Biomarker composition for isolating myogenic progenitor cell differentiated from embryonic stem cell line

Abstract

The present invention relates to a biomarker for isolating myogenic progenitor cells derived from embryonic stem cells cultured in vitro, and the cell isolation technology according to the present invention is useful for the manufacture of cell therapy agents using muscle stem cells and for the production of cultured meat.

Description

Technology Field

[0001] The present invention relates to a biomarker composition for isolating myogenic progenitor cells, and more specifically, to a technique for isolating myogenic progenitor cells derived from embryonic stem cells cultured in vitro using a myogenic progenitor cell-specific marker. Background Technology

[0002] Research on muscle development utilizes pluripotent stem cells (PSCs) induced by in vivo signaling pathways in vitro This has been conducted through models. Directed differentiation of pluripotent stem cells into the presomitic mesoderm (PSM) occurs through WNT / β-catenin signaling activation, and several studies have prevented cell fate drift into the lateral plate mesoderm (LPM) by incorporating BMP signaling inhibition. Using these methods and key growth factors, mature muscle fibers were formed in the absence of serum (Zhao M et al., Stem Cell Reports 15 , 80-94, 2020 ; Chal J et al ., Nature Biotechnology, 33 , 962-U207, 2015; Chal J et al . Nat Protoc, 11 , 1833-50, 2016).

[0003] Understanding the molecular mechanisms underlying muscle development has long led to extensive research, as it provides a crucial insight into regenerative medicine and disease modeling. Furthermore, cross-species comparative developmental studies contribute to evolutionary biology and translational research, bridging the gap between animal models and human applications. Among various animal models, research on in vitro skeletal muscle development in pigs is particularly important because pigs are not only key models in preclinical studies and comparative developmental biology but also major livestock. In this regard, various researchers are focusing on pig muscle development for agricultural uses, particularly for the production of cultured meat.

[0004] In the process of muscle development, muscle stem cells (MuSCs), such as quiescent myogenic satellite cells and activated myoblasts, can proliferate in vitro to form muscle; therefore, these cell types are considered target cell types in the aforementioned academic and industrial applications. However, in vivo-derived MuSCs have limited in vitro proliferative capacity due to cellular senescence, requiring a continuous supply of cells. Consequently, it is required to obtain myogenic progenitor cells similar to MuSCs from pluripotent stem cells capable of unlimited in vitro proliferation. Muscle production based on the directed differentiation of pluripotent stem cells (PSCs) follows natural developmental processes rather than transformation, making it useful for applications such as in-depth developmental research, regenerative medicine (cell therapy, disease modeling, etc.), and cultured meat production. However, these methods have been reported to have low efficiency, variation, and heterogeneity. In this regard, studies on directed myogenic differentiation using human pluripotent stem cells have used single-cell RNA-seq technology to identify myogenic progenitor-specific markers in heterogeneous cultures and isolate cells with myogenic competency (Xi H et al., Cell Stem Cell, 27 , 181-185, 2020; Nalbandian M et al., Life SciAlliance, 5., 2022).

[0005] Pluripotent stem cells (PSCs), including embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs), were established relatively recently in pigs, and in vitro differentiation into muscle has been attempted; however, studies on the discovery of in vitro-derived myogenic progenitor-specific markers have not been conducted (Conrad JV et al., Stem Cell Reports 18 , 2328-2343.,2023;Zhu G et al., Nat Commun, 14 , 8163., 2023).

[0006] Meanwhile, cases have been reported in pigs using markers such as CD56 and CD29 to isolate muscle stem cells (MuSCs) from in vivo muscle tissue containing various cell types, such as fibroblasts, endothelial cells, and immune cells, in addition to muscle fibers and muscle stem cells (MuSCs) (Ding S et al., Cell Death Discov, 3 , 17003, 2017; Choi KH, et al., Food Sci Anim Resour, 40 , 852-859. 2020).

[0007] However, these markers target in vivo-derived muscle stem cells (MuSCs) and may not be suitable for the purification of in vitro-derived myogenic progenitors. Therefore, technologies to discover PSC-derived myogenic progenitor-specific markers and purify these cells are essential for enhancing application potential in academia and industry.

[0008] Accordingly, the inventors of the present invention have made diligent efforts to develop a method for effectively isolating myogenic progenitor cells derived from embryonic stem cells. As a result, they discovered a marker specifically expressed in myogenic progenitor cells derived from porcine embryonic stem cell lines, and confirmed that by using an antibody against said marker to isolate the cells, embryonic stem cell-derived myogenic progenitor cells can be effectively isolated and cultured in concentration, thereby completing the present invention. The problem to be solved

[0009] The objective of the present invention is to provide a composition capable of effectively isolating embryonic stem cell-derived myogenic progenitor cells in vitro. means of solving the problem

[0010] To achieve the above objective, the present invention provides a biomarker composition for isolating myogenic progenitor cells comprising ADAM22.

[0011] In addition, the present invention provides a composition for isolating myogenic progenitor cells comprising a preparation for detecting ADAM22.

[0012] In addition, the present invention provides a kit for isolating myogenic progenitor cells comprising the above composition.

[0013] In addition, the present invention provides embryonic stem cell-derived myogenic progenitor cells in which the expression of ADAM22 is increased. Effects of the invention

[0014] Through the cell separation technology according to the present invention, it is possible to homogeneously concentrate cell populations developing into myogenic lineages within differentiation cultures mixed with non-muscular cells, and this is useful for in-depth research on muscle development biology, manufacturing of cell therapies, and production of cultured meat by applying it to in vitro cell culture modeling of muscle. Brief explanation of the drawing

[0015] Figure 1A shows the morphology of porcine embryonic stem cell lines and AP staining results. Figure 1B shows the qPCR results for pluripotency markers of porcine embryonic stem cell lines (ESCs). Porcine embryonic fibroblast (PEF) expression data were normalized to 1. Data are mean ± SEM. The significance of differences was determined by a two-sided t-test and is indicated by different letters. n = 3 repeats. p < 0.05. Figure 1C shows the results of immunostaining for pluripotency markers on porcine embryonic stem cell lines. Figure 1D shows a cell image of an embryoid (EB) derived from a porcine embryonic stem cell line. Figure 1E shows the qPCR results for pluripotency (OCT4, SOX2, and NANOG) and differentiation markers (AMY2 for endoderm, BMP4 for mesoderm, and PAX6 for ectoderm) of undifferentiated porcine embryonic stem cell lines (Undiff.) and cells differentiated via EB formation (EB diff.). Undiff. expression data were normalized to 1. Data are mean ± SEM. The significance of differences was determined by a two-sided t-test. n = 3 replicates. p < 0.05. Figure 2A shows the experimental scheme for directed myogenic differentiation of porcine embryonic stem cell lines. CHIR: CHIR99021, LDN: LDN193189, FGF: FGF2, and IGF: IGF1. qPCR results of cells under PSM differentiation conditions. Undifferentiated embryonic stem cell (Undiff.) expression data were normalized to 1. Data are mean ± SEM. Significance of differences was determined by a two-sided t-test and expressed in different letters. n = 3 replicates. p < 0.05. Figure 2B shows the qPCR results for pluripotency (NANOG), early mesoderm (T), posterior PSM (MSGN1, TBX6 and CDX2) and LPM marker (BMP4) in cells on day 4 of differentiation. Figure 2C shows the qPCR results for forward PSM markers (PAX3, FOXC2, and DLL1) and non-myogenic lineage markers including LPM (BMP4), endoderm (SOX17), and nervous lineage (SOX2) in cells on day 6 of differentiation. Figure 2D shows the results of immunostaining of the pMSGN1-EGFP reporter cell line differentiated into PSM. Figure 2E shows the qPCR results for forward PSM / SM (PAX3, FOXC2, and DLL1), myogenic lineage (PAX7, MYF5, MYOD1, MYOG, and MHC), and non-myogenic lineage markers including LPM (BMP4), endoderm (SOX17), and neural lineage (NES) in cells differentiated at days 8, 12, 15, 20, 25, and 30. Undifferentiated ESC (Undiff.) expression data were normalized to 1. Data were mean ± SEM, with n = 3 replicates. Figure 2F shows the results of immunostaining for myogenic markers in differentiated cells of porcine embryonic stem cell lines. In each set of marker images, the left image shows merged staining, the top right image shows marker-specific staining, and the bottom right image shows nuclear staining. Figure 3A shows a UMAP image showing the cell population identified in scRNA-seq. Figure 3B shows a cluster dendrogram illustrating hierarchical and stepwise grouping. Figure 3C shows the AddModuleScore results for the Myogenic population. Myogenic_score represents the adjusted average expression values ​​for a set of genes including AXIN2, PAX3, TCF15, SIX1, PAX7, NFIA, CCNB2, MYF5, MYOD1, MYOG, DES, TNNT3, and MYH3, and is normalized for background expression variability using control genes. Figure 3D is a dot plot of the expression of a set of genes. Figure 3E is a graph of the relative proportions of cell types. Figure 3F is a proportion graph showing the distribution of the Myogenic population across the entire sample. Figure 4A is a feature plot showing the expression of CDH15, ADAM22, and CD29 during the discovery of specific markers for myogenic progenitor cells derived from porcine embryonic stem cell lines. Figure 4B shows an immunohistochemical image of in vivo-derived muscle stem cells (in vivo-derived MuSCs) derived from porcine tissue. Figure 4C shows an immunostaining image of an unsorted culture derived from a porcine embryonic stem cell line. Figure 4D shows immunostaining images for each marker in sorted myogenic progenitor cells derived from porcine embryonic stem cell lines. Markers (green) and nuclei (red). Figure 4E shows a representative image of sorted myogenic progenitor cells derived from porcine embryonic stem cell lines. Figure 4F shows the qPCR results of PAX7, MYF5, and MYOD1 expression in sorted myogenic progenitor cells derived from porcine embryonic stem cell lines under maintenance conditions. Figure 4G shows the qPCR results of MHC expression in sorted and differentiated myogenic progenitor cells derived from porcine embryonic stem cell lines under terminal differentiation conditions. Expression data for unsorted cells were normalized to 1. Data are mean ± SEM. Significance of differences was determined by a two-sided t-test and expressed in different letters, with n = 3 replicates. p < 0.05. Figure 4H shows immunohistochemical images for myogenicity markers in sorted and differentiated myogenicity progenitor cells derived from porcine embryonic stem cell lines under terminal differentiation conditions. Specific details for implementing the invention

[0016] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by a skilled expert in the art to which this invention pertains. In general, the nomenclature used herein is well known and commonly used in the art.

[0017] In vivo muscle stem cells ( in vivo In the case of nephrogenic stem cells (MuSCs), in vitro proliferation is limited due to cellular senescence. To overcome this limitation, there has been a demand for technology to obtain myogenic progenitor cell types similar to muscle stem cells (MuSCs) from pluripotent stem cells (PSCs) capable of unlimited in vitro proliferation.

[0018] Muscle production based on the directed differentiation method of pluripotent stem cells (PSCs) follows natural developmental processes without the need for transformation, making it easy to apply in fields such as in-depth developmental research, regenerative medicine (cell therapy, disease modeling, etc.), and cultured meat production. However, this method requires improvement as low efficiency, variability, and heterogeneity have been identified. Although there have been reports in pigs using markers such as CD56 and CD29 to isolate muscle stem cells (MuSCs) from muscle tissue, these markers target in vivo-derived MuSCs and are not suitable for the purification of in vitro-derived myogenic progenitor cells.

[0019] Accordingly, the present invention has developed a technology to discover specific markers for myogenic progenitor cells (PSC-derived myogenic progenitor cells) derived from porcine embryonic stem cells (or pluripotent stem cells) and to isolate the myogenic progenitor cells.

[0020] In this invention, a directed myogenic differentiation method was applied to porcine embryonic stem cell lines (ES cell lines), and myogenic populations were identified from heterogeneous cultures using single-cell RNA sequencing (scRNA-seq) technology. In particular, CDH15 and ADAM22, which are specific markers for myogenic progenitors, were discovered. By establishing a technique to selectively isolate and purify ES cell line-derived myogenic progenitors using these markers, an in vitro method for isolating myogenic progenitors was developed to resolve the issues of continuous cell supply for in vivo muscle stem cells (in vivo-derived MuSCs) and heterogeneity during directed myogenic differentiation of pluripotent stem cells (PSCs).

[0021] The term "stem cell" refers to an undifferentiated cell that can differentiate into a specific tissue cell, and may include a totipotent cell that can differentiate into all types of cells or a pluripotent cell that can differentiate into one or more types of cells.

[0022] In one embodiment, the stem cells may be embryonic stem cells (ESCs), and embryonic stem cells may refer to cells obtained by extracting an inner cell mass from a blastocyst embryo just before the fertilized egg implants in the mother's uterus and culturing it in vitro. The embryonic stem cells may be cells derived from mammals, for example, humans, mice, rats, primates, cattle, horses, pigs, dogs, sheep, goats, or cats, but preferably may be porcine embryonic stem cells.

[0023] In the present invention, "myogenic progenitor cell" refers to a cell capable of differentiating into a myogenic lineage, and includes cells with characteristics similar to muscle stem cells, such as quiescent muscle satellite cells and activated myoblasts.

[0024] Accordingly, the present invention relates to a biomarker composition for isolating myogenic progenitor cells comprising ADAM22.

[0025] In the present invention, the biomarker composition may further include CDH15.

[0026] In the present invention, ADAM22 and CDH15 may be characterized as being expressed on the cell surface. In an embodiment of the present invention, magnetic activating cell sorting (MACS) was performed using magnetic particles coated with antibodies that bind to specific cell surface antigens. As a result, it was confirmed that ADAM22 and CDH15 can homogenously separate and concentrate myogenic progenitor cells, and through this, it was confirmed that epitopes recognized by antibodies that specifically bind to ADAM22 and CDH15 exist on the cell surface and are located in the extracellular domain.

[0027] In the present invention, the biomarker composition may be used for isolating myogenic progenitor cells derived from embryonic stem cells. Furthermore, the biomarker composition may be used for isolating and concentrating myogenic progenitor cells present in a cell population cultured from embryonic stem cells.

[0028] In the present invention, the embryonic stem cells may be characterized as being of porcine origin.

[0029] In the present invention, the myogenic progenitor cells may be characterized by additionally expressing one or more markers selected from the group consisting of MYF5 and MYOD1. In an embodiment of the present invention, it was confirmed that the myogenic progenitor cells of the present invention isolated with ADAM22 and / or CDH15 showed increased expression of MYF5 and MYOD1 compared to non-myogenic cells, and through this, the myogenic progenitor cells of the present invention isolated with ADAM22 and / or CDH15 showed increased expression of MYF5 + MYOD1 + It was confirmed that it is composed of cells similar to myoblasts.

[0030] In addition, the present invention relates to a composition for isolating myogenic progenitor cells comprising a preparation for detecting ADAM22.

[0031] In the present invention, the origin of the progenitor cell of the present invention may be an embryonic stem cell, and more preferably, the embryonic stem cell may be of porcine origin.

[0032] In the present invention, the composition may further include a preparation for detecting CDH15.

[0033] The above preparation may include one or more selected from the group consisting of an antibody that specifically binds to ADAM22 or its antigen-binding fragment, an oligopeptide, a ligand, a peptide nucleic acid (PNA), and an aptamer.

[0034] In this specification, "antibody" is a term known in the art and refers to a specific immunoglobulin directed toward an antigenic site. The antibody in the present invention refers to an antibody that specifically binds to ADAM22, which is a biomarker for isolating myogenic progenitor cells of the present invention, and the antibody may be prepared according to conventional methods in the art. The forms of the antibody include polyclonal antibodies or monoclonal antibodies, and include all immunoglobulin antibodies. The antibody refers to a complete form having two full-length light chains and two full-length heavy chains.

[0035] In addition, the present invention relates to a kit for isolating myogenic progenitor cells comprising the above composition.

[0036] The kit of the present invention may include an antibody that specifically binds to a marker component, a magnetic particle conjugate provided in a form in which a magnetic particle (magnetic bead) is directly bound to the antibody or bound to a secondary antibody capable of binding to the antibody, an antibody conjugate in which a color-developing label is bound to the antibody or secondary antibody, a color-developing substrate solution to react with the label, a washing solution, and an enzyme reaction stopping solution, and may be manufactured in a plurality of separate packages or compartments containing the reagent components used.

[0037] The above-mentioned color-developing label is preferably a conventional color-developing agent that undergoes a color-developing reaction, and fluorescent substances such as HRP (horseradish peroxidase), alkaline phosphatase, colloid gold, FITC (poly L-lysine-fluorescein isothiocyanate), RITC (rhodamine-B-isothiocyanate), and dyes may be used.

[0038] Through such an antigen-antibody binding-based detection or labeling process, myogenic progenitor cells expressing the marker can be selectively identified, and subsequent cell separation can be performed using Magnetic-Activated Cell Sorting (MACS), Fluorescence-Activated Cell Sorting (FACS), antibody-bead binding-based separation, or other selective cell separation methods based on marker expression.

[0039] In addition, the present invention relates to embryonic stem cell-derived myogenic progenitor cells having increased expression of ADAM22.

[0040] In the present invention, the myogenic progenitor cell is CDH15 + and ADAM22 + It may be a cell. Furthermore, the above-mentioned myogenic progenitor cell may be a myogenic cell in which the expression of CDH15 and ADAM22 is increased by more than twofold compared to the non-myogenic cell population.

[0041] The embryonic stem cell-derived myogenic progenitor cell of the present invention may be a differentiated myogenic progenitor cell isolated by the method for isolating embryonic stem cell-derived myogenic progenitor cells described below.

[0042] In addition, the present invention relates to a method for isolating embryonic stem cell-derived myogenic progenitor cells comprising the following steps:

[0043] (a) A step of inducing myogenic lineage cells from embryonic stem cells in vitro;

[0044] (b) a step of separating the above-mentioned progenitor lineage cells into single cells; and

[0045] (c) A step of isolating and concentrating progenitor cells expressing ADAM22 from the above single-cell colony.

[0046] In the present invention, step (c) may be characterized by isolating myogenic progenitor cells expressing ADAM22 and / or CDH15.

[0047] In the present invention, step (c) may be characterized by isolating myogenic progenitor cells that co-express a muscle stem cell marker selected from the group consisting of CD56, CD29, and Pax7.

[0048] In the present invention, the isolation of the myogenic progenitor cells may be characterized by using antibodies.

[0049] In the present invention, the separation of the myogenic progenitor cells may be characterized by being performed using Magnetic-Activated Cell Sorting (MACS), Fluorescence-Activated Cell Sorting (FACS), or other selective cell separation methods based on marker expression.

[0050] In the present invention, the embryonic stem cells may be characterized as being of porcine origin.

[0051] In the present invention, the step of inducing myogenic lineage cells from embryonic stem cells in vitro in step (a) can be performed through the treatment of signaling molecules. In one embodiment of the present invention, myogenic lineage cells were induced by sequentially administering CHIR99021, LDN-193189 (Cayman chemical), FGF2, HGF, and IGF-I to porcine embryonic stem cells at controlled concentrations, but the invention is not limited thereto and can be performed by administering commonly known myogenic lineage cell inducing substances.

[0052] The method of the present invention can be applied to cell enrichment through cell sorting based on marker expression, and can be applied to mass culture, homogeneous culture, differentiation studies and molecular biological analysis, and can be applied to the identification of myogenic progenitor-specific lineage markers.

[0053] The method of the present invention can be applied to provide an alternative cell source for in vivo-derived muscle stem cells (MuSCs). By applying it to cell culture modeling representing muscle stem cells (MuSCs) and their derivative lines in mammals, including pigs, it can be utilized as a useful in vitro tool for in-depth research on muscle development biology.

[0054] The method of the present invention can also be utilized in the field of regenerative medicine for cell therapy and modeling of muscle-related diseases, and can be applied to improve the efficiency of cultured meat production in the field of cell agriculture.

[0055] The present invention can also be utilized in ungulates and livestock such as cattle, horses, sheep, and goats that share developmental biological characteristics with pigs.

[0056] In the present invention, the method for isolating a myogenic cell population may, in some embodiments, utilize any known method for isolation based on such markers. In some embodiments, the isolation is an affinity or immunoaffinity-based isolation. For example, isolation comprises the isolation of cells and cell populations based on the expression level of one or more markers, typically cell surface markers, or the expression of cells, by means of a washing step and separation of cells bound to the antibody or binding partner from cells not bound to the antibody or binding partner, for example, after incubation with an antibody or binding partner that specifically binds to the marker. Such separation steps may be based on positive selection, in which cells bound to the reagent are retained for further use, and / or negative selection, in which cells not bound to the antibody or binding partner are retained.

[0057] Separation does not necessarily result in the enrichment or removal of a specific cell population or cells expressing a specific marker. For example, positive selection or enrichment of a specific type of cell, such as cells expressing a marker, refers to increasing the number or percentage of such cells, but does not necessarily result in the complete absence of cells not expressing the marker. Likewise, negative selection, removal, or depletion of a specific type of cell, such as cells expressing a marker, refers to decreasing the number or percentage of such cells, but does not necessarily result in the complete removal of all such cells. In some examples, multiple separation steps are performed, where the fractions selected positively or negatively from one step undergo another separation step, such as subsequent positive or negative selection. In some examples, a single separation step may deplete cells simultaneously expressing multiple markers by culturing cells with multiple antibodies or binding partners specific to the marker targeted for negative selection, for example. Likewise, multiple cell types may be simultaneously positively selected by culturing cells with multiple antibodies or binding partners expressed on various cell types.

[0058] [Example]

[0059] The present invention will be described in more detail below through examples. These examples are solely for illustrating the present invention, and it will be obvious to those skilled in the art that the scope of the present invention is not to be interpreted as being limited by these examples.

[0060] Experimental Example 1: Maintenance of porcine embryonic stem cell line (ES cell line)

[0061] The porcine embryonic stem cell line (ES cell line) used was the cell line established by the inventors et al. and reported in Stem Cell Reports (2019), and cultured by the following method (Choi, Kwang-Hwan, et al., Stem cell reports 13.1 221-234, 2019).

[0062] ESC medium supplemented with 20 ng / mL FGF2 (Thermo Fisher Scientific), 5 ng / mL ActA (R&D Systems), 1.5 μM CHIR99021 (Cayman Chemical), and 2.5 μM IWR-1 (Sigma-Aldrich) was replaced every 24 hours and cultured at 37°C under humidified conditions containing 5% CO2. The ESC medium consisted of DMEM / F12 (all from Gibco) containing 15% (v / v) KSR, 0.1% (v / v) LC, 1x Glutamax, 0.1 mM β1x MEM nonessential amino acids, and 1x antibiotic-antimycotic.

[0063] Experimental Example 2: Directed myogenic differentiation of porcine embryonic stem cell lines (ES cell lines)

[0064] Porcine embryonic stem cell lines (ES cell lines) were dissociated into small colonies using TrypLE™Express (Gibco) and then passaged in Geltrex (Gibco) coated dishes at a 1:4 ratio using ESC medium containing 20 ng / mL FGF2, 5 ng / mL ActA, 1.5 μM CHIR99021, 2.5 μM IWR-1, and 10 μM Y-27632 (Cayman Chemical). Within 24 hours of passing, the medium was replaced with stepwise 'myogenic differentiation medium' supplemented with signaling molecules as follows.

[0065] Myogenic differentiation medium: DMEM / F12 (all from Gibco) containing 15% (v / v) KSR, 0.1% (v / v) LC, 1x Glutamax, 0.1 mM β1x MEM nonessential amino acids, and 1x antibiotic-antimycotic.

[0066] Stepwise Myosomal Differentiation Medium

[0067] ① 3μM CHIR99021 and 0.05μM LDN-193189 (Cayman Chemical) for 4 days ('CL-medium')

[0068] ② 3μM CHIR99021, 0.05μM LDN-193189, and 20ng / mL FGF2 for 2 days ('CLF-medium')

[0069] ③ 10 ng / mL HGF (R&D Systems), 2 ng / mL IGF-I (R&D Systems), 20 ng / mL FGF2, and 0.05 μM LDN-193189 ('HIFL-medium') for 2 days

[0070] ④ 2 ng / mL IGF-I ('I-medium') for 4 days

[0071] Next, 2 ng / mL IGF-I and 10 ng / mL HGF ('IH-medium') were cultured for a continuous culture period.

[0072] Experimental Example 3: Spontaneous differentiation of porcine embryonic stem cell lines (ES cell lines)

[0073] Cultured porcine embryonic stem cell lines were dissociated using TrypLE™Express and cultured for 5 days in ultra-low-attachment plates (Sigma-Aldrich) containing DMEM (Welgene) with 15% (v / v) FBS and 10 μM Y-27632 (day 1 only). After suspension culture, the formed EBs were seeded onto 0.1% (w / v) gelatin-coated plates and cultured in DMEM containing 15% (v / v) FBS for 2–3 weeks.

[0074] Experimental Example 4: Purification of porcine embryonic stem cell line-derived myogenic progenitors using a self-activating cell separation system (MACS)

[0075] Cultures differentiated from porcine embryonic stem cell lines (ES cell line) were isolated as single cells using TrypLE™Express and sorted using a magnetically activated cell separation system (MACS) (Miltenyi Biotec). Cells were reacted with primary antibodies (CDH15; United States Biological; 1:100 or ADAM22; Abcam; 1:100) and microbeads (Miltenyi Biotec). Positive cells were sorted on a magnetic-mediated column (Miltenyi Biotec).

[0076] Experimental Example 5: Culture of porcine in vivo-derived muscle stem cells (in vivo-derived MuSCs) and embryonic stem cell line-derived myogenic progenitor cells (ES cell line-derived myogenic progenitor)

[0077] In vivo-derived porcine muscle stem cells (in vivo-derived MuSCs) and ES cell line-derived myogenic progenitors were cultured in Geltrex-coated dishes in SkGM-2 supplemented with 20 μM SB203580, respectively. The medium was changed every 24 hours, and cells were cultured at 37°C under humidified conditions containing 5% CO2. For final differentiation into myotubes, confluent cells were cultured in a differentiation medium consisting of DMEM containing 2% (V / V) KSR, 1x Glutamax, 1x Antibiotic-Antimycotic, and 0.1 mM β-mercaptoethanol.

[0078] Experimental Example 6: Gene expression analysis PCR (qPCR)

[0079] Total RNA was extracted using the TRIzol reagent (Invitrogen, Carlsbad, USA), and cDNA was synthesized using the High-Capacity RNA-to-cDNA Kit (Applied Biosystems, Waltham, MA, USA). cDNA was amplified using the primer set listed in Table 1 and PowerSYBR Green PCR Master Mix (Applied Biosystems).

[0080] Gene Primer sequence (5' > 3') order number Annealing Temperature (℃) Product size (bp) GAPDH F TGCTCCTCCCCGTTCGAC 1 60 100 R ATGCGGCCAAATCCGTTC 2 T F CTGTGAGAGGTATCCTGCCCT 3 60 184 R GGGACTCATGGGAAACATGC 4 MSGN1 F AACTACCTGCCACCGGTCTA 5 60 111 R TCCGCTGTTGAGAAGGTCTG 6 TBX6 F TCATCTCCGTGACAGCCTATCA 7 60 137 R CCGCAGTTTCCTCTTCACACGG 8 CDX2 F GCCAAGTGAAAACCAGGACGA 9 60 120 R GCTCGGCCTTTCTCCGAATG 10 PAX3 F CTGCCGACTTCTCAGTCTTATT 11 60 98 R CTTTGTCCATACTGCCCATACT 12 FOXC2 F CTGGACCCGGACTCCTACAA 13 60 206 R TCGCTCTTGATCACCACCTTC 14 DLL1 F GACGAGCAGCATGGGTTTTG 15 60 146 R CCTTCCTGGCAGTTGCATTG 16 HES7 F CCGGGATCGAGCGGAGAA 17 64 204 R CGGCTTCGCTCCCTCAAGTAG 18 PAX7 F GTGCCCTCAGTGAGTTCGAT 19 58 152 R TCCAGACGGTTCCCTTTGTC 20 MYF5 F AGTTCGGGGACGAGTTTGAG 21 60 232 R TCAAACGCCTGGTTGACCTT 22 MYOD1 F AGGGACAGGATAGAGCAGGG 23 60 199 R TCAAATCTACGTCGCGGAGC 24 MYOG F GAGCTGTATGAGACATCCCCC 25 60 75 R GTGGACGGGCAGGTAGTTTT 26 MHC F ACAGTGAAGACGGAAGCAGG 27 60 153 R TGCGTAACGCTCTTTGAGGT 28 BMP4 F CGTTGGTCTCGAGTATCCCG 29 60 106 R AGAGTTTTCGCTGGTCCCTG 30 SOX17 F TGGTTGAATCTTGAGGTCTGC 31 60 119 R CAGGGTGTAGGTGTGTGATGA 32 NES F TGCCTGGGGGAGGAATCTTTT 33 60 252 R CTCTTCAGCCAGGTTGTCGC 34 OCT4 F CTTGGAGAGCCCTGGTTTTACT 35 60 159 R GCCAGGTCCGAGGATCAAC 36 SOX2 F CGGCGGTGGCAACTCTAC 37 60 100 R TCGGGACCACACCATGAAAG 38 NANOG F CATCTGCTGAGACCCTCGAC 39 60 195 R GGGTCTGCGAGAACACAGTT 40 AMY2 F TGCTCTTGAATGTGAGCGGT 41 60 206 R TACGGACGCCAACGTTGTTA 42 PAX6 F AGAGAAGACAGGCCAGCAAC 43 60 169 R GGCAGAGCACTGTAGGTGTT 44

[0081] 실험예 7: 면역세포화학(ICC) 분석

[0082] Cells fixed with 4% (v / v) paraformaldehyde were permeabilized using 0.4% Triton X-100 (Sigma-Aldrich) at 4°C for 48 hours. After washing twice with DPBS, samples were treated with 10% (v / v) goat or donkey serum (blocking solution) for 1 hour, followed by incubation with primary antibodies (listed in Table 2) at 4°C for 24 hours. After incubation with the primary antibodies, cells were treated with Alexa Fluor-conjugated secondary antibodies at 4°C for 24 hours. Nuclei were stained with Hoechst 33342 (Molecular Probes, Eugene, OR, USA). Images were captured using a CELENA X high-content imaging system (Logos Biosystems, Anyang, Korea).

[0083] Antibody Dilution Company Cat # Goat anti-TBX6 1:100 R&D systems Cat# AF4744 Mouse anti-PAX3 25 μg / mL R&D systems Cat# MAB2457 Rabbit anti-PAX7 1:100 Thermo Fisher Scientific Cat# PA5-68506 Rabbit anti-MYOD1 1:100 Thermo Fisher Scientific Cat# PA5-23078 Mouse anti-MHC 1:200 Abcam Cat# ab37484 Mouse anti-FastMHC 1:100 Sigma Cat# M4276 Rabbit anti-DYSTROPHIN 1:100 Abcam Cat# ab15277 Rabbit anti-LAMININ 1:100 Sigma Cat# L9393 Mouse anti-CD29 1:200 for ICC1:100 for MACS R&D systems Cat# MAB17783 Rabbit anti-CDH15 1:200 for ICC1:100 for MACS United States Biological Cat# 362485 Rabbit anti-ADAM22 1:200 for ICC1:100 for MACS Abcam Cat# ab231340 Chicken anti-OCT4 1:100 Abcam Cat# ab134218 Rabbit anti-SOX2 1:200 Millipore Cat# AB5603 Rabbit anti-NANOG 1:200 PeproTech Cat# 500-P236 Mouse anti-SSEA1 1:200 Millipore Cat# MAB4301 Mouse anti-SSEA4 1:200 Millipore Cat# MAB4304 Chicken anti-GFP 1:100 Thermo Fisher Scientific Cat# A10262 GFP Polyclonal Antibody, FITC 1:200 Thermo Fisher Scientific Cat# 600-402-215

[0084] Experimental Example 8: Alkaline Phosphate (AP) Analysis

[0085] Before staining, all cell samples were pre-cultured at 4°C for 10 minutes and fixed with 4% paraformaldehyde for 15 minutes. After washing with DPBS (Welgene), the fixed cells were stained at room temperature for 30 minutes using a buffer solution containing nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphate toluidine salt stock solution (Roche, Basel, Switzerland). The stained cells were observed under an inverted microscope.

[0086] Experimental Example 9: Single-cell RNA sequencing (scRNA-seq)

[0087] Myogenically differentiated cells derived from porcine embryonic stem cell lines were subjected to single-cell RNA sequencing. Samples cultured for 24 hours in IH medium containing 10 μM Y-27632 were dissociated using TrypLE™ Express. cDNA library preparation and single-cell RNA-Seq analysis were performed at ROKIT Genomics (https: / / rokitgenomics.com / , Seoul, Korea). Viability and cell count were calculated using a LUNA-FX7™ Automated Fluorescence Cell Counter (Logos Biosystems) prior to constructing the 10x Genomics single-cell RNA-seq library. The scRNA-seq library was constructed according to the 10x Chromium Next GEM Single Cell 3' v3.1 protocol (10x Genomics) using the 10x Chromium iX system and the Next GEM Single Cell 3' GEM Kit v3.1 (10x Genomics, Pleasanton, CA, USA). The constructed library was quantified using the NovaSeq 6000 system (Illumina, San Diego, CA, USA).

[0088] Experimental Example 10: scRNA-seq data analysis

[0089] Raw sequencing data in FASTQ format were processed using the Cell Ranger v7.0.1 count pipeline (10x Genomics), and reads were aligned against the Sus scrofa 11.1 reference genome (Ensembl Release 108) with the "Include Introns" parameter enabled. After alignment, Unique Molecular Identifier (UMI) counts and barcode assignments were performed. The filtered count matrix generated by Cell Ranger was subsequently used for downstream analysis using the Seurat package v4.3.0. For quality control, cells with a mitochondrial transcript ratio exceeding 20%, fewer than 1,000 UMI counts, or fewer than 200 detected features were excluded. The filtered dataset was normalized using the SCTransform package, which applies a negative binomial regression model with normalized parameters. The datasets were integrated using a series of Seurat functions, including Select Integration Features, PrepSCT Integration, Find Integration Anchors, and Integration Data, while considering the batch effect. After PCA using the RunPCA function, the top 17 principal components (PCs) were selected to perform shared nearest neighbor (SNN)-based clustering. UMAP was applied for cluster visualization with a resolution of 0.4. Dendrograms were constructed using the hclust function with the complete linkage method (method = complete). Differentially expressed genes (DEGs) between samples were identified using the FindMarkers function.The AddModuleScore function was used to calculate the module score for each cell by averaging the gene set expression while adjusting for expression variability using the background score derived from the control gene.

[0090] Example 1: Recapitulation of skeletal muscle development in porcine embryonic stem cell lines (ES cell lines)

[0091] Using porcine embryonic stem cell lines (ES cell lines), cells were induced to differentiate stepwise into a myogenic lineage via cell fate transition. Porcine embryonic stem cell lines with verified pluripotency and differentiation potential into three germ layers were further analyzed (Fig. 1). To direct myogenic differentiation in the porcine embryonic stem cell lines, the differentiation scheme described in Fig. 2A was followed. In the differentiated porcine embryonic stem cell lines, the expression of pluripotency markers decreased, while the expression of early mesoderm and posterior presomitic mesoderm (posterior PSM) markers increased (Fig. 2B). On day 4 of differentiation, the transition from posterior presomitic mesoderm cells to anterior PSM cells was detected by the upregulation of anterior PSM markers (Fig. 2C).

[0092] To characterize the fate of whole-nodular mesoderm cells differentiated from porcine embryonic stem cell lines, specifically the posterior whole-nodular mesoderm stage representing the earliest mesoderm stage, a previously established porcine embryonic stem cell line (pMSGN1-EGFP reporter cell line) carrying an MSGN1 promoter-based reporter was utilized. Reporter activity did not overlap with PAX3 expression, which supports the developmental progression from MSGN1+ posterior whole-nodular mesoderm to PAX3+ forward whole-nodular mesoderm cell fate as previously studied (Fig. 2D). These results indicate that WNT / β-catenin and FGF activation and BMP signaling inhibition pathways induced the porcine embryonic stem cell line to whole-nodular mesoderm cell fate, thereby establishing the basis for subsequent myogenic differentiation.

[0093] During the differentiation process, the expression of anterior whole-node mesoderm / somite (SM) markers increased in the derived cells, and the expression of myogenic lineage markers was upregulated from day 12 of differentiation (Fig. 2E). After the quiescent myogenic satellite cell marker PAX7 increased until day 20 of differentiation, myogenic regulatory factors (MRFs), including MYF5, MYOD1, and MYOG, and the mature muscle cell marker MHC were activated, indicating that muscle stem cells (MuSCs) had entered final myogenic differentiation.

[0094] The gene expression pattern indicates sequential development into anterior whole-node mesoderm, somites, and muscle cells, but differentiation into non-myogenic lineages such as lateral plate mesoderm (LPM) and the nervous system was not completely excluded, as indicated by the expression of BMP4 and NES. Immunostaining confirmed the presence of PAX7 cells in the 21-day culture and MYOD1 cells in the 30-day culture, confirming differentiation into muscle stem cell (MuSC)-like cells and myoblast-like cells, respectively (Fig. 2F). Furthermore, aligned myotube-like structures were observed in the 60-day culture, accompanied by the expression of MHC, Fast MHC, DYSTROPHIN, and LAMININ. Therefore, porcine embryonic stem cell lines were sequentially induced through whole-node mesoderm and somatic cell fates using a directed myogenic differentiation method to reproduce in vivo skeletal muscle development ultimately leading to myogenesis.

[0095] Example 2: Heterogeneity of directed myogenic differentiation strategies revealed by scRNA-seq

[0096] In this example, single-cell RNA sequencing (scRNA-seq) was performed during the process of directed differentiation into the progenitor lineage. scRNA-seq was performed on differentiated cultures on days 8, 12, 20, and 25 to include the cell fate transition points indicated in Fig. 2E. A total of 15 clusters were identified in the cell atlas constructed using Uniform Manifold Approximation and Projection (UMAP). The cell populations were manually annotated using hierarchical and stepwise grouping derived from the cluster dendrogram and the average expression of markers selected from the literature (Figs. 3A and 3B).

[0097] The cellular composition revealed a myogenic population including three subgroups with distinct gene expression profiles—'Myogenic state 1 (Cluster 7), 2 (Cluster 10), and 3 (Cluster 13)'—as well as non-myogenic cell types such as Epithelium, Undifferentiated pluripotent cells (Undiff), Neural progenitor, Neuron, Neural stem cell, Neuroepithelium, and Fibroblast. The AddModuleScore tool was used to ensure cell type annotation (Fig. 3C). A set of myogenic lineage markers covering developmental stages from whole-module mesoderm to mature muscle cells identified the myogenic population (Fig. 3D). The relative percentage of cell types was then quantified to confirm that the proportion of the myogenic population increased throughout the differentiation process (Fig. 3E). Within this group, Myogenic state 1 gradually decreased, while Myogenic state 2 and Myogenic state 3 gradually increased (Fig. 3F). This suggests that during the differentiation process, the cell state transitioned from Myogenic state 1 to Myogenic state 2 and Myogenic state 3.

[0098] Example 3: Enrichment of porcine embryonic stem cell line-derived myogenic progenitors using self-activating cell separation (MACS)

[0099] Markers specific to the myogenic population were screened to distinguish and enrich myogenic progenitors in heterogeneous differentiation cultures identified by the scRNA-seq of Example 2. Cell types were grouped into Myogenic (Myogenic state 1, 2, and 3), Epithelial (Undiff. and Epithelium), Neural (Neuroepithelium, Neural stem cell, Neural progenitor, and Neuron), and Fibroblast populations from the dataset of cultures derived from porcine embryonic stem cell lines. Then, the DEGs of the Myogenic population (log₂FC > 2, p < 0.05) compared to other populations overlapped with the upregulated DEGs of in vivo-derived porcine muscle stem cells (log₂FC > 1.5, p < 0.05) compared to pig embryonic fibroblasts. In these overlapping DEG lists, markers of the myogenic population were screened based on expression levels and antibody availability.

[0100] Consequently, CDH15 (average log₂FC: 2.89 compared to the Epithelial population, 5.45 compared to the Fibroblast population) and ADAM22 (average log₂FC: 2.86 compared to the Epithelial population, 4.42 compared to the Fibroblast population) were selected for further analysis. Additionally, although CD29 was not detected in the overlapping DEG list, it was included because it is a sorting marker commonly used for porcine muscle stem cells (MuSCs).

[0101] CDH15 and ADAM22 were specifically and highly expressed in the myogenic population, whereas CD29 was broadly expressed in most cell types (Fig. 4A). Immunostaining confirmed that the expression of these markers was detected in subsets of in vivo-derived porcine muscle stem cells (in vivo-derived MuSCs) and unsorted porcine embryonic stem cell line-derived differentiation cultures (Figs. 4B and 4C).

[0102] To evaluate whether each marker could be used for isolating myogenic progenitor cells, self-activated cell sorting (MACS) was performed on these unsorted cells.

[0103] Compared to unsorted cells, CDH15+ cells accounted for 7.91%, ADAM22+ cells for 8.10%, and CD29+ cells for 29.09%, confirming that each marker homogeneously concentrates cells expressing that marker (Fig. 4D). Furthermore, MACS analysis confirmed that epitopes recognized by CDH15, ADAM22, and CD29 antibodies were present on the cell surface and located within the extracellular domain. Under proliferation conditions, the isolated cells exhibited a spindle-shaped morphology similar to myoblasts (Fig. 4E).

[0104] Notably, compared to unsorted cells, PAX7 expression in the isolated cells was significantly reduced, while MYF5 and MYOD1 expression was increased (Fig. 4F). This suggests that the isolated population is primarily composed of cells similar to MYF5+MYOD1+myoblasts, rather than a population similar to PAX7+ satellite cells. Under low mitogen differentiation conditions, MHC expression was upregulated in cells differentiated from CDH15+ and ADAM22+ myogenic progenitors, which differed from CD29+ myogenic progenitors, which exhibited heterogeneous cell morphology (Fig. 4G). Despite this heterogeneity, CDH15+ and ADAM22+ myogenic progenitors, as well as CD29+ myogenic progenitors, formed myotube-like structures expressing the mature myogenic markers Fast MHC and DYSTROPHIN (Fig. 4H).

[0105] Therefore, when using CDH15 and ADAM22, myoblast-like myogenic progenitor cells can be homogenously isolated from cells differentiated into myogenic lineages from porcine embryonic stem cell lines compared to CD29.

[0106] Foregoing, specific parts of the present invention have been described in detail. It will be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. Accordingly, the actual scope of the invention is defined by the appended claims and their equivalents.

Claims

Claim 1 Biomarker composition for isolating porcine embryonic stem cell-derived myogenic progenitor cells containing ADAM22. Claim 2 A biomarker composition according to claim 1, characterized in that the ADAM22 is expressed on the cell surface. Claim 3 delete Claim 4 delete Claim 5 In claim 1, the biomarker composition is a biomarker composition for isolating and concentrating myogenic progenitor cells present in a cell population cultured from porcine embryonic stem cells. Claim 6 In claim 1, the biomarker composition further comprises CDH15. Claim 7 A composition for isolating porcine embryonic stem cell-derived myogenic progenitor cells comprising a preparation for detecting ADAM22. Claim 8 In claim 7, the composition further comprises a preparation for detecting CDH15. Claim 9 In claim 7, the composition comprises one or more selected from the group consisting of an antibody or its antigen-binding fragment that specifically binds to ADAM22, an oligopeptide, a ligand, a peptide nucleic acid, and an aptamer. Claim 10 A kit for isolating porcine embryonic stem cell-derived myogenic progenitor cells comprising the composition of claim 1 or the composition of claim 7. Claim 11 delete

Images