PCR primer set and probe for simultaneous detection of Gobiobotia naktongensis, Microphysogobio rapidus, and Gobiobotia macrocephala and real-time PCR method using the same

Abstract

The present invention relates to a method for simultaneously detecting white-spotted minnows, riffle minnows, and pufferfish from freshwater fish or environmental water by using a primer set for simultaneous detection of white-spotted minnows, riffle minnows, and pufferfish comprising oligonucleotides of SEQ ID NOs. 1, 4, and 7; oligonucleotides of SEQ ID NOs. 2, 5, and 8; and probes of SEQ ID NOs. 3, 6, and 9, by amplifying target sequences specific to white-spotted minnows, riffle minnows, and pufferfish. In addition, the present invention relates to a primer set capable of rapidly detecting white-spotted minnows, riffle minnows, and loaches from freshwater fish or environmental water with excellent specificity and sensitivity through real-time PCR.

Description

Technology Field

[0001] The present invention relates to a method for simultaneously detecting white-spotted minnows, riffle minnows, and pufferfish from freshwater fish or environmental water by using a primer set for simultaneous detection of white-spotted minnows, riffle minnows, and pufferfish comprising oligonucleotides of SEQ ID NOs. 1, 4, and 7; oligonucleotides of SEQ ID NOs. 2, 5, and 8; and probes of SEQ ID NOs. 3, 6, and 9, by amplifying target sequences specific to white-spotted minnows, riffle minnows, and pufferfish.

[0002] In addition, the present invention relates to a primer set capable of rapidly detecting white-spotted minnows, riffle minnows, and loaches from freshwater fish or environmental water with excellent specificity and sensitivity through real-time PCR. Background Technology

[0004] Since endangered wildlife such as the white-spotted minnow, riffle minnow, and Korean bitterling live in water, confirming their habitats through capture surveys inevitably requires the partial destruction of microhabitats, which demands a significant amount of labor.

[0005] Recently, a technology capable of predicting which species inhabit an area by analyzing environmental DNA (eDNA) has been developed and is being utilized by many researchers.

[0006] Environmental DNA refers to organic matter collected from the surrounding habitat rather than DNA extracted from living organisms. In the case of amphibians, this typically involves obtaining genomes from sources such as mucus and secretions and identifying them through DNA sequencing analysis. It is a method that determines the presence of organisms in the environment by amplifying and analyzing specific genes from DNA fragments found through sampling of environmental water and soil. Consequently, it allows for the determination of a target organism's presence without direct collection, thus eliminating reliance on the collector's skills. Compared to labor-intensive methods, it is highly effective in terms of cost and reliability for identifying breeding grounds or habitats of rare species. However, for rare species with very small populations or low biomass, highly sensitive analytical methods must be utilized.

[0007] Existing methods for identifying the white-spotted minnow, the riffle minnow, and the Korean bitterling include obtaining and comparing nucleotide sequences by purifying and PCR of the mitochondrial cytochrome b (COB) region or cytochrome c oxidase subunit I (COI) region and various regions of nuclear DNA, or by drawing a phylogenetic tree for verification, and performing genotyping after PCR using microsatellite markers.

[0008] Both methods have the disadvantage of requiring significant time and effort for analysis, as well as making quantitative analysis difficult. In the case of the first method, the time required for genetic sample purification, PCR amplification, PCR product purification, base sequence determination, and analysis is at least two days. In the case of the second method, genetic sample purification, PCR amplification, and PCR product electrophoresis take more than seven hours, and because various steps are required to reach the analysis stage, there is a high possibility of contamination.

[0009] The present invention aims to solve the aforementioned problems while simultaneously improving the specificity and sensitivity of simultaneous detection of *Gobio esocinus*, *Gobio riffle*, and *Gobio gobio* in freshwater fish or environmental water. To this end, a specific primer set and probe for the simultaneous detection of *Gobio esocinus*, *Gobio riffle*, and *Gobio gobio* were developed, and a real-time PCR method was established using these to apply to the simultaneous detection of *Gobio esocinus*, *Gobio riffle*, and *Gobio gobio* from freshwater fish or environmental water. Prior art literature

[0011] Korean Registered Patent No. 10-2471933 Korean Registered Patent No. 10-1396301 The problem to be solved

[0012] The present invention was developed to solve the problems of the above technology, and aims to provide a primer set and a probe capable of simultaneously performing a PCR reaction on three species (Gobio spp., Goby, and Goby) from freshwater fish or environmental water in a single reaction, and to rapidly detect them with excellent specificity and sensitivity.

[0013] Furthermore, the present invention aims to provide a diagnostic kit capable of rapidly detecting *Pseudorasbora parva*, *Pseudorasbora parva*, and *Pseudorasbora parva* simultaneously with excellent specificity and sensitivity, thereby enabling quantitative analysis while reducing the inconvenience and process of DNA sequencing or electrophoresis.

[0014] In addition, the present invention aims to provide a method for simultaneously detecting white-spotted minnows, riffle minnows, and pufferfish from freshwater fish or environmental water by using a primer set for simultaneous detection of white-spotted minnows, riffle minnows, and pufferfish comprising oligonucleotides of SEQ ID NOs. 1, 4, and 7; oligonucleotides of SEQ ID NOs. 2, 5, and 8; and probes of SEQ ID NOs. 3, 6, and 9, by amplifying target sequences specific to white-spotted minnows, riffle minnows, and pufferfish. means of solving the problem

[0016] To achieve the above objectives, the present invention provides a primer set for the simultaneous detection of *Pseudorasbora parva*, *Pseudorasbora parva*, and *Pseudorasbora parva*, comprising oligonucleotides of SEQ ID NOs. 1, 4, and 7; oligonucleotides of SEQ ID NOs. 2, 5, and 8; and probes of SEQ ID NOs. 3, 6, and 9.

[0017] In addition, the present invention provides a diagnostic kit for the simultaneous detection of white-tailed goby, riffle goby, and loach, comprising the above primer set.

[0018] In addition, the present invention comprises the step of isolating DNA from freshwater fish or environmental water;

[0019] The above-mentioned isolated DNA; and the step of mixing the above-mentioned primer set and amplifying by PCR; and

[0020] C of the above amplified product T A method for simultaneously detecting white-spotted minnows, riffle minnows, and loaches is provided, which includes a step of checking the (threshold cycle) value.

[0021] In one embodiment of the present invention, C of the amplified product T The step of checking the value is C at or below the maximum number of cycles. T It is characterized by determining it as a White-tailed Goby, a Riffle Goby, and / or a Goby when it appears. Effects of the invention

[0023] The present invention can provide a primer set and a probe capable of rapidly detecting white-spotted minnows, riffle minnows, and loaches from freshwater fish or environmental water with excellent specificity and sensitivity.

[0024] In addition, the present invention can provide a diagnostic kit capable of rapidly detecting *Pseudorasbora parva*, *Pseudorasbora parva*, and *Pseudorasbora parva* simultaneously with excellent specificity and sensitivity, thereby reducing the inconvenience and process of DNA sequencing or electrophoresis and decreasing the possibility of contamination, while enabling quantitative analysis.

[0025] In addition, the present invention can provide a method for simultaneously detecting white-spotted minnows, riffle minnows, and pufferfish from freshwater fish or environmental water by using a primer set for simultaneous detection of white-spotted minnows, riffle minnows, and pufferfish comprising oligonucleotides of SEQ ID NOs. 1, 4, and 7; oligonucleotides of SEQ ID NOs. 2, 5, and 8; and probes of SEQ ID NOs. 3, 6, and 9, by amplifying target sequences specific to white-spotted minnows, riffle minnows, and pufferfish. Brief explanation of the drawing

[0027] Figure 1 shows the results of a real-time PCR amplification reaction of the GMG triplex standard sample (Gna-Mra-Gma plasmid mix, 50,000 copies each) of the present invention. Figure 2 shows the calibration curve of the real-time PCR amplification reaction according to the plasmid DNA concentration of the white-tailed snail of the present invention. Figure 3 shows the calibration curve of the real-time PCR amplification reaction according to the plasmid DNA concentration of the riffle minnow of the present invention. Figure 4 shows the calibration curve of the real-time PCR amplification reaction according to the plasmid DNA concentration of the present invention. Figure 5 shows the results of verifying the specificity of a real-time PCR amplification reaction using species-specific molecular markers of *Pseudorasbora parva*, *Pseudorasbora parva*, and *Pseudorasbora parva* for 40 species of freshwater fish of the present invention (only *Pseudorasbora parva* was amplified). Figure 6 shows the results of verifying the specificity of a real-time PCR amplification reaction using species-specific molecular markers of *Pseudorasbora parva*, *Pseudorasbora parva*, and *Pseudorasbora parva* for 40 species of freshwater fish of the present invention (only *Pseudorasbora parva* was amplified). Figure 7 shows the results of verifying the specificity of a real-time PCR amplification reaction using species-specific molecular markers of *Pseudorasbora parva*, *Pseudorasbora parva*, and *Pseudorasbora parva* for 40 species of freshwater fish of the present invention (only *Pseudorasbora parva* was amplified). Specific details for implementing the invention

[0028] The present invention will be described in detail below based on the embodiments and drawings. The terms, embodiments, drawings, etc. used in this invention are merely illustrative to explain the invention more specifically and to aid the understanding of those skilled in the art, and the scope of the rights of the present invention should not be interpreted as being limited thereto.

[0029] Unless otherwise defined, technical and scientific terms used in this invention represent the meanings commonly understood by those skilled in the art to which this invention pertains.

[0031] The present invention relates to a primer set for the simultaneous detection of white-spotted minnows, riffle minnows, and loaches, comprising oligonucleotides of SEQ ID NOs. 1, 4, and 7; oligonucleotides of SEQ ID NOs. 2, 5, and 8; and probes of SEQ ID NOs. 3, 6, and 9.

[0033] Previously, only one species could be detected through a single PCR amplification reaction. For example, to determine whether an unknown sample contained the white-spotted goby, the riffle goby, and the Korean minnow, a first PCR amplification reaction had to be performed using a primer composition for detecting the white-spotted goby, a second PCR amplification reaction using a primer composition for detecting the riffle goby, and a third PCR amplification reaction using a primer composition for detecting the Korean minnow, thus requiring three PCR amplification reactions.

[0034] However, the present invention can simultaneously detect three species of white-tailed minnows, riffle minnows, and loaches through a single PCR amplification reaction.

[0036] In addition, the present invention relates to a diagnostic kit for the simultaneous detection of white-spotted minnows, riffle minnows, and loaches comprising the above primer set.

[0037] In addition, the present invention comprises the step of isolating DNA from freshwater fish or environmental water;

[0038] The above-mentioned isolated DNA; and the step of mixing the above-mentioned primer set and amplifying by PCR; and

[0039] C of the above amplified product T This invention relates to a method for simultaneously detecting white-spotted minnows, riffle minnows, and loaches, comprising a step of checking the (threshold cycle) value.

[0040] At this time, C of the amplified product above T The step of checking the value is C at or below the maximum number of cycles. T When it appears, it can be identified as a White-tailed Goby, a Riffle Goby, and / or a Goby.

[0042] (Example 1) Securing freshwater fish samples

[0043] Samples of 40 species of freshwater fish were obtained for the PCR amplification reaction (Table 1).

[0044] 600 μl of DNA extraction solution (10 mM Tris-HCl pH 8.0; 125 mM NaCl; 10 mM EDTA pH 8.0; 1% SDS; 8 M Urea) (Asahida et al. 1996) and 6 μl of Proteinase K solution (20 mg / ml) were added, and genomic DNA samples were extracted from 40 samples using the same procedure as in the literature.

[0046] number Sample name scientific name Country name taxa 01 NIE-001 Misgurnus anguillicaudatus loach Order Cypriniformes, Family Cobitidae 02 NIE-002 Cyprinus carpio carp Order Cypriniformes, Family Cyprinidae, Subfamily Cyprinidae 03 NIE-003 Acheilognathus lanceolatus bitterling Order Cypriniformes, Family Cyprinidae, Subfamily Acheilognathinae 04 NIE-004 Zacco platypus minnows Order Cypriniformes, Family Cyprinidae, Subfamily Piramidae 05 NIE-005 Moroco oxycephalus willow fish Order Cypriniformes, Family Cyprinidae, Subfamily Chordata 06 NIE-006 Channa argus snakehead fish Order Perciformes, Family Snakehead 07 NIE-007 Coreoperca herzi Korean rockfish Order Perciformes, Family Pseudorasboridae 08 NIE-008 Odontobutis interrupta spotted loach Order Perciformes, Family Gobiidae 09 NIE-009 Pseudobagrus fulvidraco catfish Order Siluriformes, Family Bagridae 10 NIE-010 Silurus asotus catfish Order Siluriformes, Family Siluriidae 11 NIE-011 Anguilla japonica eel Order Anguiformes, Family Anguiformes 12 NIE-012 Arctoscopus japonicus patter Order Osmeriformes, Family Osmeridae 13 NIE-013 Mugil cephalus mullet Order Mullet, Family Mullet 14 NIE-014 Oryzias latipes minnows Order Cicadidae, Family Cypriniformes 15 NIE-015 Gasterosteus aculeatus aculeatus large stickleback Order Gasterosteiformes, Family Gasterosteiidae 16 NIE-016 Monopterus albus mudskipper Order Eurasian swamps, Family Eurasian swamps 17 NIE-017 Cottus poecilopus Poisonous dog Order Perciformes, Family Poisonous Mantis 18 NIE-018 Repomucenus olidus Gangjugeokyangtae Order Perciformes, Family Sailfish 19 NIE-019 Erythroculter erythropterus Korean perch Order Cypriniformes, Family Cyprinidae, Subfamily Chubinae 20 NIE-020 Acheilognathus yamatsute striped bitterling Order Cypriniformes, Family Cyprinidae, Subfamily Acheilognathinae 21 NIE-021 Leiocassis nitidus Miljagae Order Siluriformes, Family Bagridae 22 NIE-022 Carassius carassius crucian carp Order Cypriniformes, Family Cyprinidae, Subfamily Cyprinidae 23 NIE-023 Siniperca scherzeri Mandarin fish Percidae 24 NIE-024 Pseudobagrus emarginatus large snail Order Siluriformes, Family Bagridae 25 NIE-025 Paracheilognathus rhombea Nabjiri Order Cypriniformes, Family Cyprinidae, Subfamily Acheilognathinae 26 NIE-026 Acheilognathus korennsis Knife-shaped slicing snail Order Cypriniformes, Family Cyprinidae, Subfamily Acheilognathinae 27 NIE-027 Hemiculter eigenmanni Chiri Order Cypriniformes, Family Cyprinidae, Subfamily Chubinae 28 NIE-028 Culter brevicauda Swan fish Order Cypriniformes, Family Cyprinidae, Subfamily Chubinae 29 NIE-029 Cobitis choii Miho loach Order Cypriniformes, Family Cobitidae 30 NIE-030 Pseudopungtungia nigra Gamdolgogi Order Cypriniformes, Family Cyprinidae, Subfamily Gobiidae 31 NIE-031 Gobiobotia brevibarba Stone shark Order Cypriniformes, Family Cyprinidae, Subfamily Gobiidae 32 NIE-032 Microphysogobio koreensis sand injection Order Cypriniformes, Family Cyprinidae, Subfamily Gobiidae 33 NIE-033 Pseudopungtungia tenuicorpa slender stonefish Order Cypriniformes, Family Cyprinidae, Subfamily Gobiidae 34 NIE-034 Squalidus japonicus Molgae Order Cypriniformes, Family Cyprinidae, Subfamily Gobiidae 35 NIE-035 Microphysogobio yaluensis Stonemaja Order Cypriniformes, Family Cyprinidae, Subfamily Gobiidae 36 NIE-036 Coreoleuciscus aeruginos Chamshiri Order Cypriniformes, Family Cyprinidae, Subfamily Gobiidae 37 NIE-037 Sarcochelichthys czerskii Used meat Order Cypriniformes, Family Cyprinidae, Subfamily Gobiidae 38 NIE-038 Gobiobotia naktongensis White-tailed Goby Order Cypriniformes, Family Cyprinidae, Subfamily Gobiidae 39 NIE-039 Microphysogobio rapidus rapids Order Cypriniformes, Family Cyprinidae, Subfamily Gobiidae 40 NIE-040 Gobiobotia macrocephala Googuri Order Cypriniformes, Family Cyprinidae, Subfamily Gobiidae

[0048] (Example 2) Primer Design

[0049] Based on the cytochrome b (COB) gene from the NCBI Gene Bank and previously obtained mitochondrial DNA, primers for detecting white-spotted minnows (SEQ Nos. 1 and 2), probes for detecting white-spotted minnows (SEQ Nos. 3), primers for detecting riffle minnows (SEQ Nos. 4 and 5), probes for detecting riffle minnows (SEQ Nos. 6), primers for detecting snailfish (SEQ Nos. 7 and 8), and probes for detecting snailfish (SEQ No. 9) that can be amplified only in white-spotted minnows, riffle minnows, or snailfish were designed as follows (Table 2).

[0051] Sequence number name nucleotide sequence (5'→3') note 1 Gna-0578f CTCTTCTTCACCTRCTGTTT PCR primers for detecting white-spotted minnows 2 Gna-0870r AGAATAGTAGTGCAAGAACC 3 Gna-0616p CY5-AACAACCCAGCCGGCCTA-BHQ2 TaqMan probe for detecting white-tailed minnows 4 Mra-0023f ACCCTCTAATAAAAATCGCC PCR primers for detecting *Rhynchocypris* 5 Mra-0390r GYCCTCATGGAAGGACATAA 6 Mra-0213p NED-AGACGTTAACTACGGCTGAC-BHQ2 TaqMan probe for detecting riffle minnows 7 Gma-0725f TAGCTTTATTCTCCCCCAAC 꾸구리 검출용 PCR 프라이머 8 Gma-1057r AAGTACAGAACTGATGCGAC 9 Gma-0798p FAM-ACACATCAAGCCCGAGTGGTA-BHQ1 꾸구리 검출용 택맨(TaqMan) 프로브

[0053] The above probe may have a fluorescent material of a reporter and a quencher capable of quenching the reporter fluorescence attached to both ends.

[0054] The above reporter may be one or more selected from the group consisting of FAM (6-carboxyfluorescein), Texas red, HEX (2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein), NED, JOE, Cy3 and Cy5, and the above quencher may be one or more selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), MGB Eclipse, BHQ1, BHQ2, BHQ3, NFQ and Dabcyl, but is not limited thereto.

[0055] For example, the above probe Gna-0616p can be defined as CY5-AACAACCCAGCCGGCCTA-BHQ2.

[0056] The above probe specifically hybridizes to the template DNA during the annealing step of the PCR process, and during the extension step, only the probe hybridized to the template is degraded by the 5'->3' exonuclease activity of the polymerase, so that the fluorescent marker is released from the probe, and the inhibition by the repressor is released, causing fluorescence to be emitted.

[0058] The present invention can distinguish between the white-spotted minnow, the riffle minnow, or the pufferfish by analyzing the fluorescence color and wavelength of the reporter that appear during PCR amplification.

[0059] When PCR amplification is performed, if the fluorescence color and wavelength of CY5 appear, it can be identified as a white-spotted scorpionfish; if the fluorescence color and wavelength of NED appear, it can be identified as a rifflefish; and if the fluorescence color and wavelength of FAM appear, it can be identified as a scorpionfish.

[0061] (Example 3) Environmental DNA extraction

[0062] We received environmental water samples concentrated in a cellulose nitrate membrane filter (pore size 0.45 μm, diameter 47 mm) from the ordering agency, and DNeasy ® Environmental DNA was extracted from them according to the user manual of Blood & Tissue Kits (Qiagen, Germany). At this time, the environmental DNA was dissolved in 100 μl of Elution Buffer to facilitate the calculation of the final concentration.

[0064] (Example 4) Real-time PCR amplification reaction

[0065] To perform real-time PCR amplification, PCR reaction solutions were prepared as follows using GoTaq® Probe qPCR MasterMix (Promega, USA) (Table 3).

[0066] At this time, the primer set of Table 2 was used as the forward primer, reverse primer, and probe.

[0068] Reagent AccuPower® Plus DualStar™ qPCR PreMix &Master Mix 10 μl Genomic DNA or environmental DNA 2 μl Gna-0578f (10 pmoles) 0.5 μl Gna-0870r (10 pmoles) 0.5 μl Gna-0616p (5 pmoles) 0.5 μl Mra-0023f (10 pmoles) 0.5 μl Mra-0390r (10 pmoles) 0.5 μl Mra-0213p (5 pmoles) 0.5 μl Gma-0725f (10 pmoles) 0.5 μl Gma-1057r (10 pmoles) 0.5 μl Gma-0798p (5 pmoles) 0.5 μl Nuclease-free water 3.5 μl Total 20 μl

[0070] PCR amplification was performed using QuantStudio5 (Life Technologies, USA) under the following conditions (Table 4). Annealing and elongation were performed at 62°C.

[0072] Step Temperature Time No. cycles Initial denaturation 95℃ 2 min 1 Denaturation 95℃ 15 s 50 Annealing / elongation 62℃ 45 s

[0074] Figure 1 shows the results of a real-time PCR amplification reaction of the GMG triplex standard sample (Gna-Mra-Gma plasmid mix, 50,000 copies each) of the present invention.

[0075] In the case of a standard sample containing all the plasmid DNA of the white-spotted minnow, the riffle minnow, and the pufferfish, the DNA of the white-spotted minnow, the riffle minnow, and the pufferfish is all amplified by the primer set above, and three curves appear.

[0076] The present invention can distinguish between the White-spotted Goby, the Riffle Goby, or the Goby through the shape and slope of the curve. In this case, the curve with the steepest slope corresponds to the Goby, the curve with the middle slope corresponds to the White-spotted Goby, and the curve with the lowest slope corresponds to the Riffle Goby.

[0078] To construct a calibration curve for the real-time PCR amplification reaction, concentration-dependent real-time PCR amplification reactions were performed using the primer set in Table 2 with plasmid DNA of the COB gene region of *Sargassum*. At this time, *Sargassum* plasmid DNA was 1×10 6 It was diluted 10-fold 7 times at a concentration of copies / μl and used for real-time PCR amplification reactions.

[0079] C confirmed through real-time PCR amplification reaction T It can be confirmed that the value increases inversely proportional to the concentration of the white-spotted plasmid DNA, and from this, it is determined that quantitative analysis is possible (Fig. 2).

[0081] To construct a calibration curve for the real-time PCR amplification reaction, real-time PCR amplification reactions were performed on the plasmid DNA of the COB gene region of *Lysimachia japonica* at various concentrations using the primer set in Table 2. At this time, the *Lysimachia japonica* plasmid DNA was 1×10⁻⁶ 6 It was diluted 10-fold 7 times at a concentration of copies / μl and used for real-time PCR amplification reactions.

[0082] C confirmed through real-time PCR amplification reaction T It can be confirmed that the value increases inversely proportional to the concentration of plasmid DNA with each stroke, and from this, it is determined that quantitative analysis is possible (Fig. 3).

[0084] To construct a calibration curve for the real-time PCR amplification reaction, concentration-dependent real-time PCR amplification reactions were performed on the plasmid DNA of the *Kuguri* COB gene region using the primer set in Table 2. At this time, the *Kuguri* plasmid DNA was 1×10 6 It was diluted 10-fold 7 times at a concentration of copies / μl and used for real-time PCR amplification reactions.

[0085] C confirmed through real-time PCR amplification reaction T It can be confirmed that the value increases inversely proportional to the concentration of the plasmid DNA, and from this, it is determined that quantitative analysis is possible (Fig. 4).

[0087] The results of verifying the specificity of the above primer set for 40 species of freshwater fish are as shown in Figures 5 to 7.

[0088] No positive reaction was confirmed in any fish species other than the white-spotted minnow, riffle minnow, and loach, and the specificity was verified as real-time PCR amplification reactions were confirmed only in the white-spotted minnow, riffle minnow, and loach. Therefore, it can be seen that the primer set of the present invention has very high species specificity and is free from errors that may occur due to false negatives.

[0090] Environmental water samples concentrated in a cellulose nitrate membrane filter (pore size 0.45 μm, diameter 47 mm) were received, and DNeasy ® Their environmental DNA was extracted according to the user manual of Blood & Tissue Kits (Qiagen, Germany).

[0091] As a result of performing a real-time PCR amplification reaction using extracted environmental DNA samples, the environmental DNA samples of the white-spotted minnow, riffle minnow, and loach were C T It was confirmed at values ​​of 20 to 50.

Claims

Claim 1 A white-tailed maggot comprising primers of SEQ ID NOs 1, 4, and 7; primers of SEQ ID NOs 2, 5, and 8; and probes of SEQ ID NOs 3, 6, and 9 ( Gobiobotia naktongensis ), Yeoulmaja( Microphysogobio rapidus ) and Kuguri( Gobiobotia macrocephala Primer composition for simultaneous detection. Claim 2 White-spotted sea snail (containing the primer composition of claim 1) Gobiobotia naktongensis ), Yeoulmaja( Microphysogobio rapidus ) and Kuguri( Gobiobotia macrocephala Diagnostic kit for simultaneous detection. Claim 3 A step of isolating DNA from freshwater fish or environmental water; a step of mixing the isolated DNA; and the primer composition of claim 1 and amplifying by PCR; and C of the amplified product T White-spotted maggots including a step of checking the (threshold cycle) value; Gobiobotia naktongensis ), Yeoulmaja( Microphysogobio rapidus ) and Kuguri( Gobiobotia macrocephala A method for simultaneously detecting ). Claim 4 In paragraph 3, C of the amplified product T The step of checking the value is C at or below the maximum number of cycles. T When it appears, the white-tailed magpie ( Gobiobotia naktongensis ), Yeoulmaja( Microphysogobio rapidus ) or Kuguri( Gobiobotia macrocephala White-tailed goby characterized by determining as ) Gobiobotia naktongensis ), Yeoulmaja( Microphysogobio rapidus ) and Kuguri( Gobiobotia macrocephala A method for simultaneously detecting ).

Images