisting of antibodies, oligopeptides, ligands, PNA (peptide nucleic acid), and aptamers that specifically bind to the protein, but is not limited thereto.

[0041] As used herein, the term "antibody" refers to a substance that specifically binds to an antigen and causes an antigen-antibody reaction. For the purposes of the present invention, an antibody means an antibody that specifically binds to the biomarker protein. The antibodies of the present invention include polyclonal antibodies, monoclonal antibodies, and recombinant antibodies. The antibodies can be easily manufactured using techniques widely known in the art. For example, polyclonal antibodies can be produced by a method widely known in the art that includes the process of injecting an antigen of the protein into an animal and collecting blood from the animal to obtain serum containing antibodies. Such polyclonal antibodies can be produced from any animal, such as goats, rabbits, sheep, monkeys, horses, pigs, cattle, dogs, etc. Additionally, monoclonal antibodies can be produced using a hybridoma method or phage antibody library technology widely known in the art. Antibodies produced by the above methods can be separated and purified using methods such as gel electrophoresis, dialysis, salt precipitation, ion exchange chromatography, and affinity chromatography. In addition, the antibody of the present invention comprises not only a complete form having two full-length light chains and two full-length heavy chains, but also functional fragments of the antibody molecule. A functional fragment of the antibody molecule means a fragment having at least an antigen-binding function, and means including all of Fab, F(ab'), F(ab')2 and Fv, etc.

[0042] The term “PNA” as used in this specification refers to an artificially synthesized polymer similar to DNA or RNA, which was first introduced in 1991 by Professors Nielsen, Egholm, Berg and Buchardt of the University of Copenhagen, Denmark.

[0043] The term “aptamer” as used in this specification refers to an oligonucleotide or peptide molecule, preferably one that binds to the desired biomarker protein.

[0044] According to one aspect, a preparation for measuring the expression level of the protein may be at least one selected from the group consisting of antibodies, oligopeptides, ligands, PNAs, and aptamers that specifically bind to the protein.

[0045] According to one aspect, the composition may include a preparation for measuring the expression of a gene encoding the TIMP-3 protein. The preparation for measuring the expression level of the gene may include any that can measure the expression level of DNA present in a biological sample or mRNA transcribed therefrom, and may be, for example, at least one selected from the group consisting of primers, probes, and antisense nucleotides that specifically bind to the gene, but is not limited thereto.

[0046] As used herein, the term "primer" refers to a fragment that recognizes a target gene sequence, comprising a forward and a reverse primer pair, but preferably a primer pair that provides analysis results having specificity and sensitivity. High specificity may be conferred when the nucleic acid sequence of the primer is a sequence that is inconsistent with the non-target sequence present in the sample, thereby amplifying only the target gene sequence containing the complementary primer binding site and not causing non-specific amplification.

[0047] As used in this specification, the term "probe" refers to a substance capable of specifically binding to a target substance to be detected within a sample, and means a substance capable of specifically confirming the presence of the target substance within the sample through said binding. The type of probe is not limited to substances commonly used in the art, but preferably may be PNA (peptide nucleic acid), LNA (locked nucleic acid), peptide, polypeptide, protein, RNA, or DNA, and most preferably PNA. More specifically, the probe may be a biomaterial derived from an organism or similar, or manufactured in vitro, and may be, for example, enzymes, proteins, antibodies, microorganisms, animal and plant cells and organs, nerve cells, DNA, and RNA; DNA may include cDNA, genomic DNA, and oligonucleotides; RNA may include genomic RNA, mRNA, and oligonucleotides; and examples of proteins may include antibodies, antigens, enzymes, peptides, etc.

[0048] As used herein, the term “antisense” means an oligomer having a backbone of nucleotide base sequences and subunits such that the antisense oligomer hybridizes with a target sequence in RNA by Watson-Crick base pairing, allowing the formation of typically mRNA and RNA:oligomer heterodimers within the target sequence. The oligomer may have exact or approximate sequence complementarity with respect to the target sequence.

[0049] According to one side, the biological sample may be one or more selected from the group consisting of blood, plasma, serum and cerebrospinal fluid.

[0050] According to another embodiment of the present invention, a diagnostic kit for mild cognitive impairment or Alzheimer's dementia is provided, comprising any one of the above diagnostic compositions. The kit may be an ELISA kit, a protein chip kit, a rapid kit, or a Multiple Reaction Monitoring (MRM) kit, but is not limited thereto. Additionally, the kit may further comprise one or more other component compositions, solutions, or devices suitable for an analysis method known in the art.

[0051] The diagnostic kit of the present invention may include essential elements necessary for performing ELISA. The ELISA kit includes an antibody specific to the protein. The antibody is an antibody that has high specificity and affinity for the marker protein and has little cross-reactivity with other proteins, and is a monoclonal antibody, a polyclonal antibody, or a recombinant antibody. Additionally, the ELISA kit may include an antibody specific to a control (e.g., a housekeeping protein) protein. Furthermore, the ELISA kit may include reagents capable of detecting the bound antibody, such as a labeled secondary antibody, chromophores, an enzyme (e.g., conjugated with the antibody) and its substrate, or other substances capable of binding to the antibody.

[0052] According to another embodiment of the present invention, a method for providing information for the diagnosis of mild cognitive impairment or Alzheimer's dementia is provided, comprising the steps of: measuring the expression level of a TIMP-3 protein and / or a gene encoding it from a biological sample isolated from a subject; and comparing the measured expression level with a level measured from a normal control sample.

[0053] The step of measuring the expression level of the gene according to the present invention may be performed using a reagent for measuring the expression level of a gene selected from the group consisting of primers, probes, and antisense nucleotides that specifically bind to the gene, through reverse transcription polymerase chain reaction (RT-PCR), competitive reverse transcription polymerase chain reaction (Competitive RT-PCR), real-time reverse transcription polymerase chain reaction (Real-time RT-PCR), RNase protection assay (RPA), Northern blotting, or DNA chip, but is not limited thereto.

[0054] The step of measuring the expression level of the protein according to the present invention utilizes a preparation for measuring the expression level of a protein selected from the group consisting of at least one antibody, oligopeptide, ligand, PNA (peptide nucleic acid), and aptamer that specifically binds to the protein, wherein the preparation comprises protein chip analysis, immunoassay, ligand binding assay, MALDI-TOF (Matrix Assisted Laser Desorption / Ionization Time of Flight Mass Spectrometry) analysis, SELDI-TOF (Surface Enhanced Laser Desorption / Ionization Time of Flight Mass Spectrometry) analysis, radioimmunoassay, radioimmunodiffusion, Ouchteroni immunodiffusion, Rocket immunoelectrophoresis, tissue immunostaining, complement fixation assay, two-dimensional electrophoresis analysis, liquid chromatography-mass spectrometry (LC-MS), LC-MS / MS (liquid chromatography-mass spectrometry / mass spectrometry), Western blotting, or It can be performed using ELISA (enzyme-linked immunosorbent assay), but is not limited thereto.

[0055] According to one aspect, the method may further include a step of determining mild cognitive impairment or Alzheimer's dementia when the expression level of TIMP-3 protein measured in a biological sample is lower than the level measured in a normal control sample. The “lower case” means at least less than 90% compared to a normal control, and preferably less than 70%.

[0056] According to one aspect, the method may further include the step of determining mild cognitive impairment or Alzheimer's dementia if the expression level of a gene encoding the TIMP-3 protein measured in a biological sample is lower than the level measured in a normal control sample. The “lower case” means at least less than 90% compared to a normal control, and preferably less than 70%.

[0057] According to one aspect, the biological sample may be one or more selected from the group consisting of blood, plasma, serum and cerebrospinal fluid, and most preferably may be either plasma and cerebrospinal fluid.

[0058] According to an ideal embodiment of the present invention, even if there is no significant difference or even an increase in the expression level of the TIMP-3 protein or the gene encoding it in immunohistochemistry or PCR results of neuronal genomes, if TIMP-3 expression is decreased in plasma and cerebrospinal fluid samples, it can be determined that there is mild cognitive impairment or Alzheimer's dementia. This is based on the results confirmed in Examples 2 to 4 and corresponds to the unique effect disclosed in the present invention.

[0059] Example 1. Experimental Method

[0060] Example 1-1. Human blood sample

[0061] Subjects with healthy controls, mild cognitive impairment (MCI), and dementia were selected from the Ansan Geriatric (AGE) cohort, established to study general geriatric diseases in Korean elderly individuals aged 60 to 84 years. The sampling protocol and design of the AGE study followed the methods described in *Study design and methods of the Ansan Geriatric Study (AGE study)* by Han C., Jo SA, Kim NH, Jo I., and Park MH, BMC Neurol. 2009;9:10. Each dementia patient met the criteria of the Diagnostic and Statistical Manual of Mental Disorders, 4th Edition. Subjects with cognitive and memory impairments were evaluated using the Korean version of the Alzheimer's Disease Registry Consortium (CERAD-K) neuropsychology battery as previously described. All dementia patients met the criteria for Alzheimer's disease established by the National Institute of Neurological and Communicative Disorders and Stroke and the Alzheimer's Disease and Related Disorders Association (NINCDS-ADRDA) in the United States. The diagnosis of mild cognitive impairment was based on the Mayo Clinic criteria disclosed in Jang BG, Yun S.-M., Ahn K., Song JH, Jo SA, Kim Y.-Y., Kim DK, Park MH, Han C., Koh YH Plasma carbonic anhydrase II protein is elevated in Alzheimer's disease. J. Alzheimer's Dis. 2010;21:939-945. as previously described. Blood samples were collected from a total of 251 subjects, and the demographic and clinical variables of each participant are shown in Table 1 below.This study was approved by the Institutional Review Board (IRB) of the Korea Disease Control and Prevention Agency (KDCA) under approval numbers (2016-02-22-PA, 2017-05-05-PA, 2020-03-04-PA).

[0062] control group Mild cognitive impairment group Dementia group p-Value N (Male / Female) 115 (48 / 67) 71 (29 / 42) 65 (16 / 49) Age (years) 71.9 ± 0.43 73.05 ± 0.54 75.1 ± 0.75 0.001 Education 9.12 ± 0.47 6.18 ± 0.57 3.56 ± 0.55 <0.001 MMSE 27.21 ± 0.2 24.96 ± 0.35 16.0 ± 0.73 <0.001 CDR 0.043 ± 0.01 0.26 ± 0.02 1.12 ± 0.09 <0.001 Total CHOL 195.6 ± 3.2 190.3 ± 4.1 201.4 ± 4.5 0.306 TG 137.4 ± 7.2 127.9 ± 7.7 152.6 ± 11.5 0.287 HDL 43.4 ± 0.89 43.1 ± 1.46 44.5 ± 1.2 0.371 LDL 124.7 ± 3.0 121.5 ± 3.4 126.4 ± 3.8 0.599 Platelet 253.3 ± 6.6 268.0 ± 7.2 266.2 ± 11.3 0.229 Glucose 101.4 ± 2.0 102.3 ± 2.5 107.5 ± 5.1 0.483 vitB12 790.6 ± 57.3 699.2 ± 31.6 717.1 ± 41.3 0.903 TIMP-3 (ng / mL) 0.61 ± 0.06 0.40 ± 0.04 0.39 ± 0.05　a 0.065

[0063] Example 1-2. Cerebrospinal fluid sampling

[0064] Cerebrospinal fluid was obtained and provided by the Pusan ​​National University Hospital Brain Bank (PNUHBB). All participants underwent clinical interviews and neurological examinations following a consultation with a neurologist specializing in neurodegenerative diseases. Patients with mild cognitive impairment met both the NIA-AA core clinical criteria for mild cognitive impairment and the modified Petersen criteria, while all patients with Alzheimer's dementia met the NIA-AA core clinical criteria for Alzheimer's dementia whenever possible.

[0065] Cerebrospinal fluid samples were collected from 30 subjects as previously described. The cerebrospinal fluid samples were analyzed at the Institute of Biomedical Convergence (PNUYH) at Pusan ​​National University Hospital. The levels of Aβ1-42, total Tau, and pTau181 in the cerebrospinal fluid were measured using the INNOTEST ELISA kit (Fujirebio Diagnostics, Ghent, Belgium) according to the manufacturer's instructions.

[0067] Examples 1-3. Cell culture

[0068] Human iPSC-derived neurons were purchased from Axol Biosciences (Little Chesterford, UK). Cells were differentiated into cerebral cortical neurons in about 7 days according to the manufacturer's protocol and cultured in a humid environment of 5% CO2 at 37°C.

[0070] Examples 1-4. Animal experiments

[0071] APPsw / PS1ΔE9 transgenic mice were used as described in Cho S.-J., Yun S.-M., Jo C., Lee D.-h., Choi KJ, Song JC, Park SI, Kim Y.-J., Koh YH SUMO1 promotes Aβ production via the modulation of autophagy. Autophagy. 2014;11:100-112. All experiments were approved by the KDCA’s Institutional Animal Care and Use Committee (IACUC) and were performed in accordance with the KDCA’s guidelines for the care and use of experimental animals.

[0073] Examples 1-5. Antibodies and Reagents

[0074] The anti-TIMP-3 antibody (AB6000) was purchased from EMD Millipore (Darmstadt, Germany), the anti-β-actin (A5316) antibody from Sigma-Aldrich (St. Louis, MO, USA), the anti-Aβ (6E10, SIG39300) from Convance (Denver, PA, USA), and the Alexa Fluor 488 goat anti-mouse IgG and Alexa Fluor 594 goat anti-rabbit IgG were purchased from Molecular Probes (Eugene, OR, USA).

[0076] Examples 1-6. Measurement of blood protein by ELISA

[0077] All plasma samples were dispensed and stored at -80°C until collectively analyzed by investigators with no prior knowledge of the patient composition. Levels of TIMP-3 were determined using an ELISA kit (USCN, Wuhan, China) according to the manufacturer's recommended protocol.

[0079] Examples 1-7. Western Blotting

[0080] Protein concentration was measured using the Bradford method (Bio-Rad, Hercules, CA, USA) protein assay according to the manufacturer's protocol. Proteins were digested on a 4-12% NuPAGE gel (Invitrogen) and transferred to a nitrocellulose membrane. The membrane was blocked in TBS containing 5% non-fat milk powder and 0.1% Tween 20, incubated with the primary antibody overnight at 4°C, and washed. Subsequently, the membrane was incubated with HRP (horseradish peroxidase) anti-rabbit and anti-mouse secondary antibodies. Protein bands were detected using a chemiluminescence kit (Amersham Pharmacia Biotech, Buckinghamshire, UK).

[0082] Examples 1-8. Real-time reverse transcriptase chain reaction

[0083] Real-time quantitative polymerase chain reaction (RT-PCR) analysis was performed using the SYBR Green PCR core reagent in a two-step RT-PCR protocol according to the manufacturer's protocol (Applied Biosystems, Warrington, UK). The primer sequences for the RT-PCR experiment are shown in Table 2 below.

[0084] Sequence number name Sequence(5'->3') 1 TIMP-3 Sense Primer CAAGATGCCCATGTGCAGT 2 TIMP-3 Antisense Primer GCCATCATAGACGCGACCTG 3 GAPDH Sense Primer CAGCCTCAAGATCATCAGCA 4 GAPDH Antisense Primer TGTGGTCATGAGTCCTTCCA

[0085] Relative TIMP-3 levels were normalized to GAPDH levels. PCR reactions were performed using ABI Prism 7900 SDS (Applied Biosystems, Warrington, UK).

[0087] Examples 1-9. Immunofluorescence analysis

[0088] Anesthetized mice were perfused with PBS, and tissues were rapidly harvested. The obtained brain tissues were fixed with 4% paraformaldehyde and then transferred to a 30% sucrose solution. Brains embedded with OCT compounds were sliced ​​to 20 μm and placed on glass slides. For immunohistochemical analysis, each brain section was permeated with 0.03% Triton X-100 in PBS, blocked with 5% normal goat serum at room temperature, and incubated overnight with an appropriate primary antibody. The next day, each specimen was washed and incubated with a secondary antibody, and the labeled brain sections were visualized using a fluorescence microscope (Zeiss, Germany).

[0090] Examples 1-10. Statistical Analysis

[0091] Results were expressed as mean ± SD and mean ± SEM. Within-group demographic and clinical variables were analyzed using the Mann-Whitney U-test and the Kruskal-Wallis test. Correlations between factors were examined using Spearman's method. Statistical analysis of this study was performed using SPSS 12.0 (IBM, Armonk, NY, USA), and a p-value of less than 0.05 was considered statistically significant.

[0093] Example 2. Mouse experiment results

[0094] Since TIMP-3 levels increase upon Aβ treatment, we investigated whether TIMP-3 expression was altered in the brains of Alzheimer's mice, and the results are shown in Figure 1. As can be seen in Figure 1A, TIMP-3 levels increased in the cerebral cortex of 20-month-old APP Swedish / PS1delE9 Tg (APP Tg) mice upon amyloid beta treatment. To evaluate changes in TIMP-3 expression in Alzheimer's mice, immunostaining with anti-TIMP-3 and anti-Aβ (6E10) was performed on wild-type (WT) and APP Tg mice, and the results are shown in Figure 1B. As can be seen in Figure 1B, TIMP-3 was more deposited in APP Tg mice. Additionally, plasma TIMP-3 levels in wild-type and APP Tg mice were examined and are shown in Figure 1C. Although the plasma concentration of TIMP-3 decreased slightly, there was no significant difference.

[0096] Example 3. Evaluation of TIMP-3 expression in neurons

[0097] TIMP-3 expression was confirmed in human iPSC-derived neurons from Alzheimer's patients. The results are shown in Figure 2, and it was confirmed that once the cells differentiated into neurons, the relative expression level of TIMP-3 mRNA in Alzheimer's patients increased slightly compared to healthy control groups.

[0099] Example 4. Evaluation of TIMP-3 expression in body fluids

[0100] We investigated whether increased TIMP-3 expression was also reflected in body fluid levels. First, TIMP-3 levels were compared in the plasma of 251 subjects with dementia, subjects with mild cognitive impairment, and healthy controls. The demographic and clinical variables of the participants are shown in Table 1 above. The mean age of the healthy control participants was 71.9 ± 0.43 years, the mean age of the subjects with mild cognitive impairment was 73.05 ± 0.54 years, and the mean age of the dementia participants was 75.1 ± 0.75 years.

[0101] Dementia participants had lower levels of education than normal control participants. Mini-Mental State Examination (MMSE) scores were lower in the dementia group, but were within the normal range for the control and mild cognitive impairment groups. As can be seen in Figure 3, plasma TIMP-3 concentrations were significantly lower in the dementia group (0.39±0.05 ng / mL) compared to the control group (0.6±0.06 ng / mL) based on the Mann-Whitney U-test results (p=0.029). Correlation analysis with clinical characteristics showed that plasma TIMP-3 levels had a negative correlation with the clinical dementia rating (CDR) score, as shown in Table 3 below (r = -0.153; p = 0.015). Plasma TIMP-3 levels also had a negative correlation with LDL cholesterol (r = -0.142; p = 0.025) and glucose (r = -0.127; p = 0.046).

[0102] TIMP-3 Rho p-Value Age -0.112 0.075 Education 0.094 0.14 MMSE 0.104 0.099 CDR -0.153 0.015 Total CHOL -0.105 0.096 Tg 0.008 0.902 HDL -0.049 0.442 LDL -0.142 0.025 Platelet 0.038 0.55 Glucose -0.127 0.046 VitB12 0.079 0.21

[0103] We also confirmed the relative expression levels of TIMP-3 in cerebrospinal fluid through Western blotting to clarify whether fluid levels of TIMP-3 are associated with clinically evident ADD. The results are shown in Table 4 and Figure 4.

[0104] control group Mild cognitive impairment group Dementia group p-Value TIMP-3 2.26 ± 0.26 1.40 ± 0.29　1 0.77 ± 0.11 0.004 Aβ1-42 (pg / mL) 1030.1 ± 32.6 766.3 ± 70.9　2 401.3 ± 27.4　3 <0.001 Total Tau (pg / mL) 224.3 ± 25.6 328.9 ± 69.5 480.8 ± 100.7 0.092 pTau (pg / mL) 50.3 ± 2.4 41.2 ± 4.5 81.5 ± 9.3　4 0.001

[0105] The dementia group was older than the control and mild cognitive impairment groups. The mean age of the normal control participants (3 men, 7 women) was 63.8 ± 3.8 years, and the mean age of the patients with mild cognitive impairment (3 men, 7 women) was 63.6 ± 3.7 years. For the dementia group (5 men, 5 women), the mean age was 68.1 ± 3.3 years. In addition, the concentrations of Aβ1-42, total Tau, and pTau (phosphorylated-Tau) were measured using ELISA. The levels of Aβ1-42 in the cerebrospinal fluid differed among the three groups (p < 0.001; Kruskal-Wallis test). The concentration of Aβ1-42 in cerebrospinal fluid was found to be lower in patients of the dementia group (401.3 ± 27.4 pg / mL) and the mild cognitive impairment group (766.3 ± 70.9 pg / mL) compared to the control group (1030.1 ± 32.6 pg / mL). The concentration of pTau in cerebrospinal fluid was higher in the dementia group (81.5 ± 9.3 pg / mL) compared to the control group (50.3 ± 2.4 pg / mL) and the mild cognitive impairment group (41.2 ± 4.5 pg / mL).

[0106] Figures 4A and 4B show that the level of TIMP-3 is lower in the cerebrospinal fluid of dementia patients compared to patients with mild cognitive impairment and healthy controls.

[0107] The correlation between TIMP-3 levels and other biomarkers such as Aβ1-42, total Tau, and pTau in cerebrospinal fluid was investigated and is shown in Table 5 below.

[0108] Features TIMP-3 Rho p-Value Age -0.25 0.17 Aβ1-42 0.515 0.004 Total Tau -0.337 0.069 pTau -0.372 0.047

[0109] A positive correlation was confirmed between TIMP-3 and Aβ1-42 levels in cerebrospinal fluid (r = 0.515, p = 0.004), and TIMP-3 levels were also negatively correlated with pTau levels (r = -0.372, p = 0.047). Overall, these results demonstrate that TIMP-3 concentrations in cerebrospinal fluid are deeply associated with Aβ and pTau, which indicate the pathological progression of the disease.

[0110] Although the embodiments have been described above with reference to the limited drawings, those skilled in the art can apply various technical modifications and variations based on the above. For example, suitable results may be achieved even if the described techniques are performed in a different order than described, and / or if the components of the described system, structure, device, circuit, etc. are combined or assembled in a form different from described, or replaced or substituted by other components or equivalents.

[0111] Therefore, other implementations, other embodiments, and equivalents to the claims also fall within the scope of the claims set forth below.

Claims

Claim 1 delete Claim 2 A composition for diagnosing mild cognitive impairment or Alzheimer's dementia, comprising: a preparation for measuring the expression of TIMP-3 protein in a biological sample isolated from a subject; or a preparation for measuring the expression of a gene encoding TIMP-3 protein; wherein the biological sample is one or more selected from the group consisting of blood, plasma, serum, and cerebrospinal fluid, and the diagnostic composition is used to determine mild cognitive impairment or Alzheimer's dementia when the measured expression level of TIMP-3 protein or the expression level of the gene encoding TIMP-3 protein is lower than the level measured in a normal control sample. Claim 3 A composition for diagnosing mild cognitive impairment or Alzheimer's dementia, wherein, in claim 2, the preparation for measuring the expression level of the protein is at least one selected from the group consisting of antibodies, oligopeptides, ligands, PNAs, and aptamers that specifically bind to the protein. Claim 4 A composition for diagnosing mild cognitive impairment or Alzheimer's dementia, wherein, in claim 2, the agent for measuring the expression level of the gene is at least one selected from the group consisting of a primer, a probe, and an antisense nucleotide that specifically binds to the gene. Claim 5 delete Claim 6 A diagnostic kit for mild cognitive impairment or Alzheimer's dementia comprising a diagnostic composition according to any one of claims 2 to 4, and an instruction manual stating that the expression level of the TIMP-3 protein or the gene encoding the TIMP-3 protein is compared with the level measured from a normal control sample, and if the expression level is lower than the level measured from the normal control sample, it is determined to be mild cognitive impairment or Alzheimer's dementia. Claim 7 In claim 6, the kit is a diagnostic kit for mild cognitive impairment or Alzheimer's dementia, wherein the kit is an ELISA kit, a protein chip kit, a rapid kit, or an MRM (Multiple reaction monitoring) kit. Claim 8 A method for providing information for the diagnosis of mild cognitive impairment or Alzheimer's dementia, comprising: a step of measuring the expression level of a TIMP-3 protein and / or a gene encoding the same from a biological sample isolated from a subject; a step of comparing the measured expression level with a level measured from a normal control sample; and a step of determining mild cognitive impairment or Alzheimer's dementia if the expression level of the TIMP-3 protein measured in the biological sample is lower than the level measured in the normal control sample; wherein the biological sample is one or more selected from the group consisting of blood, plasma, serum, and cerebrospinal fluid. Claim 9 delete Claim 10 A method for providing information for the diagnosis of mild cognitive impairment or Alzheimer's dementia, comprising: a step of measuring the expression level of a TIMP-3 protein and / or a gene encoding the same from a biological sample isolated from a subject; a step of comparing the measured expression level with a level measured from a normal control sample; and a step of determining mild cognitive impairment or Alzheimer's dementia if the expression level of the gene encoding the TIMP-3 protein measured in the biological sample is lower than the level measured in the normal control sample; wherein the biological sample is one or more selected from the group consisting of blood, plasma, serum, and cerebrospinal fluid. Claim 11 delete

Images