A novel promoter and method for producing L-lysine using thereof

Abstract

The present disclosure relates to a novel polynucleotide having promoter activity and a method for producing L-lysine using the same. Since a microorganism to which the novel polynucleotide is introduced, in which a specific position of the promoter region of the NCgl0302 gene and / or the NCgl0123 gene of the present disclosure is mutated, has a significantly increased ability to produce L-lysine, the novel polynucleotide can be usefully utilized for the efficient production of L-lysine.

Description

Technology Field

[0001] The present disclosure relates to a novel promoter and a method for producing L-lysine using the same, and more specifically, to a novel polynucleotide having promoter activity, a vector containing the same, a host cell transformed with said vector, and a method for producing L-lysine using said host cell. Background Technology

[0003] Efforts such as genetic manipulation of biosynthetic pathways and / or introduction of external genes have been continuously made to produce target substances, such as amino acids or useful substances, at high titers using microorganisms for various uses including feed, pharmaceuticals, and food. One such method involves inducing the overexpression of a target gene in microorganisms, which requires a high-efficiency gene expression system. Since the promoter is one of the factors significantly involved in the degree and regulation of gene expression, the development of a useful promoter is essential for developing an expression system.

[0004] Microorganisms of the genus Corynebacterium are producers of amino acids, including L-lysine; however, unlike other industrial microorganisms such as E. coli or Bacillus subtilis, the general structure of the promoter sequences for gene expression in these microorganisms is unknown. Therefore, promoters have been developed by removing the promoter portion of antibiotic resistance genes, such as those for chloramphenicol, cutting chromosomal DNA isolated from Corynebacterium microorganisms with appropriate restriction enzymes and introducing it, and then measuring the antibiotic resistance of strains obtained by transforming Corynebacterium microorganisms with this modified DNA.

[0005] With the increasing demand for L-lysine, there is still a need to develop powerful promoters for the overexpression of L-lysine-related genes as a method to produce L-lysine in high yield from microorganisms of the genus Corynebacterium. Prior art literature

[0007] Republic of Korea Registered Patent No. 10-0015735 (November 30, 1983) The problem to be solved

[0008] One aspect of the present disclosure provides a novel polynucleotide.

[0009] Another aspect of the present disclosure provides an expression cassette comprising the polynucleotide; and a target gene.

[0010] Another aspect of the present disclosure provides a microorganism comprising the polynucleotide; or the polynucleotide and a target gene operably linked thereto.

[0011] Another aspect of the present disclosure provides a method for producing L-lysine comprising the step of culturing the microorganism in a medium. means of solving the problem

[0013] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this disclosure may also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this disclosure fall within the scope of this disclosure. Furthermore, the scope of this disclosure is not to be considered limited by the specific descriptions provided below. Additionally, a person skilled in the art can recognize or identify numerous equivalents to the specific aspects of this disclosure described herein using only ordinary experiments. Moreover, such equivalents are intended to be included in this disclosure.

[0015] Additionally, numerous papers and patent documents are referenced and cited throughout this disclosure. The disclosures of the cited papers and patent documents are incorporated by reference into this disclosure in their entirety to more clearly explain the state of the art to which this disclosure pertains and the content of this disclosure.

[0017] One aspect of the present disclosure provides a polynucleotide comprising a nucleotide sequence in which the nucleotide at the 20th position in the nucleotide sequence of SEQ ID NO. 56 is substituted with a nucleotide different from the original, or a nucleotide sequence in which any one of the nucleotides at the 12th to 19th positions in the nucleotide sequence of SEQ ID NO. 57 is deleted.

[0018] In the present disclosure, the nucleotide sequence of SEQ ID NO. 56 or SEQ ID NO. 57 can be verified in the known database NCBI Genbank, and said sequence of SEQ ID NO. 56 or SEQ ID NO. 57 is each Corynebacterium ( Corynebacterium It may be of sp.) origin, specifically Corynebacterium glutamicum ( Corynebacterium glutamicumIt may be a sequence derived from ). The nucleotide sequence of SEQ ID NO. 56 or SEQ ID NO. 57 may be an example sequence for specifying a mutation site to be introduced for the preparation of the polynucleotide of the present disclosure, and it is obvious that the mutation introduced into the polynucleotide of the present disclosure may be introduced into any sequence functionally corresponding to the nucleotide sequence of SEQ ID NO. 56 or SEQ ID NO. 57. In one example, the functionally corresponding sequence may be a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with the sequence of SEQ ID NO. 56 or SEQ ID NO. 57, or a sequence having said homology or identity with some sequences added, deleted, or modified, but is not limited thereto. In one example according to this, the polynucleotide of the present disclosure may be composed of a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with the sequence of SEQ ID NO. 56 or SEQ ID NO. 57, wherein a nucleotide corresponding to the 20th position in the sequence of SEQ ID NO. 56 is substituted with another amino acid, or any one of the nucleotides at the 12th to 19th positions in the sequence of SEQ ID NO. 57 is deleted, or a sequence having said homology or identity with said sequence of SEQ ID NO. 56 or SEQ ID NO. 57 with some of the sequences added, deleted, or modified.

[0019] In the present disclosure, the nucleotide sequence of SEQ ID NO. 56 may be the promoter sequence of a gene (NCgl0302 gene) encoding DEAD / DEAH box helicase or a part of said promoter sequence.

[0020] The above DEAD / DEAH box helicase plays a role in unwinding RNA structures, performing important functions in various RNA metabolic processes such as RNA splicing, ribosome assembly, and RNA degradation, and can provide the energy required for RNA helicase activity by hydrolyzing ATP.

[0021] In one embodiment, the nucleotide at the 20th position in the nucleotide sequence of SEQ ID NO. 56 may be adenine (A), but is not limited thereto.

[0022] In one embodiment, the polynucleotide may be one in which the nucleotide at the 20th position of the nucleotide sequence of SEQ ID NO. 56 is substituted with guanine (G), cytosine (C), or thymine, and more specifically, may be substituted with guanine (G), but is not limited thereto.

[0023] In the present disclosure, the nucleotide sequence of SEQ ID NO. 57 may be the promoter sequence of the NCgl0123 gene or a part of said promoter sequence.

[0024] In one embodiment, the nucleotides at the 12th to 19th positions in the nucleotide sequence of SEQ ID NO. 57 may be adenine, but are not limited thereto.

[0025] In one embodiment, the polynucleotide may have a missing adenine (A) among the nucleotides at the 12th to 19th positions in the nucleotide sequence of SEQ ID NO. 57, but is not limited thereto.

[0026] In the present disclosure, the polynucleotide may comprise the nucleotide sequence of SEQ ID NO. 1 or 2. In another embodiment, the polynucleotide of the present disclosure may essentially consist of the nucleotide sequence of SEQ ID NO. 1 or 2. In yet another embodiment, the polynucleotide of the present disclosure may consist of the nucleotide sequence of SEQ ID NO. 1 or 2.

[0028] In the present disclosure, the phrase “a polynucleotide or polypeptide comprises a specific nucleotide sequence (nucleic acid sequence, base sequence) or amino acid sequence” may mean that the polynucleotide or polypeptide is composed of or essentially comprises the specific nucleotide sequence (nucleic acid sequence, base sequence) or amino acid sequence.

[0029] In the present disclosure, the term “polynucleotide” comprises two or more, five or more, ten or more, thirteen or more, twenty or more, or thirty or more nucleotide monomers, wherein the nucleotide monomers may be covalently bonded to form a chain.

[0030] The polynucleotide of the present disclosure may have promoter activity and may be used as a general-purpose promoter.

[0031] In one embodiment, the polynucleotide may have promoter activity for the expression of a target gene in microorganisms of the genus Corynebacterium.

[0032] The polynucleotide having the above-mentioned promoter activity may be interchangeably used with "variant promoter" in the present disclosure.

[0033] The polynucleotide of the present disclosure according to one embodiment can be utilized as a synthetic promoter having strong expression-inducing activity.

[0034] In the present disclosure, the term “promoter” may refer to a DNA region that includes a binding site for polymerase and initiates the transcription of a downstream target DNA. The promoter may be located upstream of the transcription initiation site. The promoter may be operably and / or regulated (enhanced or weakened) to the upstream of the target DNA. For example, the promoter may be connected in a forward direction upstream of the target gene to enhance (increase) the expression of the gene, or connected in a reverse direction downstream of the target gene to weaken (decrease) the expression of the gene. When the promoter is introduced in a reverse direction downstream of the target gene, for example, below a stop codon, preferably between the stop codon and the top of a transcription terminator, it may induce transcription in a direction opposite to the normal transcription direction of the gene, thereby causing the RNA polymerase complex to collide with the RNA polymerase complex in the normal direction during the transcription process, thereby weakening the expression of the gene.

[0035] The above polymerase may refer to an enzyme that synthesizes primary transcript RNA from DNA, also called RNA polymerase or DNA-dependent RNA polymerase. The above polymerase may be a prokaryotic RNA polymerase or a eukaryotic RNA polymerase (e.g., RNA polymerase I, RNA polymerase II, RNA polymerase III, RNA polymerase IV, or RNA polymerase V, etc.). The above polynucleotide according to one embodiment may be natural or non-natural, and may be, for example, a non-natural one that is chemically or recombinantly synthesized.

[0036] In this disclosure, the term “variation” refers to a genetically or non-genetically stable phenotypic change and may be used interchangeably with “mutation” in this disclosure.

[0037] The polynucleotide of the present disclosure (variant promoter) may have altered (increased or decreased) promoter activity compared to a polynucleotide that does not contain the mutation (wild type or pre-mutation polynucleotide). The polynucleotide may regulate (increase or decrease) the expression of a target gene operably linked thereto or the expression or activity of a protein encoded by said target gene, and furthermore may regulate the expression of other genes other than the target gene.

[0038] The above "target gene" refers to a gene whose expression is to be regulated by the polynucleotide of the present disclosure, and in the case of a gene encoding a protein, it may be used interchangeably with "gene encoding a target protein." A protein encoded by the above target gene may be expressed as "target protein," and a gene encoding the above "target protein" may be expressed as "target gene."

[0039] The amino acid coding sequence of the above-mentioned target gene may be varied within a range that does not alter the protein sequence encoded by the target gene, due to codon degeneracy or by considering the codon usage frequency preferred by the organism intended to express the target gene.

[0040] The polynucleotide of the present disclosure may have an activity that increases the host cell's ability to produce a target substance (amount), for example, the ability to produce amino acids (amount), when introduced into a suitable host cell together with an operablely linked target gene.

[0041] In one embodiment, the polynucleotide may be for increasing the production capacity (production amount) of amino acids, and specifically, may be for increasing the production capacity (production amount) of L-lysine.

[0042] In addition, the nucleotide sequence of the above polynucleotide may be further modified by conventionally known mutagenesis methods, such as direct evolution and site-directed mutagenesis, to the extent that it maintains the corresponding biological activity (promoter activity) and / or the desired activity (e.g., activity to increase the production of the target substance in host cells).

[0043] Accordingly, the polynucleotide of the present disclosure may be composed of a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with the nucleotide sequence of SEQ ID NO. 1 or the nucleotide sequence of SEQ ID NO. 2, or may be composed of a sequence having said homology or identity in which some sequences are added, deleted, or modified.

[0045] In this disclosure, the terms 'homology' or 'identity' refer to the degree of similarity between two given amino acid sequences or nucleotide sequences and may be expressed as a percentage. The terms homology and identity may often be used interchangeably.

[0046] The sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard arrangement algorithms, and a default gap penalty established by the program used may be utilized. Practically, homologous or identical sequences can generally be hybridized with the entire sequence or a part thereof under moderate or high stringent conditions. It is evident that hybridization also includes hybridization with polynucleotides containing common codons or codons that account for codon degeneracy.

[0047] Whether any two polynucleotide or polypeptide sequences have homology or identity can be determined using a known computer algorithm, such as the “FASTA” program, using default parameters as in, for example, Pearson et al (1988) [Proc.Natl. Acad. Sci. USA 85]: 2444. Alternatively, it can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Homology or identity can be determined, for example, using BLAST from the National Biotechnology Information Database Center or ClustalW.

[0048] The homology or identity of polynucleotides or polypeptides can be determined by comparing sequence information using a GAP computer program, such as that described in, for example, Smith and Waterman, Adv. Appl. Math (1981) 2:482, or Needleman et al. (1970), J Mol Biol. 48:443. In summary, a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). The default parameters for a GAP program are (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), or Gribskov et al. (1986) Nucl. Acids Res. 14: A weighted comparison matrix of 6745 (or an EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0049] In one example, a polynucleotide comprising a specific nucleotide sequence provided in the present disclosure may be interpreted to comprise a polynucleotide fragment comprising not only the specific nucleotide sequence or a substantially equivalent nucleotide sequence, but also a nucleotide sequence complementary to the specific nucleotide sequence. Specifically, a polynucleotide having such complementarity can be identified under the conditions described below: such conditions are specifically described in the known literature. For example, conditions in which genes with high complementarity of 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98% or more, 99.5% or more, or 99.9% or more hybridize with each other, and genes with lower complementarity do not hybridize with each other, or the washing conditions of conventional Southern hybridization, such as 60°C, 1x SSC (saline-sodium citrate buffer), and 0.1% (w / v) SDS (Sodium Dodecyl Sulfate); 60°C, 0.1x SSC, and 0.1% SDS; Alternatively, conditions for washing once, specifically two to three times, at a salt concentration and temperature equivalent to 68°C, 0.1x SSC, and 0.1% SDS may be listed, but are not limited thereto. Hybridization requires that two nucleotides have complementary sequences; however, depending on the degree of hybridization, some base mismatches may be permitted. The term "complementary" may be used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in the case of DNA, adenosine is complementary to thymine, and cytosine is complementary to guanine. The degree of hybridization between polynucleotides depends on the length and degree of complementarity of the polynucleotides, which is well known in the relevant art (Sambrook et al., supra, 9.50-9.See 51, 11.7-11.8).

[0050] Furthermore, the polynucleotide of the present disclosure may be operably linked to a gene encoding a target protein, i.e., a target gene.

[0051] In this disclosure, the term “operatively linked” means that a polynucleotide having the promoter activity of this disclosure is functionally linked to said gene sequence to initiate and mediate the transcription of the target gene. The operatively linked may be produced using gene recombination techniques known in the art, and site-specific DNA cleavage and linkage may be produced using cleavage and linkage enzymes of the art, but is not limited thereto.

[0052] When the above polynucleotide is operably linked to a target gene, some nucleotides may be added, deleted, and / or mutated for the use of the above cleavage and linkage enzymes, etc.

[0054] In one embodiment, the target gene may be a gene encoding a protein involved in the production of L-lysine according to the present disclosure, but is not limited thereto. The protein involved in the production of L-lysine may be selected from the group consisting of proteins involved in at least one process or step of the intracellular production pathway of L-lysine (e.g., biosynthesis, metabolism, bioconversion, etc.), intracellular transport, and / or extracellular efflux pathway, such as enzymes (various synthetases, degrading enzymes, kinases, carboxylases (e.g., pyruvate carboxylase, etc.), reductases, oxidases, decarboxylases, dehydrogenases, dehydrases, transferases, epimerases, etc.), intermediates, transport proteins, membrane proteins (channels, etc.), but is not limited thereto.

[0055] In one embodiment, the target gene may be the NCgl0302 gene, but is not limited thereto. The NCgl0302 gene may be a gene encoding a DEAD / DEAH box helicase.

[0056] In one embodiment, the target gene may be the NCgl0123 gene, but is not limited thereto.

[0058] Another aspect of the present disclosure provides an expression cassette comprising the polynucleotide of the present disclosure and a target gene.

[0059] The above polynucleotide and target gene are as described above.

[0060] In this disclosure, the term “expression cassette” refers to a unit cassette capable of expressing a target gene downstream of the promoter, comprising a promoter and a target gene operably linked thereto. Various factors capable of facilitating the efficient expression of the target gene may be included inside or outside such a gene expression cassette. In addition to a promoter typically operably linked to the target gene, the gene expression cassette may include, but is not limited to, a transcription termination signal, a ribosome binding site, and a translation termination signal.

[0062] Another aspect of the present disclosure provides a vector comprising the polynucleotide of the present disclosure; said polynucleotide and a target gene operably linked thereto; or said expression cassette.

[0063] The above polynucleotide, target gene, and expression cassette are as described above. The vector may include a target gene operably linked to the above polynucleotide.

[0064] In the present disclosure, the term “vector” means a DNA product containing a sequence of a polynucleotide encoding said target protein, which is operably linked to a suitable regulatory sequence to enable the expression of said target protein within a suitable host. The regulatory sequence may include a promoter capable of initiating transcription, any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and / or a sequence regulating the termination of transcription and / or translation. After being transformed into a suitable host cell, the vector may be expressed independently of the host cell’s genome or incorporated into the host cell’s genome.

[0065] The vectors available for use in the present disclosure are not particularly limited as long as they are capable of replicating within a host cell, and can be selected from all commonly used vectors. Examples of commonly used vectors include plasmids, cosmids, viruses, bacteriophages, etc., in their natural or recombinant state. For example, as the vectors, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A, etc., can be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors, etc., can be used as plasmid vectors. Specifically, examples include, but are not limited to, vectors such as pDZ, pDC, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pDCM2, and pDC24.

[0066] The vectors available in this disclosure may be expression vectors or insertion vectors into host cell chromosomes. Insertion of the target DNA into the host cell chromosome using the insertion vector may be performed by any method known in the art, for example, homologous recombination or a CRISPR system, but is not limited thereto. The vector may further include a selection marker to determine whether the vector has been transformed or further whether the target DNA has been inserted into the chromosome. The selection marker may be selected from genes that confer selectable phenotypes, such as drug resistance, nutritional requirements, resistance to cytotoxic agents, or the expression of surface proteins. Since only cells expressing the selection marker survive or exhibit other phenotypes in an environment treated with a selective agent, the transformed cells can be selected.

[0067] In the present disclosure, the term “transformation” means introducing a target polynucleotide into a host cell. The transformed polynucleotide may be inserted into the chromosomes of the host cell or located outside the chromosomes. Additionally, the polynucleotide may be DNA and / or RNA, and it may be introduced in any form as long as it can be introduced into the host cell and function. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a gene structure containing all the elements necessary for self-expression, or in the form of a vector containing it.

[0068] The above transformation method includes all methods for introducing the target polynucleotide into cells, and depending on the host cell, a suitable standard technique as known in the art may be selected and performed. Examples include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.

[0070] Another aspect of the present disclosure provides a microorganism (host cell) comprising the polynucleotide of the present disclosure, said polynucleotide and a target gene operably linked thereto, or said expression cassette.

[0071] The above polynucleotide, target gene, or expression cassette is as described above.

[0072] The above polynucleotide, the polynucleotide and the target gene operably linked thereto, or the above expression cassette may be introduced into a microorganism by transformation, but is not limited thereto.

[0073] In this disclosure, the term “microorganism” includes all wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification, and also includes microorganisms in which specific mechanisms are weakened or strengthened due to causes such as the insertion of external genes or the enhancement or weakening of the activity of endogenous genes.

[0074] The above microorganism may be a microorganism that naturally expresses a target gene or has the ability to produce a target product, or a microorganism that does not naturally express a target gene or a parent strain that lacks the ability to produce a target product may be endowed with the ability to express a target gene or the ability to produce a target product, but is not limited thereto. In one embodiment, the microorganism may be a microorganism that naturally produces amino acids, specifically L-lysine.

[0075] In this disclosure, the term “target product” refers to a biologically active substance intended to be produced or whose production is to be controlled (increased or decreased) using a polynucleotide provided in this disclosure, said polynucleotide and a target gene operably linked thereto, an expression cassette comprising said polynucleotide and said target gene, a vector comprising said polynucleotide and said target gene, and / or a microorganism comprising said polynucleotide, and / or a concept that includes not only the biologically active substance intended to be finally produced but also the target protein that the microorganism can produce. For example, it may refer to the target protein itself encoded by said target gene, and / or any biologically active substance produced involving said target protein.The above biologically active substance refers to any substance produced or derived from an organism (e.g., a cell) or having a specific function in vivo or within a cell, such as, for example, amino acids (glycine, alanine, valine, leucine, isoleucine, threonine, serine, cysteine, glutamine, methionine, aspartic acid, asparagine, glutamic acid, lysine, arginine, histidine, phenylalanine, tyrosine, tryptophan, proline, O-acetylhomoserine, etc.), nucleic acids, vitamins (vitamins A, B (B1, B2, B3, B5, B6, B7, B9, B12, etc.), C, D, E, K, etc.), proteins (the above-mentioned target protein or other proteins, e.g., hormones, growth factors, cytokines, immunoglobulins (antibodies), antigen proteins, receptors, ligands, functional fragments thereof (fragments possessing the target function), fusion proteins formed by the fusion of two or more types, etc.), and sugars. (e.g., monosaccharides, disaccharides, polysaccharides, sugar alcohols, etc.), fatty acids (myristoleic acid, palmitoleic acid, sapienoic acid, oleic acid, elaidic acid, vacsenic acid, linoleic acid, linoleelaidic acid, arachidonic acid, eicosapentaenoic acid (EPA), erucic acid, docosahexaenoic acid (DHA), etc.), organic acids (lactic acid, citric acid, oxalic acid, uric acid, butyric acid, stearic acid, propionic acid, etc.), etc., but are not limited thereto. In addition, if the target protein is involved in producing a substance, the target product may also include, in addition to the above substances, metabolites thereof (polyhydroxyalkanoates (PHA), etc.), precursors thereof, derivatives that maintain their biological activity, etc.

[0076] In one embodiment, a microorganism comprising the polynucleotide of the present disclosure and a target gene operably linked thereto may be a microorganism with increased amino acid production capacity as a target product, specifically a microorganism with increased L-lysine production capacity. The microorganism with increased L-lysine production capacity may be a microorganism with increased L-lysine production capacity compared to a microorganism that does not comprise the polynucleotide of the present disclosure, for example, a microorganism in which the expression of the NCgl0302 gene or the NCgl0123 gene is regulated by the polynucleotide prior to the introduction of the mutation, but is not limited thereto. The polynucleotide prior to the introduction of the mutation may be a wild-type polynucleotide, specifically a nucleotide sequence of SEQ ID NO. 56 or 57.

[0077] In the present disclosure, "non-mutated microorganism" does not exclude strains containing mutations that may naturally occur in microorganisms, and may refer to wild-type strains or natural-type strains themselves, or strains prior to genetic mutations caused by natural or artificial factors. For example, the "non-mutated microorganism" may refer to strains in which a variant polynucleotide has not been introduced into the promoter region of the NCgl0302 gene or NCgl0123 gene described in the present disclosure, or strains prior to such introduction. The "non-mutated microorganism" may be used interchangeably with "pre-mutation strain," "pre-mutation microorganism," "non-mutated strain," "non-mutated strain," "non-mutated microorganism," or "reference microorganism."

[0078] The microorganisms of the present disclosure may include, without limitation, any microorganism capable of functioning as a promoter upon which the polynucleotide of the present disclosure is introduced.

[0079] In one embodiment, the microorganism is a microorganism of the genus Corynebacterium ( Corynebacterium It may be a microorganism of the genus Escherichia or Bacillus, but is not limited to sp.), a microorganism of the genus Escherichia or Bacillus.

[0080] Specifically, the microorganism may be a microorganism of the genus Corynebacterium, and more specifically, Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium stationaryis( Corynebacterium stationis ), Corynebacterium thermoaminogenes ( Corynebacterium thermoaminogenes ), Corynebacterium glutamicum ( Corynebacterium glutamicum ), Brevibacterium flavum( Brevibacterium flavum ), Brevibacterium lactofermentum( Brevibacterium lactofermentum ) and strains produced therefrom may be included, but are not limited thereto. Specifically, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.

[0081] In one embodiment, the microorganism may be Corynebacterium glutamicum with a mutation introduced into the promoter of the NCgl0302 gene or the NCgl0123 gene, but is not limited thereto.

[0082] In one embodiment, the microorganism with increased L-lysine production capacity (production amount) of the present disclosure may have an L-lysine production capacity (production amount) that is increased by about 1% or more, about 5% or more, about 7.5% or more, about 10% or more, about 11% or more, about 13% or more, about 15% or more, about 18% or more, about 20% or more, about 30% or more, or about 40% or more compared to the parent strain before mutation or the non-mutated microorganism (the upper limit is not specifically limited and may be, for example, about 200% or less, about 150% or less, about 100% or less, or about 50% or less), but is not limited thereto. In another embodiment, the microorganism of the present disclosure with increased L-lysine production capacity (production amount) may have an L-lysine production capacity (production amount) that is increased by about 1.01 times or more, about 1.05 times or more, about 1.075 times or more, about 1.1 times or more, about 1.11 times or more, about 1.13 times or more, about 1.15 times or more, about 1.18 times or more, about 1.2 times or more, about 1.3 times or more, or about 40% or more (the upper limit is not specifically limited and may be, for example, about 10 times or less, about 5 times or less, about 3 times or less, about 2 times or less, or about 1.5 times or less), but is not limited thereto.

[0083] The above term “about” refers to a range that includes ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes, but is not limited to, all numerical values ​​within a range equivalent to or similar to the numerical value following the term “about.”

[0085] Another aspect of the present disclosure provides a composition for producing L-lysine, comprising one or more selected from the group consisting of the polynucleotide of the present disclosure, the polynucleotide and the target gene operably linked thereto, the expression cassette, the vector, and the microorganism. The polynucleotide, the target gene, the expression cassette, the vector, and the microorganism, etc., are as described above.

[0086] In one example, the composition for producing L-lysine may additionally include any suitable excipient commonly used in compositions for producing L-lysine, and such excipient may be, for example, a preservative, a wetting agent, a dispersant, a suspending agent, a buffer, a stabilizer, or an isotonic agent, but is not limited thereto.

[0088] Another aspect of the present disclosure provides a use for L-lysine production of one or more selected from the group consisting of the polynucleotide of the present disclosure, the polynucleotide and the target gene operably linked thereto, the expression cassette, the vector, and the microorganism. The polynucleotide, target gene, expression cassette, vector, and microorganism, etc., are as described above.

[0090] According to another aspect of the present disclosure, a use is provided for using one or more selected from the group consisting of the polynucleotide of the present disclosure, the polynucleotide and the target gene operably linked thereto, the expression cassette, the vector, and the microorganism in the preparation of a composition for L-lysine production. The polynucleotide, target gene, expression cassette, vector, and microorganism, etc., are as described above.

[0092] Another aspect of the present disclosure provides a method for producing a target product, comprising the step of culturing a microorganism in a medium comprising the polynucleotide of the present disclosure, said polynucleotide and a target gene operably linked thereto, said expression cassette or said vector.

[0093] The above polynucleotide, target gene, expression cassette, vector, microorganism, and target product, etc. are as described above.

[0094] In one embodiment, the target product may be an L-amino acid, specifically L-lysine.

[0095] The above method may further include a step of recovering a target product from the cultured microorganism, culture, or both thereof after the culture step.

[0096] The term “culture” in this disclosure means growing microorganisms under environmental conditions that are appropriately artificially controlled. The culture process of this disclosure may be carried out according to suitable media and culture conditions known in the art. Such culture process can be easily adjusted and used by those skilled in the art depending on the strain selected. Specifically, the culture may be batch, continuous, and / or fed-batch, but is not limited thereto. Various such methods are disclosed, for example, in “Biochemical Engineering” (James M. Lee, Prentice-Hall International Editions, pp. 138-176, 1991).

[0097] In this disclosure, the term “medium” refers to a substance mixed with nutrients as the main component required to culture the microorganisms of this disclosure, and supplies nutrients and growth factors, including water, which is indispensable for survival and growth. Specifically, any medium and other culture conditions used for culturing the microorganisms of this disclosure may be used without special limitations as long as they are media used for culturing ordinary microorganisms; however, the microorganisms of this disclosure may be cultured under aerobic conditions while controlling the temperature, pH, etc., in a conventional medium containing a suitable carbon source, nitrogen source, phosphorus, inorganic compounds, amino acids, and / or vitamins. Specifically, culture media for microorganisms can be found in literature such as the “Manual of Methods for General Bacteriology” by the American Society for Bacteriology (Washington DC, USA, 1981).

[0098] The culture medium used for cultivation must meet the requirements of a specific strain in an appropriate manner. For example, cultivation may be performed under aerobic conditions in a conventional medium containing suitable carbon sources, nitrogen sources, amino acids, vitamins, etc., while controlling the temperature, pH, etc. In this case, carbon sources include carbohydrates such as glucose, fructose, and sucrose, and amino acids such as glutamic acid and cysteine. Specifically, natural organic nutrient sources such as starch hydrolysates and molasses may be used; preferably, carbohydrates such as glucose, fructose, and sterilized pre-treated molasses (i.e., molasses converted into reducing sugars) may be used, and other appropriate amounts of carbon sources may be used without restriction, but are not limited thereto. As for nitrogen sources, inorganic nitrogen sources such as ammonia; amino acids such as glutamic acid and cysteine; and peptone, meat extract, yeast extract, etc., may be used as organic nitrogen sources. These nitrogen sources may be used individually or in combination, but are not limited thereto. Phosphoric acid, potassium dihydrogen phosphate, or dipotassium hydrogen phosphate, or a corresponding sodium-containing salt may be used as the phosphorus in the above medium, but is not limited thereto. Inorganic compounds may include magnesium sulfate, iron sulfate, manganese sulfate, and calcium chloride, and may also include amino acids, vitamins, and suitable precursors. These media or precursors may be added to the culture in a batch or continuous manner, but are not limited thereto.

[0099] During cultivation, compounds such as potassium hydroxide, ammonia, and phosphoric acid can be added to the culture in an appropriate manner to adjust the pH of the culture. Additionally, during cultivation, antifoaming agents such as fatty acid polyglycol esters can be used to suppress bubble formation. Furthermore, to maintain an aerobic state of the culture, oxygen or an oxygen-containing gas can be injected into the culture. The temperature of the culture is 27°C to 37°C, specifically 30°C to 33°C. The cultivation period may continue until the desired amount of useful substance is obtained, specifically 20 to 160 hours.

[0100] In the present disclosure, the term “culture” refers to a substance comprising a medium in which microorganisms are growing or have completed growth under appropriately artificially controlled environmental conditions. In a narrow sense, the culture does not include the grown microorganisms, but in a broad sense, it may include them. The “culture” may include various target substances released into the medium by the microorganisms during growth, along with the components of the medium composed for culturing microorganisms.

[0101] In the culture of the present disclosure, the culture temperature may be maintained at 20°C to 45°C, specifically 25°C to 40°C, 25°C to 40°C, 25°C to 37°C, 25°C to 35°C, 27°C to 40°C, 27°C to 37°C, 27°C to 35°C, 30°C to 40°C, 30°C to 37°C, or 30°C to 35°C, and may be cultured for about 10 to 160 hours, but is not limited thereto.

[0102] The target product produced by the culture of the present disclosure may be secreted into the culture medium or remain within the cell.

[0103] The step of recovering the above-mentioned target product may involve collecting the target product using a suitable method known in the art according to the culture method, e.g., batch, continuous, or fed-batch culture methods. For example, various chromatographic methods such as centrifugation, filtration, treatment with a crystallizing protein precipitating agent (salting-out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, and affinity chromatography, HPLC, or a combination thereof may be used, but are not limited thereto, and the target product may be recovered from the culture medium or microorganisms using a suitable method known in the art.

[0104] Additionally, the method for producing the target product of the present disclosure may further include a purification step. The purification may be performed using a suitable method known in the art. In one example, where the method for producing the target product of the present disclosure includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially (or consecutively) regardless of the order, or simultaneously or integrated into a single step, but are not limited thereto.

[0106] Another aspect of the present disclosure provides a method for increasing the production capacity of a target product, comprising the step of culturing a microorganism in a medium comprising the polynucleotide of the present disclosure, said polynucleotide and target gene, or said polynucleotide and target gene expression cassette.

[0107] The above polynucleotide, target gene, expression cassette, and microorganism are as described above.

[0108] In one embodiment, the target product may be an L-amino acid, specifically L-lysine.

[0110] Another aspect of the present disclosure provides a method for producing a microorganism with increased production capacity of a target product, comprising the step of introducing into the microorganism a polynucleotide of the present disclosure, said polynucleotide and a target gene, or an expression cassette comprising said polynucleotide and a target gene.

[0111] The above polynucleotide, target gene, expression cassette, and microorganism are as described above.

[0112] In one embodiment, the target product may be an L-amino acid, specifically L-lysine. Effects of the invention

[0114] The present disclosure relates to a novel polynucleotide having promoter activity and a method for producing L-lysine using the same. Since microorganisms to which the novel polynucleotide of the present disclosure is introduced show a significantly increased ability to produce L-lysine, the novel polynucleotide can be usefully utilized for efficiently producing L-lysine. Specific details for implementing the invention

[0116] The present disclosure is to be explained in more detail below through examples. These examples are solely for the purpose of explaining the present disclosure more specifically, and it will be obvious to those skilled in the art that the scope of the present disclosure is not limited by these examples according to the gist of the present disclosure.

[0118] Examples

[0120] (Throughout this disclosure, "%" used to indicate the concentration of a particular substance is (weight / weight) % for solid / solid, (weight / volume) % for solid / liquid, and (volume / volume) % for liquid / liquid, unless otherwise noted.)

[0122] Example 1. Selection of mutant strains with increased lysine production capacity using an artificial mutation method

[0123] Example 1-1. Random mutagenesis via UV irradiation

[0124] To select mutant strains with increased lysine production capacity, the lysine-producing strain CJ3P (US 9556463 ​​B2) was plated onto a nutrient medium containing agar and cultured at 30°C for 16 hours. Hundreds of colonies obtained in this way were irradiated with UV (Ultraviolet mutation) at room temperature to induce random mutations on the strain's genome. The composition of the nutrient medium is as follows.

[0125] Nutrient medium (pH 7.2)

[0126] Glucose 10 g, meat extract 5 g, polypeptone 10 g, sodium chloride 2.5 g, yeast extract 5 g, agar 20 g, urea 2 g (based on 1 liter of distilled water)

[0128] Example 1-2. Selection of strains with improved L-lysine production capacity

[0129] In order to select a mutant strain with increased lysine production capacity compared to the parent strain CJ3P, the CJ3P strain and the mutant strains in which random mutations were induced in Example 1-1 were cultured in the following manner.

[0130] The above strains were each inoculated into 96-Deep Well Plate-Domes (Bioneer) containing 400 µl of seed medium and cultured in a plate shaking incubator (TAITEC) at 32°C and 1200 rpm for approximately 48 hours. The lysine concentrations of approximately 3,000 cultured strains were each analyzed using a near-infrared (NIR) spectrometer, and the top four mutant strains with improved lysine production compared to the parent strain CJ3P were selected. The composition of the seed medium is as follows.

[0131] <Seed medium (pH 7.0)>

[0132] Glucose 20 g, Peptone 10 g, Yeast extract 5 g, Urea 1.5 g, KH2PO44 g, K2HPO48 g, MgSO4·7H2O 0.5 g, Biotin 100 ug, Thiamine HCl 1000 ug, Calcium-Pantothenic Acid 2000 ug, Nicotinamide 2000 ug (based on 1 liter of distilled water)

[0133] To finally select strains with reproducibly increased L-lysine production capacity from the four selected mutant strains, they were cultured and evaluated using the following method.

[0134] The four strains and the control were each inoculated into a 250 ml Corner-Baffle flask containing 25 ml of seed medium, and cultured at 30°C for 20 hours with shaking at 200 rpm. 1 ml of seed culture was inoculated into a 250 ml Corner-Baffle flask containing 24 ml of production medium, and cultured at 30°C for 72 hours with shaking at 200 rpm. The composition of the media is as follows.

[0135] <Seed medium (pH 7.0)>

[0136] Glucose 20 g, Peptone 10 g, Yeast extract 5 g, Urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4·7H2O 0.5 g, Biotin 0.1 mg, Thiamine HCl 1 mg, Calcium-Pantothenic Acid 2 mg, Nicotinamide 2 mg (based on 1 liter of distilled water)

[0137] Production Medium (pH 7.0)

[0138] Glucose 100 g, (NH4)2SO4 40 g, Soy protein 2.5 g, Corn Steep Solids 5 g, Urea 3 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, Biotin 100 ug, Thiamine hydrochloride 1000 ug, Calcium pantothenic acid 2000 ug, Nicotinamide 3000 ug, CaCO3 30 g (based on 1 liter of distilled water)

[0139] After the culture was completed, the concentration of L-lysine in the culture medium was analyzed using high-performance liquid chromatography (HPLC), and the L-lysine production concentrations of each mutant strain are shown in Table 1 below.

[0140] strain name L-lysine (g / L) CJ3P 7.2 CJ3P_mt1 8.5 CJ3P_mt2 9.0 CJ3P_mt3 8.3 CJ3P_mt4 7.9

[0141] As shown in Table 1 above, among the four selected variant strains, CJ3P_mt2 was finally selected as the strain with the highest increase in L-lysine production.

[0143] Example 2. Confirmation of variants via Whole-genome sequencing (WGS)

[0144] Whole-genome sequencing (WGS) was performed on the CJ3P_mt2 strain selected in Examples 1-2 above to analyze the sequence, and 11 types of mutations occurring in promoter regions were identified by comparing with the parent strain CJ3P sequence (sequence numbers 56 to 66), and the sequences of the promoters containing the corresponding mutations are shown in Table 2 below.

[0145] Sequence number gene Promoter sequence (5'->3') 1 NCgl0302 ACTGCGCACTGAAACTGCGGCCTGGGAACAAGTCTTTCACGTTTAAAGCCCAAGCGATAGTCTATTAGGATTAGTTTTACGTTTTGGCAGGTCAGTCCCATTTATACAGCCCAGCGAAAGGGGGTAAATTCTTGACTACCCCCGATTTTGAGAGTGAAAAGACTCAAGCT 2 NCgl0123 ACTTTCACATCAAAAAAAGGGGGACAAATTTCTACATGAAATTCGACGAGATGAATGCTATTCATTCTTGTCTTCAGCCACATCTATTCGAAATGAAATCCTACTGAATCACCAGCTAGTCCGCCTAGGTAAAAAAGGCGTAATTAACTTATTTATACATAAAACACAATAAAAACCGCACACGCGGCGAAACTTCAATAATCCCTAGACTGCAAAAA 3 NCgl0625 GAGAGATGATTTATACCATCCTACACCATTTAGAGTGGGGCTAGTCATACCCCCATAACCCTAGCTGTACGCAATCGATTTCAAATCAGTTGGAAAAAGTCAAGAAAATTACCCGAGAATAAATTTATACCACACAGTCTATTGCAATAGACCAAGCTGTTCAGTAGGGTGCATGGGAGAAGAATTTCCTAATAAAAACTCTTAAGGACCTCCAA 4 NCgl0276 GGCGCACCCCAGGCGCACCCCAGGCGCACCCCAGCGCACCACAGGCGCACCCCAGCGCACCACAGGCGCACCCCAGCGCACCACAGGCGCACCAGCCCAGCACAAGAGCCAACGCAAGTGTCAGGCACGCCAGCAAAGGGGCTAGCAAGAAGCACGCCCCCGAAGCCTTAGAAATGCGTTCCCCGGTAGG 5 NCgl1064 CATTTTCATATGTTAATCGACCGCTTCCATCATGTTTTAACTAAGGTTTGTAGGCTTAAACCT 6 NCgl0294 GCGCCTCGGGGGGGGGGTGTGCGCGGGCCGTCAGTAACCCGGCAACGGGGGGGGATTGTGCCGGGGCAGGCCACACTGTATATCGGGGCCTTGCACCTGAAATTATGGCATATCAAACGCCACAAGACAACATCAAACCCGATTATTTATTCGAATAACACGAATACTTAACAGTGTGGCAAATGACACTTCCCGCACGCCTTCTACATTCCCAATGCGCAACCCCAGCACGTCACTTCAATCTCATTGGTAACTTTAGTTTCTTTCTCAGTCTTGGAAAGTTGCCAAAAAGCGCTAAACTATGCGGT 7 NCgl1720 GCGGTTGATTAAAAAAAAGAACACTTTGATATGAATTAAGTCGAAGTGTTCTTTTATTAATTTAAAAGTATATTTCAGCAATGGTAAATGAATCTCATAAGTTTTAAAGAAAAGTATTGCATTTGTTTGACAAGGTGATTATGCTTCACATTAATACTTAATAAGAATTGTTCTGGGAAGTAATATAAAAAGTCCCGAACAAATTAGTGTGAAAGGGTTTGTATC 8 NCgl0246 CTTTGTGCACCTTTCGATCTAGGTGCTGACAGTTACCCGCTCAACTCTACCTTTATAAACTGTGTCTACCTAGCCAGAGGAGTGTTTTCTTTCTGCACAGGGTTCCTGGGGCTTTAGCGGATGCGTCTCAGCCACTGGGACGCGTTCCAATAAACAGACCATATATTGATATTCGATTTAATATTTGAGACAAAAGTGACAGGTGCTACTTCGCGAGCAACTCTTTAGTCAACTACCCTGAATCAA 9 NCgl2356 AGATTTTGCTTTTCGACGCTCCCCTCCACCTCATTCAATGCGGCGGGAGGGGATTTCCTTGCATGTTAAGCCTATAGGAAAAAGTGTTTGCATATCACCCTTGTATTCGAACACGTGAGCGGGTAGAGTGGGTGGTAACAACACGGGGAAAGGGGGAAGACACC 10 NCgl2521 GACGGGCTGAAACCAAACCAGACTGCCCGGCAACGACGGAAATCCCAAAAGTGGGCATCCCTGTTTGGTACCGAGTACCCACCCGGGCCTGAAACTCCCTGGCAGGCGGGCGAAGCGTGGCAACAACTGGAATTTAAGAGCACAATTGAAGTCGCACCAAGTTAGGCAACACAATAGCCATAACGTTGAGGAGTTCAG 11 NCgl2960 CCTCAATGTCACGTGAAACATTGAGGGTTTTACACCCAATTAAAGAAAAAATGAATTAAACCAAAACTTCTTAATCGCAGGGGTTAAGGTAAGTTCAGCTAATCAATGAAAACTTCCCCTTTCAGCCCGTTGAAGAACCAATGAGCCCTGCCCGCACCCAGCCCCGAGCGGCTTTCCTAAGGAAGCTCCGACCCATCACATGTAGCCTTTCC

[0146] In the following examples, we aimed to identify the effective factors affecting L-lysine production capacity by evaluating whether each variation in Table 2 above affects the L-lysine production capacity of microorganisms of the genus Corynebacterium.

[0149] Example 3. Production of an L-lysine producing strain with an introduced variant promoter

[0150] Example 3-1. Construction of a recombinant vector for the introduction of a variant promoter

[0151] A vector containing the target variant was constructed to introduce each of the variant promoters of the NCgl0302, NCgl0123, NCgl0625, NCgl0276, NCgl1064, NCgl0294, NCgl1720, NCgl0246, NCgl2356, NCgl2521, and NCgl2960 genes in Table 2 above into CJ3P.

[0152] Specifically, the genomic DNA of the above CJ3P_mt2 strain was extracted using the G-spin Total DNA Extraction Mini Kit (Intron, Cat. No. 17045) according to the protocol provided in the kit, and PCR was performed using the genomic DNA as a template. The polymerase was Solg TM Pfu-X DNA polymerase was used, and the PCR conditions were denatured at 95°C for 4 minutes; then denatured at 95°C for 30 seconds, annealed at 60°C for 30 seconds, and polymerized at 72°C for 50 seconds, repeated 27 times; and then polymerized at 72°C for 5 minutes, and a PCR product of approximately 700 bp was obtained using SEQ ID NO. 12 and SEQ ID NO. 13; or SEQ ID NO. 14 and SEQ ID NO. 15; or SEQ ID NO. 16 and SEQ ID NO. 17; or SEQ ID NO. 18 and SEQ ID NO. 19; or SEQ ID NO. 20 and SEQ ID NO. 21; or SEQ ID NO. 22 and SEQ ID NO. 23; or SEQ ID NO. 24 and SEQ ID NO. 25; or SEQ ID NO. 26 and SEQ ID NO. 27; or SEQ ID NO. 28 and SEQ ID NO. 29; or SEQ ID NO. 30 and SEQ ID NO. 31; or SEQ ID NO. 32 and SEQ ID NO. 33. The primer sequences used in the above experiment are shown in Table 3 below.

[0153] Sequence number designation Sequence (5'→3') 12 Pn*_NCgl0302_F tgaattcgagctcggtacccGCCGATTTCGAACTCGACGA 13 Pn*_NCgl0302_R gtcgactctagaggatccccCACATGCTGGCCATTCCACG 14 Pn*_NCgl0123_F tgaattcgagctcggtacccTGTGTGGCTCGGGAATCATTA 15 Pn*_NCgl0123_R gtcgactctagaggatccccAGGCGGCTTTTACGGCGCGG 16 Pn*_NCgl0625_F tgaattcgagctcggtacccAAGTGCGAAACGCTGCTTGG 17 Pn*_NCgl0625_R gtcgactctagaggatccccAACGCGGGCGGTCGGTGACA 18 Pn*_NCgl0276_F tgaattcgagctcggtacccGCAGCAGCAATTTGCCGCCA 19 Pn*_NCgl0276_R gtcgactctagaggatccccGGCAGCTGACCAGAAGTCCA 20 Pn*_NCgl1064_F tgaattcgagctcggtacccGGTGTTTTGCATGTGCATTT 21 Pn*_NCgl1064_R gtcgactctagaggatccccCACAGCCATACATGATGCCG 22 Pn*_NCgl0294_F tgaattcgagctcggtacccAACTCACGGCCGTAGGCGTA 23 Pn*_NCgl0294_R gtcgactctagaggatccccACCAGTGGCTGCAGCTACGT 24 Pn*_NCgl1720_F tgaattcgagctcggtacccAGCAACCAGTAGTGAGGTAT 25 Pn*_NCgl1720_R gtcgactctagaggatccccTCCACAAAGTGGACAGTGTT 26 Pn*_NCgl0246_F tgaattcgagctcggtacccAGGTGAGCTCCTTAGGGAGC 27 Pn*_NCgl0246_R gtcgactctagaggatccccTTCCGTGGCGCTCGGTGGTG 28 Pn*_NCgl2356_F tgaattcgagctcggtacccCCACTGCCATGGCTGCCGGT 29 Pn*_NCgl2356_R gtcgactctagaggatccccGATGAGTGGGTGGAGCCAA 30 Pn*_NCgl2521_F tgaattcgagctcggtacccGAGGAAAGCCCAACGTTGGG 31 Pn*_NCgl2521_R gtcgactctagaggatccccCGATTCCGCACCGGCTGCAA 32 Pn*_NCgl2960_F tgaattcgagctcggtacccAGTCCTTCATTGCCGGGGAA 33 Pn*_NCgl2960_R gtcgactctagaggatccccCAAAGCGTTTGCGCTTGGAT

[0154] Recombinant plasmids were obtained by cloning the above-mentioned mutation-introduced fragment and the pDC24 vector (SEQ No. 67) treated with restriction enzyme smaI using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix), and the vectors containing each mutation-introduced fragment were pDC24-Pn*_NCgl0302, pDC24-Pn*_NCgl0123, pDC24-Pn*_NCgl0625, pDC24-Pn*_NCgl0276, pDC24-Pn*_NCgl1064, pDC24-Pn*_NCgl0294, pDC24-Pn*_NCgl1720, pDC24-Pn*_NCgl0246, They were named pDC24-Pn*_NCgl2356, pDC24-Pn*_NCgl2521, and pDC24-Pn*_NCgl2960.

[0156] Example 3-2. Production of an L-lysine producing strain with an introduced mutant promoter

[0157] The 11 vectors prepared in Example 3-1 above were each transformed into the lysine-producing strain CJ3P by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and strains in which the vector was inserted onto the chromosome by recombination of homologous sequences were selected using kanamycin medium. Subsequently, for the transformed strains in which secondary recombination was completed, SEQ ID NOs 34 and 35; or SEQ ID NOs 36 and 37; or SEQ ID NOs 38 and 39; or SEQ ID NOs 40 and 41; or SEQ ID NOs 42 and 43; or SEQ ID NOs 44 and 45; or SEQ ID NOs 46 and 47; or SEQ ID NOs 48 and 49; or SEQ ID NOs 50 and 51; or SEQ ID NOs 52 and 53; Alternatively, strains with introduced variant promoters were identified through PCR using primers of SEQ ID NO. 54 and SEQ ID NO. 55. PCR was performed in the same manner as in Example 3-1. The above recombinant strains were named CJ3P△Pn:: Pn*_NCgl0302, CJ3P△Pn:: Pn*_NCgl0123, CJ3P△Pn:: Pn*_NCgl0625, CJ3P△Pn:: Pn*_NCgl0276, CJ3P△Pn:: Pn*_NCgl1064, CJ3P△Pn:: Pn*_NCgl0294, CJ3P△Pn:: Pn*_NCgl1720, CJ3P△Pn:: Pn*_NCgl0246, CJ3P△Pn:: Pn*_NCgl2356, CJ3P△Pn:: Pn*_NCgl2521, and CJ3P△Pn:: Pn*_NCgl2960, respectively. The sequences of the primer pairs used for verification are shown in Table 4 below.

[0158] Sequence number designation Sequence (5'->3') 34 pNCgl0302_F ACAGCCTGAGCCTGAA 35 pNCgl0302_R AGCTGATAACCCAAAG 36 pNCgl0123_F CAATGGGGTAGTGGGG 37 pNCgl0123_R CCGTCTTCGACAGGAAC 38 pNCgl0625_F TTGGTGAGGCGGGAGT 39 pNCgl0625_R ACCGCCGCGATAACCC 40 pNCgl0276_F TGTTTGTTCGTGGTGCAG 41 pNCgl0276_R CGCCAACCTTGCCGGTGG 42 pNCgl1064_F TGTTTGTCCACACCACG 43 pNCgl1064_R CCGCCAACCCAGATTT 44 pNCgl0294_F GAGGCTTAATTGCAGG 45 pNCgl0294_R CGGTGAAAATGCCTGG 46 pNCgl1720_F CAGAAGAGCTTGATCATG 47 pNCgl1720_R TGCCGTCAGCGTCAATCGG 48 pNCgl0246_F GCCAGCATCGCGGTACTC 49 pNCgl0246_R CAGCAACAATGCAGATCT 50 pNCgl2356_F GCGGGGCATCGGATT 51 pNCgl2356_R GTGGTGGGCGCGTGCT 52 pNCgl2521_F TAGAGAATCGAGTTG 53 pNCgl2521_R TTTCCAGGACCACAAG 54 pNCgl2960_F TTCGGCGGCGTCGAGAT 55 pNCgl2960_R ATTTCGGTTAAGGGGTA

[0160] Example 4. Evaluation of L-lysine production capacity of strains introduced with a variant promoter

[0161] To confirm the L-lysine production ability of the strain prepared in Example 3-2 above, it was evaluated by culturing it in the following manner.

[0162] Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium and cultured at 30°C for 20 hours with shaking at 200 rpm. 1 ml of seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of production medium and cultured at 30°C for 72 hours with shaking at 200 rpm. The medium composition was the same as in Examples 1-2.

[0163] After the culture was finished, the L-lysine production was measured using high-performance liquid chromatography (HPLC), and the analysis results are shown in Table 5 below.

[0164] strain name L-lysine concentration (g / L) CJ3P 7.2 CJ3P△Pn:: Pn*_NCgl0302 8.0 CJ3P△Pn:: Pn*_NCgl0123 8.3 CJ3P△Pn:: Pn*_NCgl0625 7.3 CJ3P△Pn:: Pn*_NCgl0276 7.2 CJ3P△Pn:: Pn*_NCgl1064 7.3 CJ3P△Pn:: Pn*_NCgl0294 7.3 CJ3P△Pn:: Pn*_NCgl1720 7.5 CJ3P△Pn:: Pn*_NCgl0246 7.3 CJ3P△Pn:: Pn*_NCgl2356 7.5 CJ3P△Pn:: Pn*_NCgl2521 7.6 CJ3P△Pn:: Pn*_NCgl2960 7.3

[0165] As shown in Table 5, the lysine production capacity of strains into which variant promoters were introduced increased or was equivalent to that of the parent strain. In particular, it was confirmed that 'CJ3P△Pn::Pn*_NCgl0302' and 'CJ3P△Pn::Pn*_NCgl0123' showed significantly improved lysine production capacity compared to the parent strain CJ3P. Through this, it was confirmed that L-lysine can be produced more efficiently by introducing a variant of the promoter that regulates the expression of the NCgl0302 gene or a variant of the promoter that regulates the expression of the NCgl0123 gene.

[0167] From the foregoing description, those skilled in the art to which this disclosure pertains will understand that this disclosure may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of this disclosure should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.

Claims

Claim 1 A polynucleotide comprising the nucleotide sequence of SEQ ID NO. 1 or the nucleotide sequence of SEQ ID NO.

2. Claim 2 In claim 1, the polynucleotide is a polynucleotide having promoter activity. Claim 3 delete Claim 4 An expression cassette comprising the polynucleotide of claim 1 and the target gene. Claim 5 Corynebacterium genus comprising the polynucleotide of claim 1 or 2 or said polynucleotide and a target gene operably linked thereto ( Corynebacterium sp.) Microorganisms. Claim 6 In paragraph 5, the above-mentioned microorganism of the genus Corynebacterium is Corynebacterium glutamicum ( Corynebacterium glutamicum )person, microorganism. Claim 7 A method for producing L-lysine comprising the step of culturing the microorganism of claim 5 in a culture medium. Claim 8 A method for producing L-lysine according to claim 7, wherein the method further comprises the step of recovering L-lysine from a cultured medium or microorganism.

Images