AluYb8 oligonucleotide primers set for detecting human derived cells and their uses

KR103016205B1Active Publication Date: 2026-09-09THE CATHOLIC UNIV OF KOREA IND ACADEMIC COOP FOUND
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
KR1020240121465
Authority / Receiving Office
KR · KR
Patent Type
Patents
Current Assignee / Owner
Filing Date
2024-09-06
Publication Date
2026-09-09
Estimated Expiration
2044-09-06

Smart Images

  • Figure 112024098190669-PAT00001_ABST
    Figure 112024098190669-PAT00001_ABST
Patent Text Reader

Abstract

The present invention relates to an AluYb8 oligonucleotide primer set for detecting human-derived cells and the use thereof. An oligonucleotide primer set targeting the AluYb8 gene was designed, and when the AluYb8 primer set of the present invention is used, it was confirmed that human-derived cells can be detected with high accuracy from mammalian-derived cells, particularly primate-derived cells, in a sample. Therefore, it is expected that it can be usefully utilized for purposes such as detecting human-derived cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technology Field

[0001] The present invention relates to an AluYb8 oligonucleotide primer set for detecting human-derived cells and the use thereof. Background Technology

[0002] The polymerase chain reaction (PCR) is a molecular biological technique that replicates and amplifies desired portions of DNA. This technique allows researchers to selectively amplify specific DNA fragments from extremely complex and minute DNA solutions, such as the human genome. Furthermore, because the amplification process is short (approximately 2 hours), the procedure is simple, and it can be performed using fully automated machines, PCR and various technologies derived from it play a critically important role in all areas involving DNA processing, including molecular biology, medicine, criminal investigation, and biological classification.

[0003] Polymerase Chain Reaction (PCR) is broadly divided into general PCR and quantitative PCR. Quantitative PCR is a method developed to enhance the quantitative accuracy of general PCR, and it includes competitive PCR and real-time PCR. Real-time PCR is a technique that monitors and interprets the growth of PCR amplification products in real time; it enables accurate quantification of DNA and RNA, eliminates the need for electrophoresis, allows for rapid and convenient analysis, and offers the advantages of a low risk of contamination. Currently, it has become an essential technique for gene expression analysis and SNP (Single Nucleotide Polymorphism) typing.

[0004] When a real-time PCR reaction is performed using serially diluted standard samples, amplification curves are obtained that are arranged at equal intervals in order of increasing initial DNA content. If a threshold is set at an appropriate point, the Ct value (Threshold Cycle), which is the point where the threshold and the amplification curve intersect, is calculated. Since there is a linear relationship between the Ct value and the initial template amount, a calibration curve can be constructed. Therefore, for unknown samples, the Ct value is calculated in the same way as for standard samples and compared with this calibration curve to determine the initial template amount. In this method, PCR amplification products are detected via fluorescence. There are two main detection methods: the intercalating method and the method using fluorescently labeled probes.

[0005] Primer design is the most critical factor for successful real-time PCR; therefore, primers must be designed to stably anneale the target DNA sequence (within an appropriate range of Tm values), have good PCR reaction efficiency (no sequences complementary to the primer or between primers), and possess high specificity (no mispriming sites on the template DNA).

[0006] Although the process of detecting human-derived cells in samples across a wide range of experimental fields, particularly distinguishing them from evolutionarily close mammalian-derived cells, is essential, there have been few reports on the primers required for this purpose. Prior art literature

[0007] (Republic of Korea Published Patent) No. 10-2023-0070804 The problem to be solved

[0008] The object of the present invention is to provide a composition for detecting human-derived cells comprising, as an active ingredient, an oligo nucleotide primer set consisting of the following primer pairs:

[0009] A forward primer comprising SEQ ID NO. 1, and a reverse primer comprising SEQ ID NO. 2.

[0010] Another object of the present invention is to provide a method for detecting human-derived cells comprising the following steps:

[0011] (S1) a step of using genomic DNA isolated from a sample as a template and amplifying a target sequence using the composition; and

[0012] (S2) A step of detecting the composite of the amplification step.

[0013] Another objective of the present invention is to provide a kit for detecting human-derived cells, comprising the above composition and instructions.

[0014] Another object of the present invention is to provide an oligo nucleotide primer set consisting of the following primer pairs:

[0015] A forward primer comprising SEQ ID NO. 1, and a reverse primer comprising SEQ ID NO. 2.

[0017] However, the technical problems that the present invention aims to solve are not limited to those mentioned above, and other unmentioned problems will be clearly understood by those skilled in the art to which the present invention belongs from the description below. means of solving the problem

[0018] The present invention provides a composition for detecting human-derived cells comprising, as an active ingredient, an oligo nucleotide primer set consisting of the following primer pairs:

[0019] A forward primer comprising SEQ ID NO. 1, and a reverse primer comprising SEQ ID NO. 2.

[0020] In one embodiment of the present invention, the composition may be for distinguishing and detecting human-derived cells from mammalian-derived cells, but is not limited thereto.

[0021] In one embodiment of the present invention, the mammal may include, but is not limited to, primates.

[0022] In one embodiment of the present invention, the primer may target the AluYb8 gene, but is not limited thereto.

[0023] In one embodiment of the present invention, the length of the primer may be 15 to 30 bp, but is not limited thereto.

[0024] The present invention provides a method for detecting human-derived cells comprising the following steps:

[0025] (S1) a step of using genomic DNA isolated from a sample as a template and amplifying a target sequence using the composition; and

[0026] (S2) A step of detecting the composite of the amplification step.

[0027] In one embodiment of the present invention, the method may be for distinguishing and detecting human-derived cells from mammalian-derived cells, but is not limited thereto.

[0028] In one embodiment of the present invention, the mammal may include, but is not limited to, primates.

[0029] In one embodiment of the present invention, the sample may be any one selected from the group consisting of blood, serum, whole blood, plasma, urine, saliva, tissue, cell, organ, bone marrow, fine needle aspiration specimen, core needle biopsy specimen, and vacuum aspiration biopsy specimen, but is not limited thereto.

[0030] The present invention provides a kit for detecting human-derived cells, comprising the above composition and instructions.

[0031] In one embodiment of the present invention, the kit can distinguish and detect human-derived cells from mammalian-derived cells, but is not limited thereto.

[0032] In one embodiment of the present invention, the mammal may include, but is not limited to, primates.

[0033] In one embodiment of the present invention, the description may teach the method, but is not limited thereto.

[0034] The present invention provides an oligo nucleotide primer set consisting of the following primer pairs:

[0035] A forward primer comprising SEQ ID NO. 1, and a reverse primer comprising SEQ ID NO. 2.

[0037] In addition, the present invention provides a use for detecting human-derived cells comprising: an oligo nucleotide primer set consisting of the following primer pairs; or a composition comprising an oligo nucleotide primer set consisting of the following primer pairs as an active ingredient:

[0038] A forward primer comprising SEQ ID NO. 1, and a reverse primer comprising SEQ ID NO. 2.

[0039] In addition, the present invention provides a use for preparing a preparation for detecting human-derived cells comprising: an oligo nucleotide primer set consisting of the above primer pair; or a composition comprising the above primer pair consisting of an oligo nucleotide primer set as an active ingredient.

[0041] In addition, the present invention provides a composition for distinguishing human-derived cells from mammalian-derived cells, comprising as an active ingredient a set of oligo nucleotide primers consisting of the following primer pairs:

[0042] A forward primer comprising SEQ ID NO. 1, and a reverse primer comprising SEQ ID NO. 2.

[0043] In addition, the present invention provides a method for distinguishing human-derived cells from mammalian-derived cells, comprising the following steps:

[0044] (S1) a step of using genomic DNA isolated from a sample containing mammalian-derived cells as a template and amplifying a target sequence using the composition; and

[0045] (S2) A step of detecting the composite of the amplification step.

[0046] In addition, the present invention provides a use for distinguishing human-derived cells from mammalian-derived cells using a composition comprising an oligo nucleotide primer set consisting of the above primer pairs; or an oligo nucleotide primer set consisting of the above primer pairs as an active ingredient.

[0047] In addition, the present invention provides a use for preparing a formulation for distinguishing human-derived cells from mammalian-derived cells, comprising: an oligo nucleotide primer set consisting of the above primer pairs; or a composition comprising an oligo nucleotide primer set consisting of the above primer pairs as an active ingredient. Effects of the invention

[0048] According to the AluYb8 oligonucleotide primer set for detecting human-derived cells and its use, an oligonucleotide primer set targeting the AluYb8 gene was designed, and when the AluYb8 primer set of the present invention is used, it was confirmed that human-derived cells can be detected with high accuracy from mammalian-derived cells, particularly primate-derived cells, in a sample, and it is expected that it can be usefully utilized for purposes such as detecting human-derived cells. Brief explanation of the drawing

[0049] Figure 1 shows the results of confirming the amplification, melt peak, and melt curve when the AluYb8 oligonucleotide primer set of the present invention was used in qPCR. Figure 2 shows the results of detecting human-derived cells from mammalian-derived cells in a sample when the AluYb8 oligonucleotide primer set of the present invention was used in qPCR, compared with when the AluYa5 oligonucleotide primer set was used. Specific details for implementing the invention

[0050] The present invention provides a composition for detecting human-derived cells comprising, as an active ingredient, an oligo nucleotide primer set consisting of the following primer pairs:

[0051] A forward primer comprising SEQ ID NO. 1, and a reverse primer comprising SEQ ID NO. 2.

[0052] The present invention provides an oligo nucleotide primer set consisting of the following primer pairs:

[0053] A forward primer comprising SEQ ID NO. 1, and a reverse primer comprising SEQ ID NO. 2.

[0054] In the present invention, “primer” refers to a single-stranded oligonucleotide sequence complementary to the nucleic acid strand to be copied. Specifically, it may refer to an oligonucleotide that acts as a starting point for synthesis under conditions in which the synthesis of a primer extension compound complementary to a nucleic acid chain (template) is induced, namely, the presence of a polymerizing agent such as a nucleotide and DNA polymerase, and a suitable temperature / pH. Accordingly, in the present invention, “primer” can be interchangeably used as an “oligonucleotide primer.”

[0055] Since primers can act as initiators for the synthesis of primer extension compounds, their length and sequence must allow for the initiation of the extension compound's synthesis. The specific length and sequence of the primer may depend on the complexity of the required DNA or RNA target, as well as primer usage conditions such as temperature and ionic strength. Primers typically consist of 15 to 30 bases and can be in DNA or RNA form. Generally, they can be composed of bases such as A (adenine), T (thymine), G (guanine), and C (cytosine), depending on the base composition of the nucleic acid.

[0056] In PCR, primers are single gene fragments that bind complementarily to the specific gene to be amplified, playing the role of initiating the DNA synthesis process. The preceding steps of PCR can be listed as denaturation, annealing, and extension. During the annealing step, primers perform the function of binding to the complementary base sequence of a specific gene region to enable specific gene synthesis.

[0057] It binds to the base sequence complementary to the specific gene region to be amplified, specifically binding to a specific sequence (corresponding to the ALU sequence in the specification) to initiate the replication process. Specifically, a DNA replication enzyme (polymerase) binds to this site to start the amplification process; the replication enzyme binds to the 3' end of the primer and extends the DNA poly chain based on this.

[0058] At this point, as the PCR reaction proceeds by triggering a chain reaction, the product size can be determined as the number between the number of bases of the forward primer and the reverse primer that bind to the complementary base sequence of a specific gene region.

[0059] In the present invention, “complementary” means sufficiently complementary to the extent that a primer or probe selectively hybridizes to a target nucleic acid sequence under specific annealing or hybridization conditions, and encompasses both substantially complementary and perfectly complementary cases, specifically referring to the perfectly complementary case. In this specification, the term “substantially complementary sequence” includes not only perfectly matching sequences but also sequences that are partially mismatched with the sequence to the extent that they can serve as a primer after annealing to a specific sequence.

[0060] Meanwhile, mammalian genomes contain short scattered DNA repeats (SINES). In humans, the major family of this type can be represented by Alu repeat sequences. These repeats are widely found in human DNA, estimated at 900,000 in the haploid human genome, with an average distance between copies of 4 kilobases. It is known that this distance shows significant differences, as Alu sequences appear to be abundant in certain chromosomal regions and scarce in others. Repetitive elements homologous to human Alu repeats have also been found in mammalian genomes, including rodents. In this case, Alu repeat sequences can be classified into AluYa, AluYb, etc., depending on the degree of variation. In one embodiment of the present invention, the primer may target the AluYb8 gene, but is not limited thereto.

[0061] In the present invention, the term “primer” may include forward and reverse primers. Additionally, since the primers of the present invention target the AluYb8 gene, the term “primer” of the present invention may be used interchangeably with “AluYb8 primer” or “AluYb8 oligonucleotide primer,” which may include “AluYb8 forward primer” and “AluYb8 reverse primer.” Accordingly, when referred to as “AluYb8 primer,” it may refer to a set (or pair) of primers of the present invention that includes both forward and reverse primers, but is not limited thereto, and may also be referred to as “AluYb8 forward primer” and “AluYb8 reverse primer,” respectively.

[0062] The “primer” of the present invention may be a primer having a 17 bp oligonucleotide. In this case, the forward primer may each include the nucleotide sequence represented by SEQ ID NO. 1 and the reverse primer may each include the nucleotide sequence represented by SEQ ID NO. 2. Accordingly, the primer of the present invention may mean a nucleotide sequence that continuously includes the nucleotide sequence represented by SEQ ID NO. 1 or 2. In this case, any sequence capable of binding to an amplification site may additionally be included in the nucleotide sequence represented by SEQ ID NO. 1 or 2. Furthermore, in the present invention, the forward primer may be represented by SEQ ID NO. 1 and the reverse primer may be represented by SEQ ID NO. 2, but is not limited thereto.

[0063] The forward primer and reverse primer of the present invention produce a PCR composite through complementary binding with the AluYb8 gene.

[0064] The primers of the present invention are designed to target a mutated exon portion of the total AluYb8 gene. In this case, the length of the targeted portion may be 865 bp. That is, the AluYb8 primer set of the present invention was designed by analyzing the Chr5 Alu region, which is an 865 bp Alu position sequence, and confirming that the exon sequence is 310 bp, and using this, primers capable of accurately distinguishing human-derived cells were designed.

[0065] Meanwhile, PCR compounds can be produced in a range of sizes as intended by the inventors in the art. In one embodiment of the present invention, since it was confirmed that the length of the exon of the target AluYb8 gene is 310 bp, a qPCR compound of size 310 bp could be produced using the AluYb8 primer set including the 20 bp forward and reverse primers of the present invention, and it was confirmed that human-derived cells could be clearly distinguished and detected from mammalian, particularly primate-derived, cells. That is, when using the primer set of the present invention, the preferred length of the qPCR compound may be up to 865 bp when considering the length of the AluYb8 gene to be analyzed, but more preferably up to 310 bp when considering the length of the target exon. In addition, for efficient analysis, in one embodiment of the present invention, a qPCR composite having a size of 115 bp, specifically in the range of 80 to 120 bp, is produced experimentally, so it may be 80 to 120 bp.

[0066] Accordingly, in one embodiment of the present invention, the length of the RT-qPCR composite (product; or product, amplified composite) produced by the AluYb8 forward and reverse primers of the present invention may be 60 to 350 bp, but is not limited thereto. For example, it may be 60 to 345 bp, 60 to 340 bp, 60 to 335 bp, 60 to 330 bp, 60 to 325 bp, 60 to 320 bp, 60 to 315 bp, or 60 to 310 bp, but is not limited thereto.

[0067] In addition, for example, 60 to 300 bp, 60 to 250 bp, 60 to 200 bp, 60 to 190 bp, 60 to 180 bp, 60 to 170 bp, 60 to 160 bp, 60 to 150 bp, 60 to 140 bp, 60 to 135 bp, 60 to 130 bp, 60 to 125 bp, 60 to 120 bp, 65 to 310 bp, 65 to 300 bp, 65 to 250 bp, 65 to 200 bp, 65 to 190 bp, 65 to 180 bp, 65 to 170 bp, 65 to 160 bp, 65 to 150 bp, 65 to 140 bp, 65 to 135 bp, 65 to 130 bp, 65 to 125 bp, 65 to 120 bp, 70 to 310 bp, 70 to 300 bp, 70 to 250 bp, 70 to 200 bp, 70 to 190 bp, 70 to 180 bp, 70 to 170 bp, 70 to 160 bp, 70 to 150 bp, 70 to 140 bp, 70 to 135 bp, 70 to 130 bp, 70 to 125 bp, 70 to 120 bp, 75 to 310 bp, 75 to 300 bp, 75 to 250 bp, 75 to 200 bp, 75 to 190 bp, 75 to 180 bp, 75 to 170 bp, 75 to 160 bp, 75 to 150 bp, 75 to 140 bp, 75 to 135 bp, 75 to 130 bp, 75 to 125 bp, 75 to 120 bp, 80 to 310 bp, 80 to 300 bp, 80 to 250 bp, 80 to 200 bp, 80 to 190 bp, 80 to 180 bp, 80 to 170 bp, 80 to 160 bp, 80 to 150 bp, 80 to 140 bp, 80 to 135 bp, 80 to It may be 130 bp, 80 to 125 bp, or 80 to 120 bp, but,It is not limited to this.

[0068] The length of the product produced by the AluYb8 oligonucleotide primer set of the present invention was designed considering the length of the target AluYb8 gene sequence and experimental efficiency. Accordingly, the AluYb8 oligonucleotide primer set of the present invention may be designed considering the size of the synthesized product according to PCR so as to exhibit the best efficiency for clear analysis.

[0069] The AluYb8 oligonucleotide primer set of the present invention was designed based on the confirmation that, considering the target AluYb8 gene sequence, the efficiency for detecting human-derived cells may decrease if the length exceeds 310 bp, and excellent detection efficiency can be exhibited even in the range of 80 to 120 bp.

[0070] Accordingly, in one embodiment of the present invention, the oligonucleotide primer set may be designed so that the length of the RT-qPCR product (or product, amplified product) is up to 310 bp. Additionally, considering experimental efficiency, it may be designed to be 80 to 120 bp, particularly 115 bp, but is not limited thereto.

[0071] In addition, the AluYb8 oligonucleotide primer set of the present invention may be designed to exhibit optimal efficiency depending on the length of the human-derived cell-specific portion for distinguishing and detecting human-derived cells using the target AluYb8 gene.

[0072] In one embodiment of the present invention, the length of the primer, that is, the forward and reverse primers, may be 15 to 30 bp, but is not limited thereto. For example, it may have a length of 15 to 30 bp, 15 to 28 bp, 15 to 26 bp, 15 to 24 bp, 15 to 22 bp, 15 to 20 bp, 15 to 19 bp, 15 to 18 bp, 15 to 17 bp, 16 to 30 bp, 16 to 28 bp, 16 to 26 bp, 16 to 24 bp, 16 to 22 bp, 16 to 20 bp, 16 to 19 bp, 16 to 18 bp, 16 to 17 bp, or 17 bp, but is not limited thereto.

[0073] The respective lengths of the forward primer and the reverse primer of the primer set of the present invention may be designed to target a human-specific portion of the AluYb8 gene.

[0074] In the present invention, the AluYb8 oligonucleotide primer set represented by SEQ ID NO. 1 and SEQ ID NO. 2, respectively, may be primers comprising a minimum gene unit for distinguishing and detecting human-derived cells from mammalian-derived cells.

[0075] In the present invention, the oligonucleotide used as a primer may include a nucleotide analogue, for example, a phosphorothioate, an alkylphosphorothioate, or a peptide nucleic acid, or may include an intercalating agent.

[0076] In the present invention, it was confirmed that when the AluYb8 oligonucleotide primer set, which is the primer set of the present invention, is used, only human-derived cells can be distinguished from mammalian-derived cells with high accuracy, and in particular, it was confirmed that human-derived cells can be distinguished from primates among mammals. The composition of the present invention includes the AluYb8 oligonucleotide primer set as an active ingredient. In one embodiment of the present invention, the composition may be used to distinguish and detect human-derived cells from mammalian-derived cells, but is not limited thereto. Furthermore, in one embodiment of the present invention, the mammal may include primates, but is not limited thereto.

[0077] The AluYb8 oligonucleotide primer set of the present invention is capable of detecting human-derived cells with high accuracy and distinguishing human-derived cells within a sample, in particular, distinguishing human-derived cells from mammalian-derived cells in the sample, but primates may be excluded from the mammals.

[0078] In the present invention, “human-derived cells” may refer to cells in a broad sense that include all cells that can be collected from organisms within the range generally understood as humans in the art. In this case, the term “cell” is not a single concept and may include cell lines; and while cells, organs, etc. were used as samples in one embodiment of the present invention, the invention is not limited thereto.

[0079] Accordingly, the present invention provides a composition for distinguishing human-derived cells from mammalian-derived cells, comprising as an active ingredient an oligo nucleotide primer set consisting of the following primer pairs:

[0080] A forward primer comprising SEQ ID NO. 1, and a reverse primer comprising SEQ ID NO. 2.

[0082] The present invention provides a method for detecting human-derived cells comprising the following steps:

[0083] (S1) a step of using genomic DNA isolated from a sample as a template and amplifying a target sequence using the composition; and

[0084] (S2) A step of detecting the composite of the amplification step.

[0085] The method of the present invention includes a process of isolating genomic DNA from a sample. The method for isolating genomic DNA may utilize methods known in the art, for example, the CTAB method or the Wizard prep kit (Promega), but is not limited thereto.

[0086] A target sequence can be amplified by using genomic DNA isolated by a method generally used in the industry as a template and performing an amplification reaction using an oligonucleotide primer set according to one embodiment of the present invention as primers. In the present invention, the method of amplifying a target nucleic acid may refer to a method of amplifying a target sequence by performing a polymerase chain reaction. Additionally, the method of amplifying a target sequence by performing a polymerase chain reaction includes methods known in the art, and may include, but is not limited to, any one method selected from the group consisting of, polymerase chain reaction (PCR), real-time PCR (RT-PCR), reverse transcription polymerase chain reaction, competitive RT-PCR, nuclease protection assay (RNase, S1 nuclease assay), in situ hybridization, nucleic acid microarray, Northern blot, DNA chip, ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, strand displacement amplification, or amplification via Qβ replicase. Or there are any other suitable methods for amplifying nucleic acid molecules known in the art. Among these, PCR is a method that uses polymerase to amplify a target nucleic acid from a primer pair that specifically binds to the target nucleic acid. This PCR method is well known in the industry, and commercially available kits can also be used.

[0087] The terms “polymerase chain reaction” or “PCR” used in the present invention encompass general (non-quantitative) PCR and quantitative PCR, and are a concept that includes, for example, general PCR, general RT-PCR, real-time PCR, and real-time RT-PCR, but may be used as a concept referring to “general PCR or general RT-PCR” depending on the context.

[0088] In the present invention, the amplified target sequence may be labeled with a detectable labeling substance. The labeling substance may be a fluorescent, phosphorescent, or radioactive substance, but is not limited thereto. Preferably, the labeling substance is Cy-5 or Cy-3. When performing PCR by labeling the 5'-terminus of a primer with Cy-5 or Cy-3 during the amplification of the target sequence, the target sequence may be labeled with a detectable fluorescent labeling substance. Additionally, labeling using a radioactive substance may be performed by adding a radioisotope such as P or S to the PCR reaction solution during PCR, so that the radioactivity is incorporated into the amplification compound as the amplification compound is synthesized, thereby labeling the amplification compound radioactively.

[0089] In the present invention, a method for detecting human-derived cells includes a step of detecting the composite of the amplification step, and the detection of the amplification step composite may be performed through DNA chips, gel electrophoresis, capillary electrophoresis, radiometric measurement, fluorescence measurement, or phosphorescence measurement, but is not limited thereto. As one of the methods for detecting the amplification composite, capillary electrophoresis may be performed. For example, an ABi Sequencer may be used for capillary electrophoresis. Additionally, gel electrophoresis may be performed, and depending on the size of the amplification composite, agarose gel electrophoresis or acrylamide gel electrophoresis may be used. Furthermore, for the fluorescence measurement method, when PCR is performed by labeling the 5'-terminus of a primer with Cy-5 or Cy-3, the target sequence is labeled with a detectable fluorescent labeling substance, and the fluorescence thus labeled can be measured using a fluorescence detector. In addition, for radioactivity measurement, a radioactive isotope such as P or S is added to the PCR reaction solution during PCR to label the amplified composite, and then radioactivity can be measured using a radioactivity measuring instrument, for example, a Geiger counter or a liquid scintillation counter.

[0090] In one embodiment of the present invention, the method may be for distinguishing and detecting human-derived cells from mammalian-derived cells, but is not limited thereto.

[0091] In one embodiment of the present invention, the mammal may include, but is not limited to, primates.

[0092] In one embodiment of the present invention, the sample may be any one selected from the group consisting of blood, serum, whole blood, plasma, urine, saliva, tissue, cell, organ, bone marrow, fine needle aspiration specimen, core needle biopsy specimen, and vacuum aspiration biopsy specimen, but is not limited thereto.

[0093] As described above, since the primers of the present invention can distinguish human-derived cells from animal-derived cells, the present invention provides a composition for distinguishing human-derived cells from mammalian-derived cells, comprising as an active ingredient a set of oligo nucleotide primers consisting of the following primer pairs:

[0094] A forward primer comprising SEQ ID NO. 1, and a reverse primer comprising SEQ ID NO. 2.

[0095] In addition, the present invention provides a method for distinguishing human-derived cells from mammalian-derived cells, comprising the following steps:

[0096] (S1) a step of using genomic DNA isolated from a sample containing mammalian-derived cells as a template and amplifying a target sequence using the composition; and

[0097] (S2) A step of detecting the composite of the amplification step.

[0098] In one embodiment of the present invention, the method of distinguishing is,

[0099] (S3) A step of distinguishing human-derived cells from the composite of the amplification step detected above;

[0100] It may additionally include, but is not limited to.

[0101] In addition, methods for distinguishing human-derived cells from mammalian-derived cells, like methods for detecting human-derived cells, may all general processes in the art exemplarily described in this invention be applied.

[0102] In the present invention, “detection” may mean determining the presence of a detected or measured object and / or quantifying its concentration.

[0103] In addition, in the present invention, “distinction” refers to classifying a specific substance, particularly cells, after quantifying the presence and / or concentration of a detected target, and in the present invention, may mean classifying and distinguishing human-derived cells from mammalian-derived cells.

[0104] In one embodiment of the present invention, the amplified composite can be detected by one or more methods selected from the group consisting of capillary electrophoresis, DNA chip, gel electrophoresis, radiometric measurement, fluorescence measurement, phosphorescence measurement, and combinations thereof, and the method can be performed by electrophoresis of the amplified composite to determine its size, but is not limited thereto.

[0106] The present invention provides a kit for detecting human-derived cells, comprising the above composition and instructions.

[0107] In one embodiment of the present invention, the kit can distinguish and detect human-derived cells from mammalian-derived cells, but is not limited thereto.

[0108] In one embodiment of the present invention, the mammal may include, but is not limited to, primates.

[0109] In one embodiment of the present invention, the description may teach the method, but is not limited thereto.

[0110] In the present invention, the kit may additionally include components for amplifying a target sequence. For example, it may include conventional components of a detection kit required for a polymerase chain reaction (reaction buffer, Taq DNA polymerase, labeling agent, etc.) and may include reagents required for PCR (Polymerase chain reaction), RT-PCR, or real-time RT-PCR.

[0111] In addition to the above components, the “kit” of the present invention may include other components, devices, materials, etc. that are typically required for the storage, management, and enhancement of the effects of the composition of the present invention. Furthermore, all components included in the kit may be used one or more times without limitation on the number of times, and there is no restriction on the order in which each material is used, and the application of each material may proceed simultaneously or sequentially.

[0112] The kit of the present invention may include a container in addition to the formulation and instructions. The container may serve to package the composition and may also serve to store and secure it. The material of the container may take the form, for example, a bottle, a tub, a sachet, an envelope, a tube, an ampoule, etc., and may be formed partially or wholly from plastic, glass, paper, foil, wax, etc. The container may be equipped with a cap that is initially part of the container or can be attached to the container by mechanical, adhesive, or other means and may be fully or partially detachable, and may also be equipped with a stopper that allows access to the contents by a needle. The kit may include an outer package, which may include instructions for the use of the components, but is not limited thereto.

[0114] The terms used in this invention have been selected based on currently widely used general terms, taking into account their functions within the invention; however, these terms may vary depending on the intent of those skilled in the art, case law, the emergence of new technologies, etc. Additionally, in specific cases, terms have been arbitrarily selected by the applicant, and in such cases, their meanings will be described in detail in the relevant description of the invention. Therefore, the terms used in this invention should be defined not merely by their names, but based on their meanings and the overall content of the invention.

[0115] Throughout the specification of the present invention, when a part is described as “comprising” a certain component, this means that, unless specifically stated otherwise, it does not exclude other components but may include additional components. Throughout the specification of the present invention, terms such as “about,” “substantially,” etc., are used to mean at or near the stated value when inherent manufacturing and material tolerances are presented in the said sense, and are used to prevent unscrupulous infringers from unfairly exploiting disclosures in which precise or absolute values ​​are mentioned to aid in understanding the present invention.

[0116] Throughout the specification of the present invention, the term “combination thereof” included in a Markush-style expression means one or more mixtures or combinations selected from a group consisting of components described in the Markush-style expression, and means including one or more selected from said group consisting of said components.

[0118] Preferred embodiments are presented below to aid in understanding the present invention. However, the following embodiments are provided merely to facilitate a better understanding of the invention, and the scope of the invention is not limited by the following embodiments.

[0120] [Example]

[0122] gDNA (genomic DNA) extraction

[0123] A spin protocol was performed according to the manufacturer's protocol using a total DNA extraction kit (BIONICS, Cat. No. DN40200). Specifically, 50 mg of tissue was chopping with scissors, followed by the addition of cell lysis solution and proteinase K, and lysis was carried out sufficiently at 56°C for 30–60 minutes. Subsequently, the lysate was used to recover only the DNA using a binding column, and its concentration was measured for use.

[0125] AluYb8 Oligonucleotide Primer Design

[0126] Primers were designed using the following formula so that the annealing temperature ranged from 60°C to 65°C: [Tm = 4°C X (number of G+Cs) + 2°C X (number of A+Ts)]. Primers for RT-qPCR were designed so that the product size was 80-310 bp.

[0128] No. Name Sequence(5'→3') 1 AluYb8 Primer-F GCGCCTGTAGTCCCAGC 2 AluYb8 Primer-R GGCCAGACTGCGGACTG

[0130] qPCR (real-time polymerase chain reaction) protocol

[0131] qPCR was prepared using the recovered gDNA, primers (forward and reverse), and SYBR Green, with the mixing ratios as follows.

[0133] SYBR Green 2X 5 μL Forward primer (5 pmol / μL) 0.5 μL Reverse primer (5 pmol / μL) 0.5 μL gDNA (1~10 ng) X μL Sterile water up to 10 μL

[0135] After placing duplicates of each sample into the PCR plate, the solution adhering to the walls was centrifuged to settle to the bottom. The plates were placed in a qPCR machine, the temperature and cycle were adjusted, and qPCR was performed. The temperature and cycle are as follows.

[0137] Cycling step Temperature Time # of cycles Initial denaturation and enzyme activation 95℃ 2 min 1 Denaturing 95℃ 10 sec 25 Annealing 63℃ 15 sec Extension 72℃ 10 sec

[0139] We checked the number of cycles to verify if an Alu product was formed.

[0141] Example 1. Detection and classification of human-derived cells from mammalian, particularly primate-derived, cells using AluYb8 oligonucleotide primers

[0142] We investigated whether the AluYb8 gene could be used to distinguish human-derived cells from mammalian-derived cells, specifically from primate-derived cells. First, to verify this, Quantitative PCR / real-time PCR (qPCR) was used to determine the presence of Alu sequences in the total DNA. The oligonucleotide sequences listed in Table 1 were used as the AluYb8 oligonucleotide primer set. Distilled water (DW), rabbit, swine, hNCs, 293T, and U373 were prepared as samples for DNA analysis. Specifically, New Zealand White Rabbits and Mini Pigs were used as mammalian samples to distinguish mammalian-derived cells. The analysis was conducted using gDNA directly isolated from the livers of rabbits and pigs (Liver gDNA), rather than from specific cells. Additionally, hNCs (gDNA), 293T (gDNA), and U373 (gDNA) were used, respectively, to distinguish human-derived cells. In addition, gDNA isolated from the blood of cynomolus (Macaca fascicularis) and rhesus monkeys was used as samples to distinguish primate-derived cells. AluYa5, a gene of the same Alu family, was used as a control group, and the set of AluYa5 target primers is as shown in Table 4 below.

[0144] No. Name Sequence(5'→3') 3 AluYa5 Primer-F ACGAGGTCAGGAGATCGAGA 4 AluYa5 Primer-R CCCGAGTAGCTGGGACTACA

[0146] The results were confirmed as shown in Figures 1 and 2 and Table 5.

[0148] First, according to the upper graph of Figure 1, the Cq value was low, confirming that the target gene content level was high. In addition, according to the results of the second and third graphs of Figure 1, it was proven that only the target gene was amplified because no non-specific PCR product was generated when using the AluYb8 oligonucleotide primer set.

[0150] Meanwhile, Table 5 shows the results representing the Cq values ​​for each sample in Fig. 1, and the graph illustrating this is Fig. 2.

[0152] Sample AluYa5 Cq-1 AluYb8 Cq-2 DW NA NA NA NA Rabbit NA NA NA NA Swine NA NA NA NA cynomolus 16.14 16.19 NA NA rhesus 14.68 14.36 NA NA hNCs 16.14 15.80 22.51 23.19 293T 12.98 13.10 20.08 20.06 U373 13.11 13.31 19.75 19.87

[0154] DW is a sample in which only the primers are amplified to check whether a dimer is formed, and if a dimer is generated, it cannot be considered an accurate primer; however, when the AluYb8 lio nucleotide primer set and the AluYa5 olion nucleotide primer set of the present invention were used, it was found that no dimer was generated in the DW sample.

[0156] In addition, when examining the DNA of mammalian and human-derived cells, it was found that the AluYb8 and AluYa5 genes were not detected in the mammalian DNA.

[0158] According to these results, when examining mammalian DNA, primate DNA, and DNA of human-derived cells, both primers targeting Alu genes were able to distinguish human-derived cells from mammalian-derived cells. In particular, the AluYb8 oligonucleotide primer was detected only in human-specific DNA; while the AluYa5 oligonucleotide primer could not distinguish between humans and primates that are extremely similar to humans, the AluYb8 oligonucleotide primer was confirmed to be able to distinguish human-derived cells from mammalian-derived cells, specifically from primate-derived cells.

[0160] The foregoing description of the present invention is for illustrative purposes only, and those skilled in the art will understand that other specific forms can be easily modified without altering the technical spirit or essential features of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive.

Claims

Claim 1 Composition for detecting human-derived cells comprising, as an active ingredient, a set of oligo nucleotide primers consisting of the following primer pairs: a forward primer comprising SEQ ID NO. 1, and a reverse primer comprising SEQ ID NO.

2. Claim 2 In claim 1, the above composition is a detection composition intended to distinguish and detect human-derived cells from mammalian-derived cells. Claim 3 A detection composition according to paragraph 2, wherein the mammal includes primates. Claim 4 A detection composition according to claim 1, wherein the primer targets the AluYb8 gene. Claim 5 A detection composition according to claim 1, characterized in that the length of the primer is 15 to 30 bp. Claim 6 A method for detecting human-derived cells comprising the following steps: (S1) a step of using genomic DNA isolated from a sample as a template and amplifying a target sequence using the composition of claim 1; and (S2) a step of detecting the composite of the amplification step. Claim 7 In claim 6, the above method is a method for detecting human-derived cells, which is intended to distinguish and detect human-derived cells from mammalian-derived cells. Claim 8 A method for detecting human-derived cells according to claim 7, wherein the mammals include primates. Claim 9 A method for detecting human-derived cells according to claim 6, wherein the sample is any one selected from the group consisting of blood, serum, whole blood, plasma, urine, saliva, tissue, cell, organ, bone marrow, fine needle aspiration specimen, core needle biopsy specimen, and vacuum aspiration biopsy specimen. Claim 10 A kit for detecting human-derived cells, comprising the composition of claim 1 and instructions. Claim 11 In claim 10, the above kit is a kit for detecting human-derived cells, which is intended to distinguish and detect human-derived cells from mammalian-derived cells. Claim 12 A kit for detecting human-derived cells according to claim 11, wherein the mammals include primates. Claim 13 In item 10, the above instructions are a kit for detecting human-derived cells that teaches the method of item 6. Claim 14 delete

Citation Information

Patent Citations

  • Method for quantitative detection of human cells

    JP2017192365A

  • Detection kit and detection method

    JP2018102252A

  • Method for measuring tumor burden in patient derived xenograft (PDX) mice

    US20180288982A1