Cell Surface Tag Exchange (CSTE) System for Tracking and Manipulating Cells During Recombinase-Mediated Cassette Exchange Integration of Nucleic Acid Sequences into Engineered Receptor Cells

KR103017353B1Active Publication Date: 2026-09-09GENOVIE
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
KR1020217003789
Authority / Receiving Office
KR · KR
Patent Type
Patents
Current Assignee / Owner
Priority Date
2018-07-09
Filing Date
2019-07-09
Publication Date
2026-09-09
Estimated Expiration
2039-07-09

Smart Images

  • Figure 112021015401288-PCT00001_ABST
    Figure 112021015401288-PCT00001_ABST
Patent Text Reader

Abstract

A combination system comprising two separate components, wherein the first component is a tag-exchange donor vector (TEDV) encoding a first cell surface tag (CST) exon adjacent to a 3' intron fragment and a gene of interest (GOI) in the antisense direction, and the second component is an engineered cell comprising a second CST exon whose entire intron sequence is adjacent to an exon encoding a transmembrane domain, and also a tag-exchange receptor site (TERS) in the genome encoding a reporter gene in the antisense direction, and a paired recombinase-mediated cassette exchange (RMCE) element is included in the TEDV and TERS, and performing RMCE between the TEDV and TERS results in the exchange of the reporter element to the GOI encoded by the TEDV, and the exchange of the first CST exon to the second CST exon, so that the derived engineered cell now expresses the first CST and GOI instead of the second CST and reporter gene.
Need to check novelty before this filing date? Find Prior Art

Description

Technology Field

[0001] The present invention relates to the field of cell engineering and recombinant DNA technology. In particular, the present invention relates to a system and method for generating, purifying, tracking, and manipulating engineered cells during recombinase-mediated cassette exchange (RMCE)-based integration of a gene of interest. Background Technology

[0002] In the fields of genetic engineering and immunology, recombinase-mediated cassette exchange (RMCE) has become a useful tool for targeted gene modification (e.g., literature [Turan et al. Gene (2013): 515[Refer to :1-27]). Generally, post-RMCE methods to verify whether a gene of interest (GOI) has been incorporated at the correct location require cell disruption and sample processing. A recently described approach overcomes the need for such cell disruption and demonstrates that recombination events can be monitored and isolated based on the expression of fluorescent marker proteins (Phan et al. Sci Rep. (2017):7(1):17771). Although the approach by Phan et al. avoids the need for cell disruption, it relies on intracellular protein fluorescence and is therefore not suitable for high-content screening of integrated constructs due to the limited set of unique spectral characteristics provided by fluorescent proteins; consequently, only a limited number of genes can be simultaneously labeled and detected using the described strategy. In addition, intracellular fluorescent proteins are not suitable for physical manipulation of cells via substrate affinity methods, such as magnetic activated cell sorting (MACS), which provide the possibility for high-throughput and parallelization during cell engineering workflows, or for increasing the efficiency of high-content cell library manipulation.

[0003] Currently, there is a need for tools for rapid and powerful cell manipulation using the RMCE technique in the near future, particularly when cells are simultaneously transfected with a vector pool containing a pool of individual genes of interest, or when cell selection by substrate affinity methods is desirable, in both high-throughput and high-concentration applications. Therefore, there is a clear need to provide an effective and improved method.

[0004] The present invention relates to providing a two-component cell surface tag exchange (CSTE) system for tracking and manipulating engineered cells during recombinase-mediated cassette exchange (RMCE)-based integration of a gene of interest (GOI). The first part of the CSTE system represents a tag-exchange donor vector (TEDV) encoding a GOI for integration, together with a first cell surface tag (CST) adjacent to a 3' fragment of an intron sequence containing a splice receptor site. An RMCE element is adjacent to the TEDV construct. The second part of the CSTE represents a tag-exchange receiver site (TERS) contained within the genome of an engineered target cell encoding a selected gene, and a second CST having an intra-membrane transmembrane domain adjacent to a complete intron sequence encoding an RMCE element and a second RMCE element adjacent to the GOI-coding sequence. The CST encoded by TERS is essentially encoded as a single intron as two adjacent exons. The paired RMCE elements included in both TEDV and TERS are designed such that the execution of the RMCE between the two constructs results in the exchange of CST and GOI from TEDV to TERS, and mutual loss in the TERS CST and the selected gene encoded by TERS. The CST delivered by TEDV utilizes the transmembrane domain encoded by TERS, where the execution of the RMCE results in the exchange of the unique CST exon sequence. Since the promoter element driving CST and selected gene / GOI expression from TERS is exogenous to the RMCE-exchanged construct, the sequence delivered by TEDV will generally be expressed only upon faithful execution of the RMCE.These CSTE systems are conditionally reported by the detection of affinity epitopes presented on the cell surface via CST, and also enable rapid and potent RMCEs that allow for the physical division of cells via substrate-immobilized affinity methods. These CSTE systems also enable the multiplexing and lineage tracing of GOI integration through the use of multi-affinity epitopes as CST elements. The CSTE systems represent a powerful tool for rapid and potent cell manipulation in both high-throughput and high-concentration applications.

[0005] In a first aspect, the present invention provides a combined system comprising two separate components, wherein the first component is a tag-exchange donor vector (TEDV) encoding a first cell surface tag (CST) exon adjacent to a 3' intron fragment and a gene of interest (GOI) in the antisense direction, and the second component is an engineered cell comprising a tag-exchange receptor site (TERS) in the genome that encodes a second CST exon whose entire intron sequence is adjacent to an exon encoding a transmembrane domain and also encodes a reporter gene in the antisense direction, wherein paired recombinase-mediated cassette exchange (RMCE) elements are included in the TEDV and TERS, and performing RMCE between the TEDV and TERS results in the exchange of a reporter element for the GOI encoded by the TEDV and the exchange of a first CST exon for a second CST exon, so that the derived engineered cell now has the first CST and instead of the second CST and reporter gene Expresses GOI.

[0006] In one embodiment, the first component is,

[0007] a. 1st RMCE element – ​​5' RMCE element encoded in a non-coding and 'non-functional' 3' intron fragment

[0008] b. A 3' intron fragment containing a branching point sequence, a polypyrimidine tube, and a 3' receptor splice site

[0009] c. Exon containing TEDV-encoded CST in the 5' to 3' direction

[0010] d. First transcription terminator sequence for the CST encoded in the 5' to 3' direction

[0011] e. Second transcription terminator for GOI encoded from 3' to 5'

[0012] f. Sequence encoding a GOI in the 3' to 5' direction

[0013] g. Kozak sequence

[0014] h. 5' RMCE element

[0015] It is a TEDV that includes,

[0016] Here, the CST exon and the first transcription terminator are encoded in the antisense direction from the GOI, and the associated transcription terminator and Kojak sequence.

[0017] In another embodiment, the second component is,

[0018] a. Trans-promoter element

[0019] b. Kojak hierarchy

[0020] c. Type 2 membrane protein transmembrane domain exon

[0021] d. 5' intron splice donor site

[0022] e. A 5' RMCE element encoded in a non-coding and 'non-functional' 3' intron fragment that is equivalent to and paired with the 5' RMCE element of TEDV

[0023] f. Functional sequence of a 3' intron fragment including a branching point sequence, a polypyrimidine tube, and a 3' receptor splice site

[0024] g. Exon containing TERS-encoded CST in the 5' to 3' direction (different from TEDV-encoded CST)

[0025] h. Transcription terminator sequence for CST encoded in the 5' to 3' direction

[0026] i. Warrior terminator sequence for the 3' to 5' direction

[0027] j. Sequence encoding the selected gene in the 3' to 5' direction

[0028] k. Kojak sequence for efficient translation initiation of selected gene transcripts

[0029] l. 3' RMCE element

[0030] m. 3' genomic element responsible for regulating and tracking CST transcript expression

[0031] It is a TERS that includes,

[0032] Here, the transmembrane domain exon and the CST exon are encoded from the reporter gene toward the antisense direction, so that the first transcription promoter element drives the transcription of the combined transmembrane domain and CST, and the second transcription promoter element drives the transcription of the reporter gene.

[0033] In a second aspect, the present invention provides a method for generating a derived engineered cell expressing a TEDV-encoded GOI from a TERS locus, said method

[0034] a. Step to generate a TEDV encoding the GOI

[0035] b. A step of delivering the TEDV to an engineered cell line comprising a paired TERS, together with a recombinant enzyme matching an internally encoded RMCE element.

[0036] c. A step of contacting cells with two or more affinity reagents specific to both TEDV-encoded CSTs and TERS-encoded CSTs.

[0037] d. A step of selecting derived engineered cells based on reduced expression of a reporter gene and TERS-encoded CST, and increased expression of TEDV-encoded CST, as a proxy for selecting cells having an integrated GOI.

[0038] Includes

[0039] In a third aspect, the present invention provides a tag-exchange donor vector (TEDV) that encodes a cell surface tag (CST) exon adjacent to a 3' intron fragment and a gene of interest (GOI) in the antisense direction.

[0040] In a fourth aspect, the present invention provides an engineered cell comprising, within its genome, a tag-exchange receptor site (TERS) that encodes a cell surface tag (CST) exon adjacent to an exon encoding a transmembrane domain, and also encodes a reporter gene in the antisense direction, wherein a recombinase-mediated cassette exchange (RMCE) element is included in the TERS, and performing RMCE between the TERS and a tag-exchange donor vector (TEDV) results in the exchange of a reporter element for a gene of interest (GOI) encoded by the TEDV.

[0041] The present invention provides a system for incorporating GOI into cell lines engineered by RMCE, wherein the report of said incorporation is conditionally detected by analysis of a co-integrated cell surface tag (CST). Furthermore, upon incorporation of the GOI, the concomitant loss of a separate CST from the engineered cell line enables double positive / negative selection of GOI-expressing derived engineered cells. This 'tag-exchange' is very potent and forms the basis for strict positive / negative selection enabled by the CSTE system. A second selection gene is also lost from the TERS site, enabling very potent double negative selection and single positive selection during the generation of derived engineered cells expressing the GOI. Importantly, the characteristics of the CST system mean that these markers, which require the selective addition of co-affinity reagents for detection, can also be utilized to physically divide target cell populations by using substrate-immobilized affinity reagent methodologies. This enables an efficient, high-throughput method for generating derived engineered cells through cell division using methods such as Magnetic Acquisition and Sorting (MACS), unlike methods such as Fluorescence-Activated Cell Sorting (FACS), which are difficult to compare and more time-consuming. Finally, in replacing the intracellular expression of fluorescent proteins and antibiotic resistance genes as integrated markers, the CSTE system provides a much larger space of selectable markers. Specifically, unlike widely overlapping sets of fluorescent proteins or highly restricted sets of antibiotic resistance genes, the generation of multiple unique CST epitopes for conditional selection is easily achieved. This broad approach to selectable markers enables the generation of various forms of high-throughput derived cells while increasing efficiency, and further enables high-throughput methods for both cell library formation and cell lineage tracking in cell manipulation, pathway manipulation, and experimental workflows. Specific details for implementing the invention

[0042] The overall architecture and operation of the CSTE system are illustrated in Fig. 1. The CSTE system operates as a donor / receiver pair, where a tag-exchange donor vector (TEDV) serves to deliver a GOI sequence and a cell-surface tag (CST) exon to paired tag-exchange receptor sites (TERS) typically contained within the genome of a engineered cell line. The TERS encode separate CST exons and selected genes, which are exchanged for the TEDV-encoded CST and GOI, respectively.

[0043] The TEDV-encoded CST exon is encoded in the sense (5' to 3') direction and in a frame containing a 3' intron fragment including a splice receptor site, a polypyrimidine tube, and a branching point sequence. A first RMCE element is encoded for the 5' of this functional intron sequence within the 'non-functional' intron sequence. The GOI is encoded in the antisense (3' to 5') direction. A second RMCE element is encoded for the 3' end of a structure adjacent to the GOI transcription start site.

[0044] A paired TERS construct delivered by an engineered cell line encodes a CST exon in a frame having a complete intron sequence by utilizing a first RMCE element within a 'non-functional' intron sequence that is paired with and in an equivalent context to the first RMCE element of TEDV. The complete intron sequence encoding this first RMCE site includes a transmembrane domain (TD) exon and a 5' splice donor site encoded within the frame. This TD drives transcription to the 5' of the TERS construct, including a transcription start site and a promoter sequence. Thus, the TERS-encoded CST is expressed at the cell surface once translated from the spliced ​​transcript. Similarly, once the RMCE is executed between TEDV and TERS, the TEDV encoded in the CST exon is exchanged for the TERS-encoded CST exon. This results in the execution of 'tag-exchange,' whereby the derived engineered cell line now expresses TEDV-encoded CST on the cell surface and does not express TERS-encoded CST. In this process, the TEDV-encoded CST exon 'acquires' the 5' splice donor site, TD domain, transcription start site, and promoter sequence from the TERS construct, enabling the expression of TEDV-encoded CST and providing stricter site-specific control than the integration of the TEDV-encoded sequence.

[0045] As mentioned above, TERS encodes a selection gene in the antisense (3' to 5') direction, whereby the promoter sequence can drive the transcription of this selection gene at the 3' end of the TERS construct. Between the transcription start site of the selection gene and the 3' promoter sequence of the TERS, a second RMCE element is encoded and paired with a second 5' RMCE element encoded in TEDV. Thus, when RMCE is executed between TEDV and TERS, the TEDV-encoded GOI is exchanged with the TERS-encoded selection gene.

[0046] It is important to note that since TEDV does not contain a promoter sequence, both the TEDV-encoded CST exon and the GOI must be complemented with a promoter sequence that enables their transcription. Importantly, as outlined above, the inclusion of intron and TD exon complements to the CST exon provides much stricter site selectivity for the integration of the TEDV-encoded sequence. The use of intron elements in CSTE provides an additional level of assurance that random integration of the construct will not result in a TEDV-encoded CST expressible on the cell surface. In contrast to donor vectors that deliver the entire CST ORF including TD, the CSTE system provides only the CST epitope exon and the splice receptor site. Therefore, random anomalous integration of the donor construct will not only need to be integrated adjacent to the active promoter, but will also require the acquisition of a type II transmembrane domain, or an equivalent, along with an appropriate 5' splice donor sequence. This makes the probability of randomly integrated constructs expressing TEDV-encoded CST extremely low, thereby minimizing the selection of such random and unwanted events during the generation of derivative engineered cells expressing the delivered GOI.

[0047] The specific architecture of the CSTE system components, including TEDV and TERS, is described in detail below.

[0048] TERS Architecture

[0049] The TERS contained within the engineered cell line constitutively express a TERS-encoded CST and a selected gene, which are exchanged for a TEDV-encoded CST and a GOI, respectively, during the execution of RMCE with a paired TEDV. The general architecture of the TERS is included but is limited to these.

[0050] TERS typically includes the following:

[0051] a) Kojak sequence

[0052] b) Exon encoding a transmembrane domain of a type 2 membrane protein.

[0053] c) 5' intron splice donor site.

[0054] d) A 5' RMCE element encoded in a non-coding and 'non-functional' 3' intron fragment that is equivalent to and paired with the 5' RMCE element of TEDV.

[0055] e) Functional sequence of a 3' intron fragment including a branching point sequence, a polypyrimidine tube, and a 3' receptor splice site.

[0056] f) Exon containing a TERS-encoded CST in the 5' to 3' direction.

[0057] g) Transcription terminator sequence for CST encoded in the 5' to 3' direction.

[0058] h) Transcription terminator sequence for a selected gene encoded from 3' to 5'.

[0059] i) Sequence encoding the selected gene in the 3' to 5' direction

[0060] j) Kojak sequence for efficient translation initiation of selected gene transcripts

[0061] k) 3' RMCE factor

[0062] x) A 5' genomic element responsible for the regulation of CST transcript expression and tracking. This genomic element contains at least a promoter sequence that drives CST transcription.

[0063] y) A 3' genomic element responsible for the regulation of expression and tracking of selected gene transcripts. This genomic element contains at least a promoter sequence that drives selected gene transcription;

[0064] Herein, a) is provided to ensure efficient translation initiation from adjacent TD / CST transcripts driven by TERS for both the TERS-encoded CST prior to the execution of RMCE and the TEDV-encoded CST after the execution of RMCE; b) represents a TD adjacent to a CST exon by transcript splicing, mediates the insertion of a protein construct translated at the cell plasma membrane, and presents the CST to the extracellular space; c) is an RMCE element located within the intron sequence of the TERS construct and is equivalent to the 5' RMCE element of TEDV, mediating CST exon exchange during the execution of RMCE within the CSTE system; and e) is a functional sequence associated with the splice receptor site and the intron, enabling the splicing of an intron containing the RMCE element from the TD / CST transcript driven by TERS; f) is an exon in which a TD / CST protein expressed encoding CST epitope(s) within a TERS region presents said epitope to the extracellular space and can be conditionally detected by a homoaffinity reagent; g) represents a transcription terminator for a TD / CST open reading frame encoded in the 5' to 3' direction; h) represents a transcription terminator for a selection gene open reading frame encoded in the 3' to 5' direction within the TERS; i) represents an open reading frame encoding a selection gene expressed from the TERS in an engineered cell line; and j) is a Kojak sequence provided to ensure efficient translation initiation from a selection gene transcript driven from the TERS prior to the execution of RMCE; k) is an RMCE element located between the transcription start site of the selected gene and the promoter sequence driving the transcription of this open reading frame, equivalent to the 3' RMCE element of TEDV, and mediates the exchange between the TEDV-encoded GOI and the selected gene when executed by the RMCE within the CSTE system;x) represents the minimal TD / CST open reading frame encoded by TERS prior to RMCE, and the promoter sequence driving the transcription of TEDV-encoded TD / CST after the execution of RMCE; y) represents the minimal Select Gene open reading frame encoded by TERS prior to RMCE, and the promoter sequence driving the transcription of TEDV-encoded GOI after the execution of RMCE.;

[0065] Schematic diagrams of TERS cloning fragments are included, but are limited to these.

[0066] TERS essentially encodes a fully functional intronic sequence containing a 5' RMCE site. Such a sequence may represent any intron that enables efficient splicing of TD / CST transcripts in the context of a host-engineered cell. The splice receptor site of TEDV is required to be functional together with the splice donor site of TERS. Therefore, the splice receptor sequences encoded by TEDV and TERS must be identical or equivalent.

[0067] The non-coding and 'non-functional' intron sequences encoded by the RMCE site may also additionally encode genetic elements, such as transcription enhancers, transcription insulators, separate open reading frames encoding distinct desired components for the function or reporting of TERS constructs within engineered cells, or other unique sequences used for transcriptome and / or construct tracking and quantification.

[0068] In the context of TERS, both the encoded TD / CST and the selected gene may contain 5' and 3' untranslated regions (UTRs), and the UTRs encode unique sequences used, for example, for transcriptome and / or construct tracking and quantification, or confer regulation of transcriptome stability.

[0069] Selective genes are

[0070] a. Antibiotic resistance genes,

[0071] b. Reporter gene

[0072] c. Nutritional requirement complementary genes,

[0073] d. Induced suicide gene

[0074] It can be selected from, wherein the selection, formatting, and application of such positive selection markers are well known to those skilled in the art. The use of inducible suicide genes can be used to remove parental engineered cells after the execution of RMCE in the generation of derivative engineered cells expressing GOI. Reporter genes may represent unique TD / CST constructs for conditional or constitutive reporting on the cell surface. To enable positive selection during the generation of engineered cell lines and negative selection during the generation of derivative engineered cell lines, multiple selection genes may be included in this part of the TERS.

[0075] 5' and 3' genomic elements minimally encode promoter sequences that mediate the transcription of TD / CST and selected genes. Such promoters may represent the configuration of inducible promoters. These genomic elements may also additionally encode genetic elements, such as transcription enhancers, transcription insulators, distinct open reading frames encoding separate desired components for the function or reporting of TERS constructs within engineered cells, or other unique sequences used for construct tracking and quantification.

[0076] In this description, it is important to note that TD / CST is encoded in the sense (5' to 3') direction (as shown in FIG. 3) and the select gene is encoded in the antisense (3' to 5') direction (including, but limited to, as shown in the description). This is for the sake of clarity of the description. If the TD / CST construct can also incorporate a functional intron sequence encoding an RMCE site paired with an equivalent RMCE site within the 3' intron fragment of TEDV, there is no substantial reason why this orientation cannot be reversed in the context of TERS / TEDV.

[0077] The inclusion of a selected gene is not absolutely necessary for the operation of the CSTE system, but it is desirable to aid in triple selection for the expression of the GOI of interest during the execution of RMCE. Additionally, the generation and maintenance of engineered cell lines by the use of a reporter in both sense and antisense directions ensures that the promoter sequences contained within the 5' and 3' genomic elements are fully functional prior to the execution of RMCE, thereby generating derived engineered cells that express TEDV-encoded GOIs.

[0078] Cell Surface Tag (CST) Architecture

[0079] One of the key functional characteristics of the CSTE system is the conditional reporting of the presence of an exchanged structure incorporating an initial TERS structure and a TEDV-encoded sequence during the execution of RMCE using several unique CST structures.

[0080] To achieve a TD complementary array within the CSTE system, only specific types of TD exons are suitable. That is, they can be spliced ​​with a CST exon located at the 3' and also allow the CST protein fragment to be exposed extracellularly.

[0081] To simplify the expressed CST epitope-presenting protein product and minimize the size and complexity of the TD exon, TDs derived from type II membrane proteins are most suitable. Type II TDs are single-pass and are located at the N-terminus of the protein facing the cytoplasmic side of the membrane, allowing the C-terminal CST epitope to be exposed extracellularly. If the spliced ​​CST transcript exposes the CST epitope to the extracellular space, other TDs, including multi-pass TDs, may be used.

[0082] In spliced ​​transcripts, CST exons adjacent to TDs have the function of simply presenting unique epitopes extracellularly that can be conditionally detected by the use of homologous affinity reagents. Generally, such epitopes include synthetic sequences, sequences encoded by distinct organisms derived from the host engineered cell, or sequences derived from the same organism as the host engineered cell but not expressed extracellularly.

[0083] Generally, it is desirable to include a linker domain between the TD and the CST epitope. While the CST epitope may consist of a few amino acids, such a linker region ensures the availability of the CST at the cell surface for affinity reagent binding. Such a linker region may include a flexible 'unstructured' region or a structurally fully folded protein domain.

[0084] The characteristics of the epitope encoded by the CST exon reflect uniqueness only in the context of epitopes that are differently expressed on the cell surface of engineered cells containing TERS, and thus may represent any protein sequence from which a specific affinity reagent can be produced.

[0085] Generally, CST structures should be functionally neutral with respect to cell function as a whole. Often, a transmembrane domain simply fused to an inactive epitope structure without an exogenous functional domain via a linker sequence is preferred.

[0086] In this context, an affinity reagent is defined as any antibody, peptide, nucleic acid, or other small molecule that specifically binds to a larger target molecule to confirm, track, capture, or otherwise influence the activity of a CST epitope. Often, such affinity reagents will be labeled with fluorescent, chromogenic, radioactive, or other detectable markers to track cells expressing homologous CSTs. Alternatively, such affinity reagents may be functionalized to a substrate so that substrate affinity enhancement methods can divide CST-expressing engineered cells.

[0087] TERS engineered cell line including

[0088] Since synthetic TERS constructs are inserted, cell lines containing TERS must be engineered. Generally, this would mean the integration of the TERS constructs into the genome of the engineered cells, but may also include other methods for nuclear retention of the TERS constructs, such as methods for episodic retention of the gene constructs.

[0089] Methods for incorporating constructs into the genome of target mammalian cells are well known to those skilled in the art and can be achieved through homology-induced recombination (HDR) and / or random integration methods, wherein HDR can be promoted by targeted mutations at loci where HDR occurs, and

[0090] i. Zinc-finger nucleases

[0091] ii. CRISPR / Cas9-mediated targeting

[0092] iii. Synthetic Transcriptional Activation-Pseudo-Effector Nuclease (TALEN)

[0093] It can be achieved through various means, including but not limited to site-specific mutagenesis through, and

[0094] Here, the aforementioned site-targeting nuclease induces site-specific DNA repair by HDR at the target locus. After such an event, a proportion of cells will contain the HDR vector, and

[0095] iv. Non-destructive phenotypic expression analysis

[0096] v. Analysis of destructive phenotype expression

[0097] vi. Genetic Analysis

[0098] It can be selected and / or determined through any combination of,

[0099] Here, iv and vi are preferred methods for the selection and determination of successful genome integration events.

[0100] Alternatively, viral vectors can be used to deliver necessary components in a site-specific or non-site-specific manner.

[0101] If a TERS-encoding CST detectable on the cell surface is present and an expressed select gene is present, the methodology of TERS construct integration is not central to TERS operation, indicating that it is functional in relation to the transcription of the coding sequence containing the construct. Indeed, both the TERS-encoding CST and the select gene are convenient selectable markers for generating engineered cell lines containing TERS.

[0102] One important aspect to note is that in some applications, particularly when utilizing the ability to generate cell-based arrays of derived engineered cell lines expressing a single GOI from a library of TEDV constructs, there is a requirement for copy number control of the integrated TERS construct, and similar 'multiple' methods are needed. With this in mind, episodic maintenance of the TERS construct would largely be incompatible with such multiple methods for generating derived engineered cell lines. Methods for determining the copy number of a construct within the genome of an engineered cell line are well known to those skilled in the art.

[0103] TEDV Architecture

[0104] TEDVs encode a CST exon encoded by TERS and a CST exon and GOI to be exchanged with a selected gene, respectively, during the execution of RMCE, where TERS is contained within the engineered cell line. The general architecture of the TEDV is illustrated in Fig. 2.

[0105] TEDV is typically

[0106] 1) 5' RMCE elements encoded in non-coding and 'non-functional' 3' intron fragments.

[0107] 2) A 3' intron fragment comprising a branching point sequence, a polypyrimidine tube, and a 3' receptor splice site.

[0108] 3) Exon containing TEDV-encoded CST in the 5' to 3' direction.

[0109] 4) Transcription terminator sequence for CST encoded in the 5' to 3' direction.

[0110] 5) Transcription terminator sequence for GOI encoded from 3' to 5'.

[0111] 6) A sequence encoding a GOI in the 3' to 5' direction.

[0112] 7) Kojak sequence.

[0113] 8) 3' RMCE factor

[0114] Includes,

[0115] Here, 1) represents an RMCE element located within the intron non-coding and non-functional sequence of the 3' intron fragment of the TEDV construct, equivalent to the 5' RMCE element of TERS, mediating CST exon exchange during the execution of RMCE within the CSTE system; and 2) is a 3' intron fragment that generates derived engineered cells expressing GOI by providing a branching sequence, a polypyrimidine tube, and a 3' receptor splice site for the execution of efficient splicing of TD / CST transcripts of integrated TEDV-encoded CST exons after the execution of RMCE between TEDV and TERS; 3) is an exon encoding CST epitope(s) within a TEDV construct that can be conditionally detected by a homoaffinity reagent, causing the expressed TD / CST protein supplemented after the execution of RMCE between TEDV and TERS to present the CST epitope in the extracellular space; 4) represents a transcription terminator for the CST exon encoded in the 5' to 3' direction, acting as a transcription terminator for the TD / CST supplemented by the TEDV-encoded CST during the execution of RMCE; 5) represents a transcription terminator for the GOI open reading frame encoded in the 5' to 3' direction within TEDV, acting as a transcription terminator for the encoded GOI when integrated into the TERS site during the execution of RMCE; and 6) represents an open reading frame encoding the GOI integrated into the engineered cell to generate a derived engineered cell expressing the GOI; 7) is provided to ensure efficient translation initiation from the GOI transcript driven by TERS after the execution of RMCE; and 8) is the RMCE site at the 3' end of the TEDV construct and is equivalent to the 3' RMCE site of the TERS located between the transcription initiation site of the selected gene and the promoter sequence driving the transcription of this open reading frame.

[0116] A schematic diagram of the TEDV cloning fragment is presented in Fig. 2.

[0117] TEDV may represent a synthetic DNA construct or a cloned construct generated by a method well known to those skilled in the art. To aid in the cloning methodology, TEDV may include restriction endonuclease sequences for inserting various CST exons and / or GOI sequences into the construct. The inclusion and use of such cloning sites are well known to those skilled in the art.

[0118] In this context, TEDV is generally likely to be a plasmid construct bred in bacteria, and therefore may also contain a replication origin and a selection gene.

[0119] TEDV may also represent a structure having a sequence motif that can be packaged into a specific delivery vector, such as a viral vector well known to those skilled in the art. The use of viral vector transduction of engineered cells containing TERS will be beneficial for the use of CSTE systems in cells that would otherwise be difficult to transfect.

[0120] TEDV can represent RNA constructs, which can be reverse transcribed upon the provision of an appropriate reverse transcriptase.

[0121] In this context, the GOI is defined by any nucleic acid-coding or non-coding sequence of interest. This may include any protein- or polypeptide-open reading frame, non-protein-coding RNA, such as microRNA, short hairpin RNA, tRNA, or rRNA.

[0122] Importantly, a GOI can represent a library of variants of a single open reading frame, and TEDVs encoding such GOIs can follow a pooled library of TEDVs. Due to precise control over the copy number activated by the CSTE system and reliable multifactor and conditional reporting of GOI integration, a library of high-content derived engineered cells can be generated, allowing each derived engineered cell to express only a single GOI within a pool of target cells. This can be utilized for the manipulation of various cells, pathways, proteins, and specific GOIs in viable cellular contexts (see below).

[0123] RMCE urea and enzymes

[0124] The use of site-specific recombinases (SSRs) has proven to be a predictable tool for modifying the cellular genome. SSRs fall into two main classes: Ser integrases, which include but are not limited to ΦC31, γδ-res, ParA, Tn3, Gin, ΦBT1, R4, Bxb1, and TP901-1, and Tyr recombinases, which include but are not limited to Flp, Cre, and R. Both classes can perform RMCE, but Ser integrases are restricted by the initial crossover, so the introduction of the desired TEDV-encoded CST and GOI or TEDV vector backbone will occur. Although not all Tyr recombinases have been comprehensively evaluated experimentally, Cre and Flp have been widely used to perform RMCE. For the purpose of incorporating single copies of TEDV-encoded CST and GOI genetic elements, using Flp with well-characterized heterospecific FRT sites is most suitable due to the lack of similar FRT sites encoded in the human genome. This is not the case for Cre, which exhibits promiscuous activity toward LoxP genomic similar sites.

[0125] Method for generating derived engineered cells

[0126] The use of RMCE in mammalian cells is well known to those skilled in the art, wherein the donor construct can be delivered to target cells by various methodologies including, but not limited to, chemical transfection, electroporation, or viral vector delivery. In addition to the provision of the donor construct, specific recombinant enzyme(s) must also be provided. This will generally be provided as a separate expression construct that is co-delivered to the target cells along with the donor construct. In some examples, it may be desirable to conditionally express the necessary recombinant enzyme by modifying engineered cells expressing TERS to increase the efficiency of the overall process.

[0127] In the context of a CSTE system, RMCE is performed by the delivery of TEDV to engineered cells containing TERS, followed by a derivation period, and then a target cell population can be analyzed or selected to generate derived engineered cells expressing TEDV-encoded GOIs. This can be performed in three ways that are unique to the CSTE system and independent of the detection of GOI expression.

[0128] Derived engineered cell lines can be selected based on the negative selection of TERS-encoded CSTs and / or the positive selection of TEDV-encoded CSTs as a reflection of successful tag exchange. These are recorded conditionally and require the addition of a homologous affinity reagent for each CST. Such selection methodologies can utilize FACS through the addition of fluorescently labeled affinity reagents and the selection of desired CST expression profiles. Due to the extracellular presentation of CST epitopes, cell division can also be achieved via substrate-based enrichment approaches, such as MACS.

[0129] Further negative selection can be achieved based on a TERS-encoded selection gene, wherein the selection gene represents a reporter gene or an inducible suicide gene. For the reporter gene, FACS can be used, for example, in the case of a fluorescent reporter gene, or FACS and / or MACS if the reporter gene itself represents a unique CST. Using an inducible suicide gene, parental engineered cells from a culture can be negatively selected; for example, derivative engineered cells expressing GOI can be enriched.

[0130] Overall, double positive selection and single negative selection provide very strong selection of derived engineered cells, which can be conditionally recorded and used to divide cells using substrate-immobilized affinity reagents. These selections may additionally include positive selection for TEDV-encoded GOIs if the characteristics of the TEDV-encoded GOIs can be modified for non-destructive detection within derived engineered cells. The aforementioned selections can be used sequentially or simultaneously to achieve high-throughput or accurate high-concentration derived engineered cell populations.

[0131] The above-mentioned phenotypic analysis will be supported by genotyping the copy number of the TEDV sequence in derived engineered cells using methods generally well known to those skilled in the art. This can also be achieved to some extent phenotypically when considering the highly standardized context of CST expression, where very rare cases in which aberrant integration of TEDV constructs results in the expression of TEDV-encoded CSTs at the cell surface can be negatively selected by excluding cells with high TEDV-encoded CST expression, particularly when using FACS selection methodologies. For engineered cells expressing multiple TERS sites (see below), copy number control can be similarly achieved based on the degree of TEDV-encoded CSTs expressed at the cell surface.

[0132] Cell matrix-immobilization affinity reagent splitting method

[0133] The primary advantage of the CSTE system is the ability to divide cells based on cell surface exposure of CST epitopes and the resulting substrate immobilization affinity method. This is particularly useful for stepwise selection in high-throughput methods or for generating high-content derived engineered cell libraries. A methodology well known to those skilled in the art is the ferromagnetic bead-based MACS approach, among various other affinity reagent-functionalized substrates for cell capture and physical division based on the specific expression of surface epitopes. Such rapid conditional positive and / or negative selection based on cell surface CST expression is highly parallel and therefore suitable for high-throughput methods, offering much faster speed and accuracy in antibiotic resistance selection, as well as significantly faster speed and cost reduction compared to FACS selection limited to intracellular fluorescent proteins. Furthermore, the ability to positively and negatively select both the parent engineered cells and the derived engineered cells leads to the generation of accurate high-content libraries of derived engineered cells expressing one or more GOIs.

[0134] Cell surface utilizing multiple and multivalent CSTs Barcoding ' method

[0135] An advantage of the CSTE system is the increased amount of available selectable marker space. In contrast to standard fluorescent protein reporter and antibiotic resistance gene systems, which are limited to only a few parallelizable markers, a large number of unique markers can be rapidly generated by using simple epitopes with homologous affinity reagents. Since multi-epitope CST domains can be easily configured for all unique combinations of available CST epitopes and homologous detection reagents, they are not limited solely by the number of available CST epitopes and homologous reagents. The expanded and parallelizable conditional reporter space enables various high-throughput and high-content methodologies.

[0136] The use of multiple TEDV-encoded epitopes associated with different GOIs or GOI variant sequences can be used to increase efficiency in high-throughput cell manipulation. For example, a pool of such unique vectors can be integrated into a pool of engineered cells expressing TERS. This can be processed in bulk through negative selection as outlined above and subsequently divided based on unique TEDV-encoded CST expression.

[0137] Similarly, the use of multi-TEDV-encoded CST epitopes enables the generation of intermediate-content libraries for tracking and selecting viable cell lines. For example, a library of GOIs associated with a unique CST can be incorporated into a pool of derived engineered cells, allowing for the tracking of the persistence or function of cell lines expressing specific GOIs over time. This can be applied to the selection of proteins, pathways, or cell engineering or culture systems for analysis, or it can be used similarly when cells are transplanted into viable animals and subsequently recovered as viable cells for analysis.

[0138] High content Library and multi- TERS engineered cells

[0139] With strong positive and negative selection of derivative engineered cells expressing GOI, accurate high-content libraries can be generated in various ways to support protein, pathway, and cell engineering workflows.

[0140] In the simplest sense, a library of TEDVs encoding a single CST epitope but not multiple GOIs can be incorporated into a pool of cells. For example, the application of standard positive / negative CST selection using TERS- and TEDV-encoded CST epitopes will induce a population of derived engineered cells expressing a single GOI variant in each cell of the selected population. Then, functional selection can be applied in the workflow to engineer proteins, cellular pathways, or more generally cellular functions based on the variant GOIs incorporated into this high-content cell library.

[0141] By adding multiple TERS with unique CST epitopes for a single engineered cell, and multiple TEDV libraries with unique CST epitopes, multiple families of variant GOIs can be incorporated into such an engineering workflow to process enzymes in biosynthetic pathways, for example, as combined variant GOIs. In this context, where engineered cells contain multiple TERS, they can be used to enhance the overall expression of a single GOI. Multiple-TERS engineered cells will generally require the use of unique heterospecific recombinase sites for each TERS / TEDV pair to ensure the efficiency and stability of GOI integration and selection.

[0142] Drawing legend

[0143] Fig. 1. Cell surface tag exchange ( CSTE ) Composition and operation of the system

[0144] Schematic diagram of the CSTE system. The top panel illustrates system components with a modified cell containing a tag-exchange donor vector (TEDV) on the right and a tag-exchange receptor site (TERS) on the left.

[0145] TEDV encodes RMCE elements at both ends of the structure (open and closed triangles), and these elements are paired with RMCE sites contained within TERS. At the 5' end of the TEDV structure (closed triangle), the RMCE element is encoded within a sequence representing a 3' intron fragment, where immediately next to the 3' of the RMCE element is the 3' element of the intron (open circle) containing a branching point sequence, a polypyrimidine tubule, and a splice receptor site. Thus, the RMCE is contained within a 'non-functional' and non-coding intron sequence, and the 3' intron fragment contained within TEDV does not have a 5' splice donor site. Immediately next to the 3' of the splice receptor site, TEDV encodes the 3' exon of the cell surface tag (CST), which means that the exon encodes a portion of the CST (gray rectangle) containing a unique molecular binding motif. The CST sequence is encoded in the 5' to 3' direction, where TEDV also encodes the gene of interest (GOI) (rectangle marked with a grid) to be incorporated into the TERS encoded in the 3' to 5' direction.

[0146] The central portion of the TERS contained within the engineered cells encodes elements that have the same architecture but are distinct from those of TEDV. Specifically, between the RMCE elements paired with those of TEDV (open and closed triangles), the TERS encodes a CST exon distinct from that of the TEDV-encoded CST (checkered rectangle) by utilizing the splice receptor site immediately adjacent to the 5' of this CST (open circle) and the associated 3' intronic sequence. Similarly, the selection gene (closed rectangle) is encoded in the antisense direction within the TERS, similar to the GOI of TEDV. At the 5' end of the construct, a promoter sequence is included (right arrow) to drive the transcription of the CST. For the 3' of this promoter sequence, a transmembrane domain (TD) exon (open rectangle) is encoded using the 5' intronic sequence immediately adjacent to the 3' (closed circle). This means that the RMCE element containing the intron and the TD exon and CST exon encoded within the frame are generated as a continuous transcript in which the exons are spliced ​​to be adjacent to each other in a single-coding mRNA. The TERS-encoded TD-CST product (open / checkered dumbbell) is expressed on the cell surface. At the 3' end of the TERS construct, there is a separate promoter element that drives the transcription of the selected gene (closed rectangle) in the 3' to 5' direction, which results in the expression of the selected gene (closed square).

[0147] When TEDV is introduced into engineered cells containing TERS along with an appropriate expression construct for a recombinase specific to the RMCE element paired with TEDV / TERS, RMCE is executed, resulting in the generation of derivative engineered cells expressing GOI (bottom panel). The TERS-encoded element was exchanged for the TEDV-encoded element. Thus, the derivative cell line expresses the TEDV-encoded CST as a TD-CST product on the cell surface, along with the original TERS-encoded TD (open / gray dumbbells) and GOI (squares marked with a mesh).

[0148] Overall, the execution of RMCE between TEDV and TERS results in the generation of derivative engineered cells that lose expression of the selected gene and TERS-encoded CST, and gain expression of TEDV-encoded CST and GOI.

[0149] Fig. 2. Tag-exchange transfer vector ( TEDV ) Architecture

[0150] Schematic diagram of TEDV, illustrated as a linear structure with numbered boxes representing key elements of the structure architecture. This structure includes both a TEDV-encoded CST and a gene of interest (GOI).

[0151] 1) represents a 5' RMCE element encoded in a non-coding and 'non-functional' 3' intron fragment.

[0152] 2) represents the functional sequence of a 3' intron fragment including a branching point sequence, a polypyrimidine tube, and a 3' receptor splice site.

[0153] 3) represents an exon encoding a TEDV-encoded CST in the 5' to 3' direction.

[0154] 4) represents the transcription terminator sequence for the CST encoded in the 5' to 3' direction.

[0155] 5) represents the transcription terminator sequence for the GOI encoded from 3' to 5'.

[0156] 6) represents a sequence encoding a GOI in the 3' to 5' direction.

[0157] 7) represents a Kojak sequence for efficient translation initiation of GOI transcripts.

[0158] 8) represents the 3' RMCE factor.

[0159] Fig. 3. Tag-exchange receptor site ( TERS ) Open Architecture - Before Tag Exchange

[0160] Schematic diagram of TERS, depicted as a linear structure with boxes containing letters representing the core elements of the structure architecture. This structure includes both the TERS-encoded CST and the gene of interest (GOI).

[0161] a) Shows a Kojak sequence for efficient translation initiation of adjacent transmembrane domain (TD) / CST transcripts.

[0162] b) Represents an exon encoding a type 2 membrane scaffold protein domain.

[0163] c) Represents the 5' intron splice donor site.

[0164] d) Represents a 5' RMCE element encoded in a non-coding and 'non-functional' 3' intron fragment that is equivalent to and paired with the 5' RMCE element of TEDV.

[0165] e) Functional sequence of a 3' intron fragment including a branching point sequence, a polypyrimidine tube, and a 3' receptor splice site.

[0166] f) Represents an exon encoding a TERS-encoded CST in the 5' to 3' direction.

[0167] g) Shows the transcription terminator sequence for the CST encoded in the 5' to 3' direction.

[0168] h) Shows the transcription terminator sequence for the selected gene encoded from 3' to 5'.

[0169] i) Represents a sequence encoding a selected gene in the 3' to 5' direction.

[0170] j) Shows a Kojak sequence for efficient translation initiation of a selected gene transcript.

[0171] k) Represents the 3' RMCE factor.

[0172] x) Represents a 5' genomic element responsible for regulating the expression and tracking of CST transcripts. This genomic element contains at least a promoter sequence that drives CST expression.

[0173] y) Represents a 5' genomic element responsible for regulating the expression and tracking of CST transcripts. This genomic element contains at least a promoter sequence that drives CST expression.

[0174] Fig. 4. Derived engineered cell TERS exchange

[0175] Schematic diagram of the TERS locus after TEDV-encoded element and RMCE-mediated exchange. As illustrated in Fig. 1, the element encoded between adjacent RMCE sites of TEDV is exchanged with a sequence of equivalent architecture encoded between adjacent RMCE sites of TERS. This results in TERS exchange within the derived engineered cell line. Boxes labeled with letters and numbers represent key genetic elements as described in Figs. 2 and 3, respectively.

[0176] Fig. 5. Exchanged TEDV by-product

[0177] Schematic diagram of TEDV byproducts after RMCE-mediated exchange with TERS-encoded elements. As illustrated in Fig. 1, elements encoded between adjacent RMCE sites of TEDV are exchanged with sequences of equivalent architecture encoded between adjacent RMCE sites of TERS. This generates unstable exchanged TEDV byproducts during the generation of derived engineered cell lines. Boxes labeled with letters and numbers represent key genetic elements as described in Figs. 2 and 3, respectively.

[0178] Fig. 6. TERS' Integration into engineered cells

[0179] a) The engineered cell line population ACL-1163 was formed by incorporating a TERS cassette encoding the Myc epitope CST and RFP selection genes into the parent cell line ACL-128 via homology-induced recombination. Ten days after electroporation, cells were stained with anti-Myc antibodies and analyzed by flow cytometry for selection markers encoded by TERS, the Myc epitope CST, and RFP. The plot displays live single cells as RFP versus Myc, indicating that among the transfected cells, there is a population of transfected individuals showing high signals for both RFP and Myc (Q2 left panel) compared to parent cells (Q2 right panel). b) Cells with high RFP and Myc signals were selected and grown larger, and representative engineered ACL-1163 were analyzed by flow cytometry. The plot displays the RFP versus Myc parameters of gated live single cells. Monoclonal ACL-1163 has high RFP and Myc signals as expected (Q2).

[0180] Fig. 7. To generate derived engineered cells GOI's with tag exchange and delivery TEDV used RMCE's execution

[0181] Flp recombinase-mediated tag exchange was performed on ACL-1163 engineered cells. ACL-1163 cells harboring TERS encoding the RFP selector gene and the Myc epitope CST were transfected with a construct encoding flp recombinase and TEDV encoding the SBP epitope CST and GOI. Seven days after electroporation, cells were stained with anti-Myc and anti-SBP antibodies and analyzed by flow cytometry for RFP, Myc, and SBP signals. Cells displaying reduced RFP and Myc signals but high signals for SBP surface expression were sorted and expanded into monoclones. a and b) Contour plots showing representative derived engineered cell monoclones ACL-3426 (left) compared to parent cells (right). Derived cells show a loss of RFP and Myc signals (Q4 top left panel) compared to parent cells (Q4 top right panel). The derived engineered cell monoclonal ACL-3426 successfully expresses the TEDV-encoded SBP epitope CST, as indicated by a signal increase upon staining with the anti-SBP antibody (Q5 bottom right panel). These results suggest that Flp recombinase-mediated tag exchange successfully performed on ACL-3426 cells resulted in the loss of signals for RFP and Myc markers and the acquisition of SBP surface expression, as expected due to the tag-exchange of CSTs between TERS and TEDV. c) Immunoblots showing three examples of expression of integrated GOIs with C-terminal FLAG tags. Detection of GOI (RSV-1 ORF) expression was achieved by immunoblotting using antibodies against the flag tags. The parental monoclonal line ACL-1163 is included as a control.CSTE was performed in three independent experiments, thereby transfecting cells with a construct encoding flp recombinase; and a TEDV encoding the SBP epitope CST and RSV-1 P gene (the generated cell line monoclone was ACL-3374); or a TEDV encoding the SBP epitope CST and RSV-1 N gene (the generated cell line monoclone was ACL-3386); or a TEDV encoding the SBP epitope CST and RSV-1 M2 long gene (the generated cell line monoclone was ACL-3433). Proteins were extracted from the monoclones, and immunoblotting was performed using mouse anti-Flag antibodies. Western blot results demonstrated that each RSV-1 ORF was expressed, as evidenced by the presence of a single band in each corresponding cell corresponding to the expected molecular weight of each GOI, and the absence of a signal in the parent cell line.

[0182] Fig. 8. From a mixed cell population after a successful tag exchange event Tag 2 (SBP) Self-attracting cell sorting (MACS) enrichment or Tag 1 (Myc)'s depletion

[0183] This figure indicates that surface tagging technology can be used for MACS enrichment of cells carrying Tag 2 or depletion of cells carrying Tag 1 following a successful tag exchange event from a mixed population of cells. Starting mixed populations of two engineered monoclonal cell lines, namely APL-4535 and APL-3015, were used to enrich cells expressing Tag 2 (SBP) or deplete Tag 1 (Myc) using MACS following a successful tag exchange event. TERS in APL-4535 cells encoded the full-length FLAG tag GOI encoding the SBP epitope CST and intracellular protein; meanwhile, TERS in APL-3015 cells encoded the Myc epitope CST and RFP selector gene. Two cell populations were mixed together at a ratio of 90% (APL-3015) to 10% (APL-4535), and SBP-positive cells were enriched using MACS (a) or Myc-positive cells were depleted in a separate experiment (b). a) All cells were labeled with the anti-SBP-Alexa 488 fluorescence tag and incubated with anti-mouse IgG iron beads. Samples were passed through MACS, and fractions were obtained at three experimental time points: before enrichment, flow through, and binding. All three fractions were counterstained with anti-c-Myc-Alexa 405, and data were collected using a BD Influx instrument. The graph shows the percentage of SBP and Myc-positive cells in all three experimental fractions. The pre-MACS fraction indicates that the starting cell population consisted of 90% Myc-positive cells and 10% SBP-positive cells. Successful enrichment of SBP-positive cells was evidenced by the absence of SBP signaling in the passing fraction (greater than 0.01% of SBP-positive cells), while 95% of the combined cells after SBP-targeted enrichment were SBP-positive. b) In a separate experiment, all cells were labeled with anti-c-Myc-Alexa 405 fluorescence and incubated with anti-mouse IgG iron beads.Labeled cells were depleted using MACS, and fractions were collected at the three experimental time points as described above. All three fractions were counterstained with anti-SBP-Alexa 488, and data were acquired using a BD Influx instrument. The graph shows the percentage of SBP and Myc-positive cells after Myc-targeted depletion in all three experimental fractions. The pre-MACS fraction again indicated that the starting cell population consisted of 90% Myc-positive cells and 10% SBP-positive cells. Successful depletion of Myc-positive cells was demonstrated by a decrease in the number of Myc-positive cells (25%) and an increase in the number of SBP-positive cells (75%) in the pass fraction. Additionally, the combined fraction contained more than 90% Myc-positive cells and less than 5% SBP-positive cells. c) A total of 546 positively stained individual monoclones were evaluated for whether they encode SBP-linked GOIs. The chart shows that 96.52% of SBP-positive cells incorporated GOI, while 3.48% of SBP-positive cells did not encode GOI.

[0184] The results demonstrate that MACS can be used to enrich tag 2 (SBP)-positive cells or deplete tag 1 (Myc)-positive cells from a mixed population of cells. Additionally, the presence of tag 2 (SBP) can be used as an indicator of successful tag exchange and GOI genome integration.

[0185] Fig. 9. Cell surface tag exchange using a barcode ( CSTE System configuration and operation

[0186] Schematic diagram of a CSTE system using barcodes. a) illustrates the components of a tag exchange donor vector (TEDV). Each TEDV encodes RMCEs (open and closed triangles) at both ends of the structure, which are paired with RMCE sites contained within TERS. At the 5' end of the TEDV structure, the RMCE element (closed triangle) is encoded within a sequence representing a 3' intron fragment, where the 3' element of the intron (open circle) containing a branching sequence, a polypyrimidine tube, and a splice receptor site is located right next to the 3' of the RMCE element. Right next to the 3' of the splice receptor site, the TEDV encodes the 3' exon of the cell surface tag (CST), meaning that the exon encodes a portion of the CST (gray rectangle) containing a unique molecular binding motif. The CST sequence is encoded in the 5' to 3' direction, where TEDV also encodes the gene of interest (GOI) (rectangle marked with a grid) to be incorporated into the TERS encoded in the 3' to 5' direction.

[0187] In this embodiment, each CST consists of two different epitopes selected from three potential unique epitopes (A, B, C), which can be combined into six possible unique combinations. AB is substantially equivalent to BA. In this embodiment, the AX combination was assigned to the GOI family, which has three variants (GOI ai, a-ii, and a-iii), and the BX combination was assigned to the second GOI family, which has three variants (GOI bi, b-ii, and b-iii). In this embodiment, individual TEDVs are pooled. b) illustrates the components of the tag-exchange receptor site (TERS). The TERS RMCE elements are paired with elements of the TEDV (open and closed triangles). TERS encodes a CST exon distinct from that of the TEDV-encoded CST (checkered rectangle) by utilizing the splice receptor site immediately adjacent to the 5' end of this CST and the associated 3' intronic sequence (open circle). Similarly, the selection gene (closed rectangle) is encoded in the antisense direction within the TERS, just like the GOI of TEDV. At the 5' end of the construct, a promoter sequence is included (right arrow) to drive the transcription of the CST. For the 3' end of this promoter sequence, a transmembrane domain (TD) exon is encoded (open rectangle) using the 5' intronic sequence immediately adjacent to the 3' end (closed circle). The TERS-encoded TD-CST product (open / checkered dumbbell) is expressed on the cell surface. At the 3' end of the TERS construct, there is a separate promoter element that drives the transcription of the selected gene (closed rectangle) in the 3' to 5' direction, which results in the expression of the selected gene (closed square). c) illustrates that when a TEDV pool is introduced into an engineered cell population containing TERS along with an appropriate expression construct for a recombinase specific to the RMCE element paired with TEDV / TERS, RMCE is executed, resulting in the generation of a derived engineered cell population expressing various GOIs.During RMCE, TERS-encoded elements are exchanged for TEDV-encoded elements. Thus, the derived cell population expresses TEDV-encoded CSTs on the cell surface as TD-CST products, along with the original TERS-encoded TDs (open / gray dumbbells) and GOIs (squares marked with reticular lines). d) After RMCE, the pool of engineered cells expressing GOIs can be further isolated into individual members via FACS based on the expression of unique CST barcodes. This can be achieved by isolating a large population of the desired barcodes or by isolating individual cells through a single-cell sorting method. Alternatively, analysis of the pool can be performed via FACS without sorting using barcodes as a means to identify populations of interest within a digital dataset. e) As a demonstration of the principle of using a CSTE system to barcode engineered cells, ACL-5 and ACL-1 cells were transfected using chemical transfection (ACL-5) or electroporation (ACL-1) using standard methods known to those skilled in the art, with a plasmid encoding CST or a control plasmid without CST. CST contained three unique epitopes, namely FLAG, MYC, and HA (indicated by sequence number 20). 48 hours after transfection, cells were harvested and stained with fluorophore-conjugated homologous antibodies, namely anti-FLAG-PE, anti-MYC-AF647, and anti-HA-AF488. Cells were analyzed by flow cytometry; live cells were gated by forward scatter (FSC) and side scatter (SSC). The mean fluorescence intensity (MFI) of live cells was determined for each of the three epitopes, and the percentage of live cells expressing each epitope was determined. All three epitopes were detected at a high rate and intensity in cells transfected with a plasmid encoding the barcoded CST compared to an empty vector, thereby demonstrating the ability of the CST composed of multiple epitopes.

[0188] The following list of non-limiting embodiments further illustrates the invention:

[0189] 1. A combination system comprising two separate components, wherein the first component is a tag-exchange donor vector (TEDV) encoding a first cell surface tag (CST) exon adjacent to a 3' intron fragment and a gene of interest (GOI) in the antisense direction, and the second component is an engineered cell comprising a second CST exon whose entire intron sequence is adjacent to an exon encoding a transmembrane domain, and also a tag-exchange receptor site (TERS) in the genome encoding a reporter gene in the antisense direction, and a paired recombinase-mediated cassette exchange (RMCE) element is included in the TEDV and TERS, and performing RMCE between the TEDV and TERS results in the exchange of the reporter element to the GOI encoded by the TEDV, and the exchange of the first CST exon to the second CST exon, so that the derived engineered cell now expresses the first CST and GOI instead of the second CST and reporter gene.

[0190] 2. A combination system in which, in embodiment 1, the first cell surface tag (CST) exon is different from the second CST.

[0191] 3. In embodiment 1 or 2, the first component is,

[0192] a. First RMCE element

[0193] b. 3' intron fragment

[0194] c. CST exon

[0195] d. 1st Warrior Terminator

[0196] e. Second Warrior Terminator

[0197] f. GOI

[0198] g. Kojak sequence

[0199] h. Second RMCE element

[0200] TEDV including,

[0201] A combination system in which the CST exon and the first transcription terminator are encoded in the antisense direction from the GOI and associated transcription terminator and the Kojak sequence.

[0202] 4. In any one of embodiments 1 to 3, the first component is,

[0203] a. 1st RMCE element – ​​5' RMCE element encoded in a non-coding and 'non-functional' 3' intron fragment

[0204] b. A 3' intron fragment containing a branching point sequence, a polypyrimidine tube, and a 3' receptor splice site

[0205] c. Exon containing TEDV-encoded CST in the 5' to 3' direction

[0206] d. First transcription terminator sequence for the CST encoded in the 5' to 3' direction

[0207] e. Second transcription terminator for GOI encoded from 3' to 5'

[0208] f. Sequence encoding a GOI in the 3' to 5' direction

[0209] g. Kojak sequence

[0210] h. 5' RMCE element

[0211] It is a TEDV that includes,

[0212] Here, the CST exon and the first transcription terminator are encoded in the antisense direction from the GOI and the associated transcription terminator and the Kojak sequence, in a combination system.

[0213] 5. In any one of embodiments 1 to 3, the first component is,

[0214] a. First RMCE element

[0215] b. 3' intron fragment

[0216] c. CST exon

[0217] d. 1st Warrior Terminator

[0218] e. Second Warrior Terminator

[0219] f. GOI

[0220] g. Kojak sequence

[0221] h. Second RMCE element

[0222] It is a TEDV that includes,

[0223] Here, the CST exon and the first transcription terminator are encoded in the antisense direction from the GOI and the associated transcription terminator and the Kojak sequence, in a combination system.

[0224] 6. In any one of embodiments 1 to 5, the second component is,

[0225] a. Trans-promoter element

[0226] b. Kojak hierarchy

[0227] c. Membrane-penetrating domain exon

[0228] d. Intron

[0229] e. First RMCE factor

[0230] f. CST exon

[0231] g. First Warrior Terminator

[0232] h. Second Warrior Terminator

[0233] i. Reporter gene

[0234] j. Kojak sequence

[0235] k. Second RMCE factor

[0236] l. Second Warrior Promoter Element

[0237] A TERS that includes,

[0238] A combination system in which a transmembrane domain exon and a CST exon are encoded from a reporter gene toward antisense, a first transcription promoter element drives the transcription of the combined transmembrane domain and CST, and a second transcription promoter element drives the transcription of the reporter gene.

[0239] 7. In any one of embodiments 1 to 6, the second component is,

[0240] a. Trans-promoter element

[0241] b. Kojak hierarchy

[0242] c. Type 2 membrane protein transmembrane domain exon

[0243] d. 5' intron splice donor site

[0244] e. A 5' RMCE element encoded in a non-coding and 'non-functional' 3' intron fragment that is equivalent to and paired with the 5' RMCE element of TEDV

[0245] f. Functional sequence of a 3' intron fragment including a branching point sequence, a polypyrimidine tube, and a 3' receptor splice site

[0246] g. Exon containing TERS-encoded CST in the 5' to 3' direction (different from TEDV-encoded CST)

[0247] h. Transcription terminator sequence for CST encoded in the 5' to 3' direction

[0248] i. Warrior terminator sequence for the 3' to 5' direction

[0249] j. Sequence encoding the selected gene in the 3' to 5' direction

[0250] k. Kojak sequence for efficient translation initiation of selected gene transcripts

[0251] l. 3' RMCE element

[0252] m. 3' genomic element responsible for regulating and tracking CST transcript expression

[0253] It is a TERS that includes,

[0254] Here, a transmembrane domain exon and a CST exon are encoded from a reporter gene toward antisense, a first transcription promoter element drives the transcription of the combined transmembrane domain and CST, and a second transcription promoter element drives the transcription of the reporter gene, a combination system.

[0255] 8. In any one of embodiments 1 to 6, the second component is,

[0256] a. Trans-promoter element

[0257] b. Kojak hierarchy

[0258] c. Membrane-penetrating domain exon

[0259] d. Intron

[0260] e. First RMCE factor

[0261] f. CST exon

[0262] g. First Warrior Terminator

[0263] h. Second Warrior Terminator

[0264] i. Reporter gene

[0265] j. Kojak sequence

[0266] k. Second RMCE factor

[0267] l. Second Warrior Promoter Element

[0268] It is a TERS that includes,

[0269] Here, a transmembrane domain exon and a CST exon are encoded from a reporter gene toward antisense, a first transcription promoter element drives the transcription of the combined transmembrane domain and CST, and a second transcription promoter element drives the transcription of the reporter gene, a combination system.

[0270] 9. A combination system in any one of embodiments 1 to 8, wherein the first RMCE element of the TEDV is paired with the first RMCE element of the TERS, and the second RMCE element of the TEDV is paired with the second RMCE element of the TERS.

[0271] 10. In any one of embodiments 1 to 9, each CST exon comprises a sequence encoding one or more molecular affinity tags, and the CST encoded by TEDV and TERS is a different combination system.

[0272] 11. A combination system in any one of embodiments 1 to 10, wherein the engineered cell comprises a single TERS in its genome.

[0273] 12. A method for generating derived engineered cells expressing a TEDV-encoded GOI from a TERS locus,

[0274] a. Step to generate a TEDV encoding the GOI

[0275] b. A step of delivering the TEDV to an engineered cell line comprising a paired TERS, together with a recombinant enzyme matching an internally encoded RMCE element.

[0276] c. A step of contacting cells with two or more affinity reagents specific to both TEDV-encoded CSTs and TERS-encoded CSTs.

[0277] d. A step of selecting derived engineered cells based on reduced expression of a reporter gene and TERS-encoded CST, and increased expression of TEDV-encoded CST, as a proxy for selecting cells having an integrated GOI.

[0278] A method including

[0279] 13. A method according to embodiment 12, wherein the affinity reagent used in step c. is fluorescently labeled to detect a decrease in the expression of TERS-encoded CST and an increase in the expression of TEDV-encoded CST, thereby enabling cell division and selection based on said expression by fluorescently activated cell sorting.

[0280] 14. A method according to embodiment 12, wherein the affinity reagent used in step c. is immobilized on a substrate, so that cells expressing TERS-encoded CST in a target cell population can be depleted or cells expressing TEDV-encoded CST can be enriched using a substrate affinity method, such as self-activating cell sorting.

[0281] 15. A method for generating multiple derivative engineered cells expressing various TEDV-encoded GOIs from a pool of TEDV,

[0282] a. A step of generating a library of two or more TEDVs, each encoding a unique GOI sequence and having a unique TEDV-encoded CST.

[0283] b. A step of delivering the library of TEDV as a pool to an engineered cell line containing paired TERS, together with a recombinant enzyme matching the internally encoded RMCE element.

[0284] c. A step of contacting cells with three or more affinity reagents specific to both multiple TEDV-encoded CSTs and TERS-encoded CSTs.

[0285] d. A step of selecting derived engineered cells based on the decrease in expression of the reporter gene and TERS-encoded CST, and the increase in expression of each unique TEDV-encoded CST.

[0286] A method including

[0287] 16. A method for tracing the cell lineage of derivative engineered cells expressing various TEDV-encoded GOIs within a pool of cells generated by steps a. and b. of Embodiment 15, wherein

[0288] a. A step of contacting cells with two or more affinity reagents specific to multiple TEDV-encoded CSTs.

[0289] b. A step of analyzing the content of derived engineered cells based on the expression of each unique TEDV-encoded CST.

[0290] A method including

[0291] 17. - A step of generating a library of two or more TEDVs, each encoding a unique GOI sequence and having a unique TEDV-encoded CST.

[0292] - A step of delivering the library of TEDV as a pool to an engineered cell line containing paired TERS, together with a recombinant enzyme matching the internally encoded RMCE element.

[0293] As a cell lineage tracking method for derivative engineered cells expressing various TEDV-encoded GOIs within a pool of cells generated by,

[0294] The above method

[0295] a. A step of contacting cells with two or more affinity reagents specific to multiple TEDV-encoded CSTs.

[0296] b. A step of analyzing the content of derived engineered cells based on the expression of each unique TEDV-encoded CST.

[0297] A method including

[0298] 18. A tag-exchange donor vector (TEDV) encoding a cell surface tag (CST) exon adjacent to a 3' intron fragment and a gene of interest (GOI) in the antisense direction.

[0299] 19. In embodiment 18,

[0300] a. First RMCE element

[0301] b. 3' intron fragment

[0302] c. CST exon

[0303] d. 1st Warrior Terminator

[0304] e. Second Warrior Terminator

[0305] f. GOI

[0306] g. Kojak sequence

[0307] h. Second RMCE element

[0308] Includes,

[0309] A tag-exchange donor vector (TEDV) in which the CST exon and the first transcription terminator are encoded in the antisense direction from the GOI and the associated transcription terminator and the Kojak sequence.

[0310] 20. A engineered cell comprising, in its genome, a cell surface tag (CST) exon whose entire intron sequence encodes an exon encoding a transmembrane domain, and a tag-exchange receptor site (TERS) encoding a reporter gene in the antisense direction, wherein a recombinase-mediated cassette exchange (RMCE) element is included in the TERS, and performing RMCE between the TERS and a tag-exchange donor vector (TEDV) results in the exchange of the reporter element for the gene of interest (GOI) encoded by the TEDV.

[0311] 21. In embodiment 20, the TERS is,

[0312] a. Trans-promoter element

[0313] b. Kojak hierarchy

[0314] c. Membrane-penetrating domain exon

[0315] d. Intron

[0316] e. First RMCE factor

[0317] f. CST exon

[0318] g. First Warrior Terminator

[0319] h. Second Warrior Terminator

[0320] i. Reporter gene

[0321] j. Kojak sequence

[0322] k. Second RMCE factor

[0323] l. Second Warrior Promoter Element

[0324] Includes,

[0325] An engineered cell in which a transmembrane domain exon and a CST exon are encoded in the antisense direction from a reporter gene, wherein a first transcription promoter element drives the transcription of the combined transmembrane domain and CST, and a second transcription promoter element drives the transcription of the reporter gene.

[0326] Materials and Methods

[0327] Manipulated cell line TERS' Integration

[0328] DNA constructs necessary to generate engineered cells using a single TERS site integrated into the AAVS1 site by homology-induced recombination were delivered using electroporation.

[0329] For each reaction, 4×10⁶ of Glutamax-I (Life Technologies) in 500 µl RPMI 1640 using a Gene Pulser Xcell (trademark) (Bio-Rad) with the following settings: Square Wave 285 V, pulse length 12.5 ms, and 2 pulses at a 1 s interval. 6Canine cells were electroporated. The DNA concentrations used were 15 µg / µl for the TERS integration vector (V9.F.5), 10 µg / ml for the Cas9-P2A-GFP encoding plasmid (V1.A.8), and 7.5 µg / ml for the vector encoding gRNA targeting the integration site AAVS1 region (V2.J.6). (Table 3) .

[0330] After electroporation, cells were incubated for 2 days in culture medium RPMI 1640 with Glutamax-I + 10% FBS (37℃, 5% CO2) before analysis.

[0331] polyclonal GFP - Classification of expressing transfected cells

[0332] Using a FACSJAzz (trademark) cell sorter (BD Biosciences), cells electroporated with Cas9-P2A-GFP (V1.A.8) or a plasmid encoding a GFP selection marker (V1.A.4) for transient GFP expression were sorted. Cells were washed and resuspended in an appropriate volume of DPBS, then sorted in RPMI 1640 containing Glutamax-I with 20% HI-FBS and anti-anti 100X (Life Technologies).

[0333] TERS' Classification of monoclonal cells using stable expression

[0334] Single cells constitutively expressing Myc epitope CST and RFP selector genes expressed from TERS receptor cassettes were obtained using FACS. To detect Myc CST, cells were stained with an anti-Myc antibody (anti-c-Myc-Alexa 647, Santa Cruz) prior to sorting. After washing the cells in DPBS, they were sorted in RPMI 1640 containing Glutamax-I with 20% HI-FBS and anti-anti-100X (Life Technologies).

[0335] vector ID designation V1.A.8 SpCas9-2A-GFP V9.F.5 AAVS-EF1aL-TxnCS-S-STv5a_G-in:FRT:MYC-RFP:F3-EF1a V2.J.6 AAVSI_sg-sp-opti_3 V12.A.8 M2-gene-Long_RSV1-FLAG_Tx V4.I.8 CMVpro_FLPo-sv40pA-V2

[0336] Table 4 GFP and RFP fluorescence were detected in Influx (trademark) (BD Biosciences) FACS for the filter sets listed in [document]. A set of monoclonals was grown by sorting single cells expressing Myc and RFP into a 96-well plate containing 200 µl of growth medium.

[0337] FACS Jazz and Influx filter protein fluorescent dye Here's the laser Detection filter Cas9 / GFP GFP 488 530 / 40 RFP RFP 561 585 / 29 Myc Alexa 647 640 670 / 30 Myc PE 561 585 / 29 SBP Alexa 647 640 670 / 30 SBP Alexa 488 488 530 / 40 Myc Alexa 405 405 460 / 50 Flag PE 561 585 / 29 HA Alexa 488 488 530 / 40

[0338] monoclonal Group phenotypic screening

[0339] Samples of an overgrown monoclonal population of 20,000 cells were transferred to a microtiter plate for analysis, and the cells were resuspended in 250 µl of DPBS 1× (Life Technologies) and analyzed on an LRS Fortessa (trademark) (BD Biosciences). The monoclonal population (ACL-1163) was screened for the presence of Myc epitopes CST and RFP. Myc expression was detected using an anti-Myc antibody labeled with Alexa Fluor 647 fluorescence. The staining solution was prepared using the recommended antibody volume diluted in 100 µl of staining buffer (DPBS + 2% FBS). Cells were incubated at 4°C for 1 hour and then washed twice with 500 µl of staining buffer prior to analysis.

[0340] Monoclonal Genotype Screening - Confirmation of Integration at Precise Genomic Locations

[0341] ACL-1163 cells were maintained in RPMI 1640 normal growth medium with Glutamax-I + 10% HI-FBS. Cell confluence was 10 to 12 × 10⁻⁶ 6 Cell confluence was monitored daily until it was reached. Using the QIAamp DNA Minikit (Qiagen), 5×10 6DNA was extracted from dog cells. The remaining cells were further expanded and 3×10⁶ were placed in 70% growth medium + 20% HI-FBS + 10% DMSO. 6 It was cryopreserved at a density of cells / mL.

[0342] ACL-1163 monoclones were screened and evaluated at the molecular level, which was performed by PCR using Q5 (registered trademark) Hot Start High-Fidelity DNA Polymerase (NEB) in 20 µl of reactants, using the components and reaction conditions listed in Tables 5 and 6, respectively. To determine whether the TERS integration cassette was integrated into the AACS1 locus, primers 15.F.9 and 19.E.7 were used, targeting the anterior region and transmembrane domain of the left homologous arm, respectively. (Table 7) Precise left-sided homologous cancer recombination was indicated using a 2.1 kb amplicon. Initially, a PCR Master Mix was prepared using all components (Q5 (trademark) reaction buffer, dNTPs, Hot-Start Q5 (trademark) DNA polymerase, forward and reverse primers, 100 ng of DNA template, and H2O). The PCR reaction was performed using a C1000 Touch (trademark) temperature cycler (Bio-Rad). The PCR products were run on a 1% agarose gel in 1×TAE buffer using PowerPac Basic (Bio-Rad), stained with a 10,000-fold dilution of CyberSafe, and analyzed with Fusion SL (Vilber Lourmat).

[0343] TERS' To evaluate integration PCR reagent Reaction components Volume per reaction 5x Fusion Buffer (Phusion buffer) 4㎕ DNTP 0.2㎕ Fusion DNA polymerase 0.15㎕ 15.F.9 0.5㎕ 19.E.7 0.5㎕ H20 Max. 20 µl DNA(100 ng) 1 µl (100 ng / µl) DMSO 3% 0.6㎕

[0344] PCR cycle conditions step temperature hour Early degeneration 98℃ 30 seconds 30 cycles 98℃62℃72℃ 10 seconds 1:10 minutes 15 seconds Final extension 72℃ 10 minutes

[0345] primer ID designation order 1.I.7 turboRFP_GT_F1 GAGAGGCCATTCTCAGATGG 1.I.8 turboRFP_GT_R1 CGGGCATCTTCAGGTTCTTG 1.I.9 turboRFP_Probe_FAM CTACCTGCACTGCTCCTTCAAGACC 10.A.10 TRAC_TCRA-Promoter_F1 CTGATCCTCTTGTCCCACAGATA 10.B.6 TRAC_Probe(HEX) ATCCAGAACCCTGACCCTGCCG 15.F.9 AAVS1_GT_F5 ACTCTGCCCTCTAACGCTG 19.E.7 AMPN-TMD_GT_R1 GCTGATGTAGAAGCCCTTGG 21.G.5 ORF-AM_GT_F2 TTCTGTAGCTCCATTGGCAG 21.G.8 ORF-AM_GT_R1 ATCCGTATGGTGACAAGACG

[0346] Check gene duplication number

[0347] Selected monoclonal DNA was evaluated against multiple TERS cassettes integrated within the cell genome. To achieve this, Droplet Digital PCR (ddPCR) was performed using primers and probes specific to the TERS cassette and the reference gene (TRAC). (Table 8) TERS-specific probes were conjugated to FAM, and reference gene-specific probes were conjugated to HEX. The conjugation copy numbers accounted for the fact that ACL-1163 cells are diploid with respect to the reference gene (TRAC). Prior to ddPCR, DNA was digested using MfeI (NEB) to separate tandem conjugates. Reaction setup and cycling conditions followed the protocol for ddPCR Supermix (without dUTP) (Bio-Rad) for probes, using a QX200 (trademark) droplet reader and droplet generator and a C1000 Touch (trademark) deep-well temperature cycler (Bio-Rad). Data were acquired using QuantaSoft (trademark) software, with Ch1 used for FAM detection and Ch2 used for HEX.

[0348] ddPCR primer / probe ID designation order 1.I.7 Turbo RFP_GT_F1 GAGAGGCCATTCTCAGATGG 1.I.8 TurboRFP_GT_R1 CGGGCATCTTCAGGTTCTTG 1.I.9 TurboRFP_Probe_FAM CTACCTGCACTGCTCCTTCAAGACC 10.A.9 TRAC-TCRA-ex1-F1 CTGATCCTCTTGTCCCACAGATA 10.A.10 TRAC-TCRA-ex1-F1 GACTTGTCACTGGATTTAGAGTCTCT 10.B.6 TRAC-Probe (HEX) ATCCAGAACCCTGACCCTGCCG

[0349] In derived engineered cell lines GOI hierarchy Flp -Mediated Integration

[0350] DNA constructs necessary to facilitate Flp recombinase-mediated tag exchange were delivered using electroporation. Per reaction, 4×10⁶ DNA constructs were delivered in 500 µl of RPMI 1640 containing Glutamax-I (Life Technologies) using a Gene Pulsar EXCELL (trademark) (Bio-Rad) with the following setup. 6Canine cells were electroporated: square wave 285 V, pulse length 12.5 ms, and 2 pulses with a 1 s interval. The DNA concentrations used were 7.5 µg / µl for the TEDV vector (V9.F.5), 10 µg / mL for the FLPO encoding plasmid (V12.A.8), and 7.5 µg / mL for the GFP encoding vector (V1.A.4) for tracking DNA delivery. (graph 3) .

[0351] After electroporation, cells were incubated for 2 days in culture medium RPMI 1640 containing Glutamax-I + 10% FBS (37℃, 5% CO2) before analysis and cell sorting of GFP-positive cells.

[0352] Phenotype for tag exchange

[0353] To determine whether Flp recombinase-mediated tag exchange occurred, cells were stained for surface expression of Myc and SBP and measured for RFP fluorescence intensity.

[0354] After 7 to 10 days of electroporation, cells were harvested and surface stained for SBP and Myc using the following antibodies (anti-SBP-Alexa647 and anti-c-Myc-AlexaPE, Santa Cruz). Table 4 GFP and RFP fluorescence were detected in Influx (trademark) (BD Bioscience) FACS for the filter sets listed in [here].

[0355] A monoclonal set of single cells expressing SBP but not Myc and RFP was grown by sorting them into a 96-well plate containing 200 µl of growth medium.

[0356] Single cells were sorted, and monoclonal phenotypes were performed after 20 to 24 days. For flow cytometry, cells were transferred from wells, and 300 µl of RPMI was added per tube. Cells were centrifuged at 400 g for 3 minutes at 4°C. The supernatant was aspirated, and the cell pellet was resuspended in 25 µl of staining mixture or RPMI (unstained control) (staining mixture: anti-SBP-Alexa647 and anti-c-Myc-AlexaPE), followed by incubation at 4°C for 30 minutes. Cells were washed twice with staining buffer (SB) (DBPS + 2% FBS) and centrifuged at 400 g for 3 minutes. Cells were resuspended in 200 µl of SB and transferred to 96-well plates for data acquisition on an LSRFortessa. Analysis was performed using a FlowJo.

[0357] Confirmation of GOI expression

[0358] After growing and harvesting the cells, the cells were lysed on a rotor at 4°C for 20 minutes using 150 mM NaCl, 50 mM Tris pH 8, 1% CHAPS, 5 mM imidazole, 1 mM PMSF, and a 1× protease and phosphatase inhibitor (Thermo). The lysate was removed by centrifugation at 17,000 g for 10 minutes at 4°C, and sodium dodecyl sulfate (SDS) gel electrophoresis was performed on a 10% acrylamide pre-cast gel (Biorad) at 140 V for 1 hour. Cells were turboblotted onto a PVDF membrane (Bio-Rad), blocked in 1× Sea Block (Thermo) in 1× Tris-buffered saline / Tween 20 (TBST) for 15 minutes, and incubated with mouse anti-flag antibody (Sigma) at room temperature for 2 hours. The membrane was washed with 3× of unbound primary antibody in 1× TBST for 5 minutes and incubated with anti-mouse horseradish peroxidase (HRP)-conjugated goat antibody at room temperature for 1 hour. Finally, the membrane was washed with 3× of unbound secondary antibody in 1× TBST for 5 minutes, and the HRP signal was developed on an ECL substrate (Bio-Rad) and acquired using a Fusion SL Vilber system.

[0359] GOI Genome Integration Verification

[0360] To co-integrate the GOI coding sequence, monoclonal cell lines expressing cell surface tag 2 (SBP) were evaluated at the molecular level. This was performed by PCR using Q5 (trademark) hot start high-accuracy DNA polymerase (NEB) in 30 µl reactants, using the components and reaction conditions listed in Tables 9 and 10, respectively. To determine whether the GOI was integrated into the genome, primers 12.G.5 and 21.G.8 targeting the 3' UTR region of the GOI were used. (Table 7) Initially, a PCR master mix was prepared using all components (Q5 (trademark) reaction buffer, dNTPs, hot-start Q5 (trademark) DNA polymerase, forward and reverse primers, 100 ng of DNA template, and H2O). The PCR reaction was performed using a C1000 Touch (trademark) temperature cycler (Bio-Rad). The PCR products were run on a 1% agarose gel in 1×TAE buffer using PowerPack Basic (Bio-Rad), stained with a 10,000-fold dilution of CyberSafe, and analyzed with Fusion SL (Bilber Lumat). Bands of the correct size were identified by encoding the sequence of the GOI 3' UTR via Sanger sequencing.

[0361] PCR mix reagent Per / Reaction(µl) Master mix for 96 samples 5X Fusion HF Buffer 6 660 DNTP 0.3 33 Phusion Hot Star Pol 0.3 33 21.G.5 ORF-AM_GT_F2(100μM) Stock 0.15 55 21.G.8 ORF-AM_GT-R1(100μM) Stock 0.15 55 H20 20.4 2244 cell samples 2 NA

[0362] PCR conditions step temperature hour Cycle count Early degeneration 98℃ 30 seconds 1 denaturalization 98℃ 10 seconds 35 annealing 62℃ 20 seconds prolongation 72℃ 10 seconds Final extension 72℃ 5 minutes 1 maintain 12℃ maintain 1

[0363] MACS of cells expressing surface tags enrichment / depletion

[0364] Generally, the manufacturer's MACS protocol for enrichment / depletion was followed (Miltenyi Biotec, #130-047-101,IM0001377.PDF).

[0365] Sample preparation

[0366] Cells were harvested and washed once by centrifugation (300×g for 3 minutes at 4°C) in staining buffer-M (SB-M - cold Dulbecco phosphate-buffered saline (DPBS), 2% FBS, 2 mM EDTA). Cells resuspended in SB-M were filtered through a 40-µm cell straightener to obtain a single-cell suspension. Cells were washed with 3 mL of cold SB-M, and the cell pellet was collected. 80 µL of staining solution containing the appropriate antibody or dead cell removal reagent per 10 million cells was applied, and the samples were incubated at 4°C for 30 minutes. Cells were washed twice with 3 mL of SB-M buffer and pelleted.

[0367] self Bead Cover art

[0368] Cells were resuspended in 160 µl of SB-M, and pelleted cells were labeled with magnetic beads upon the addition of anti-mouse IgG1 MACS micro beads (Miltenny) (40 µl of MACS micro beads were added per 10 million cells). After incubation at 4°C for 20 minutes, the cells were washed with 3 ml of SB-M and finally resuspended in 500 µl of SB-M.

[0369] Self-separation

[0370] The LS column (Milteny) was placed in the magnetic field of a suitable MACS separator (Milteny) and rinsed with 3 mL SB-M. The pre-MACS fraction was also collected. The cell suspension was added to the column, and the pass fraction containing unlabeled cells was collected into a 15 mL conical tube (referred to as the pass fraction). The column was removed from the separator and placed in a suitable collection tube. 5 mL SB-M was added to the column containing the magnetically labeled cells. Using the provided plunger, pressure was applied until the plunger reached the bottom of the column. The magnetically labeled cells were eluted from the column (referred to as the binding fraction), and the fraction was used for downstream application.

[0371] Examples 1 - Integration of TERS into engineered cell lines

[0372] This example describes the stable incorporation of TERS into a cell line to generate an engineered cell line monoclonal ACL-1163 containing a single TERS in its genome.

[0373] In this embodiment, the TERS presented as SEQ ID NO. 1 consists of the following selected genetic elements encoding two genes. The first gene encoded in the sense direction consists of an EF1a promoter upstream of an ORF encoded across two exons. The first exon encodes a transmembrane type II protein domain (TD), and the second exon encodes a Myc epitope tag. The intron between the two exons is derived from the human GAPDH gene and is modified to encode a first heterospecific FRT site (FRT) between the 5' intron splice donor site and the intron branching point sequence. The 3' end of the OFR encodes an SV40 polyadenylation signal terminator. The second gene encoded in the antisense direction consists of an EF1a promoter upstream of an ORF encoding an RFP, which is a fluorescent reporter. The region between the Kojak sequence and the promoter encodes a second heterospecific FRT site (F3). The 3' end of the RFP ORF encodes a bGHpA polyadenylation signal terminator.

[0374] To facilitate the stable genomic integration of TERS into the genomic safe harbor locus AAVS1, a plasmid was constructed in which the DNA elements of TERS were lateralized to the left and right homologous arms of AAVS1. Each arm consisted of a sequence of over 500 bp that was homologous to the AAVS1 genomic locus. The stable integration of TERS was achieved through the process of homology-induced recombination (HDR) at the genomic safe harbor locus AAVS1.

[0375] ACL-128 cell lines were transfected with plasmids encoding TERS genetic elements adjacent to left and right homologous cancers of AAVS1, plasmids encoding optimal gRNAs targeting AAVS1 loci, and plasmids encoding Cas9-P2A-GFP. Cells positive for uptake of the Cas9-P2A-GFP plasmid were sorted by FACS based on GFP fluorescence after 2 days. GFP-sorted cells were expanded for more than 7 days. TERS-transfected cells were stained with anti-Myc antibodies and analyzed by flow cytometry for the presence of RFP and Myc epitope CSTs (Fig. 6a). Cells incorporating TERS into their genomes exhibited increased RFP and Myc signaling. These cells were sorted and expanded to form a monoclonal set. ACL-1163, a representative monoclonal shown in Fig. 6b, exhibited constant and robust surface expression of RFP and Myc. To determine whether the genomic receiver cassette was incorporated into the targeted AAVS1 site, genomic DNA was extracted from selected ACL-1163 cell lines, and PCR reactions were performed using internal primers for the TERS receiver cassette and primers specific to the AAVS1 locus (15.F.9 and 19.E.7, see Table 7). PCR amplicons of the expected size were detected (data not shown). Additionally, ddPCR using primers and probes (forward primer 1.I.7, reverse primer 1.I.8, probe 1.I.9, see Table 8) confirmed that only a single copy of the TERS receiver cassette was incorporated (data not shown).

[0376] The generated engineered cell line ACL-1163 contained a single copy of TERS designed for RMCE using a suitably paired TEDV.

[0377] Examples 2- Execution of RMCE using TEDV with tag-exchange and delivery of GOI to generate derived engineered cells

[0378] This example demonstrates that the execution of the CSTE system, which is an RMCE-driven reaction between a TEDV-encoded sequence and TERS, results in the conversion of CST at the cell surface, reporting an exchanged construct incorporating the TEDV-encoded sequence and a cargo GOI. In this example, the ACL-1163 described above was used as the targeted engineered cell line.

[0379] In the present embodiment, the TEDV encodes a first heterospecific FRT site (FRT) in the sense direction; a 3' intron fragment comprising a branching point sequence, a polypyrimidine tube, and a 3' receptor splice site; an exon encoding a streptavidin binding peptide (SBP) and an SV40 polyadenylation signal terminator. Three individual GOIs derived from respiratory syncytial virus (RSV) are encoded in the antisense direction of the individual TEDV, and each GOI ORF is located between the second heterospecific FRT site (F3) and the 3' bGHpA polyadenylation signal terminator. The sequences of SEQ ID NOs 3 to 5 represent GOIs encoding three independent SBP epitope CSTs and the TEDV constructs used.

[0380] In this embodiment, the engineered cell line ACL-1163, constructed in Example 1, was electroporated with a vector (FLPO, V4.1.8, Table 3, SEQ No. 2) encoding the expression of TEDV (selected from the sequences of SEQ Nos. 3 to 5) and RMCE recombinant enzyme. Cells were incubated for 7 to 10 days to allow for the development of integrating couples, then stained with anti-Myc and anti-SBP antibodies and analyzed for RFP, Myc, and SBP reporter signals by flow cytometry. Cells exhibiting 'tag exchange'—where RFP and Myc signals decreased but SBP signals increased—were classified and expanded to show a set of monoclones. The characteristics of the representative monoclone, ACL-3426, are illustrated in Figures 7a and 7b. To confirm successful surface tag exchange, monoclonal ACL-3426 were stained with antibodies against Myc and SBP and analyzed by flow cytometry for the loss of RFP and surface Myc expression (Fig. 7a) and the acquisition of SBP signals (Fig. 7b). Indeed, cells that underwent CSTE demonstrated successful tag-exchange by displaying SBP but not Myc or RFP signals. Parent cells were analyzed simultaneously and consistently showed high signals for both RFP and Myc (Fig. 7a right panel) and low SBP signals (Fig. 7b right panel).

[0381] Following CSTE, to demonstrate that the GOI ORF is being incorporated and expressed, three monoclones from independent experiments were evaluated by immunoblotting using each of the aforementioned TEDVs encoding distinct RSV-1 GOIs (Fig. 7c). The GOI ORFs encoding each Flag-tag provided by the TEDV contained three RSV-1 derived genes: the P, N, and M2 genes (long). CSTE was performed, thereby evaluating the construct and TEDV encoding flp recombinase; the SBP epitope CST and RSV-1 P gene (the resulting cell line monoclone is ACL-3374); or the TEDV encoding the SBP epitope CST and RSV-1 N gene (the resulting cell line monoclone is ACL-3386); Alternatively, cells were transfected with TEDV encoding the SBP epitope CST and RSV-1 M2 long gene (the generated cell line monoclone was ACL-3433). Proteins were extracted from the monoclones, samples were immunoblotted using a mouse anti-Flag primary antibody, and then incubated with an anti-mouse horseradish peroxidase (HRP)-conjugated goat antibody. The HRP signal was developed using an ECL substrate. Successful CSTE was demonstrated by the presence of a single positive band for the flag with the expected molecular weight for each GOI (lanes 2 to 4 in Fig. 7c). Parent cells were analyzed concurrently and showed the absence of the Flag-tagged signal (lane 5 in Fig. 7c).

[0382] In summary, this example demonstrates that cell surface tag-exchange can be used to conditionally record the presence of an initial TERS construct and an exchanged construct containing a TEDV-encoded sequence at the time of RMCE execution, and to report GOI integration and expression independently of the detection of the GOI itself.

[0383] Examples 3- Self-affinity cell sorting (MACS) of Tag 2 (SBP) enrichment or Tag 1 (Myc) depletion from mixed-manipulated cell populations after a successful tag exchange event

[0384] This example demonstrates that surface tagging technology can be used for MACS enrichment of Tag 2 (SBP) or depletion of Tag 1 (Myc). Additionally, the presence of Tag 2 (SBP) can be used to monitor the inclusion of the gene of interest (GOI) after a successful tag exchange event. A starting mixed population of two engineered monoclonal cell lines, APL-3015 and APL-4535, was used. The cell population was mixed with 90% Myc-positive APL-3015 cells and 10% SBP-positive APL-4535 cells. The tag-exchange receptor sites (TERS) in APL-4535 cells encoded the full-length FLAG tag GOI encoding the SBP epitope CST and an intracellular protein, whereas the TERS in APL-3015 cells encoded the Myc epitope CST and an RFP selector gene. SBP-positive APL-4535 cells were enriched from a mixed population using self-affinity cell sorting (MACS). In a separate experiment, Myc-positive APL-3015 cells were depleted from a mixed population using MACS.

[0385] In the first case, a mixed cell population was labeled with the anti-SBP-Alexa 488 fluorescence and then incubated with anti-mouse IgG iron beads. SBP-labeled cells were enriched using MACS and counterstained with the anti-c-Myc-Alexa 405 fluorescence. Figure 8a illustrates the percentages of SBP and Myc-positive cells in three experimental steps: 1) a pre-MACS step to ensure the starting ratio of SBP and Myc-positive cells in the mixed cell population; 2) a pass step to evaluate the percentage of SBP and Myc-positive cells not captured by the MACS column when the column is in a magnetic field; and 3) a binding fraction step used to evaluate the percentage of SBP and Myc-positive cells captured by the MACS column. All three fractions were counterstained with the anti-c-Myc Alexa 405 fluorescence, and data were acquired using a BD influx instrument. Figure 8b demonstrated successful enrichment of SBP-positive cells due to the absence of SBP-positive cells in the passing fraction (<0.01), whereas 95% of the combined cells after SBP-targeted enrichment were SBP-positive.

[0386] To demonstrate the use of surface tagging technology to deplete MACS in primary cell lines expressing Tag 1 (Myc) from a mixed cell population, all cells were labeled with the anti-c-Myc-Alexa 405 fluorescence dye and incubated with anti-mouse IgG iron beads. The labeled cells were depleted using MACS, and the fractions were collected as shown. All three fractions were counterstained with anti-SBP-Alexa 488, and data were acquired using a BD Influx instrument. Successful depletion of Myc-positive cells was demonstrated by a decrease in the number of Myc-positive cells (25%) and an increase in the number of SBP-positive cells (75%) in the passing fractions.

[0387] Additionally, to demonstrate that the presence of Tag 2 (SBP) can be used as a reporter to monitor the inclusion of GOIs after a successful tag exchange event, a total of 546 individual SBP-positive monoclones were evaluated to determine whether they encoded SBP-linked GOIs. The chart in Figure 8c indicates that 96.52% of SBP-positive cells encoded GOIs, while 3.48% of SBP-positive cells did not express GOIs.

[0388] The results demonstrate that surface tagging technology is suitable for the enrichment of monoclones expressing Tag 2 (SBP) from mixed cell populations or the depletion of unmodified base lines (monoclones expressing Tag 1 (Myc)) after a successful tag exchange. Furthermore, the presence of Tag 2 (SBP) correlates with the inclusion of GOI after a successful tag exchange event; therefore, the presence of Tag 2 (SBP) on the cell surface can be used as an indicator that GOI has been successfully transferred into TERS within the engineered cell lines.

[0389] Examples 4 - Configuration and operation of a cell surface tag exchange (CSTE) system using barcodes.

[0390] This example illustrates a schematic diagram of the concept of using a CSTE system to barcode engineered cells expressing GOI.

[0391] FIG. 9 is a schematic diagram of using a CSTE system to barcode cells expressing GOI. Panels a and b illustrate the system components along with a pool of tag-exchange donor vectors (TEDV) and engineered cells containing tag-exchange recipient sites (TERS), respectively.

[0392] Each TEDV encodes RMCE elements at the 5' and 3' ends of the structure, said RMCE elements paired with RMCE sites contained within the TERS. The RMCE element at the 5' end of the TEDV structure is encoded within a sequence representing a 3' intron fragment, where the 3' element of the intron, including a branching sequence, a polypyrimidine tubule, and a splice receptor site, is located right next to the 3' of the RMCE element. Thus, the RMCE is contained within a 'non-functional' and non-coding intron sequence, and the 3' intron fragment contained within the TEDV does not have a 5' splice donor site. Right next to the 3' of the splice receptor site, the TEDV encodes the 3' exon of the cell surface tag (CST), which means that the exon encodes a portion of the CST containing a unique molecular binding motif. The CST sequence is encoded in the 5' to 3' direction, where TEDV also encodes a gene of interest (GOI) to be incorporated into a TERS encoded in the 3' to 5' direction.

[0393] In this embodiment, each CST consists of two different epitopes selected from three potential unique epitopes (A, B, C), which can be combined into six possible unique combinations. Since the arrangement of each epitope is difficult to distinguish using current techniques, AB is substantially equivalent to BA. In this embodiment, the AX combination was assigned to a GOI family with three variants (GOI ai, a-ii, and a-iii), and the BX combination was assigned to a second GOI family with three variants (GOI bi, b-ii, and b-iii). In this embodiment, individual TEDVs are pooled (Fig. 9a).

[0394] The central portion of the TERS contained within the engineered cells encodes elements that have the same architecture but are distinct from those of TEDV. Specifically, between the RMCE elements paired with those of TEDV, the TERS encodes a CST exon distinct from that of TEDV-encoded CST by utilizing the splice receptor site immediately adjacent to the 5' end of the TEDV-encoded CST and the associated 3' intronic sequence. Similarly, the selected gene is encoded in the antisense direction within the TERS, similar to the GOI of TEDV. At the 5' end of the construct, a promoter sequence is included to drive the transcription of the CST. For the 3' end of this promoter sequence, a transmembrane domain (TD) exon is encoded using the 5' intronic sequence immediately adjacent to the 3' end. This means that the intron-containing RMCE element and the TD exon and CST exon encoded within the frame are generated as a continuous transcript in which the exons are spliced ​​to be adjacent to each other in a single-coding mRNA. The TERS-encoded TD-CST product is expressed on the cell surface. At the 3' end of the TERS construct, there is a separate promoter element that drives the transcription of the selected gene in the 3' to 5' direction, which results in the expression of the selected gene (Fig. 9b).

[0395] When a TEDV pool is introduced into a population of engineered cells containing TERS along with an appropriate expression construct for a recombinase specific to the RMCE element paired with TEDV / TERS, the RMCE is executed, resulting in the generation of a pool of derived engineered cells expressing GOI (Fig. 9c). The TERS-encoded element was exchanged for the TEDV-encoded element. Thus, the derived engineered cells express the TEDV-encoded CST on the cell surface as a TD-CST product, along with the original TERS-encoded TD and GOI.

[0396] Overall, the execution of RMCE between the TEDV pool and TERS resulted in the generation of a derived pool of engineered cells that lost expression of the selected gene and the original TERS-encoded CST, with each cell in the pool having obtained expression of the TEDV-encoded CST and one of the GOI members from the TEDV pool. The pool of engineered cells expressing the GOI can be further analyzed / isolated into individual members by isolating them via FACS, for example, based on the expression of a unique CST barcode (Fig. 9d). This can be achieved by isolating a bulk population of the desired barcode, or by isolating individual cells, for example, through a single-cell sorting method. Alternatively, analysis of the pool can be performed via FACS without sorting, using the barcode as a means to identify populations of interest within the digital dataset, for example, along with a secondary analysis of cell function to correlate variant GOI expression or cell function.

[0397] To demonstrate the concept that CST can be composed of multiple epitopes, ACL-1 and ACL-5 cells were transfected with a plasmid encoding CST or a control plasmid without CST (Fig. 9e). CST consisted of three distinct epitopes, namely FLAG, MYC, and HA, represented by the sequence of SEQ ID NO. 20. Cells were transfected using chemical transfection (ACL-5) or electroporation (ACL-1) using standard methods known to those skilled in the art. After 48 hours, cells were harvested and stained with fluorophore-conjugated homologous antibodies, namely anti-FLAG-PE, anti-MYC-AF647, and anti-HA-AF488. Cells were analyzed by flow cytometry, and live cells were gated by forward scattering (FSC) and side scattering (SSC). The mean fluorescence intensity (MFI) of living cells was determined for each of the three epitopes, and the percentage of living cells expressing each epitope was determined. All three epitopes were detected at a high rate and intensity in cells in samples transfected with a plasmid encoding the barcoded CST compared to an empty vector, thereby demonstrating the ability of the CST composed of multiple epitopes.

[0398] The results demonstrate that surface tag technology is suitable for barcoding cell lines because CST can be composed of multiple epitopes.

[0399] List of abbreviations

[0400] AAVS1 Adeno-associated virus integration site 1

[0401] APC Antigen-presenting cells

[0402] Cas9 CRISPR-associated genes 9

[0403] CMV cytomegalovirus

[0404] cre Cre recombinase

[0405] CRISPR Clustered and regularly repeating short palindromic structured repeating sequences

[0406] CST Cell surface tags

[0407] CSTE Cell surface tag exchange

[0408] DMSO dimethyl sulfoxide

[0409] DNA Deoxyribonucleic acid

[0410] DPBS Dulbecco phosphate buffered saline

[0411] DSB double-strand damage

[0412] dUTP Deoxyuridine Triphosphate

[0413] EDTA Ethylenediaminetetraacetic acid

[0414] EF1 Alpha elongation factor alpha (for eukaryotic translation)

[0415] FACS Fluorescence-activated cell classification

[0416] FAM Fluoresane amidite

[0417] FBS fetal bovine serum

[0418] FLP Flippaje

[0419] FRT Flippaje recognition target

[0420] GFP green fluorescent protein

[0421] GOi. Genes of interest

[0422] gRNA Guide ribonucleic acid

[0423] HDR Homology-induced recombination

[0424] HLA Human leukocyte antigen

[0425] IRESInternal ribosome entry site

[0426] MACS Classification of self-activating cells

[0427] NEB New England Biolabs

[0428] NHEJ Non-homologous terminal suture

[0429] ORF Open Reading Frame

[0430] PCR polymerase chain reaction

[0431] RFP red fluorescent protein

[0432] RMCE Recombinase-mediated cassette exchange

[0433] RPMi. Roswell Park Memorial Institute

[0434] RSV Respiratory syncytial virus

[0435] RT Reverse Warrior

[0436] RNA Ribonucleic acid

[0437] SBP streptavidin-binding peptide

[0438] SSR Site-specific recombinant enzyme

[0439] SV40 40 primate viruses

[0440] SV40pA Primate virus 40 poly (A)

[0441] TAA Tumor-associated antigen

[0442] TALEN Warrior-like Effector Nuclease

[0443] TAE Tris-acetate-EDTA

[0444] T cells T lymphocytes

[0445] TCR T-cell receptor

[0446] TCS Target coding sequence

[0447] TD Membrane-penetrating domain

[0448] TEDV Tag-Exchange Donor Vector

[0449] TERS Tag-exchange receptor sites

[0450] rRNA Ribosome RNA

[0451] tRNA delivery RNA

[0452] UTR Non-translated section

[0453] ZNF Zinc finger nuclease

[0454] List of definitions

[0455] Amplicon : A fragment of DNA or RNA that is the source and / or product of artificial amplification using various methods including PCR.

[0456] antibodies : An affinity molecule containing two chains, expressed by specialized cells of the immune system called B cells. B cells generally do not bind to their own proteins but express a very large and diverse repertoire of antibodies capable of binding to and neutralizing pathogens or toxins that threaten the host. Natural or artificially engineered antibodies are often used as affinity reagents.

[0457] Nutritional requirements : Mutant organisms that require specific additional nutrients not needed by normal strains (especially bacteria or fungi).

[0458] Sis - Action elements: A region of non-coding DNA that regulates the transcription of nearby ORFs.

[0459] CST : Co-integrated cell surface tag capable of reporting integrated genes of interest

[0460] CSTE System: A system that operates as a donor / receiver pair, in which a tag-exchange donor vector serves to deliver the gene sequence of interest and the cell-surface tag exon to a paired tag-exchange receptor site contained within the genome of a engineered cell line.

[0461] Derived engineered cells : Engineered cells further genetically modified to exchange CSTs and integrate GOIs

[0462] DNA : Deoxyribonucleic acid. The chemical name for a molecule that forms the genetic material encoding genes and proteins.

[0463] Manipulated cell : A cell whose genome has been manipulated through genetic modification.

[0464] Epitope : A region on an antibody target bound by an antibody or other affinity reagent.

[0465] Eukaryotic conditional regulatory elements : A DNA sequence that can affect promoter activity and can be induced or inhibited under limited conditions

[0466] Eukaryotic promoter : A DNA sequence encoding the RNA polymerase binding site and the reactive enzyme. Since the sequence of the promoter region controls the binding of RNA polymerase and transcription factors, the promoter therefore plays a major role in determining when and where a gene of interest will be expressed.

[0467] Eukaryotic terminator / signal terminator : A DNA sequence recognized by a protein factor associated with RNA polymerase II that triggers the termination of transcription. It also encodes the poly-A signal.

[0468] FACS / Flow cytometry : Fluorescence-activated cell sorting. Flow cytometry is a technique that allows for the simultaneous analysis of individual cells for the expression of specific cell surface and intracellular markers. Cell sorting, a variation of this technique, enables the search for cells with a limited set of markers for further analysis.

[0469] Flippaje : Bread yeast Saccharomyces cerevisiae ( Saccharomyces cerevisiae Recombinant enzyme (flipase, Flp) derived from a 2 µm plasmid of ).

[0470] Fluorescence (protein) Marker : A molecule having specific extinction and emission characteristics and capable of being detected by microscopy, FACS, and related techniques.

[0471] gene Sis Functional elements: This is because it exists on the same DNA molecule as the gene that this element regulates, whereas trans-regulatory elements can regulate genes located far from the gene from which they were transcribed. Cis-regulatory elements are often binding sites for one or more trans-acting factors.

[0472] gene Barcoding : DNA barcoding is a taxonomic method that uses short genetic markers in an organism's DNA to identify that the DNA belongs to a specific species.

[0473] GOI : A gene of interest defined as an arbitrary nucleic acid coding or non-coding sequence of interest.

[0474] Heterogeneous recombinase site : A DNA sequence recognized by a recombinant enzyme that facilitates the crossing of two DNA molecules

[0475] Homology cancer: A DNA segment that has nearly identical sequence identity with complement homologous cancer and thus facilitates the exchange of two DNA molecules by homologous-induced repair, a cellular process.

[0476] Insulator : A DNA sequence that prevents a gene from being affected by the activation or repression of nearby genes. The insulator also prevents heterochromatin from spreading from the silenced gene to the gene that is actively transcribed.

[0477] Integration : Physical ligation of DNA sequences into cell chromosomes

[0478] Internal ribosome entry site (IRES) A DNA sequence encoding an RNA element that, once transcribed, enables the initiation of translation in a cap-independent manner.

[0479] Intron : RNA transcripts or non-coding regions of DNA encoding them that are removed by splicing before being translated into proteins.

[0480] Intron Branch point sequence : A branching nucleotide that initiates a nucleophilic attack at the 5' donor splice site. The free end of the upstream intron then initiates a second nucleophilic attack at the 3' acceptor splice site, releasing the intron into a tethered RNA (RNA lariat) and covalently bonding two exons.

[0481] K is a nucleotide code representing Keto (K = G or T).

[0482] Kojak order : Short sequence required for efficient translation initiation

[0483] M is a nucleotide code representing amino (aMino) (M = A or C)

[0484] MACS:Self-activated cell sorting: A cell isolation technique that labels cells with affinity molecules containing magnetic particles to separate them using a magnetic field.

[0485] agreement : When two components encode genetic elements that induce and restrict the interaction between complementary components

[0486] Monoclonal cell line: A limited group of cells generated from a single progenitor cell by repeated cell replication. N is a nucleotide code representing an aNy nucleotide (N = A, T, C, or G).

[0487] Native : Naturally occurring organisms in relation to cells

[0488] Voice selection Marker : Selectable markers conferring negative selection of a host organism having a vector and / or the marker-bearing vector

[0489] non-coding genes : Non-protein coding DNA sequences transcribed into functional non-coding RNA molecules

[0490] Replication starting point : A specific sequence of a vector, plasmid, or genome where replication is initiated.

[0491] ORF : Open reading frame. A segment of genetic material that encodes a translation frame for the synthesis of proteins (polypeptides) by ribosomes.

[0492] overhang : A single-stranded sequence at the end of a double-stranded nucleic acid molecule. It is often referred to as a sticky or cohesive end.

[0493] PCR Polymerase chain reaction in which a specific target DNA molecule is amplified exponentially

[0494] peptide: A short amino acid chain typically 6 to 30 amino acids long

[0495] Phenotype analysis : Analysis of observable characteristics of cells.

[0496] Plasmid: Genetic structures can replicate independently of chromosomes and are typically small, circular strands of DNA located in the cytoplasm of bacteria or protozoa.

[0497] polypeptide : A protein composed of a series of peptides that form a three-dimensional structure.

[0498] Polypyrimidine Motif : Rich in pyrimidines and located upstream of the 3' end of the CAG intron (C n T n ) Motif.

[0499] Positive selection Marker : Selectable markers conferring positive selection of a host organism having a vector and / or the marker-bearing vector

[0500] primer : For example, a short DNA sequence that enables specific recognition of a target DNA sequence during PCR.

[0501] Promoter Regulatory DNA element for controlling the initiation of gene expression

[0502] recombinant enzyme : An enzyme that mediates genetic recombination and promotes RMCE.

[0503] Reporter element : A genetic element that mediates a signal reported in an organism or vector possessing the corresponding element. It can be used as a positive or negative selection marker.

[0504] Restriction enzyme cleavage sequence: A gene sequence that is cleaved by a restriction enzyme, which may be endogenous or endogenous with respect to the recognition sequence of the restriction enzyme.

[0505] Restriction enzyme recognition sequence:Gene sequences recognized and linked by restriction enzymes

[0506] RMCE : Recombinase-mediated cassette exchange. Exchange of genetic material at genomic receiver regions facilitated by recombinase.

[0507] Splice receptor site : DNA sequence at the 3' end of the intron AM, APX CM, or affinity reagent for interaction between the surface TCRsp, or TCRsp-based reagent, and the cell

[0508] Splice donor site : DNA sequence at the 5' end of an intron

[0509] Suicide Gene: A gene that mediates apoptosis within a host organism possessing the gene. It can be used as a positive or negative selection marker.

[0510] synthesis : Artificially generated entities

[0511] TEDV : A tag-exchange donor vector paired with a tag-exchange receptor site contained within the genome of a engineered cell. This is used to deliver the gene of interest and the cell-surface tag exon.

[0512] TERS : Paired tag-exchange receptor sites contained within the genome of engineered cell lines

[0513] Type II membrane penetration domain: A single non-cleavageable transmembrane region of hydrophobic residues near the N-terminus acting as a combined signal / anchor sequence, with the N-terminus located inside the membrane and the C-terminus located outside the cell or within the ER lumen.

[0514] vector:A vector is a genetic structure that carries genetic information. In this context, a vector usually describes a plasmid DNA vector. A vector can represent any such structure that can be replicated and selected in a host organism.

[0515] W is a nucleotide code indicating weakness (W = A or T)

Claims

Claim 1 A combined system comprising two separate components, wherein the first component is a tag-exchange donor vector (TEDV) encoding a first cell surface tag (CST) exon adjacent to a 3' intron fragment and a gene of interest (GOI) in the antisense direction, wherein the first CST comprises one or more epitopes and the TEDV does not contain a promoter sequence, and the second component is an isolated engineered cell or engineered cell pool comprising a tag-exchange receiver site (TERS) encoding a second CST exon within the genome that is different from the first CST and whose entire intron sequence is adjacent to an exon encoding a transmembrane domain, and which also encodes a reporter gene in the antisense direction, and wherein paired recombinase-mediated cassette exchange (RMCE) elements are included in the TEDV and TERS. A combination system in which performing RMCE between TEDV and TERS results in the exchange of a reporter element for a GOI encoded by TEDV, and the exchange of a first CST exon for a second CST exon, such that each derived engineered cell expresses the first CST and GOI instead of the second CST and reporter gene, wherein the first component in the 5' to 3' direction comprises: a. a first RMCE element, which is a 5' RMCE element encoded in a non-coding and 'non-functional' 3' intron fragment; b. a 3' intron fragment comprising a branching sequence, a polypyrimidine track, and a 3' acceptor splice site; c. an exon comprising a TEDV-encoded CST in the 5' to 3' direction; d. a first transcription terminator sequence for the CST encoded in the 5' to 3' direction; e. Second transcription terminator f for GOI encoded in the 3' to 5' direction.g. A sequence encoding a GOI in the 3' to 5' direction. h. A Kozak sequence. h. A TEDV containing a 3' RMCE element, wherein the CST exon and the first transcription terminator are encoded in the antisense direction from the GOI, the second transcription terminator, and the Kozak sequence, and the second component is in the 5' to 3' direction, a. A first transcription promoter element. b. A Kozak sequence. c. A type 2 membrane protein permeation domain exon. d. A 5' intron splice donor site. e. A 5' RMCE element encoded in a non-coding and 'non-functional' 3' intron fragment, which is paired with the 5' RMCE element of the TEDV. f. A functional sequence of the 3' intron fragment comprising a branching point sequence, a polypyrimidine track, and a 3' acceptor splice site. g. A combination system comprising: an exon h containing a CST that is TERS-encoded in the 5' to 3' direction and is distinct from a TEDV-encoded CST; a transcription terminator sequence i for the CST encoded in the 5' to 3' direction; a transcription terminator sequence j in the 3' to 5' direction; a sequence k encoding a selected gene in the 3' to 5' direction; a Kojak sequence l for efficient translation initiation of a reporter gene transcript; a 3' RMCE element m; and a TERS comprising a second transcription promoter element, wherein the transmembrane domain exon and the CST exon are encoded in the antisense direction from the reporter gene, such that the first transcription promoter element drives the transcription of the combined transmembrane domain and CST, and the second transcription promoter element drives the transcription of the reporter gene. Claim 2 In claim 1, each CST exon comprises a sequence encoding one or more molecular affinity tags, and the CST encoded by the TEDV and the TERS is a different combination system. Claim 3 A combination system according to claim 1 or 2, wherein the first CST comprises at least two different epitopes for identifying the GOI. Claim 4 A combination system according to claim 1 or 2, wherein at least two epitopes are selected from the group comprising HA, MYC and FLAG. Claim 5 A combination system according to claim 1 or 2, wherein the engineered cell comprises a single TERS in its genome. Claim 6 A method for generating derived engineered cells expressing a TEDV-encoded GOI from a TERS locus, comprising: a. generating a TEDV defined in claim 1 or 2 that encodes the GOI and does not contain a promoter sequence; b. delivering said TEDV to an engineered cell line comprising a paired TERS defined in claim 1 or 2, together with a recombinase enzyme that matches an internally encoded RMCE element; c. contacting the cells with two or more affinity reagents specific to both the TEDV-encoded CST and the TERS-encoded CST; and d. selecting the derived engineered cells as a proxy for selecting cells having an integrated GOI, based on a decrease in the expression of the reporter gene and / or the TERS-encoded CST and an increase in the expression of the TEDV-encoded CST. Claim 7 A method for generating derived engineered cells, wherein the affinity reagent used in step c. is fluorescently labeled to detect a decrease in the expression of TERS-encoded CST and an increase in the expression of TEDV-encoded CST, and enabling cell division and selection based on said expression by fluorescently activated cell sorting. Claim 8 A method for generating derived engineered cells, wherein the affinity reagent used in step c. is immobilized on a substrate, and the substrate affinity method can deplete cells expressing TERS-encoded CST in a target cell population or enrich cells expressing TEDV-encoded CST. Claim 9 A method for generating multiple derivative engineered cells expressing various TEDV-encoded GOIs from a pool of TEDVs, comprising: a. generating a library of two or more TEDVs defined in claim 1 or 2, each encoding a unique GOI sequence, each having a unique TEDV-encoded CST, and each not containing a promoter sequence; b. delivering said library of TEDVs as a pool to an engineered cell line comprising paired TERS defined in claim 1 or 2, together with a recombinase enzyme matching an internally encoded RMCE element; c. contacting the cells with three or more affinity reagents specific to both multiple TEDV-encoded CSTs and TERS-encoded CSTs; and d. selecting the derivative engineered cells based on a decrease in the expression of the reporter gene and the TERS-encoded CST, and an increase in the expression of each unique TEDV-encoded CST. Claim 10 - A method for tracing the cell lineage of derived engineered cells expressing various TEDV-encoded GOIs within a pool of cells generated by the step of generating a library of two or more TEDVs defined in claim 1 or 2, each encoding a unique GOI sequence, each having a unique TEDV-encoded CST, and each not containing a promoter sequence; - delivering said library of TEDVs as a pool to engineered cell lines comprising paired TERS defined in claim 1 or 2, together with a recombinase enzyme matching an internally encoded RMCE element, comprising: a. contacting the cells with two or more affinity reagents specific to a plurality of TEDV-encoded CSTs; b. analyzing the content of the derived engineered cells based on the expression of each unique TEDV-encoded CST. Claim 11 A tag-exchange donor vector (TEDV) that encodes a cell surface tag (CST) exon adjacent to a 3' intron fragment and a gene of interest (GOI) in the antisense direction and does not contain a promoter sequence, wherein the TEDV comprises: a. a first RMCE element, which is a 5' RMCE element encoded in a non-coding and 'non-functional' 3' intron fragment; b. a 3' intron fragment comprising a branching sequence, a polypyrimidine track, and a 3' acceptor splice site; c. an exon comprising a TEDV-encoded CST in the 5' to 3' direction, wherein the CST comprises one or more epitopes; d. a first transcription terminator sequence for the CST encoded in the 5' to 3' direction; e. a second transcription terminator for the GOI encoded in the 3' to 5' direction; f. g. A sequence encoding a GOI in the 3' to 5' direction. h. A Kojak sequence comprising a 3' RMCE element, wherein the CST exon and the first transcription terminator are encoded in the antisense direction from the GOI, the second transcription terminator, and the Kojak sequence, a tag-exchange donor vector (TEDV). Claim 12 In paragraph 11, the TEDV, wherein the CST exon encodes at least two different epitopes. Claim 13 In paragraph 12, the above at least two epitopes are selected from the group including HA, MYC and FLAG, TEDV. Claim 14 An isolated engineered cell comprising, in its genome, a cell surface tag (CST) exon whose entire intron sequence encodes an exon encoding a transmembrane domain, and also a tag-exchange receptor site (TERS) defined in claim 1 or 2 encoding a reporter gene in the antisense direction, wherein a recombinase-mediated cassette exchange (RMCE) element is included in the TERS, and performing RMCE between the TERS and a tag-exchange donor vector (TEDV) defined in claim 1 or 2 that does not contain a promoter sequence results in the exchange of a reporter element for a gene of interest (GOI) encoded by the TEDV, wherein, in the 5' to 3' direction, the TEDV comprises: a. a first RMCE element, which is a 5' RMCE element encoded in a non-coding and 'non-functional' 3' intron fragment; b. c. A 3' intron fragment comprising a branching point sequence, a polypyrimidine track, and a 3' acceptor splice site. d. An exon comprising a TEDV-encoded CST in the 5' to 3' direction. e. A first transcription terminator sequence for the CST encoded in the 5' to 3' direction. f. A second transcription terminator for the GOI encoded in the 3' to 5' direction. g. A sequence encoding the GOI in the 3' to 5' direction. h. A Kojak sequence comprising a 3' RMCE element, wherein the CST exon and the first transcription terminator are encoded in the antisense direction from the GOI, the second transcription terminator, and the Kojak sequence, and the TERS in the 5' to 3' direction a. Transcription promoter element b. Kojak sequence c. Type 2 membrane protein permeation domain exon d. 5' intron splice donor site e. f. A 5' RMCE element encoded in a non-coding and 'non-functional' 3' intron fragment, paired with the 5' RMCE element of TEDV. g. A functional sequence of a 3' intron fragment comprising a branching sequence, a polypyrimidine track, and a 3' acceptor splice site.An exon h comprising a CST that is TERS-encoded in the 5' to 3' direction and is distinct from a TEDV-encoded CST. A transcription terminator sequence i for the CST encoded in the 5' to 3' direction. A transcription terminator sequence j in the 3' to 5' direction. A sequence k encoding a selected gene in the 3' to 5' direction. A Kojak sequence l for efficient translation initiation of the selected gene transcript. A 3'RMCE element m comprising a 3' genomic element responsible for regulating and tracking the expression of the CST transcript, wherein the transmembrane domain exon and the CST exon are encoded in the antisense direction from the reporter gene, so that the first transcription promoter element drives the transcription of the combined transmembrane domain and CST, and the second transcription promoter element drives the transcription of the reporter gene, an isolated engineered cell. Claim 15 delete Claim 16 delete

Citation Information

Patent Citations

  • Allele editing and applications thereof

    WO2017186718A1

  • An engineered multi-component system for identification and characterisation of t-cell receptors and t-cell antigens

    WO2018083316A1

  • An engineered multi-component system for identification and characterisation of t-cell receptors, t-cell antigens and their functional interaction

    WO2018083317A1