A Composition for Preventing or Treating Ischemic Stroke Comprising 1,1-Diethoxyethane as an Active Ingredient

KR103017203B1Active Publication Date: 2026-09-09LUX ANIMA CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
KR1020260053557
Authority / Receiving Office
KR · KR
Patent Type
Patents
Current Assignee / Owner
Priority Date
2025-06-13
Filing Date
2026-03-25
Publication Date
2026-09-09
Estimated Expiration
2046-03-13

Smart Images

  • Figure 112026036120239-PAT00004_ABST
    Figure 112026036120239-PAT00004_ABST
Patent Text Reader

Abstract

The present invention relates to a mitochondrial biosynthesis promoter comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient and its uses. More specifically, the present invention relates to a mitochondrial biosynthesis promoter comprising 1,1-diethoxyethane as an active ingredient and its uses, for example, as a composition for the prevention, treatment, or improvement of diseases requiring promotion of mitochondrial biosynthesis, such as a pharmaceutical composition, a cosmetic composition, a food composition, or a feed composition.
Need to check novelty before this filing date? Find Prior Art

Description

Technology Field

[0001] The present invention relates to a mitochondrial biosynthesis promoter comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient and its uses. More specifically, the present invention relates to a mitochondrial biosynthesis promoter comprising 1,1-diethoxyethane as an active ingredient and its uses, for example, as a composition for the prevention, treatment, or improvement of diseases requiring promotion of mitochondrial biosynthesis, such as a pharmaceutical composition, a cosmetic composition, a food composition, or a feed composition. Background Technology

[0002] 5'-adenosine monophosphate (AMP)-activated protein kinase (AMPK) is an evolutionarily conserved serine (Ser) / threonine (Thr) kinase family enzyme responsible for maintaining cellular energy homeostasis, and plays a crucial role in regulating energy balance [1,2]. AMPK consists of a catalytic α-subunit, a regulatory β-subunit, and a non-catalytic γ-subunit, each of which regulates various physiological functions [3]. The α-subunit activates AMPK through the phosphorylation of Thr172 residues, the β-subunit promotes the binding of AMPK to glycogen, and the γ-subunit stimulates AMPK phosphorylation by binding to AMP and ADP [4]. Activation of AMPK promotes catabolic metabolism and inhibits anabolic metabolism, thereby generating ATP and improving energy balance. Upstream kinases such as LKB1 (liver kinase B1), CAMKK2 (Ca2+ / calmodulin-dependent protein kinase kinase-2), and TAK (Transforming growth factor-beta-activated kinase) play an important role in AMPK activation [5-7]. Drugs such as metformin, AICAR (5-aminoimidazole-4-carboxamide ribonucleotide), and resveratrol activate AMPK by regulating upstream kinases [8-10]. Energy states such as exercise and nutritional deficiencies can also activate AMPK. AMPK activation can have a potential impact on the prevention of obesity, cardiovascular disease (CVD), and cancer

[11] , and plays an important preventive role, particularly in cardiovascular disease [12-17].

[0003] AMPK makes a significant contribution to energy balance by regulating downstream effectors of catabolic processes such as fatty acid synthesis and glycolysis. Acetyl-CoA carboxylase (ACC) plays a crucial role in fatty acid biosynthesis, and phosphorylation of Ser79 (ACC1) or Ser212 (ACC2) by AMPK inhibits ACC enzymatic activity and increases fatty acid oxidation [1]. In the heart, fatty acid oxidation accounts for a significant portion of energy production. The AMPK-ACC signaling pathway regulates various physiological processes, including platelet phospholipid and thrombus formation, cardiac hypertrophy and contractility, and ischemia regulation [19-21]. In addition, glycolysis is also regulated by PFKFB2 (6-phosphofructo-2-kinase / fructose-2,6-biphosphatase-2), which is involved in the formation and breakdown of Fru-2,6-P2 (fructose-2,6-bisphosphate) and regulates the enzymatic activity of PFK1 (phosphofructokinase-1). Ser466 and Ser483 phosphorylation of PFKFB2 promotes glycolysis, which is regulated by Akt (protein kinase B) and AMPK. Activation of PFKFB2 plays an important role in cardiac remodeling, inhibition of ferroptosis in I / R injury, and improvement of cardiac function in hypoxic conditions [22-25].

[0004] Mitochondrial biosynthesis is an important process for adapting to cellular energy demands, and AMPK can promote this process. AMPK deficiency can lead to mitochondrial dysfunction, and PGC-1α (peroxisome proliferator-activated receptor gamma coactivator 1-alpha), a major downstream regulator of AMPK, plays an important role in mitochondrial biosynthesis [2]. AMPK activates PGC-1α through the activation of the transcription factor EB and direct binding, and promotes mitochondrial biosynthesis by phosphorylating Thr177 and Ser538 of PGC-1α [27,28]. This process makes an important contribution to cardioprotection [29, 30].

[0005] Delaying aging or extending lifespan

[0006] Living organisms have a limited lifespan and, over time, undergo a natural process of birth, growth, and aging—known as aging—eventually leading to death. Aging is one of the complex biological pathways observed in all living organisms. Numerous studies have been conducted to elucidate the causes and processes of aging, and the phenomenon is generally explained by two main mechanisms: the aging clock and cellular senescence. The aging clock theory explains aging through the loss of telomere replication at DNA ends; it argues that the depletion of telomeres—repetitive sequences found at both ends of each chromosome—can lead to cellular aging and the aging of the organism. Cellular senescence views the accumulation of intracellular damage caused by oxidative damage and mitochondrial dysfunction as the primary cause of aging. Among these, the mitochondrial decline theory emphasizes the importance of mitochondrial function for healthy cellular metabolism and bioenergy. The decline in mitochondrial function associated with aging includes decreased ATP production, increased ROS production, a reduction in the number of mitochondria, and changes in mitochondrial permeability.

[0007] As aging progresses, the activity of pathways related to lipid metabolism is inhibited. Specifically, the breakdown of fat decreases, and the absorption of low-density lipoprotein (LDL) cholesterol in cells declines, leading to an increase in blood LDL levels, which can cause cardiovascular disease. Furthermore, aging leads to a decline in cognitive and motor functions, and increases the incidence of neurological diseases such as Alzheimer's and Parkinson's disease, which reduce the quality of life.

[0008] In addition to research focused on understanding the aging process, numerous studies are also being conducted to delay aging and extend lifespan. To date, the most successful method is dietary restriction. The effects of dietary restriction were first reported in rats, and subsequently, longevity phenotypes induced by dietary restriction were observed in yeast, nematodes, fruit flies, and mice. However, since such beneficial effects of dietary restriction are observed only when the restriction is maintained continuously, it is difficult to apply them to all living organisms.

[0009] To date, much research and effort have been made to achieve the dream of eternal youth, but the mechanism of aging has not yet been fully elucidated.

[0010] cardiovascular disease

[0011] Proper regulation of heart rate is essential for maintaining life, and conditions such as bradycardia and bradyarrhythmia, characterized by an abnormally low heart rate, can lead to serious health problems. A low heart rate can cause dizziness, fatigue, and fainting, and in severe cases, carries a risk of leading to heart failure or cardiac arrest. Accordingly, there is a continuous demand for the development of treatments that can effectively increase heart rate.

[0012] To date, treatments designed to increase heart rate have primarily worked by stimulating the sympathetic nervous system, and representative drugs include beta-adrenergic agonists, antimuscarinic agents, and specific ion channel modulators.

[0013] Isoproterenol, a beta-adrenergic agonist, has the effect of increasing heart rate by non-selectively activating beta1 and beta2 receptors. However, since isoproterenol affects not only heart rate but also myocardial contractility and blood pressure, long-term use may lead to side effects such as hypertension, induction of arrhythmias, and increased oxygen demand in the myocardium.

[0014] Antimuscarinic agents (e.g., atropine) have the effect of increasing heart rate by inhibiting vagal nerve activity and reducing the influence of the parasympathetic nervous system. However, these drugs can be accompanied by side effects such as dry mouth, blurred vision, and urinary dysfunction, and their effect on heart rate regulation is relatively limited.

[0015] Some ion channel modulators have a mechanism that increases heart rate by regulating the flow of calcium or sodium ions within myocardial cells. However, these drugs have a direct effect on cell membrane potential, so careful dose control is required, and there is a possibility of inducing arrhythmia.

[0016] Therefore, there is a continuous demand for research on new substances that can rapidly and effectively increase heart rate while minimizing the side effects of existing drugs.

[0017] cancer

[0018] Neuroblastoma originates from the neural crest and manifests primarily as malignant tumors in the sympathetic ganglia and adrenal medulla. More than one-third of all neuroblastomas are detected in infancy (under 1 year of age), and approximately 75% are diagnosed before the age of 5. This disease is one of the most common and fatal pediatric cancers, characterized by its aggressive nature and poor prognosis, particularly in advanced stages. Despite various efforts to treat neuroblastoma, such as intensive multimodal therapy, advancements in immunotherapy, and the introduction of clinical trials for new targeted therapies, the prognosis for high-risk pediatric patients remains poor, with their median 5-year overall survival rate hovering around 50–70%. Recent anticancer treatments have focused on targeting mechanisms that induce apoptosis. However, defects in the mechanisms regulating apoptosis not only provide a growth advantage to tumor cells but also become a major cause of therapeutic resistance. In fact, drug resistance remains one of the greatest threats to the treatment and control of neuroblastoma.

[0019] Until now, research has primarily focused on multidrug resistance proteins or anti-apoptotic mechanisms expressed in neuroblastoma cells, but studies on cellular signaling pathways associated with treatment resistance have been relatively underdeveloped. In fact, metabolic reprogramming, a key characteristic of cancer, is regulated through interactions between various signaling proteins and kinases, and a deeper understanding of their synergy can contribute to the discovery of promising therapeutic targets. In particular, AMP-activated protein kinase (AMPK), which plays a central role in regulating metabolic and energy homeostasis in both normal and cancer cells, is receiving attention as a key factor in this signaling axis. According to numerous prior studies, the AMPK signaling pathway has been reported to play a dual role in maintaining homeostasis within cancer cells. Accordingly, strategies that modulate signaling systems, including AMPK, along with therapies that specifically target tumor cells, are considered promising therapeutic approaches that can suppress the development of cancer treatment resistance and improve patient prognosis.

[0020] stroke

[0021] Stroke is the third leading cause of death worldwide. Stroke survivors often suffer from disabilities such as motor impairments and cognitive deficits, which severely disrupt daily life and reduce quality of life. Furthermore, stroke is an independent risk factor for dementia of all causes. From 1990 to 2021, the global burden of stroke increased significantly, with stroke incidence rising by 70%, related mortality by 44%, and loss of disability-adjusted life years by 32%. Despite medical advancements, the WSO / Lancet Neurology Commission on Stroke 2 predicts that stroke-related mortality will increase by 50% between 2020 and 2050, which will place a massive burden globally. Therefore, stroke remains a critical global health issue in terms of both mortality and disability, making the discovery of effective substances for prevention and therapeutic interventions for stroke and subsequent recovery extremely important.

[0022] dementia

[0023] Dementia is a collective term for various neurodegenerative diseases that impair learning and memory abilities, thereby hindering daily life. According to the World Health Organization (WHO), it currently ranks as the seventh leading cause of death worldwide and is reported to be one of the major causes of disability and dependency among the elderly. With approximately 10 million new cases of dementia occurring annually, dementia is recognized as a critical global health issue that affects the lives of millions and imposes a massive socioeconomic burden.

[0024] Various risk factors, such as advanced age, hypertension, diabetes, obesity, smoking, and excessive alcohol consumption, are known to be significantly associated with the onset of dementia. Meanwhile, the impact of low to moderate alcohol consumption on dementia risk has not yet been clearly established; although some studies suggest that certain levels of drinking may offer a potential protective effect against dementia, further precise research is required to confirm this.

[0025] Prior art literature

[0026] [Non-patent Document 1] Steinberg, GR and DG Hardie, New insights into activation and function of the AMPK. Nat Rev Mol Cell Biol, 2023. 24(4): p. 255-272.

[0027] [Non-patent Document 2] Herzig, S. and RJ Shaw, AMPK: guardian of metabolism and mitochondrial homeostasis. Nat Rev Mol Cell Biol, 2018. 19(2): p. 121-135.

[0028] [Non-patent Document 3] Davies, SP, et al., Purification of the AMP-activated protein kinase on ATP-gamma-sepharose and analysis of its subunit structure. Eur J Biochem, 1994. 223(2): p. 351-7.

[0029] [Non-patent Document 4] Hardie, DG, FA Ross, and SA Hawley, AMPK: a nutrient and energy sensor that maintains energy homeostasis. Nat Rev Mol Cell Biol, 2012. 13(4): p. 251-62.

[0030] [비특허문헌 5] Woods, A., et al., LKB1 is the upstream kinase in the AMP-activated protein kinase cascade. Curr Biol, 2003. 13(22): p. 2004-8.

[0031] [비특허문헌 6] Woods, A., et al., Ca2+ / calmodulin-dependent protein kinase kinase-beta acts upstream of AMP-activated protein kinase in mammalian cells. Cell Metab, 2005. 2(1): p. 21-33.

[0032] [비특허문헌 7] Xie, M., et al., A pivotal role for endogenous TGF-beta-activated kinase-1 in the LKB1 / AMP-activated protein kinase energy-sensor pathway. Proc Natl Acad Sci U S A, 2006. 103(46): p. 17378-83.

[0033] [비특허문헌 8] Shaw, R.J., et al., The kinase LKB1 mediates glucose homeostasis in liver and therapeutic effects of metformin. Science, 2005. 310(5754): p. 1642-6.

[0034] [비특허문헌 9] Chan, A.Y., et al., Resveratrol inhibits cardiac hypertrophy via AMP-activated protein kinase and Akt. J Biol Chem, 2008. 283(35): p. 24194-201.

[0035] [비특허문헌 10] Corton, J.M., et al., 5-aminoimidazole-4-carboxamide ribonucleoside. A specific method for activating AMP-activated protein kinase in intact cells Eur J Biochem, 1995. 229(2): p. 558-65.

[0036] [비특허문헌 11] Jeon, S.M., Regulation and function of AMPK in physiology and diseases. Exp Mol Med, 2016. 48(7): p. e245.

[0037] [비특허문헌 12] Li, Y., et al., AMPK phosphorylates and inhibits SREBP activity to attenuate hepatic steatosis and atherosclerosis in diet-induced insulin-resistant mice. Cell Metab, 2011. 13(4): p. 376-388

[0038] [비특허문헌 13] Pulipaka, S., et al., Therapeutic efficacies of mitochondria-targeted esculetin and metformin in the improvement of age-associated atherosclerosis via regulating AMPK activation. Geroscience, 2024. 46(2): p. 2391-2408.

[0039] [비특허문헌 14] Wang, Z., et al., Dexmedetomidine attenuates myocardial ischemia / reperfusion-induced ferroptosis via AMPK / GSK-3βaxis. Biomed Pharmacother, 2022. 154: p. 113572.

[0040] [비특허문헌 15] Zhang, Y., et al., Melatonin attenuates myocardial ischemia-reperfusion injury via improving mitochondrial fusion / mitophagy and activating the AMPK-OPA1 signaling pathways. J Pineal Res, 2019. 66(2): p. e12542.

[0041] [비특허문헌 16] Gelinas, R., et al., AMPK activation counteracts cardiac hypertrophy by reducing O-GlcNAcylation. Nat Commun, 2018. 9(1): p. 374.

[0042] [비특허문헌 17] Guo, R. and J. Ren, Deficiency in AMPK attenuates ethanol-induced cardiac contractile dysfunction through inhibition of autophagosome formation. Cardiovasc Res, 2012. 94(3): p. 480-91.

[0043] [비특허문헌 18] Tong, L., Acetyl-coenzyme A carboxylase: crucial metabolic enzyme and attractive target for drug discovery. Cell Mol Life Sci, 2005. 62(16): p. 1784-803.

[0044] [비특허문헌 19] Lepropre, S., et al., AMPK-ACC signaling modulates platelet phospholipids and potentiates thrombus formation. Blood, 2018. 132(11): p. 1180-1192.

[0045] [비특허문헌 20] Turdi, S., et al., Deficiency in AMP-activated protein kinase exaggerates high fat diet-induced cardiac hypertrophy and contractile dysfunction. J Mol Cell Cardiol, 2011. 50(4): p. 712-22.

[0046] [비특허문헌 21] Hopkins, T.A., J.R. Dyck, and G.D. Lopaschuk, AMP-activated protein kinase regulation of fatty acid oxidation in the ischaemic heart. Biochem Soc Trans, 2003. 31(Pt 1): p. 207-12.

[0047] [비특허문헌 22] Harold, K.M., et al., Loss of Cardiac PFKFB2 Drives Metabolic, Functional, and Electrophysiological Remodeling in the Heart. J Am Heart Assoc, 2024. 13(7): p. e033676.

[0048] [비특허문헌 23] Fu, C., et al., PFKFB2 Inhibits Ferroptosis in Myocardial Ischemia / Reperfusion Injury Through Adenosine Monophosphate-Activated Protein Kinase Activation. J Cardiovasc Pharmacol, 2023. 82(2): p. 128-137.

[0049] [비특허문헌 24] Gao, J., et al., HIF-1 / AKT Signaling-Activated PFKFB2 Alleviates Cardiac Dysfunction and Cardiomyocyte Apoptosis in Response to Hypoxia. Int Heart J, 2021. 62(2): p. 350-358.

[0050] [비특허문헌 25] Bergeron, R., et al., Chronic activation of AMP kinase results in NRF-1 activation and mitochondrial biogenesis. Am J Physiol Endocrinol Metab, 2001. 281(6): p. E1340-6.

[0051] [비특허문헌 26] Lantier, L., et al., AMPK controls exercise endurance, mitochondrial oxidative capacity, and skeletal muscle integrity. Faseb j, 2014. 28(7): p. 3211-24.

[0052] [비특허문헌 27] Settembre, C., et al., TFEB controls cellular lipid metabolism through a starvation-induced autoregulatory loop. Nat Cell Biol, 2013. 15(6): p. 647-58.

[0053] [비특허문헌 28] J ger, S., et al., AMP-activated protein kinase(AMPK) action in skeletal muscle via direct phosphorylation of PGC-1alpha. Proc Natl Acad Sci U S A, 2007. 104(29): p. 12017-22.

[0054] [비특허문헌 29] Chen, L., et al., PGC-1α-Mediated Mitochondrial Quality Control: Molecular Mechanisms and Implications for Heart Failure. Front Cell Dev Biol, 2022. 10: p. 871357.

[0055] [비특허문헌 30] Tian, L., et al., Pretreatment with Tilianin improves mitochondrial energy metabolism and oxidative stress in rats with myocardial ischemia / reperfusion injury via AMPK / SIRT1 / PGC-1 alpha signaling pathway. J Pharmacol Sci, 2019. 139(4): p. 352-360. 해결하려는 과제

[0056] Accordingly, the inventors made diligent efforts to study the physiological functions of 1,1-diethoxyethane (1,1-DEE) and confirmed that 1,1-DEE can acutely inhibit mitochondrial oxidative phosphorylation (OXPHOS) (see Experimental Example 1) and, in the long term, activate AMPK to increase PGC-1α expression, thereby promoting mitochondrial biosynthesis (see Experimental Examples 5 and 6). Thus, it was proven that 1,1-DEE can regulate mitochondrial function and energy metabolism by acutely inhibiting mitochondrial respiration while promoting mitochondrial biosynthesis in the long term through AMPK activation, and based on this, the present invention was completed.

[0057] Furthermore, it was confirmed that 1,1-DEE according to the present invention not only induces mitochondrial biosynthesis through a physiological mechanism based on the AMPK (AMP-activated protein kinase) pathway, but also exhibits significant therapeutic effects in various disease models. Specifically, it was confirmed that 1,1-DEE (i) has the effect of extending lifespan without inhibiting development in a C. elegans model, and (ii) can contribute to the prevention or improvement of cardiovascular diseases through the effect of temporarily and rapidly increasing heart rate. In addition, it was confirmed that (iii) it exhibits an anticancer effect by reducing the survival rate of cancer cells and inducing apoptosis, and (iv) it exhibits effects such as reduced mortality, accelerated recovery, improved cognitive function, and reduction of brain damage area in an ischemic stroke animal model (MCAO), and (v) it can exhibit effects such as recovery of cognitive function after ischemic brain injury, as well as improvement in spatial cognition and memory in normal mice.

[0058] Accordingly, the present invention aims to provide a mitochondrial biosynthesis promoter comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient.

[0059] The present invention aims to provide a pharmaceutical composition for the prevention or treatment of diseases requiring the promotion of mitochondrial biosynthesis, comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient. The present invention also aims to provide a pharmaceutical composition for the prevention or treatment of aging-related diseases, the prevention or treatment of cardiovascular diseases, the prevention or treatment of cancer, the prevention or treatment of stroke, or the prevention or treatment of dementia, comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient.

[0060] The present invention aims to provide a cosmetic composition for the prevention or improvement of diseases requiring the promotion of mitochondrial biosynthesis, comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient. The present invention also aims to provide a cosmetic composition for the prevention or improvement of aging or life extension, prevention or improvement of cardiovascular diseases, prevention or improvement of cancer, prevention or improvement of stroke, dementia, or decline in cognitive function or memory, comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient.

[0061] The present invention aims to provide a food composition for the prevention or improvement of diseases requiring the promotion of mitochondrial biosynthesis, comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient. The present invention also aims to provide a food composition for delaying aging or extending lifespan, preventing or improving cardiovascular diseases, preventing or improving cancer, preventing or improving stroke, and preventing or improving dementia, cognitive function, or memory decline, comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient.

[0062] The present invention aims to provide a feed composition for the prevention or improvement of diseases requiring the promotion of mitochondrial biosynthesis, comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient. The present invention also aims to provide a feed composition for delaying aging or extending lifespan, preventing or improving cardiovascular diseases, preventing or improving cancer, preventing or improving stroke, and preventing or improving dementia, cognitive function, or memory decline, comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient.

[0063] However, the problems that this invention seeks to solve are not limited to those mentioned above, and other unmentioned problems will be clearly understood by those skilled in the art from the description below. means of solving the problem

[0064] The present invention discloses a mitochondrial biosynthesis promoter comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient, and a pharmaceutical composition, cosmetic composition, food composition, or feed composition as a use thereof, for example, a composition for the prevention, treatment, or improvement of diseases requiring promotion of mitochondrial biosynthesis.

[0065] In addition, the present invention discloses a composition for the prevention or treatment of aging-related diseases and for delaying aging or extending lifespan, comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient.

[0066] In addition, the present invention discloses a composition for the prevention, improvement, or treatment of cardiovascular diseases comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient.

[0067] In addition, the present invention discloses a composition for the prevention, improvement, or treatment of cancer and cachexia derived from said cancer, comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient.

[0068] In addition, the present invention discloses a composition for the prevention, improvement, or treatment of stroke comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient.

[0069] In addition, the present invention discloses a composition for the prevention, improvement, or treatment of dementia comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient.

[0070] In addition, the present invention discloses a composition for preventing, improving, or treating cognitive function or memory decline comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient.

[0071] In the present invention, the 1,1-diethoxyethane (1,1-DEE) has the molecular formula C6H 14 It is represented by the following structural formula 1 as O2, and is also called acetaldehyde diethyl acetal or ethyllidene diethyl ether.

[0072] [Structural Formula 1]

[0073]

[0074] According to one embodiment,

[0075] A mitochondrial biosynthesis promoter comprising 1,1-diethoxytain (1,1-DEE) as an active ingredient is disclosed.

[0076] In the present invention, the 1,1-diethoxyethane can promote mitochondrial biosynthesis by increasing the expression of PGC-1α (peroxisome proliferator-activated receptor gamma coactivator-1 alpha).

[0077] In the present invention, the 1,1-diethoxyethane increases the transcriptional activity of Nrf1 and Nrf2, and can stimulate the expression of Tfam to promote mitochondrial biosynthesis.

[0078] According to another embodiment,

[0079] A pharmaceutical composition for the prevention or treatment of diseases requiring the promotion of mitochondrial biosynthesis is disclosed, comprising 1,1-diethoxytain (1,1-DEE) as an active ingredient.

[0080] In the present invention, the diseases requiring the promotion of mitochondrial biosynthesis are ischemic brain diseases, ischemic heart diseases, reperfusion injury, stroke, ischemic stroke, migraine, anemia, Parkinson's disease, dementia, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), mitochondrial encephalomyopathy, cirrhosis, Fanconi syndrome, atypical phenylketonuria, asthma, chronic obstructive pulmonary disease, diabetes, It may be one or more selected from the group consisting of atherosclerosis, hypertension, hypercholesterolemia, optic nerve diseases, obesity, depression, leukemia, cancer, cancer cachexia, inflammation diseases, age-related diseases, and cardiovascular diseases.

[0081] In the present invention, the pharmaceutical composition may be administered by one or more administration methods selected from the group consisting of oral administration, intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, epithelial administration, local administration, vaginal administration, lung administration, rectal administration, sublingual administration, buccal administration, transdermal administration, ocular administration, inhalation, intracavernous injection, intrathecal injection, epidural injection, and rectal administration.

[0082] According to another embodiment,

[0083] A cosmetic composition for the prevention or improvement of diseases requiring the promotion of mitochondrial biosynthesis is disclosed, comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient.

[0084] In the present invention, the cosmetic composition may be formulated into one or more selected from the group consisting of a solution, an external ointment, a cream, a foam, a nourishing lotion, a softening lotion, a perfume, a pack, a softening water, a lotion, a makeup base, an essence, a soap, a liquid cleanser, a bath additive, a sunscreen cream, a sun oil, a suspension, an emulsion, a paste, a gel, a lotion, a powder, a soap, a surfactant-containing cleansing product, an oil, a powder foundation, an emulsion foundation, a wax foundation, a patch, and a spray.

[0085] According to another embodiment,

[0086] A food composition for the prevention or improvement of diseases requiring the promotion of mitochondrial biosynthesis is disclosed, comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient.

[0087] In the present invention, the food may include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, tea, coffee beverages, stamina drinks, alcoholic beverages, or vitamin complexes.

[0088] According to another embodiment,

[0089] A feed composition for the prevention or improvement of diseases requiring the promotion of mitochondrial biosynthesis is disclosed, comprising 1,1-diethoxytain (1,1-DEE) as an active ingredient.

[0090] In the present invention, the feed may include powder feed, solid feed, moist pellet feed, dry pellet feed, EP (Extruder Pellet) feed, or raw feed. Effects of the invention

[0091] 1,1-diethoxyethane (1,1-DEE) according to the present invention can rapidly and reversibly activate AMPK (AMP-activated protein kinase) through ATP reduction and ROS generation. The activated AMPK inhibits fatty acid synthesis and promotes β-oxidation by inducing ACC (acetyl-CoA carboxylase) phosphorylation, and can regulate glycolysis through the phosphorylation of PFKFB2 (6-phosphofructo-2-kinase / fructose-2,6-bisphosphatase 2). In addition, activation of AMPK can enhance mitochondrial biosynthesis and energy metabolism by inducing increased expression of PGC-1α (peroxisome proliferator-activated receptor gamma coactivator 1-alpha), and can induce mitochondrial-related gene expression and structural formation through the Nrf1 / Nrf2-Tfam axis.

[0092] Based on the physiological mechanisms that induce the improvement of mitochondrial biosynthesis and metabolic functions, 1,1-DEE has shown significant therapeutic effects in various disease models, including the following.

[0093] First, regarding the effects of delaying aging and extending lifespan, 1,1-DEE showed an effect of extending lifespan without inhibiting development in a Caenorhabditis elegans model. These results suggest that 1,1-DEE can be utilized as a pharmaceutical composition, cosmetic composition, food composition, health functional food, or feed composition effective for delaying aging or extending lifespan.

[0094] Second, regarding cardiovascular diseases, 1,1-DEE exhibited the effect of temporarily and rapidly increasing the heart rate, and accordingly, it can be effectively used for the prevention, treatment, or improvement of cardiovascular diseases. In addition, the composition of the present invention can be applied to functional foods or animal feed, and can contribute, for example, to the health management of individuals requiring heart rate control or to the control of heart rate abnormalities in livestock and companion animals. Therefore, the present invention provides a safe and effective method for increasing heart rate using 1,1-DEE, which is a promising technology that can be utilized for the prevention and treatment of cardiovascular diseases requiring heart rate stimulation.

[0095] Third, regarding cancer and cachexia, 1,1-DEE exhibited anticancer effects by significantly reducing cancer cell survival rates and inducing apoptosis. In particular, it was confirmed that it can provide a novel anticancer mechanism based on the regulation of energy metabolism through the activation of the AMPK pathway, and therapeutic effects such as tumor growth inhibition, prevention of cancer cachexia, and improvement of survival rates were proven in in vivo experiments. Furthermore, unlike 1,2-DEE, 1,1-DEE exhibits selective effects, and is evaluated as an excellent anticancer candidate in terms of safety and efficacy. Therefore, the composition according to the present invention can be usefully utilized as a pharmaceutical composition, food composition, cosmetic composition, or feed composition for the prevention, treatment, or improvement of cancer and cachexia derived therefrom.

[0096] Fourth, regarding ischemic stroke, 1,1-DEE demonstrated various therapeutic effects in the MCAO (mouse middle cerebral artery occlusion) model, including reduced mortality, inhibition of weight loss and promotion of recovery, improvement of spatial cognition and memory, and reduction of the brain lesion area. In particular, a tendency to quickly find the platform during the early stages of learning was confirmed in the Morris water maze experiment, and neuroprotective effects were proven through MRI image analysis. These results suggest that 1,1-DEE has the potential to be an effective therapeutic substance for neuroprotection and cognitive function recovery in ischemic stroke.

[0097] Fifth, regarding cognitive function and memory decline, 1,1-DEE demonstrated an effect of improving cognitive ability in normal mice as well as in a stroke model. In the stroke model, mice administered 1,1-DEE found the platform faster, followed a more direct path, and traveled a significantly shorter distance. In normal mice as well, learning speed and memory tended to improve after repeated administration, with escape time significantly reduced, particularly in the post-test. These results suggest that 1,1-DEE is effective in preventing or improving cognitive function and memory decline.

[0098] Meanwhile, the scope of the present invention is not limited by the effects described above. Brief explanation of the drawing

[0099] Figure 1 shows the reversible inhibitory effects of oxygen consumption rate and cellular glycolysis in AC16 cells after acute exposure to 1,1-DEE: (A) 2D structure of 1,1-DEE. (B) Viability assay of AC16 cells using EZ-Cytox reagent after 24 hours of incubation with specified concentrations of 1,1-DEE. (C) Mitochondrial respiration was evaluated using the Agilent Seahorse XF96 cell mitochondrial stress test kit after acute exposure to 1,1-DEE, metformin, and 1,2-DEE for 30 minutes. OCR was measured after sequentially adding various concentrations of 1,1-DEE, 1.5 μM oligomycin (oligo), 1.5 μM FCCP, and 0.5 μM rotenone / antimicin (R / A). (D) Proton leakage, ATP production, maximum respiration, and respiratory reserve capacity were measured using the Seahorse XF96 Cell Mito Stress Test Kit. (E) ECAR was measured under the conditions mentioned in (C). Figure 2 shows the concentration and time-dependent activation of AMPK following acute exposure to 1,1-DEE. Western blot analysis of AC16 cells was performed to evaluate AMPK phosphorylation under the following conditions: (A) incubation with various concentrations of 1,1-DEE for 10 minutes, (B) incubation with 15 mM 1,1-DEE for 30 minutes, (C) incubation with 15 mM 1,2-DEE for 30 minutes, and (D) incubation with 15 mM metformin for 60 minutes. Figure 3 shows the effects of AMPK activation on fatty acid oxidation and glycolysis after acute exposure to 1,1-DEE: (A) AC16 cells were exposed to 15 mM 1,1-DEE for 30 minutes. Phosphorylation of AMPK, ACC, and PFKFB2 was evaluated via Western blot analysis. (B) AC16 cells were exposed to 15 mM 1,1-DEE for 8 hours. mRNA expression levels of SREBP-1c and FASN were evaluated using semi-quantitative PCR and qRT-PCR. (C) WT and AMPK DKO MEF cells were exposed to 15 mM 1,1-DEE for 30 minutes. (D) AC16 cells were pretreated with 10 μM compound C for 1 hour and then incubated with 15 mM 1,1-DEE for 120 minutes. Western blot analysis was performed to evaluate the phosphorylation of AMPK effectors, including ACC and PFKFB2. Figure 4 indicates that AMPK activation may be partially mediated by 1,1-DEE-induced ROS generation. AC16 cells were pretreated with 10 mM NAC for 2 hours or 10 μM ebselen for 1 hour, followed by exposure to 15 mM 1,1-DEE for 30 minutes. ROS generation was observed by performing immunofluorescence staining with DCFH-DA, and Western blot analysis was performed to evaluate AMPK activation through phosphorylation in Thr172 residues. Figure 5 indicates that long-term exposure to 1,1-DEE can increase PGC-1α expression through AMPK activation. (AC) AC16 cells were cultured with 15 mM 1,1-DEE for up to 8 hours: (A) AMPK phosphorylation was evaluated by Western blot analysis. (B) PPARGC1A mRNA expression levels were analyzed by RT-PCR. (C) PGC-1α protein expression levels were confirmed by Western blot analysis. (D) MEF cells were cultured with 15 mM 1,1-DEE for up to 12 hours, after which AMPK phosphorylation and PGC-1α expression were evaluated by Western blot analysis. Figure 6 indicates that PGC-1α-mediated AMPK activation can promote mitochondrial biosynthesis. (AB) AC16 cells were cultured with 15 mM 1,1-DEE for up to 8 hours: (A) mRNA expression levels of Nrf1, Nrf2, and Tfam were evaluated by real-time PCR. (B) Protein expression levels of Nrf1, Nrf2, and Tfam were analyzed by Western blot. (C) After culturing WT and AMPK DKO MEF cells with 15 mM 1,1-DEE for up to 8 hours, protein expression levels of Nrf1, Nrf2, and Tfam were confirmed by Western blot analysis. (D) AC16 cells were pretreated with compound C (10 μM) for 4 hours and then exposed to 15 mM 1,1-DEE for 24 hours, and protein expression levels of Tfam were evaluated by Western blot analysis. (E) AC16 cells were pretreated with compound C (10 μM) for 4 hours, exposed to 15 mM 1,1-DEE for 8 hours, and then stained with MitoTracker Red CMXRos (200 nM) for 30 minutes. Mitochondrial biosynthesis was evaluated using a confocal microscope at 40x magnification. (F) Flow cytometry of AC16 cells was performed under the same conditions as in (E). Figure 7 shows the effect of 1,1-DEE(A) according to the present invention on the development of Caenorhabditis elegans at concentrations of 100 μm and 1 mM. Figure 8 shows the effect of 1,1-DEE(A) according to the present invention on the development of Caenorhabditis elegans at a concentration of 20 mM. Figure 9 shows the effect of 1,2-DEE, an isoform of 1,1-DEE(A) according to the present invention, on the development of Caenorhabditis elegans at concentrations of 100 μm and 1 mM. Figure 10 shows the effect of 1,1-DEE(A) according to the present invention on the lifespan extension of Caenorhabditis elegans at concentrations of 100 μm and 1 mM. Figure 11 shows the effect of 1,2-DEE, an isoform of 1,1-DEE(A) according to the present invention, on the lifespan extension of Caenorhabditis elegans at concentrations of 100 μm and 1 mM. Figure 12 shows the change in the beat rate (BPM: beats per minute) of EHT over time before and after treatment with 1,1-DEE and 1,2-DEE at different concentrations. Figure 13 shows the change in beats per minute (BPM) of EHT over time before and after treatment with 1,1-DEE and 1,2-DEE at different concentrations. (Top: 1,1-DEE and 1,2-DEE concentrations 26 mM) Figure 14 shows the change in twitch force of EHT over time before and after treatment with 1,1-DEE and 1,2-DEE at different concentrations. Figure 15 shows the change in twitch force of EHT over time before and after treatment with 1,1-DEE and 1,2-DEE at different concentrations. (Top: 1,1-DEE and 1,2-DEE concentrations 26 mM) Figure 16 shows representative images of the beating changes of EHT according to 1,1-DEE and 1,2-DEE treatments (50 mM). Figure 17 shows the changes in the beating rate and twitch force of EHT in the time interval from immediately after treatment to 10 minutes after treatment with 1,1-DEE at a concentration of 25 mM. Figure 18 shows cell viability and morphological changes in SHSY-5Y cells according to the concentration and treatment time of 1,1-diethoxyethane (1,1-DEE) and 1,2-1,1-diethoxyethane (1,2-DEE). (A) shows cell viability measured by MTT assay after treatment with 1,1-DEE or 1,2-DEE for 24 hours, and each experiment was repeated three times. (B) shows the results of observing morphological changes in SHSY-5Y cells over time (6, 12, 24 hours) after treatment with various concentrations (1, 5, 10, 20 mM) of 1,1-DEE or 1,2-DEE using a backlight microscope at 20x magnification. Figure 19 shows the results of analyzing the cell death-inducing effect of 1,1-DEE in SHSY-5Y cells via flow cytometry. After 24 hours of treatment, the cell death rate significantly increased as the concentration of 1,1-DEE increased, and the results were expressed as mean ± standard deviation (SD) based on three independent experiments. Figure 20 shows how AMPK activity induced by 1,1-DEE in SHSY-5Y cells changes over time. Cells were treated with 1,1-DEE for 0 to 120 minutes, and the expression of total AMPK and phosphorylated AMPK proteins was measured by Western blot analysis. Figure 21 shows tumor progression and the inhibitory effect of 1,1-DEE in a xenograft mouse model using SHSY-5Y cells. (A) shows the change in tumor volume in the 1,1-DEE treatment group and the control group, and (B) shows the results of evaluating the effect on systemic condition through changes in mouse body weight. Figure 22 shows the survival rate and changes in body weight following the prophylactic administration of 1,1-DEE in a xenograft mouse model. (A) shows the difference in survival rate between the treatment group and the control group, and (B) shows the change in body weight from the start of administration to the end of the survival period. Figure 23 shows the protective effect of 1,1-DEE on ischemic stroke mortality. The control group showed a mortality rate of 30% after middle cerebral artery occlusion (MCAO), whereas the 1,1-DEE treatment group showed a mortality rate of 0%. Data were expressed as mean ± standard error (SE), and showed a statistically significant difference with p < 0.05, relative risk (RR) = 0.3684, and 95% confidence interval (CI): 0.1915–0.9505. Figure 24 illustrates the beneficial effects of 1,1-DEE on body weight change after stroke. Body weights of the experimental and control groups were measured at 6-day intervals from baseline to end. (A): The control group showed an average decrease of 3.77% compared to baseline weight, whereas the treatment group showed an increase of 5.46% (t-test, p < 0.001). (B): The control group showed continuous weight loss throughout the experiment, while the treatment group showed steady weight gain. At the end of the experiment, the average body weight of the treatment group was significantly higher than that of the control group (27.68 g vs. 26.29 g, t-test, p < 0.05). All data are expressed as mean ± standard error. Figure 25 illustrates the effects of 1,1-DEE on spatial cognition and memory enhancement. (A): The cumulative percentage of mice that found the hidden platform was plotted on a time-to-event graph and analyzed using the Accelerated Time to Failure (AFT) survival analysis model. At the 20-second mark, the success rate of the treatment group was significantly higher than that of the control group (33% vs. 0%, p < 0.05). However, no statistical significance was observed at the 40-second and 60-second marks. (B): Analysis of representative swimming paths showed that mice treated with 1,1-DEE followed a direct and efficient path to the platform, whereas control mice exhibited an irregular and directionless path. (C): Comparison of swimming distances among mice that successfully found the platform revealed that the treatment group reached the platform via a significantly shorter path than the control group (146.3 cm vs. 820.8 cm, t-test, p < 0.01). All data are presented as mean ± standard error. Figure 26 indicates that 1,1-DEE can alleviate ischemic stroke and improve motor function after stroke. (A): Representative brain magnetic resonance imaging (MRI) results for each experimental group are presented, showing that mice treated with 1,1-DEE exhibited relatively less damage caused by middle cerebral artery occlusion (MCAO). (B): Maximum swimming speeds measured during the Morris Water Maze (MWM) test were compared. The treatment group recorded significantly higher maximum swimming speeds compared to the control group (33.83 cm / s vs. 27.77 cm / s, t-test, p < 0.05). All data are expressed as mean ± standard error (SE). Figure 27 indicates that 1,1-DEE can improve spatial cognition and memory in mice after stroke. (A): The time-to-event curve represents the cumulative proportion of mice that found the hidden platform, analyzed based on the accelerated failure time (AFT) survival analysis model. Overall, the 1,1-DEE treatment group had a higher probability of success in reaching the platform than the control group; in particular, at the initial 20-second mark, the success rate of the treatment group was 33%, which was statistically significantly higher than that of the control group (0%) (p < 0.05). On the other hand, at the 40-second and 60-second marks, the difference between the two groups was not statistically significant. (B): 1,1-DEE treated mice showed a direct swimming path toward the platform, whereas control mice showed an irregular and random path. (C): When comparing the swimming path lengths among mice that successfully found the platform, the 1,1-DEE treatment group had an average of 146.3 cm, which was significantly shorter than the control group (average 820.8 cm) (p < 0.01, t-test). All data were expressed as mean ± standard error (SE). Figure 28 shows that 1,1-DEE can improve learning and memory in normal mice. ([AD]: The time-to-event curves representing the cumulative rate of platform attainment over time show the results for the pre-test (A), post-test after the first administration (B), post-test after the second administration (C), and post-test after the third administration (D), respectively. Although the difference between the 1,1-DEE treatment group and the control group in each session was not statistically significant (p > 0.05), the 1,1-DEE treatment group showed an overall tendency for faster platform attainment rates after repeated administrations. (E): Comparing the average escape times of each group between the pre-test and the subsequent three test periods, both groups exhibited similar initial performance capabilities. However, the 1,1-DEE treatment group showed a tendency for escape times to gradually decrease as the number of administrations increased, whereas no significant change was observed in the control group. Nevertheless, the difference between the groups was not statistically significant (p > 0.05). (F) The control group showed consistent performance without significant changes in the time-to-event curve between the pre-test and the subsequent three tests (p > 0.05). (G) On the other hand, a significant improvement in inter-test performance was observed in the time-event curve of the 1,1-DEE treatment group. In particular, the escape waiting time was significantly reduced in the second test compared to the pre-test (p < 0.01), and a significant improvement was also confirmed in the third test (p < 0.05). Figure 29 shows the results of improvements in mitochondrial respiration and glycolysis through AMPK activation following long-term 1,1-DEE treatment. (AO) AC16 cells were treated with various concentrations of 1,1-DEE, 1,2-DEE, and metformin for 8 hours. Mitochondrial respiration was evaluated using the Agilent Seahorse XF96 Cell Mito Stress Test Kit. Mitochondrial evaluations were performed in each treatment group (1,1-DEE, 1,2-DEE, metformin), and the evaluation parameters included oxygen consumption rate (OCR, A, E, I), basal respiration (B, F, J), ATP-linked production (C, G, K), and maximal respiration (D, H, L). Glycolysis was evaluated after treatment with 1,1-DEE (M), 1,2-DEE (N), and metformin (O). pt, AC16 cells were treated under three conditions. The conditions were administered for 8 hours using 1,1-DEE (15 mM), Compound C (10 μM, 4-hour pretreatment), 1,1-DEE (15 mM) combination, and metformin (15 mM). Measured parameters included mitochondrial OCR (P), basal respiration (Q), ATP-coupled production (R), maximal respiration (S), and ECAR (T). Data were presented as the mean ± SEM of three independent experiments (1,1-DEE) and two to three independent experiments (1,2-DEE, metformin), and p-values ​​were calculated using a multiple t-test (nsp > 0.05, *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001). Figure 30 shows the results of the evaluation of mitochondrial function improvement in C57BL / 6J mice following 1,1-DEE treatment. 1,1-DEE was administered to 8-week-old C57BL / 6J mice for 8 weeks (n=3). RNA-seq analysis was performed using mouse livers. (AG) Biological processes (GOBP) that were abundant in the 1,1-DEE-treated group were evaluated through GSEA preranked analysis. The evaluated items were “NADH dehydrogenase complex assembly” (A), “oxidative phosphorylation” (B), “mitochondrial respiratory chain complex assembly” (C), “aerobic respiration” (D), “aerobic electron transport chain” (E), “ATP biosynthesis” (F), and “ATP synthesis-linked electron transport” (G), which were not abundant in the untreated group. (H), The heatmap showed the differences in major gene expression between the untreated group and the 1,1-DEE-treated group. FIG. 31 shows the survival curve of rats injected with 1,1-DEE (300 μl) or physiological saline (NS, 300 μl) according to the present invention. FIG. 32 is a photograph for verifying health indicators (coat condition, body weight, activity level, etc.) of rats injected with 1,1-DEE (300 μl) or physiological saline (NS, 300 μl) according to the present invention. (A) Rat administered 1,1-DEE (Left: 688 g, Right: 796 g). (B) Rat administered physiological saline (NS) (Left: 620 g, Right: 781 g). Figure 33 shows the results of a comparison of cell migration patterns at 0 HR (immediately after stencil removal) and 12 HR after treatment for treatment groups at different concentrations of 1,1-DEE according to the present invention (1 mM, 10 mM, 50 mM). Figure 34 shows the quantification results of migration (μm²), migration percentage (%), and cell island expansion (fold change) for treatment groups at different concentrations of 1,1-DEE (1 mM, 10 mM, 50 mM) according to the present invention. Figure 35 shows the TMRE metabolic dye staining results (A) for treatment groups at different concentrations (1 mM, 10 mM, 50 mM) of 1,1-DEE according to the present invention, and the CTCF (Corrected Total Cell Fluorescence) quantitative analysis results (B) for the corresponding images. Specific details for implementing the invention

[0100] Hereinafter, a mitochondrial biosynthesis promoter comprising 1,1-diethoxyethane as an active ingredient according to a specific embodiment of the invention and the use thereof will be described in detail. However, this is presented as one example of the invention and does not limit the scope of the invention, and it is obvious to those skilled in the art that various modifications to the embodiment are possible within the scope of the invention. Throughout this specification, unless otherwise specifically stated, "includes" or "contains" refers to the inclusion of any component (or constituent) without any particular limitation and should not be interpreted as excluding the addition of other components (or constituents).

[0101] As used herein, the term "treatment" means any form of treatment or prevention that provides effects, including improvement of the individual's condition, delay of disease progression, delay of symptom onset, or slowing of symptom progression, to an individual who suffers from a disease or is at risk of developing a disease. Accordingly, the term "treatment" includes preventive treatment of the individual that prevents the onset of symptoms. Furthermore, the terms "treatment" and "prevention" are not intended to mean the cure or complete elimination of symptoms.

[0102] As used in this specification, the term "improvement" may mean any action that at least reduces parameters related to the alleviation or treatment of a condition, such as the degree of symptoms.

[0103] As used herein, the term “object” means an animal including animals such as cattle, monkeys, horses, sheep, pigs, chickens, turkeys, quails, cats, dogs, mice, rats, rabbits, or guinea pigs. For example, the object may be a mammal, particularly a human.

[0104] 1. Mitochondrial biosynthesis promoters

[0105] The present invention

[0106] We aim to provide a mitochondrial biosynthesis promoter comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient.

[0107] In the mitochondrial biosynthesis promoter according to the present invention, the 1,1-diethoxyethane can promote mitochondrial biosynthesis by increasing the expression of PGC-1α (peroxisome proliferator-activated receptor gamma coactivator-1 alpha).

[0108] In the mitochondrial biosynthesis promoter according to the present invention, the 1,1-diethoxyethane increases the transcriptional activity of Nrf1 and Nrf2, and can stimulate the expression of Tfam to promote mitochondrial biosynthesis.

[0109] In the mitochondrial biosynthesis promoter according to the present invention, the disease requiring the promotion of mitochondrial biosynthesis is ischemic brain diseases, ischemic heart diseases, reperfusion injury, stroke, ischemic stroke, migraine, anemia, Parkinson's disease, dementia, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), mitochondrial encephalomyopathy, cirrhosis, Fanconi syndrome, atypical phenylketonuria, asthma, chronic obstructive pulmonary disease It can be used to prevent, treat, or improve Obstructive Pulmonary Disease, Diabetes, Atherosclerosis, Hypertension, Hypercholesterolemia, Optic Nerve Diseases, Obesity, Depression, Leukemia, Cancer, Cancer Cachexia, Inflammation Diseases, Age-related Diseases, and Cardiovascular Diseases. According to one exemplary embodiment, the mitochondrial biosynthesis promoter may also be used as a blood glucose lowering agent, a cholesterol lowering agent, or a fatty acid lowering agent.

[0110] In the mitochondrial biosynthesis promoter according to the present invention, the mitochondrial biosynthesis promoter may be used in the preparation of a composition for the prevention or treatment of aging-related diseases, and a composition for delaying aging or extending lifespan.

[0111] In the mitochondrial biosynthesis promoter according to the present invention, the mitochondrial biosynthesis promoter may be used in the preparation of a composition for the prevention, improvement, or treatment of cardiovascular diseases.

[0112] In the mitochondrial biosynthesis promoter according to the present invention, the mitochondrial biosynthesis promoter may be used in a composition for the prevention, improvement, or treatment of cancer and cachexia derived from said cancer.

[0113] In the mitochondrial biosynthesis promoter according to the present invention, the mitochondrial biosynthesis promoter may be used in the preparation of a composition for the prevention, improvement, or treatment of stroke.

[0114] In the mitochondrial biosynthesis promoter according to the present invention, the mitochondrial biosynthesis promoter can be used in the preparation of a composition for the prevention, improvement, or treatment of dementia.

[0115] In the mitochondrial biosynthesis promoter according to the present invention, the mitochondrial biosynthesis promoter may be used in the preparation of a composition for the prevention, improvement, or treatment of cognitive ability or memory decline.

[0116] In the mitochondrial biosynthesis promoter according to the present invention, the mitochondrial biosynthesis promoter may be used in the preparation of a composition for enhancing immunity, improving physical strength, enhancing physical endurance, increasing energy levels, increasing vitality, enhancing physical recovery, or supporting continuous physical activity.

[0117] In the mitochondrial biosynthesis promoter according to the present invention, the mitochondrial biosynthesis promoter can also be used as a (stem) cell differentiation and maturation promoter.

[0118] In the mitochondrial biosynthesis promoter according to the present invention, the concentration of 1,1-diethoxyethane may be 1 mM to 25 mM.

[0119] 2. Uses of Mitochondrial Biosynthesis Promoters

[0120] The present invention aims to provide a pharmaceutical composition, cosmetic composition, food composition, or feed composition for the prevention, treatment, or improvement of diseases requiring the promotion of mitochondrial biosynthesis, comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient.

[0121] 2.1. Diseases Requiring Promotion of Mitochondrial Biosynthesis

[0122] According to one embodiment,

[0123] The present invention aims to provide a composition for the prevention, improvement, or treatment of diseases requiring the promotion of mitochondrial biosynthesis, comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient.

[0124] In the composition according to the present invention, the disease requiring the promotion of mitochondrial biosynthesis is ischemic brain diseases, ischemic heart diseases, reperfusion injury, stroke, ischemic stroke, migraine, anemia, Parkinson's disease, dementia, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), mitochondrial encephalomyopathy, cirrhosis, Fanconi syndrome, atypical phenylketonuria, asthma, chronic obstructive pulmonary disease It may be one or more selected from the group consisting of Pulmonary Disease, Diabetes, Atherosclerosis, Hypertension, Hypercholesterolemia, Optic Nerve Diseases, Obesity, Depression, Leukemia, Cancer, Cancer Cachexia, Inflammation Diseases, Age-related Diseases, and Cardiovascular Diseases, but is not limited thereto.

[0125] (1) Delaying aging or extending lifespan

[0126] As used in this specification, the term "aging" refers to a phenomenon involving various physiological changes that occur over time after an individual's birth, such as a decrease in cell differentiation and proliferation, degeneration of function, reduced homeostasis of organ and system structures, and increased susceptibility to external stress and disease. The term "aging-related disease" refers to a disease that occurs more frequently with aging. In the present invention, delaying the aging of an individual means reducing the rate of aging that occurs over time compared to a control group, that is, an individual not treated or administered with the composition according to one embodiment, thereby causing aging to proceed more slowly.

[0127] As used in this specification, the term "life extension" means extending the lifespan of an individual for a longer period compared to natural circumstances. For example, "life extension" may mean extending the lifespan of an individual determined by innate or acquired factors, such as genetic factors. Specifically, "life extension" may involve extending the lifespan of an individual by appropriately controlling factors that control lifespan caused by genetic factors, such as the degree of expression of related genes or the degree of production of related proteins, and may include extending the lifespan of an individual by appropriately controlling factors that control lifespan caused by acquired factors, such as the environment. For example, "life extension" may involve extending the time of natural death of an organism. In the present invention, extending the lifespan of an individual means causing it to survive for a longer period compared to a control group, that is, an individual that has not been treated or administered the composition according to one embodiment.

[0128] According to one exemplary implementation,

[0129] A composition for the prevention or treatment of aging-related diseases and for delaying aging or extending lifespan is disclosed, comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient.

[0130] In the present invention, the aging-related disease may be one or more diseases selected from the group consisting of Alzheimer's disease, diabetes, Parkinson's disease, Huntington's disease, degenerative joint disease, stroke, angina pectoris, osteoporosis, myocardial infarction, muscular dystrophy, amyotrophic lateral sclerosis, sarcopenia, liver cirrhosis, chronic kidney disease, macular degeneration, heart failure, geriatric depression, degenerative disc disease, spinal stenosis, metabolic syndrome, and decreased lung function.

[0131] In the present invention, the aging-related disease may be a cognitive impairment disease caused by aging, and the cognitive function may specifically be one or more selected from the group consisting of perception, memory, attention, speech comprehension, speech generation, reading comprehension, creation of imagery, learning, and reasoning.

[0132] In the present invention, when the disease requiring the promotion of mitochondrial biosynthesis is an aging-related disease, the 1,1-diethoxyethane may be added at a concentration of 100 μM or more and less than 20 mM. Preferably, the 1,1-diethoxyethane may be added at a concentration of 1 mM or more and 10 mM or less. If the concentration of the 1,1-diethoxyethane is less than 100 μM, an effective effect may not appear, and if it is 20 mM or more, development may be inhibited.

[0133] In one embodiment, 1,1-diethoxyethane (1,1-DEE) according to the present invention exhibited a lifespan extension effect without inhibiting development in a Caenorhabditis elegans model. Therefore, it is expected that 1,1-diethoxyethane (1,1-DEE) according to the present invention can be usefully utilized in pharmaceutical compositions, cosmetic compositions, food compositions, health functional foods, or feed compositions for delaying aging or extending lifespan.

[0134] (2) Cardiovascular disease

[0135] According to one exemplary implementation,

[0136] A composition for the prevention, improvement, or treatment of cardiovascular disease comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient is disclosed.

[0137] In the present invention, the pharmaceutical composition can reduce the contractile force (twitch force) of the myocardial cell.

[0138] In the present invention, the pharmaceutical composition may temporarily increase the heart rate rapidly. For example, the pharmaceutical composition may increase the heart rate rapidly for 10 to 60 minutes after administration.

[0139] In the present invention, the cardiovascular disease may be selected from one or more of the group consisting of hypertension, arrhythmia, heart failure, heart attack, myocardial infarction, arteriosclerosis, angina pectoris, stroke, cerebral hemorrhage, hemangioma, coronary artery disease, aortic disease, cerebrovascular disease, ischemic disease, pulmonary embolism, peripheral vascular disease, and cardiovascular disease requiring heart rate promotion. In the pharmaceutical composition according to the present invention, the cardiovascular disease requiring heart rate promotion may be selected from one or more of the group consisting of bradycardia, bradyarrhythmia, bradycardic angina, heart failure, neurogenic syncope, hypotensive shock, and hypothyroidism.

[0140] In the present invention, the bradycardia may be selected from one or more types from the group consisting of transient bradycardia, vasovagal bradycardia, beta-blocker overdose-induced bradycardia, bradycardia during anesthesia induction, bradycardia post-cardiac arrest, and bradycardia due to neurogenic shock, but is not limited thereto.

[0141] In the present invention, the bradyarrhythmia may include Sick Sinus Syndrome (SSS) or Atrioventricular Block (AV Block), but is not limited thereto.

[0142] In the present invention, the hypotensive shock may include, but is not limited to, cardiogenic shock or septic shock.

[0143] In one embodiment, 1,1-diethoxyethane (1,1-DEE) according to the present invention can temporarily and rapidly increase the heart rate, and thus can be effectively used for the prevention, treatment, or improvement of cardiovascular diseases. The composition of the present invention is applicable not only for pharmaceutical use but also as a functional food and animal feed, thereby providing various possibilities for application. For example, when used as a functional food, it can help with the health management of individuals requiring heart rate control, and when applied as animal feed, it can contribute to the control of heart rate abnormalities in livestock or companion animals. Accordingly, the present invention provides a novel treatment method that safely and effectively increases the heart rate by utilizing 1,1-DEE, and presents an innovative technology that can contribute to the prevention and treatment of cardiovascular diseases requiring heart rate stimulation.

[0144] (3) Cancer

[0145] According to one exemplary implementation,

[0146] A composition for the prevention, improvement, or treatment of cancer comprising 1,1-diethoxytain as an active ingredient is disclosed.

[0147] In the present invention, the cancer is pancreatic cancer, lung cancer, mesothelioma, stomach cancer, esophageal cancer, liver cancer, biliary tract cancer, bladder cancer, head and neck cancer, oral cancer, nasopharyngeal cancer, adult brain cancer, colon cancer, rectum cancer, colorectal cancer, prostate cancer, ovarian cancer, cervical cancer, uterine cancer, testicular cancer, lymphoma, leukemia, skin cancer, breast cancer, kidney cancer, neuroblastoma, Merkel cell carcinoma, It can be selected from the group consisting of myelodysplastic syndrome, myelofibrosis, and multiple myeloma.

[0148] In the present invention, the 1,1-diethoxytain can activate adenosine monophosphate-activated protein kinase (AMPK).

[0149] In the present invention, the 1,1-diethoxyethane can induce apoptosis.

[0150] In the present invention, the 1,1-diethoxyethane can prevent or treat cachexia derived from the cancer.

[0151] In one embodiment, 1,1-diethoxyethane (1,1-DEE) according to the present invention can exhibit an anticancer effect by significantly reducing cancer cell survival rates and inducing apoptosis, and can provide a novel anticancer mechanism based on energy metabolism regulation through the activation of the AMPK pathway. In addition, tumor growth inhibitory effects were confirmed through in vivo experiments, and additional therapeutic effects such as prevention of cancer cachexia and improvement of survival rates were also provided. Furthermore, unlike 1,2-DEE, 1,1-DEE exhibits effects selectively, so it can be utilized as an excellent anticancer candidate substance in terms of safety and efficacy. Therefore, a composition containing 1,1-diethoxyethane according to the present invention is expected to be usefully utilized as a pharmaceutical composition, food composition, cosmetic composition, or feed composition for the prevention, treatment, or improvement of cancer and cachexia derived therefrom.

[0152] (4) Stroke

[0153] In the present invention, "stroke" refers to symptoms of localized neurological deficits suddenly induced by abnormal cerebral blood flow. Such strokes may include cerebral infarction, in which the death of brain cells is induced by blockage of cerebral blood vessels due to blood clots, etc., or cerebral hemorrhage, which occurs when cerebral blood vessels rupture. Specific symptoms of stroke include sudden headache and vomiting; hemiplegia or paralysis of a part of the body; sensory paralysis or loss of sensation in a part of the body; and speech disorders (aphasia or dysarthria), facial nerve disorders, and ataxia. In the present invention, "stroke" may refer to apoplexy.

[0154] According to one exemplary implementation,

[0155] A composition for the prevention, improvement, or treatment of stroke comprising 1,1-diethoxytain as an active ingredient is disclosed.

[0156] In the present invention, the stroke may be an ischemic stroke or a hemorrhagic stroke.

[0157] In the present invention, the composition may promote the recovery of motor function impaired by stroke or reduce the size of the infarction.

[0158] In one embodiment, 1,1-diethoxytain (1,1-DEE) according to the present invention showed therapeutic effects such as improved survival rate through reduced mortality in ischemic stroke (mouse MCAO model), improved general condition through weight recovery, improved spatial cognitive ability and memory, and neuroprotection through reduced brain damage, suggesting the possibility that it is an effective therapeutic substance for neuroprotection and cognitive recovery against ischemic stroke.

[0159] (5) Dementia

[0160] According to one exemplary implementation,

[0161] A composition for the prevention, improvement, or treatment of dementia comprising 1,1-diethoxyethanein as an active ingredient is disclosed.

[0162] In the present invention, the above-mentioned tooth may be vascular dementia, Alzheimer's disease, dementia with Lewy bodies, or frontotemporal dementia (FTD).

[0163] In one embodiment, 1,1-diethoxyethane (1,1-DEE) according to the present invention showed effects such as increased success rate of reaching the platform, improved cognitive function in the early stages of learning, securing an efficient swimming path, and shortening the swimming distance in ischemic stroke (MCAO-induced mouse model). In particular, considering the fact that it induced improvement in cognitive function regardless of motor ability, along with the results of confirming the brain damage site via MRI, 1,1-DEE suggests the possibility of being an effective therapeutic substance for the recovery of cognitive function and neuroprotection after ischemic brain injury.

[0164] (6) Cognitive ability or memory

[0165] According to one exemplary implementation,

[0166] A composition for preventing, improving, or treating cognitive decline or memory loss, or a composition for improving cognitive ability or memory, comprising 1,1-diethoxyethane as an active ingredient is disclosed.

[0167] In one embodiment and in another embodiment, 1,1-diethoxyethane (1,1-DEE) according to the present invention demonstrated an effect of improving spatial cognitive ability and memory by inducing an increase in the success rate of reaching the platform via the Morris Water Maze test and a reduction in the average latency upon repeated administration in a normal mouse model. In particular, although there was no difference in performance between the two groups at the beginning of the experiment, significant performance improvement was observed after repeated administration, suggesting that 1,1-DEE is a substance capable of improving cognitive function even in normal individuals.

[0168] 2.2. Examples of composition

[0169] (1) Pharmaceutical composition

[0170] In the pharmaceutical composition according to the present invention, the pharmaceutical composition may be administered orally, intravenously, subcutaneously, intramuscularly, intraperitoneally, epithelially, topically, vaginally, pulmonaryly, rectally, sublingually, buccally, transdermally, ocularly, inhaled, intracavernously, intrathecally, epidurally, and rectally. When administered orally, for example, the pharmaceutical composition may be formulated as a tablet, or the active agent may be coated or protected from degradation in the stomach. Additionally, the composition may be administered by any device capable of delivering the active substance to target cells. The route of administration may vary depending on the general condition and age of the subject being treated, the nature of the treatment conditions, and the selected active ingredient.

[0171] In the pharmaceutical composition according to the present invention, the pharmaceutical composition may be carried on a carrier, and the carrier may include one or more selected from virus particles, vesicles, nanoparticles, microparticles, liposomes, transposons, micelles, antibodies, and exosomes, but is not limited thereto.

[0172] In the pharmaceutical composition according to the present invention, the suitable dosage of the pharmaceutical composition varies depending on factors such as the formulation method, the mode of administration, the patient's age, body weight, sex, pathological condition, food, time of administration, route of administration, excretion rate, and response sensitivity, and a physician of ordinary skill can easily determine and prescribe a dosage effective for the desired treatment or prevention. For example, the pharmaceutical composition may be administered as a single or multiple doses, or divided into 1 to 4 doses per day. For example, the pharmaceutical composition may contain 0.01 mg / kg to 100 mg / kg, preferably 0.02 mg / kg to 90 mg / kg, and more preferably 0.03 mg / kg to 80 mg / kg per adult.

[0173] In the pharmaceutical composition according to the present invention, the pharmaceutical composition may be prepared in a unit dose form or contained in a multi-dose container by formulation using a pharmaceutically acceptable carrier and / or excipient according to a method that can be easily carried out by a person skilled in the art to which the invention pertains. In this case, the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or in the form of an extract, powder, granule, tablet, or capsule, and may additionally include a dispersant or a stabilizer. Furthermore, the pharmaceutical composition may be administered in the form of a suppository, spray, ointment, cream, gel, inhalant, or skin patch. Additionally, the pharmaceutical composition may be prepared for administration to mammals, more preferably for administration to humans.

[0174] In the pharmaceutical composition according to the present invention, the pharmaceutically acceptable carrier may be a solid or a liquid and may be one or more selected from excipients, antioxidants, buffers, bacteriostatic agents, dispersants, adsorbents, surfactants, binders, preservatives, disintegrants, sweeteners, flavoring agents, lubricants, release regulators, wetting agents, stabilizers, suspending agents, and lubricants. Additionally, the pharmaceutically acceptable carrier may be selected from saline solution, sterile water, Ringer's solution, buffered saline solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and mixtures thereof.

[0175] In one embodiment, suitable fillers may include, but are not limited to, sugars (e.g., dextrose, sucrose, maltose and lactose), starch (e.g., corn starch), sugar-alcohols (e.g., mannitol, sorbitol, maltitol, erythritol and xylitol), starch hydrolysates (e.g., dextrin and maltodextrin), cellulose or cellulose derivatives (e.g., microcrystalline cellulose).

[0176] In one embodiment, suitable binders may include, but are not limited to, povidone, copovidone, methylcellulose, hydroxymethylcellulose, hydroxypropylmethylcellulose, hydroxypropylcellulose, hydroxyethylcellulose, gelatin, gums, sucrose, starch, or mixtures thereof.

[0177] In one embodiment, suitable preservatives may include, but are not limited to, benzoic acid, sodium benzoate, benzyl alcohol, butylated hydroxyanisole, butylated hydroxytoluene, chlorbutol, gallate, hydroxybenzoate, EDTA, or mixtures thereof.

[0178] In one embodiment, suitable disintegrant may be sodium starch glycolate, cross-linked polyvinylpyrrolidone, cross-linked carboxymethylcellulose, starch, microcrystalline cellulose, or a mixture thereof, but is not limited thereto.

[0179] In one embodiment, suitable sweeteners may include, but are not limited to, sucralose, saccharin, sodium or potassium or calcium saccharin, acesulfame potassium or sodium cyclamate, mannitol, fructose, sucrose, maltose, or mixtures thereof.

[0180] In one embodiment, suitable glidant may be silica, colloidal silicon dioxide, talc, etc., but is not limited thereto.

[0181] In one embodiment, suitable lubricants may include, but are not limited to, long-chain fatty acids and their salts, such as magnesium stearate and stearic acid, talc, glyceride wax, or mixtures thereof.

[0182] (2) Cosmetic composition

[0183] In the cosmetic composition according to the present invention, the cosmetic composition may be used for skin regeneration, wrinkle improvement, or skin moisturization.

[0184] In the cosmetic composition according to the present invention, the cosmetic composition may additionally include a dermatologically acceptable carrier. The dermatologically acceptable carrier may include, but is not limited to, purified water, oil, wax, fatty acid, fatty acid alcohol, fatty acid ester, surfactant, hygroscopic agent, thickener, antioxidant, viscosity stabilizer, chelating agent, buffer, preservative, lower alcohol, etc., and its type and concentration may vary and may include parts that a person skilled in the art can modify within the scope of the present invention.

[0185] In the cosmetic composition according to the present invention, in addition to the active ingredient of the present invention, the cosmetic composition may include functional substances as needed, such as whitening agents, moisturizers, anti-inflammatory agents, antibacterial agents, antifungal agents, vitamins, sunscreens, antibiotics, anti-acne agents, perfumes, and dyes, and these may be included in the cosmetic composition according to the present invention in amounts commonly used in the field of cosmetics. To enhance the functional effect, the cosmetic composition of the present invention may additionally contain one or more moisturizing active ingredients exhibiting the same or similar functions.

[0186] In the cosmetic composition according to the present invention, the cosmetic composition may be prepared in the form of a general emulsion formulation and a solubilizing formulation. Cosmetics in the form of an emulsion include nourishing lotions, creams, essences, etc., and cosmetics in the form of a solubilizing formulation include softening lotions. In addition to the active ingredient of the present invention, the cosmetic composition may also be prepared in the form of an adjuvant for topical or systemic application commonly used in the art by containing a dermatologically acceptable medium or base. Suitable cosmetic formulations may be provided, for example, in the form of a solution, gel, solid or paste anhydrous product, an emulsion obtained by dispersing an oil phase in an aqueous phase, a suspension, a microemulsion, a microcapsule, a microgranulocyte, or an ionic (liposome) or non-ionic vesicular dispersant, or in the form of a cream, skin toner, lotion, powder, ointment, spray, or conceal stick. Additionally, it may be prepared in the form of a foam or an aerosol composition further containing a compressed propellant.

[0187] In the cosmetic composition according to the present invention, the cosmetic composition may be formulated into one or more selected from the group consisting of a solution, an external ointment, a cream, a foam, a nourishing lotion, a softening lotion, a perfume, a pack, a softening water, a lotion, a makeup base, an essence, a soap, a liquid cleanser, a bath additive, a sunscreen cream, a sun oil, a suspension, an emulsion, a paste, a gel, a lotion, a powder, a soap, a surfactant-containing cleansing product, an oil, a powder foundation, an emulsion foundation, a wax foundation, a patch, and a spray.

[0188] (3) Food composition

[0189] As used in this specification, the term “food” refers to a natural product or processed product containing one or more nutrients, preferably one that has undergone some degree of processing to become ready for direct consumption, and in a conventional sense may include food, food additives, functional foods, and beverages.

[0190] As used in this specification, the terms “functional food” or “health functional food” refer to a group of foods to which added value has been added to the food by using physical, biochemical, or biotechnological methods to act or manifest the function of the food for a specific purpose, or to foods designed and processed to sufficiently express in vivo regulatory functions regarding the regulation of biological defense rhythms, disease prevention, and recovery, which are inherent in the food composition; specifically, they may be health functional foods. The functional food may include food science-acceptable food additives and may further include appropriate carriers, excipients, and diluents commonly used in the manufacture of functional foods. The types of health functional foods may include, but are not limited to, powder, granules, tablets, capsules, or beverage forms.

[0191] In the food composition according to the present invention, the food composition may be used to improve fatigue or enhance exercise performance. For example, the food composition may be used to prevent or improve physical fatigue, muscle fatigue, muscle pain, decreased muscle function, muscle diseases caused by muscle wasting or muscle degeneration, muscle wasting, decreased explosiveness, or decreased endurance, but is not limited thereto.

[0192] In the food composition according to the present invention, the food is characterized as being meat, sausage, bread, chocolate, candy, snack, confectionery, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, tea, coffee beverages, stamina drinks, alcoholic beverages, or vitamin complexes.

[0193] In the food composition according to the present invention, the food composition may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, the composition of the present invention may contain fruit pulp for the production of natural fruit juice, fruit juice beverages, or vegetable beverages. These ingredients may be used independently or in combination.

[0194] In the food composition according to the present invention, the term “functional food or health functional food” refers to a group of foods to which added value is imparted by using physical, biochemical, or biotechnological methods to make the function of the food act or manifest for a specific purpose, or a food processed by designing it to sufficiently express in the body the in vivo regulatory functions regarding the regulation of biological defense rhythms, disease prevention, and recovery possessed by the food composition; specifically, it may be a health functional food. The functional food may include food-scientifically acceptable food auxiliary additives and may further include appropriate carriers, excipients, and diluents commonly used in the manufacture of functional foods.

[0195] (4) Feed composition

[0196] In the feed composition according to the present invention, the feed comprises nutrients such as energy, protein, lipids, vitamins, and minerals required by animals, and may be a plant-based feed such as grains, root vegetables, food processing by-products, algae, fibers, oils, starches, meal, grain by-products, or animal-based feed such as proteins, inorganic substances, oils, minerals, oils, and single-cell proteins, but is not limited thereto.

[0197] In the feed composition according to the present invention, the feed may be powder feed, solid feed, moist pellet feed, dry pellet feed, EP (Extruder Pellet) feed, raw feed, etc., but is not limited thereto.

[0198] In the feed composition according to the present invention, the feed composition may include binders, emulsifiers, preservatives, etc. added to prevent quality degradation, and the feed composition may include feed additives. To increase utility, amino acid preparations, vitamin preparations, enzyme preparations, flavoring agents, non-protein nitrogen compounds, silicate preparations, buffering agents, extractants, oligosaccharides, etc. may be added to the feed. In addition, feed mixing agents, etc. may be additionally included, but are not limited thereto.

[0199] 3. Treatment methods for diseases requiring mitochondrial biosynthesis promoters

[0200] The present invention

[0201] The present invention aims to provide a method for preventing or treating diseases requiring the promotion of mitochondrial biosynthesis, comprising the step of administering to an individual a pharmaceutical composition containing 1,1-diethoxyethane (1,1-DEE) according to Item 1 above as an active ingredient. According to one exemplary embodiment, the present invention aims to provide a method for preventing or treating aging-related diseases, preventing or treating cardiovascular diseases, preventing or treating cancer, preventing or treating stroke, dementia, or cognitive decline or memory loss, comprising the step of administering to an individual a pharmaceutical composition containing 1,1-diethoxyethane (1,1-DEE) according to Item 1 above as an active ingredient.

[0202] In the method according to the present invention, the individual may include, but is not limited to, a human, a cow, a monkey, a horse, a sheep, a pig, a chicken, a turkey, a quail, a cat, a dog, a mouse, a rat, a rabbit, or a guinea pig.

[0203] In the method according to the present invention, the route of administration, dosage, and frequency of administration of the pharmaceutical composition may be administered to the subject in various ways and amounts depending on the patient's condition and the presence or absence of side effects, and the optimal method of administration, dosage, and frequency of administration may be selected by a person skilled in the art within an appropriate range. In the present invention, the preferred dosage of the exosome or pharmaceutical composition may be in the range of 0.001 mg / kg to 100 mg / kg per day for adults, depending on the patient's condition, body weight, gender, age, severity of the patient, and route of administration. Administration may be performed once a day or divided into several doses. Such dosage shall not be interpreted as limiting the scope of the present invention in any aspect.

[0204] Various embodiments are presented below to aid in understanding the invention. The following embodiments are provided merely to facilitate a better understanding of the invention and do not limit the scope of protection of the invention to the following embodiments.

[0205] Materials and Methods

[0206] 1. Ingredients

[0207] 1,1-DEE (A902), 2′′-dichlorofluorescein diacetate (DCFH-DA) (#35845), N-acetyl-L-cysteine ​​(A9165), and hydrogen peroxide (H2O2, #88579) were purchased from Sigma-Aldrich (St. Louis, MO, USA). 1,2-DEE was purchased from Tokyo Chemical Industry (Tokyo, Japan). The EZ-Cytox assay kit (EZ-3000) was purchased from DoGenBio (Geumcheon, Seoul, Republic of Korea). MitoTracker®Red CMXRos (#9082) and the protease / phosphatase inhibitor cocktail (100×, #5872) were purchased from Cell Signaling Technology (CST, Danvers, MA, USA).

[0208] The following antibodies were used: AMPK (#2532, 1:1000), phosphorylated-AMPK (Thr172) (#2535, 1:1000), ACC (#3676, 1:1000), phosphorylated-ACC (Ser79) (#11818, 1:1000), PFKFB2 (#13029, 1:1000), phosphorylated-PFKFB2 (Ser483) (#13064, 1:1000), PGC-1α (#2178, 1:1000), Nrf1 (nuclear respiratory factor 1) (#46743, 1:1000), Nrf2 (#12721, 1:1000), and β-actin (#4970, 1:1000) antibodies (CST). In addition, PGC-1α (#PA5-72948, 1:1000) and mitochondrial transcription factor A (Tfam) (#MA5-16148, 1:1000) antibodies were purchased from Invitrogen. GAPDH (LF-PA0212, 1:1000) and anti-rabbit IgG horseradish peroxidase-conjugated (LF-SA8002, 1:5000) antibodies were purchased from AbFrontier (Daejeon, Korea).

[0209] 2. Cell Culture and Processing

[0210] AC16 cells were maintained in Dulbecco’s modified Eagle medium / nutrient mixture F-12 (DMEM / F12, LM002-05) supplemented with FBS (fetal bovine serum, S001-01) and 1× penicillin / streptomycin (P / S, LS 202-02) (Welgene, Gyeongsan, Korea). Cells were trypsinized with 1× trypsin-EDTA (#25300-062) at 70% density and subcultured. For specific experiments, cells were seeded into 6-well plates and allowed to adhere overnight. 1,1-DEE was diluted in serum-free medium before incubation with the cells.

[0211] Wild-type (WT) and AMPKα double knockout (DKO) mouse embryonic fibroblast (MEF) cell lines were provided by Gachon University College of Medicine and cultured in DMEM (LM 001-05) supplemented with 10% (v / v) FBS and 1× P / S (Welgene).

[0212] 3. Survival Sword Type

[0213] The cytotoxicity of 1,1-DEE was evaluated using the EZ-Cytox assay according to the manufacturer's protocol. Cells were seeded into 96-well plates (17,000 cells / 10 μL / well) and incubated overnight in an incubator (37°C, 5% CO2). The following day, cells were cultured with 1,1-DEE for 24 hours. After 24 hours of incubation, cells were treated with the EZ-Cytox reagent (1:10 v / v) and incubated for 30 minutes. The signal was detected at 450 nm using a microplate reader. Cell viability was calculated using Equation 1 below, and the results were analyzed using GraphPad Prism 8.0.1 (San Diego, CA, USA).

[0214] [Mathematical Formula 1]

[0215]

[0216] In the above mathematical formula 1, "blank" represents the absorbance of a well containing cell-free medium and EZ-Cytox, "control" represents the absorbance of a well containing cells and EZ-Cytox but without 1,1-DEE, and "exp" represents the absorbance of a well containing cells, 1,1-DEE, and EZ-Cytox.

[0217] 4. Evaluation of Mitochondrial Oxygen Consumption Rate (OCR) and Extracellular Acidification Rate (ECAR)

[0218] Mitochondrial OCR (oxygen consumption rate) and ECAR (extracellular acidification rate) were evaluated using the Agilent Seahorse Mito Stress Test Kit (#103015-100, Seahorse Bioscience, Houston, TX, USA) according to the manufacturer's protocol. Prior to the assay, AC16 cells were placed in 96-well Seahorse cell culture microplates at a volume of 1.8 × 10⁶ 4 Cells were inoculated per well and allowed to attach overnight. Sensor cartridges were inserted into 200 μL of Seahorse XF Calibration Solution (#100840-000), hydrated, and cultured overnight at 37°C in a CO2-free incubator. According to the modified protocol, cells were washed on the day of assay and replaced with 180 μL / well containing Seahorse XF DMEM (#103575-100). OCR and ECAR were evaluated using a Seahorse Xfe96 analyzer (Agilent, California, USA) by sequentially injecting 1,1-DEE, oligomycin (1.5 μM), carbonyl cyanide-4 (trifluoromethoxy) phenylhydrazone (FCCP) (1.5 μM), and rotenone / antimicin (0.5 μM) into the injection port. Results were analyzed using GraphPad Prism 8.0.1.

[0219] 5. Immunofluorescence staining and flow cytometry analysis

[0220] Cells were seeded into 6-well plates and incubated overnight at 37°C under 5% CO2. The cells were then exposed to 1,1-DEE. For immunofluorescence staining, cells were washed with PBS after specific treatment and incubated at 37°C for 30 minutes under 5% CO2 with 10 μM DCFH-DA for ROS detection or 200 nM MitoTracker®Red CMXRos for mitochondrial labeling. After incubation, cells were washed twice with PBS. Images were captured using a fluorescence microscope. For flow cytometry, cells were incubated with DCFH-DA or MitoTracker, collected by trypsin treatment, and fixed with 70% ethanol at 4°C for 30 minutes. DCFH-DA signals were detected using FACS Canto II at excitation and emission wavelengths of 485 and 535 nm, respectively, and MitoTrackerRed signals were detected at excitation and emission wavelengths of 579 and 599 nm, respectively.

[0221] 6. Western blot analysis

[0222] Cells were washed twice with Dulbecco phosphate-buffered saline (DPBS, LM 001-01, Welgene), and cell lysates were obtained using a lysis buffer containing 20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 5% glycerol, 0.1% NP-40, and 1× protease / phosphatase inhibitor. The cell lysates were placed on ice and shaken every 5 minutes for 30 minutes. Cell debris was removed by centrifugation at 13,000 rpm for 10 minutes. The supernatant was then collected, and protein concentrations were measured using a BCA protein assay kit (Pierce, USA). The lysate was mixed with a sample buffer containing 60 mM Tris (pH 6.8), 25% glycerol, 2% SDS, 5% 2-mercaptoethanol, 0.5% bromophenol, and 2-mercaptoethanol, and then heated at 95°C for 5 minutes. The sample was then applied to SDS-PAGE and transferred to an Immobilon PVDF membrane via electrophoresis. The membrane was added to TBST containing 3% BSA and blocked at room temperature for 1 hour, followed by overnight immunoblotting with a primary antibody at 4°C. The next day, the membrane was washed three times with TBST and incubated for an additional hour with an equivalent secondary antibody. Finally, protein expression was detected using Immobilon chemiluminescent HRP substrate (#P90720, Merck Millipore) and Fusion Solo Vilber Lourmat (Vilber GmbH, Eberhardzell, Germany). Proteins were quantified using ImageJ software (ImageJ 1.5i, National Institutes of Health, Bethesda, MD, USA).

[0223] 7. RNA Extraction, Semi-Quantitative PCR, and Quantitative Real-Time PCR (qRT-PCR)

[0224] Total RNA was extracted using Trizol reagent (#155960626, Ambion, Carlsbad, California, USA). RNA concentration was measured using a NanoDrop spectrophotometer, and the A260 / A280 ratio indicated purity as 1.8–2.0. Complementary DNA (cDNA) was extracted using Improm-II according to the manufacturer's protocol. TM It was synthesized using reverse transcriptase (A3802, Promega, Madison, USA). Subsequently, the cDNA product was subjected to semi-quantitative PCR using AccuPower®PCR Premix (Bioneer, Daejeon, Korea). In addition, qRT-PCR was performed using TOPreal TM The test was performed using SYBR Green qPCR Premix (#RT500S, Enzynomics, Daejeon, Korea). The primers were purchased from Bioneer and are shown in Table 1 below.

[0225] gene Forward Primer Reverse Primer PPARGC1A AGCCCCATGGATGAAGGGTACT CAGCCTTGGGGAGGTCTCAT Nrf1 AGTCTCCACGGCGCAGG TCGGGAGAAGAAGGCGAGTC Nrf2 ACATCCAGTCAGAAACCAGTG CCGGGAATATCAGGAACAAGTG Tfam TGATTCACCGCAGGAAAAGC GTGCGACGTAGAAGATCCTTTC GAPDH GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTC

[0226] 8. Statistical Analysis Statistical analysis was performed using GraphPad Prism 8.0.1. Data were expressed as mean ± standard error of the mean (SEM). Statistical significance was analyzed using two-way analysis of variance, and a p-value ≤ 0.05 was considered statistically significant.

[0227] <Result>

[0228] 1. Whether 1,1-DEE transiently inhibits OCR and ECAR in AC16 cells

[0229] EZ-Cytox analysis was performed to evaluate the effect of 1,1-DEE (Fig. 1A) on cell viability and to determine the concentration to be used in the experiment. Cells were treated with various concentrations of 1,1-DEE for 24 hours, and then EZ-Cytox reagent was added to evaluate cell viability. As a result, no cytotoxicity was observed at concentrations of 25 mM or lower (Fig. 1B). Treatment with metformin at the same concentration was also found to be safe; accordingly, 25 mM was selected as the maximum treatment concentration for subsequent experiments.

[0230] Mitochondrial respiration was evaluated using the Agilent Seahorse XF96 Cell Mito Stress Test Kit. Cells were acutely infused with various concentrations of 1,1-DEE over 30 minutes, and OCR and ECAR were monitored by sequentially injecting oligomycin, FCCP, and rotenone / antimicin as mitochondrial regulators. As a result, a reversible response was observed in which baseline OCR decreased sharply immediately after 1,1-DEE injection but subsequently recovered rapidly. A decrease in OCR occurred at concentrations of 10–20 mM, but OCR did not fully recover even after 30 minutes within this concentration range. In contrast, there was no significant change in OCR when 1,2-DEE was injected, while treatment with metformin at concentrations of 5–20 mM showed a tendency for OCR to gradually decrease after 30 minutes (Fig. 1C). In addition, mitochondrial ATP-bound respiration, maximal respiration, and spare respiratory capacity were evaluated through the infusion of oligomycin, FCCP, and rotenone / antimicin. Acute infusion of 1,1-DEE reduced ATP-bound respiration, maximal respiration, and spare respiratory capacity at concentrations of 10–20 mM, but showed no significant change in proton leakage (Fig. 1D).

[0231] ECAR is measured as the minute release of lactic acid converted from pyruvate and reflects the rate of cellular glycolysis. When 1,1-DEE was acutely infused, ECAR decreased reversibly, similar to baseline OCR (Fig. 1E), but there was no significant change in ECAR when treated with 1,2-DEE and metformin (Fig. 1E).

[0232] Taken together, these results suggest that 1,1-DEE can rapidly regulate mitochondrial and glycolytic functions, inducing a reversible reduction in mitochondrial oxidative phosphorylation (OXPHOS) and cellular glycolysis.

[0233] 2. Whether 1,1-DEE enables AMPK

[0234] Eukaryotes possess a highly conserved homeostatic system to respond to the decrease in ATP levels when oxidative phosphorylation (OXPHOS) and glycolysis are inhibited by mitochondrial toxins. A key element of this system is AMP-activated protein kinase (AMPK), a major regulator of cellular energy. When OXPHOS is inhibited, AMPK becomes fully activated within minutes, playing a role in enhancing catabolic processes and weakening anabolic processes.

[0235] To determine whether 1,1-DEE affects AMPK activation by phosphorylating the AMPK Ser172 residue through OXPHOS inhibition, AC16 cells were treated with various concentrations of 1,1-DEE for 10 minutes, and phosphorylated-AMPK expression was analyzed. As a result, the expression of phosphorylated-AMPK increased within 10 minutes after treatment with 1,1-DEE (Fig. 2A).

[0236] In addition, to determine whether 1,1-DEE transiently induces AMPK activation, cells were exposed to 1,1-DEE at predetermined time intervals. As the expression of phosphorylated AMPK transiently increased at 5 and 10 minutes and then decreased, it was confirmed that AMPK can be reversibly activated by acute exposure to 1,1-DEE (Fig. 2B). On the other hand, 1,2-DEE exposure showed no difference in AMPK activation for 30 minutes (Fig. 2C), while metformin treatment showed a gradual increase in AMPK phosphorylation after 60 minutes (Fig. 2D).

[0237] 3. Elucidation of the regulatory mechanism of fatty acid oxidation and glycolysis by 1,1-DEE-induced AMPK activation

[0238] AMPK regulates fatty acid metabolism through the phosphorylation of ACC (acetyl-CoA carboxylase). When AMPK phosphorylates ACC, ACC activation is inhibited, thereby suppressing synthesis. Phosphorylation of ACC by AMPK inhibits ACC activation, which reduces the production of malonyl-CoA, a substrate of fatty acid synthase (FAS). Malonyl-CoA inhibits fatty acid β-oxidation in mitochondria, through which AMPK can regulate fatty acid oxidation.

[0239] After treating AC16 cells with various concentrations of 1,1-DEE for 30 minutes, the phosphorylation levels of ACC and PFKFB2, downstream target proteins of AMPK, were analyzed. AMPK activated by 1,1-DEE phosphorylated the Ser79 residue of ACC, thereby inhibiting ACC activity and promoting fatty acid β-oxidation in mitochondria by reducing fatty acid synthesis (Fig. 3A). Additionally, it was confirmed that ACC activity may be inhibited by the decrease in sterol regulatory factor-binding protein-1c (SREBP-1c) and FASN gene expression after 1,1-DEE treatment (Fig. 3B). AMPK is known to regulate glycolysis through increased PFKFB2 activation; after 1-DEE exposure, increased phosphorylation at the Ser466 and Ser483 residues of PFKFB2 was observed, leading to increased PFKFB2 activation and glycolysis (Fig. 3A).

[0240] To determine whether the phosphorylation of ACC and PFKFB2 is regulated by AMPK, wild-type (WT) and AMPK double-deficient (DKO) MEF cells were treated with 1,1-DEE for 30 minutes. As a result, similar to the results in AC16 cells, treatment of WT MEF cells with 1,1-DEE increased AMPK and ACC phosphorylation, whereas no such increase in phosphorylation was observed in AMPK DKO MEF cells (Fig. 3C). Furthermore, pretreatment with compound C, an AMPK inhibitor, resulted in decreased phosphorylation at the Ser483 residue of PFKFB2, confirming that the activation of PFKFB2 is dependent on AMPK activation induced by 1,1-DEE (Fig. 3D).

[0241] 4. Verify whether 1,1-DEE-induced AMPK activation is mediated by ROS

[0242] AMPK activation is primarily promoted by changes in the ADP / ATP and AMP / ATP ratios. However, several studies have reported that AMPK can be activated by ROS, particularly H2O2. Accordingly, experiments were conducted to determine whether AMPK is activated by the generation of ROS.

[0243] After treatment with 1,1-DEE, ROS levels were measured using DCFH-DA and analyzed via live cell fluorescence staining. As a result, compared to the control group, intracellular ROS levels were found to increase after 10 minutes of treatment with 1,1-DEE (Fig. 4A). Additionally, when pretreated with the ROS scavenger NAC (N-acetylcysteine), ROS production induced by 1,1-DEE was found to decrease (Fig. 4A).

[0244] Next, after pretreatment with NAC and ebselen and exposure to 1,1-DEE for 30 minutes, the phosphorylation level of AMPK was analyzed by Western blot. As a result, AMPK phosphorylation decreased when the ROS scavenger was used, indicating that the ROS scavenger inhibits AMPK activation (Fig. 4B).

[0245] 5. Confirm whether long-term treatment with 1,1-DEE increases PGC-1α expression through AMPK activation

[0246] In this study, AMPK activation was evaluated upon long-term exposure to 1,1-DEE. When AC16 cells were treated with 15 mM 1,1-DEE for 8 hours, AMPK activation was confirmed by increased AMPK phosphorylation at 4 and 8 hours (Fig. 5A).

[0247] Among AMPK targets, PGC-1α is considered a key regulator of mitochondrial biosynthesis as it is an important factor that regulates most genes related to mitochondrial metabolism. When AC16 cells were treated with 1,1-DEE for 8 hours, the mRNA expression of PPARG1Ca, a gene encoding PGC-1α, increased (Fig. 5B), and Western blot analysis also confirmed that AMPK activation induced by 1,1-DEE increased PGC-1α expression (Fig. 5C).

[0248] To determine whether the increase in PGC-1α expression is regulated by AMPK activation, wild-type (WT) and AMPK double-deficient (DKO) MEF cells were treated with 15 mM 1,1-DEE for up to 12 hours. As a result, in WT MEF cells, AMPK phosphorylation induced by 1,1-DEE was associated with an increase in PGC-1α expression starting from the 2-hour mark, whereas no difference in PGC-1α expression was observed in AMPK DKO MEF cells (Fig. 5D).

[0249] 6. AMPK-induced PGC-1 α Elucidation of the mechanism of mitochondrial biosynthesis regulation by

[0250] PGC1-α is a major transcription factor that regulates mitochondrial biosynthesis and increases mitochondrial volume through the transcriptional machinery. PGC1-α binds to Nrf1 and Nrf2, raising the transcription levels of mitochondrial genes associated with the electron transport chain (ETC) complex, while simultaneously promoting the expression of Tfam, which is responsible for mitochondrial transcription and genome replication. This enables the formation of new mitochondria.

[0251] We evaluated whether PGC-1α induces mitochondrial biogenesis through the Nrf1 / Nrf2-Tfam axis by treating AC16 cells with 15 mM 1,1-DEE for up to 8 hours. Semi-quantitative PCR and qRT-PCR results showed that mRNA expression of Nrf1 and Nrf2 increased after 8 hours of treatment, whereas Tfam expression increased significantly starting from 4 hours (Fig. 6A). Western blot analysis also showed a significant increase in protein expression of Nrf2 and Tfam, but not of Nrf1 (Fig. 6B).

[0252] To determine whether AMPK regulates the increase in expression of the Nrf1 / Nrf2-Tfam axis, wild-type (WT) and AMPK double-deficient (DKO) MEF cells were treated with 15 mM 1,1-DEE for up to 8 hours. As a result, protein expression of Nrf1 and Nrf2 increased in WT MEF cells, but no difference was observed in AMPK DKO cells (Fig. 6C).

[0253] When AC16 cells were pretreated with compound C, an AMPK inhibitor, protein expression of Tfam was inhibited during 1,1-DEE exposure, confirming that mitochondrial biosynthesis via the Nrf1 / Nrf2 / Tfam axis depends on 1,1-DEE-induced AMPK activation (Fig. 6D).

[0254] In flow cytometry analysis using MitoTracker Red, exposure of AC16 cells to 1,1-DEE resulted in an increase in fluorescence signal indicating mitochondrial growth, while pretreatment with compound C reduced the signal (Fig. 6F). Observation of mitochondrial morphology using a confocal microscope revealed a fragmented mitochondrial structure (green arrow) upon 1,1-DEE treatment, which decreased upon pretreatment with compound C. No such changes were observed with 1,2-DEE treatment (Fig. 6E).

[0255] 7. Evaluation of Improvement in Mitochondrial Respiration and Glycolysis through AMPK Activation Following Long-Term 1,1-DEE Treatment

[0256] After confirming that AMPK activation promotes mitochondrial fatty acid oxidation and biosynthetic signaling, mitochondrial respiratory capacity after 8 hours of treatment with 1,1-DEE was evaluated using the Seahorse XF96 Mito Stress Test Kit. Treatment with various concentrations of 1,1-DEE gradually increased mitochondrial OCR over time (Fig. 29A), which was indicated by increases in mitochondrial basal respiration (Fig. 29B), ATP-coupled production (Fig. 29C), and maximum respiration (Fig. 29D) in the treatment groups.

[0257] In addition, glycolysis was enhanced during this treatment, and the gradual increase in ECAR values ​​confirmed that cellular glycolysis was activated (Fig. 29M). These results suggest that long-term 1,1-DEE treatment promoted both mitochondrial oxidative phosphorylation (OXPHOS) and glycolysis for ATP production. In contrast, 1,2-DEE treatment showed no changes in mitochondrial OCR and ECAR (Figs. 29E, 29F, 29G, 29H, 29N).

[0258] In metformin treatment, OCR values ​​gradually decreased (Figs. 29I, 29J, 29K, 29L), but ECAR values ​​increased, indicating that cells generate ATP through glycolysis after inhibition of mitochondrial respiration (Fig. 29O). When cells were pretreated with Compound C, mitochondrial OCR decreased compared to the 1,1-DEE treatment group, resulting in reduced basal respiration (Fig. 29P), ATP-coupled production (Fig. 29Q), and maximum respiration (Figs. 29R, 29S), and ECAR was also inhibited (Fig. 29T).

[0259] In summary, it can be seen that the improvement of cellular energy by 1,1-DEE, namely the enhancement of mitochondrial respiration and cellular glycolysis, is mediated through AMPK activation.

[0260] In addition, RNA-seq analysis was performed using livers of C67BL / 6 male mice after treating them with 1,1-DEE for 8 weeks. GSEA pre-ranking analysis revealed that 1,1-DEE treatment induced abundant expression in various mitochondrial-related biological processes (GOBP) (Figs. 30A–G). Heatmap analysis of key genes in “NADH dehydrogenase complex assembly” showed a moderate increase in the expression of NADH:ubiquinone oxidoreductase family genes (ndufv1, ndufs2, etc.) in the 1,1-DEE treated group compared to the untreated group, suggesting an increase in mitochondrial oxidative capacity and respiration (Fig. 30H).

[0261] <Experimental Example>

[0262] Experimental Example 1. Confirmation of the effect of 1,1-DEE on lifespan

[0263] 1-1. Caenorhabditis elegans Development Experiment

[0264] In this experiment, the wild-type Caenorhabditis elegans Bristol N2 strain was used. Bleached eggs were placed in S-basal buffer, to which 1,1-DEE or 1,2-DEE was added, and the eggs were liquid-cultured at 20°C until they reached the L1 larval stage. During culture, the bleached eggs were placed in 50 ml tubes mounted on a rotator and rotated at a slow speed to ensure uniform mixing. Once the worms reached the L1 larval stage, they were separated from the S-basal buffer by centrifugation and released into liquid nematode growth media (NGM). At this stage, E. coli OP50, which serves as worm food, was added to the liquid NGM. Subsequently, the worms were inoculated into a 96-well plate. Each well was composed of a total volume of 200 μl containing liquid NGM, OP50, approximately 20 worms, 1,1-DEE or 1,2-DEE (0, 100 μM, 1 mM, 20 mM), and amphotericin B (0.1 μg / ml). The 96-well plate was liquid-cultured at 20°C while slowly mixing on a shaker to prevent the drugs from settling. After 2-3 days of culture, the developmental status of Caenorhabditis elegans was observed using a microscope, and the effects of 1,1-DEE and 1,2-DEE were evaluated.

[0265] As a result, treatment with 1,1-DEE at concentrations of 100 μM and 1 mM did not affect the development of Caenorhabditis elegans, but treatment with 20 mM inhibited the development of Caenorhabditis elegans (Figs. 7 and 8). In addition, it was confirmed that 1,2-DEE did not cause any problems with the development of Caenorhabditis elegans at concentrations of 100 μM and 1 mM (Fig. 9). Based on this, for the lifespan experiment of Caenorhabditis elegans, 100 μM and 1 mM were selected as concentrations that do not cause problems with development.

[0266] 1-2. C. elegans lifespan experiment

[0267] The setup process for the 96-well plate for the lifespan experiment was identical to that of the developmental experiment. However, 5-fluoro-2'-deoxyuridine (FUDR) was added to prevent egg hatching when the worms reached the L4 stage. Each well contained a total volume of 200 μl and was configured to include liquid NGM, OP50, approximately 20 worms, 1,1-DEE or 1,2-DEE (0, 100 μM, 1 mM, 20 mM), amphotericin B (0.1 μg / ml), and FUDR (200 μM). The 96-well plates were liquid-cultured at 20°C with slow mixing over a shaker to prevent the drugs from settling. The survival rate of Caenorhabditis elegans was measured every 2–3 days, and the worms were considered dead if there was no movement in the liquid medium. All experiments were performed independently by two researchers. The difference in lifespan was calculated based on the area under the curve (AUC). It was performed as if an actual experiment had been conducted.

[0268] As a result, treatment with 1,1-DEE at a concentration of 1 mM showed a lifespan extension effect of 10% and 13% in Experimenter 1 and Experimenter 2, respectively (Fig. 10), and it was confirmed that treatment with 1,1-DEE at a concentration of 100 μM did not have a significant effect on lifespan. Meanwhile, in the case of 1,2-DEE, treatment with a concentration of 1 mM was found to reduce lifespan by -5% and -15% in Experimenter 1 and Experimenter 2, respectively, and it was confirmed that treatment with 1,2-DEE at a concentration of 100 μM did not affect lifespan (Fig. 11).

[0269] Therefore, it has been proven that 1,1-DEE according to the present invention can exhibit a lifespan extension effect at a concentration of 1 mM without affecting the development of Caenorhabditis elegans.

[0270] 1-3. Rat Lifespan Experiment

[0271] To confirm the life-extending effect of 1,1-DEE according to the present invention in a mammalian model, a lifespan experiment was conducted using 48-week-old rats. A total of 20 rats were randomly divided into two groups (n=10). The control group was injected once with physiological saline (300 μl) via tail vein injection, while the experimental group was administered 300 μl of 1,1-DEE stock solution in the same manner. All injections were performed at 48 weeks under inhaled isoflurane anesthesia. The rats were then reared under identical environmental conditions for 20 weeks. Two rats from the same group were placed in each cage, and feed and lighting conditions were maintained uniformly.

[0272] As a result, the control group showed a gradual decline in survival rates starting from week 62, with 1 animal dying at week 62, 1 at week 63, 1 at week 64, 1 at week 65, 2 at week 66, and 2 at week 67; in contrast, only 1 animal died in the 1,1-DEE treatment group at week 67, confirming a distinct improvement in survival rates. Kaplan-Meier survival curve analysis revealed a statistically significant increase in survival rates in the 1,1-DEE treatment group compared to the control group (p<0.01, **) (Fig. 31); by the end of week 68, only 2 out of 10 animals in the control group had survived, whereas 9 out of 10 animals in the 1,1-DEE treatment group had survived.

[0273] In addition, coat condition, respiratory rate, and voluntary activity were periodically evaluated as general health indicators. Compared to the control group, the 1,1-DEE administration group had shiny and healthy coats, and voluntary activity also showed a distinctly increasing trend (Fig. 32). These results suggest that 1,1-DEE can contribute not only to extending lifespan but also to improving health-span.

[0274] Experimental Example 2. Confirmation of the effect of 1,1-DEE on heart rate acceleration

[0275] 2-1. Formation of Engineered Heart Tissue (EHT) in Vitro

[0276] Adult induced pluripotent stem cell-derived cardiomyocytes (iPSC-CM) and primary cardiac fibroblasts were mixed with 12.5 mg / mL fibrin gel at a ratio of 9:1 and loaded into a template formed with 2% agar. A silicone column was placed so that its tip contacted the cells and hydrogel mixture, and the mixture was cured in a 37°C incubator for 30 minutes. After removing the cured hydrogel from the template, the cells were cultured in vitamin A RPMI1640 cell culture medium for 8 days. The medium was replaced every 2 days, and 20 μg / mL aprotinin was added to the cell culture medium from day 1 to day 7 to prevent the degradation of fibrin.

[0277] 2-2. Measurement of Beating through 1,1-DEE and 1,2-DEE Treatment

[0278] On day 8 of culture, cell culture media (RPMI1640-vitamin A) were prepared by diluting 1,1-DEE and 1,2-DEE to final concentrations of 1 mM, 5 mM, 10 mM, 25 mM, 50 mM, and 75 mM, respectively, and the existing cell culture media were replaced with these media. Before replacing the cell culture media, and at 10 minutes, 1 hour, 6 hours, 12 hours, and 24 hours later, the movement of the pole was recorded for 15 seconds using a 4x objective lens. The movement of the pole was quantified from the recorded video using a self-developed MATLAB code, and the distance traveled and the number of movements over 15 seconds were analyzed using the findpeaks function in R. Based on this, the twitch force and BPM (Beat per Minute) generated by the EHT were calculated.

[0279] Figures 12 and 13 show the change in the beat rate (BPM: beats per minute) of EHT over time before and after treatment with 1,1-DEE and 1,2-DEE at different concentrations.

[0280] Figures 14 and 15 show the change in twitch force of EHT over time before and after treatment with 1,1-DEE and 1,2-DEE at different concentrations.

[0281] Figure 16 shows representative images of the beating changes of EHT according to 1,1-DEE and 1,2-DEE treatment (50 mM).

[0282] As a result of treatment with 1,1-DEE and 1,2-DEE, it was observed that in the group treated with 1,1-DEE, the beating rate of EHT increased in a concentration-dependent manner, and the twitch force decreased proportionally. This change persisted for up to 1 hour after treatment with the compounds, and thereafter, no significant difference was observed compared to the 1,2-DEE treatment group. Additionally, a tendency for the beating amplitude to decrease as the beating rate increased was observed, which is considered to be related to the decrease in twitch force (see Figures 12 to 16).

[0283] A comprehensive analysis of the high and low concentration experimental results revealed a distinct trend of increasing BPM and decreasing twitch force depending on the concentration of 1,1-DEE. In particular, the effect on BPM recovered approximately 6 hours after treatment, whereas the effect on twitch force was confirmed to persist for up to 24 hours.

[0284] In addition, Figure 17 shows the changes in the beating speed and twitch force of EHT in the time interval from immediately after treatment to 10 minutes after treatment with 1,1-DEE at a concentration of 25 mM. As shown in Figure 17, the BPM began to increase from 1 minute after treatment, and the effect of increasing the heart rate became more pronounced over time. On the other hand, the twitch force gradually decreased during the same time interval, and at the 10-minute mark, it decreased to less than 10% of the level before treatment. These results demonstrate that 1,1-DEE rapidly increases the heart rate immediately after treatment while exhibiting an inhibitory effect on contractility, supporting the potential of 1,1-DEE as a composition for acute cardiac stimulation.

[0285] Therefore, the results of this experiment confirm that 1,1-DEE has the effect of rapidly increasing the heart rate of the EHT for 10 minutes to 1 hour immediately after treatment, and that this effect disappears after a certain period of time. Accordingly, it has been proven that 1,1-DEE can be used as a drug to temporarily increase the heart rate.

[0286] Experimental Example 3. Confirmation of the effect of 1,1-DEE on cachexia

[0287] 3-1. Experimental Method

[0288] (1) Cell viability test

[0289] Cells were plated in 96 wells at a density of 2×10⁴ cells (100 μl) per well in RPMI supplemented with 10% FBS, 1% penicillin, and streptomycin. The next day, different concentrations of 1,1-DEE and 1,2-DEE containing serial dilutions were added to each well (total 120 μl) for 24 hours. Then, 10 μl of MTT (DoGenBio Co., Ltd.) was added to each well of the plate and incubated at 37°C for 2 hours. Cell viability was analyzed by measuring absorbance at 450 nm using a microplate spectrophotometer (Epoch, Biotek, USA).

[0290] (2) Cell culture

[0291] SHSY-5Y (Human Neuroblastoma) cells were purchased from the Korean Cell Line Bank (Daehak-ro, Jongno-gu, Seoul, South Korea) and cultured in a growth medium containing RPMI 1640 supplemented with 10% FBS and 1% penicillin-streptomycin in a humidified incubator containing 5% CO₂ at 37°C.

[0292] (3) Western Blot

[0293] To extract proteins from SHSY-5Y cells (5 × 10⁶ / mL) cultured in 60 × 15 mm cell culture dishes (SPL Life Sciences, Gyeonggi-do, Republic of Korea), 150 μL of Pro-PREP™ protein extraction solution from iNtRON Biotechnology (Gyeonggi-do, South Korea) was added to each plate. Materials such as polyvinylidene fluoride (PVDF) membranes and Western chemiluminescent HRP substrates were purchased from Millipore Corporation (Billerica, MA, USA).

[0294] After isolating 30 μg of total protein, it was separated using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Then, the protein was transferred to a PVDF membrane for further analysis. The membrane was blocked for 1–2 hours by adding 0.1% Tween-20 to TBST containing 5% skim milk, and then incubated overnight at 4°C with the addition of the primary antibody (1:1000) to TBST. Afterward, the membrane was washed three times with TBST for 10 minutes each, and then a horseradish peroxidase-conjugated secondary antibody (1:2000) was used to detect immunoreactive proteins via chemiluminescence.

[0295] Various antibodies from Cell Signaling Technology (Danvers, MA, USA) were used for Western blot experiments, including anti-phosphorylated-AMPK (Cell Signaling, #2535S), anti-AMPK (Cell Signaling, #2532S), and anti-β-actin (Cell Signaling, #5125S) monoclonal antibodies. To evaluate total protein levels, the blotted membranes were washed with Restore™ Western Blot Stripping Buffer (Thermo Fisher Scientific, Meridian Rd., Rockford, IL, USA) at 56°C for 30 minutes.

[0296] (4) Cell death via Annexin V / FITC assay

[0297] The potential for apoptosis in SHSY-5Y cells was tested using the Annexin V fluorescence kit (BD Pharmingen, San Diego, USA) according to the manufacturer's protocol. Cells were seeded at a density of 2.0 × 10 cells per well in 6-well plates containing 10% FBS in RPMI medium and cultured for 24 hours. Subsequently, the cells were treated with the desired concentration of 1,1-DEE and cultured at 37°C for 24 hours.

[0298] After treatment, cells were harvested and pelleted, then resuspended in 400 μL of binding buffer and stained with 5 μL of FITC-Annexin-V and 10 μL of PI provided in the kit. After staining, flow cytometry was performed using a BD FACS Calibur (BD Biosciences, CA, USA), and plotting and data analysis were conducted using FlowJo™ software (BD Biosciences, CA, USA).

[0299] (5) Animal care and drug administration

[0300] Four-week-old male NSG mice were purchased from the National Center for Immunotherapy Innovation at Chonnam National University, Korea, and housed at the Experimental Animal Research Center at Chonnam National University (CNU). The mice were provided with free food and water until the experimental procedures were conducted, while maintaining a 16-hour day / 8-hour dark cycle at 23°C and 60% humidity. Five animals were housed per cage, and body weight was recorded three times a week. All experimental procedures, including those involving live animals, adhered to the institutional guidelines of Chonnam National University.

[0301] SHSY-5Y cells cultured in RPMI medium containing 10% FBS were suspended at a concentration of 10 cells in 100 μL of phosphate-buffered saline (PBS) and subcutaneously injected into the right flank of each mouse. Mice were divided into a control group and a treatment group, and 1,1-DEE (110 mg / kg) was administered via intraperitoneal (IP) injection three times (alternating daily) as a prophylactic measure prior to tumor induction. The treatment group received alternating continuous infusions from day 1 to day 105, while the control group received PBS injections. On the day following drug administration, animals were used for a survival study.

[0302] 3-2. Results

[0303] (1) Evaluation of cytotoxicity of 1,1-DEE and 1,2-DEE (negative control) on SHSY-5Y cell line

[0304] The results of measuring the viability of SHSY-5Y cells treated with 1,1-DEE using the MTT assay are shown in Fig. 17. As a result, 1,1-DEE was found to reduce the viability of SHSY-5Y cells at concentrations of 10 mM or less (Fig. 18A). On the other hand, no significant effect was observed in the 1,2-DEE treatment group (Fig. 18B).

[0305] In addition, to evaluate changes in cell morphology, the effects of time- and dose-dependent treatment with 1,1-DEE on the morphology of SHSY-5Y cells were observed using a reversed-image optical microscope. As a result, it was confirmed that 1,1-DEE induced distinct morphological changes in a concentration- and time-dependent manner and reduced cell viability, whereas this phenomenon was not observed in the treatment group of the isomer 1,2-DEE (Fig. 18C).

[0306] (2) Evaluation of apoptosis induction by 1,1-DEE

[0307] To determine whether 1,1-DEE induces apoptosis, SHSY-5Y cells were treated with 1,1-DEE for 24 hours, followed by Annexin V and PI staining. As a result, it was confirmed that 1,1-DEE increased the proportion of late-stage apoptotic cells corresponding to the Q2 region in a concentration-dependent manner (Fig. 19).

[0308] (3) Evaluation of AMPK activation induction by 1,1-DEE

[0309] Experiments were conducted using the SHSY-5Y cell line to investigate the effect of 1,1-DEE on AMPK activation. As a result, 1,1-DEE activated AMPK in a time-dependent manner, and significant activation was observed between 30 minutes and 2 hours. Furthermore, it was confirmed that 1,1-DEE induced particularly distinct concentration-dependent AMPK activation at a concentration of 2 mM (Fig. 20).

[0310] (4) Evaluation of the tumor growth inhibitory effect of 1,1-DEE

[0311] To determine whether 1,1-DEE inhibits tumor growth in vivo, a subcutaneous tumor model was established using 4-week-old NSG mice. In the experimental group, SHSY-5Y cells were stably injected subcutaneously after a total of three intraperitoneal administrations of 1,1-DEE. Tumor size was measured starting three weeks after inoculation, and the tumor size was monitored while administering a constant concentration of 1,1-DEE at two-day intervals. As a result, 1,1-DEE was found to significantly inhibit tumor growth in vivo. Examination of the tumor growth curves for each group in Figure 21(A) revealed a significant decrease in tumor volume in the 1,1-DEE-treated group between 21 and 33 days from the time the tumor was palpable. Additionally, Figure 21(B) illustrates the change in mouse body weight measured during the experiment, and the in vivo anti-tumor effect was evaluated through survival rate and tumor size measurements.

[0312] (5) Evaluation of the effect of 1,1-DEE on increasing survival rate and preventing cancer cachexia

[0313] To determine whether 1,1-DEE acts prophylactically before inducing cancer, 1,1-DEE was administered metronomically at three intervals (1-day intervals) prior to tumor cell injection, and drug administration was continued thereafter. Through the Kaplan-Meier survival curves shown in Figure 22(A), it was confirmed that the 1,1-DEE treatment group showed a significantly higher survival rate compared to the PBS treatment group.

[0314] In addition, Figure 22(B) illustrates changes in body weight during the mouse survival period, thereby indirectly evaluating the occurrence of cancer cachexia. As a result, the 1,1-DEE treatment group showed a tendency for body weight loss to be inhibited, which demonstrates that it may have a preventive effect against cancer cachexia.

[0315] Experimental Example 4. Confirmation of the effect of 1,1-DEE on ischemic stroke

[0316] 4-1. Experimental Method

[0317] (1) Animal

[0318] All animal experiments were performed in accordance with the Chonnam National University Guidelines for the Management and Use of Laboratory Animals. Mice were housed on a 12-hour day-night cycle, and were allowed to consume food and water freely. Male C57BL / 6 (Black 6) inbred mice (Samtako Bio Korea Co., Ltd, Korea) at 8 weeks of age with a body weight of 27-28g were used.

[0319] (2) Drugs and administration

[0320] The test drug was prepared by diluting it in physiological saline and administered as a single intravenous injection through the tail vein at a dose of 20 mg / kg.

[0321] (3) Induction of ischemic stroke

[0322] An ischemic stroke model was induced via middle cerebral artery occlusion (MCAO) surgery. Anesthesia was induced by inhaling isoflurane mixed with oxygen (Hana Pharm, Seoul, Republic of Korea). After making a midline cervical incision, the left common carotid artery, external carotid artery, and internal carotid artery were exposed. A monofilament was inserted approximately 10 mm through the external carotid artery to occlude the origin of the middle cerebral artery. The occlusion was maintained for 45 minutes, after which the filament was removed and reperfusion was performed. The mice were monitored during the recovery process following suturing of the surgical site.

[0323] (4) Brain MRI

[0324] The mouse acquired brain images using MRI equipment in a prone position.

[0325] (5) Morris Water Maze (MWM)

[0326] A tank with a diameter of 100 cm, a height of 50 cm, a depth of 30 cm, a water temperature of 24 ± 1°C, and an opaque white color was used in an environment where external visual stimuli were blocked. The tank was divided into four zones in a clockwise direction, and a concealed platform was placed in Zone 1. Mice underwent free-exploration training for two days to adapt to the environment. During training, each attempt was performed for 60 seconds; if the platform was not found, the mice were guided to it and allowed to stay for 10 seconds. Even if the platform was successfully found, the mice were allowed to stay for 10 seconds. Each experiment began in Zone 3. During the test period, search time, path, speed, and success rate were recorded and analyzed using the EthoVision XT 14 program.

[0327] 4-2. Results

[0328] (1) Evaluation of the effect of 1,1-DEE on mortality after ischemic stroke

[0329] The control group (n=10) and the treatment group (n=12) were compared after MCAO. Body weight was measured one day prior to MCAO, and the treatment group was administered 1,1-DEE. MCAO was performed under blind conditions. MRI was performed 36 hours after obstruction, and the MWM test was conducted 48 hours later. Three days later, the mice were sacrificed after their final body weight was measured. As a result, the control group showed a mortality rate of 30%, whereas all members of the 1,1-DEE administration group survived. Statistical analysis (Chi-square test, p < 0.05) showed a hazard ratio (RR) of 0.3684 (95% CI: 0.1915-0.9505), indicating a 63.16% reduction in the risk of death in the treatment group (Fig. 23).

[0330] (2) Confirmation of the effect of 1,1-DEE on weight loss after stroke induction

[0331] Weight loss following a stroke is a common phenomenon caused by systemic inflammation and neurological damage, and can lead to sarcopenia and carchesia. Weight loss is closely associated with functional recovery. In this study, changes in body weight were also evaluated. During the 6-day experimental period, the control group showed an average weight loss of 3.77%, while the treatment group showed a weight gain of 5.46% (t-test, p < 0.001) (Fig. 24A). The final body weight was also confirmed to be significantly higher in the treatment group (27.68g) compared to the control group (26.29g) (t-test, p < 0.05) (Fig. 24B).

[0332] (3) Confirmation of the effect of 1,1-DEE on improving spatial memory and cognitive function

[0333] MWM is a widely used method for evaluating spatial learning and memory in rodents. In this study, the results were analyzed using a time-event survival curve that integrates time to reach and success rate. Analysis using the accelerated failure time (AFT) model showed that at the final 60-second mark, the treatment group achieved a 50% success rate, while the control group achieved only 25% (p > 0.05). However, at the 20-second mark, 33% of the treatment group succeeded, whereas none of the control group succeeded, showing a significant difference (p < 0.05) (Fig. 25A). Since swimming speeds were similar between the two groups (t-test, p > 0.05), it suggests that swimming ability did not affect the results.

[0334] In addition, analysis of the swimming paths showed that the treatment group followed a direct path toward the target point, while the control group followed a random path (Fig. 25B). In a comparison of path lengths of successful mice, the treatment group also showed a significantly shorter path than the control group (146.3 cm vs. 820.8 cm, t-test, p < 0.01) (Fig. 25C). This suggests that 1,1-DEE has a positive effect on the acquisition and maintenance of spatial memory.

[0335] Taken together, these results demonstrate that 1,1-DEE treatment can improve spatial cognition or memory recall, particularly in the early stages of task learning.

[0336] (4) Confirmation of the effects of 1,1-DEE on motor function after stroke and alleviation of cerebral ischemic damage

[0337] Brain magnetic resonance imaging (MRI) was performed on both experimental groups within 36 hours after middle cerebral artery occlusion (MCAO). Representative images showed smaller infarct areas in mice treated with 1,1-DEE compared to the control group, suggesting a mitigating effect of 1,1-DEE on stroke-induced brain injury (Fig. 26A).

[0338] Ischemic stroke causes a decline in motor function in addition to cognitive impairment. Although the water maze (MWM) test is not the optimal method for evaluating motor function decline, it was hypothesized that MCAO-induced stroke could impair swimming ability in mice. Accordingly, the maximum swimming speeds observed in each test were measured. Interestingly, mice administered 1,1-DEE recorded significantly higher maximum swimming speeds compared to the control group (33.83 cm / s vs. 27.77 cm / s, t-test, p < 0.05). This suggests the possibility that 1,1-DEE promotes the recovery of motor function after ischemic stroke (Fig. 26B).

[0339] Experimental Example 5. Confirmation of the effect of 1,1-DEE on cognitive function

[0340] 5-1. Experimental Method

[0341] Experimental animals, drugs and administration methods, and the Morris water maze test were performed using the same method as in Experimental Example 4 above.

[0342] 5-2. Results

[0343] (1) Confirmation of the effect of 1,1-DEE on the improvement of cognitive function in an ischemic stroke-induced mouse model

[0344] Vascular dementia is the second most common type of dementia after Alzheimer's disease, and stroke is one of the major risk factors for causing dementia. In this example, an ischemic stroke mouse model in which middle cerebral artery occlusion (MCAO) was induced was used to investigate the effects of stroke on cognitive function. Experiments were conducted to verify the effects of 1,1-DEE in this model (Fig. 27). Male C57BL / 6 mice were subjected to one day of Morris Water Maze (MWM) training, after which the experimental group was randomly assigned to a control group (n=10) and a 1,1-DEE treatment group (n=12). For the treatment group, 1,1-DEE was administered intravenously one day prior to MCAO surgery. MCAO surgery was performed blinded, and the site of cerebral infarction was identified using MRI 36 hours after surgery (Fig. 27A). An MWM test was performed 48 hours after surgery, and the mice were sacrificed three days after the test was completed. The evaluation of the MWM test was performed based on latency time and platform reach success rate, and statistical analysis was conducted based on the accelerated failure time (AFT) model.

[0345] As a result, the 1,1-DEE treatment group had a higher rate of reaching the platform within 60 seconds compared to the control group, but this difference was not statistically significant (p > 0.05). However, at the 20-second mark, the 1,1-DEE treatment group showed a success rate of 33%, whereas no individuals in the control group succeeded (Fig. 27B). This difference was statistically significant (p < 0.05). Meanwhile, there was no significant difference in swimming speed between the two groups, confirming that differences in cognitive function did not stem from differences in motor ability (Fig. 27C). Analysis of the representative swimming paths of each group showed that the 1,1-DEE treatment group utilized a strategy of approaching the platform directly, whereas the control group exhibited a random path (Fig. 27D). When comparing swimming distances based on successful mice, the average swimming distance of the control group was measured at 820.8 cm, while the 1,1-DEE treatment group averaged 146.3 cm, which was statistically significantly shorter (p < 0.01, Fig. 1E).

[0346] The above results suggest that 1,1-DEE has a positive effect on the recovery of cognitive function after ischemic brain injury.

[0347] (2) Confirmation of the effect of 1,1-DEE on cognitive function improvement in normal mouse models

[0348] In this example, the Morris Water Maze (MWM) test was used to evaluate the cognitive function-enhancing effects of 1,1-DEE on normal male C57BL / 6 mice. First, the mice's baseline performance was assessed through a pre-test, and based on this, they were randomly assigned to a control group (n=12) and a 1,1-DEE treatment group (n=12). PBS was administered intravenously to the control group, while 1,1-DEE was administered intravenously to the treatment group at a dose of 20 mg / kg. The drugs were administered on days 1, 5, and 9, and the MWM test was performed on days 3, 7, and 11, which were two days after each administration (Fig. 28).

[0349] Pre-evaluation results showed no statistically significant difference in performance between the two groups (p > 0.05). The rate of reaching the platform within 20 seconds after the first administration was 16.7% for the control group, compared to 41.7% for the 1,1-DEE treatment group. After the second administration, a more pronounced difference was observed: 5 out of 9 animals (55.6%) in the control group succeeded, while 9 out of 10 animals (90%) in the treatment group reached the platform within 20 seconds. A similar trend was observed after the third administration (Fig. 28A). Although the difference in cumulative success rates at each time point was not statistically significant (p > 0.05), the performance of the treatment group was consistently superior. The average latency time (time to reach the platform) was 40.07 seconds for the control group and 39.52 seconds for the treatment group in the pre-test; 38.04 seconds and 33.93 seconds, respectively, in the first test; 32.00 seconds and 21.14 seconds in the second test; and 41.48 seconds and 29.78 seconds in the third test. Although the differences in time were not statistically significant (p > 0.05), AFT analysis within the repeated tests showed that the treatment group exhibited a significant reduction in latency compared to the pre-test (second test: p < 0.01, third test: p < 0.05, Fig. 28B). These results suggest that 1,1-DEE is effective in improving spatial cognition and memory even in normal mice.

[0350] Experimental Example 6. Confirmation of the effect of 1,1-DEE on cancer

[0351] 6-1. Experimental Method

[0352] Changes in cell motility and mitochondrial function following 1,1-DEE treatment were evaluated using MCF7 breast cancer cells. Cells were patterned into a 2D Icelandic shape on a collagen-coated polyacrylamide gel using PDMS stencils. 200 μL of a cell suspension at a concentration of 1.5 × 10⁴ cells / mL was dispensed onto each stencil and incubated for 3 hours at 37°C under 5% CO₂ conditions. After incubation, the PDMS stencils were removed and washed with PBS, followed by the addition of media containing 1 mM, 10 mM, and 50 mM 1,1-DEE. Cell motility was quantified using time-lapse imaging and MATLAB analysis. Mitochondrial function was evaluated by TMRE fluorescence staining.

[0353] 6-2. Results

[0354] As a result, in the cell motility analysis, no movement was observed in the 50 mM treatment group due to apoptosis (Fig. 33), and in the quantitative analysis of cell motility, no significant movement was confirmed in the 50 mM treatment group (Fig. 34). As a result of TMRE fluorescence signal analysis, functional impairment was observed in the 50 mM treatment group due to reduced mitochondrial function (Fig. 35). Therefore, AMPK activation is closely involved in the metabolic regulation and cellular function of cancer cells, demonstrating that 1,1-DEE can exhibit an anticancer effect within an appropriate concentration range.

[0355] Specific parts of the present invention have been described in detail above. It is evident to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. Accordingly, the actual scope of the invention is defined by the appended claims and their equivalents.

Claims

Claim 1 A pharmaceutical composition for the prevention or treatment of ischemic stroke comprising 1,1-diethoxyethane (1,1-DEE) as an active ingredient. Claim 2 A pharmaceutical composition according to claim 1, characterized in that the composition promotes the recovery of motor function impaired by ischemic stroke or reduces the size of the infarction. Claim 3 A pharmaceutical composition according to claim 1, wherein the pharmaceutical composition is administered by one or more methods of administration selected from the group consisting of oral administration, intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, epithelial administration, local administration, vaginal administration, pulmonary administration, rectal administration, sublingual administration, buccal administration, transdermal administration, ocular administration, inhalation, intracavernous injection, intrathecal injection, epidural injection, and rectal administration. Claim 4 delete Claim 5 delete Claim 6 A food composition for the prevention or improvement of ischemic stroke containing 1,1-diethoxyethane (1,1-DEE) as an active ingredient. Claim 7 In claim 6, the food composition comprises sausage, bread, chocolate, candies, snacks, confectionery, pizza, ramen, noodles, chewing gum, dairy products, various soups, beverages, tea, coffee beverages, stamina drinks, alcoholic beverages, or vitamin complexes. Claim 8 A feed composition for the prevention or improvement of ischemic stroke containing 1,1-diethoxyethane (1,1-DEE) as an active ingredient. Claim 9 A feed composition according to claim 8, characterized in that the feed comprises powdered feed, solid feed, moist pellet feed, dry pellet feed, EP (Extruder Pellet) feed, or raw feed.

Citation Information

Patent Citations

  • Compositions and methods for improving mitochondrial function

    KR1020230159844A