Multiplex real-time PCR primer set for detection of pathogenic Microsporidia and its use

Abstract

The present invention relates to a primer set for multiplex real-time PCR for the detection of pathogenic microsporidians, and according to the present invention, the presence of infection by pathogenic microsporidians can be confirmed in real time and the results can be interpreted quantitatively, thereby providing the effect of excellent specificity and accuracy.

Description

Technology Field

[0001] The present invention relates to a multiplex real-time PCR primer set capable of detecting pathogenic microsporidia, etc. Background Technology

[0003] Microsporidia are a group of unicellular eukaryotic organisms that parasitize the cells of various animals, and more than 1,200 species have been identified to date. They include many pathogens that infect insects, crustaceans, fish, and mammals, including humans. When some of these microsporidia are pathogenic and infect the human body, microsporidiasis develops.

[0004] Microsporidiasis causes various clinical symptoms in humans, including diarrhea, and can pose a serious risk of death, particularly in immunocompromised individuals. The most common causes of diarrheal microsporidiasis are known to be Enterocytozoon bieneusi and Encephalitozoon intestinalis. While stool sample PCR is typically used for the diagnosis of microsporidiasis, rapid diagnosis in the field remains difficult due to the need to interpret results after PCR using electrophoresis. The problem to be solved

[0006] The technical problem that the present invention aims to solve is to provide a multiplex real-time PCR primer set capable of diagnosing the presence of pathogenic microsporidia infection within a short period of time.

[0007] However, the technical problems that the present invention aims to solve are not limited to those mentioned above, and other unmentioned problems will be clearly understood by a person skilled in the art from the description below. means of solving the problem

[0009] To solve the above problem, the present invention provides a primer set for detecting pathogenic microsporidians, comprising primers composed of the nucleotide sequences of SEQ ID NOs. 1, 2 and 4 to 7.

[0010] According to one side, the primer set may additionally include a probe consisting of the nucleotide sequences of SEQ ID NOs. 3, 8 and 9.

[0011] According to one aspect, a probe composed of the nucleotide sequences of SEQ ID NOs 3, 8 and 9 may include a fluorescent label at the 5' end.

[0012] According to one aspect, the fluorescent labeling material is FAM (6-carboxyfluorescein), Texas Red, fluorescein, HEX (2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein), fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethyl rhodamine, FITC (fluorescein isothiocyanate), Oregon Green, Alexa Fluor, JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-XRhodamine), TET (Tetrachloro-Fluorescein), TRITC (tertramethylrodamine isothiocyanate), It may be one or more selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine series dyes and thiadicarbocyanine.

[0013] According to another embodiment of the present invention, a composition for detecting pathogenic microsporidia is provided, comprising any one of the primer sets.

[0014] According to another embodiment of the present invention, a kit for detecting pathogenic microsporidians comprising the above composition is provided.

[0015] According to another embodiment of the present invention,

[0016] (1) A step of isolating genomic DNA (gDNA) from a biological sample;

[0017] (2) a step of amplifying the target sequence by performing a real-time PCR reaction using the isolated gDNA as a template and primers and probes of SEQ ID NOs 1 to 9; and

[0018] (3) A step of detecting the amplified product; a method for providing information for testing for pathogenic microsporidia infection is provided.

[0019] According to one aspect, the sample in step (1) above may be one or more selected from the group consisting of sputum, bronchial aspiration and bronchial washing, body fluid, saliva, urine, feces, dermal lesion swab, cerebrospinal fluids, blood, serum, plasma, peripheral blood monocyte, peripheral blood leukocyte, cervical smears and pharyngeal swab, and preferably feces. Effects of the invention

[0021] According to the present invention, pathogenic microsporidians can be detected rapidly in real-time at the site. The primer set of the present invention exhibits high sensitivity and accuracy against pathogenic microsporidians, and can diagnose whether a sample is infected with microsporidians with high accuracy within a short period of time. Brief explanation of the drawing

[0023] Figure 1 shows the probe design process for Enc. intestinalis SSU rRNA. Figure 2 shows the primer and probe design process for the Ent. bieneusi ITS region. Figure 3 shows the results of verifying the performance of the primer and probe. Figure 4 shows the results of a multiple efficiency verification test of the primer / probe set. Figure 5 shows the result of confirming the amplification curve of positive standard plasmid DNA using Real-time PCR. Figure 6 shows that the positive control group was constructed to have a Ct of 23±3. Figure 7 is a standard curve using Enc. intestinalis positive standard. Figure 8 is a standard curve using Ent. bieneusi positive standard material. Specific details for implementing the invention

[0024] The inventors have completed the present invention regarding a primer set for real-time PCR for rapidly and quickly diagnosing the presence of infection by pathogenic microsporidia.

[0025] As used in this specification, the term “pathogenic microsporidia” refers to microorganisms belonging to a subclass of the class Microsporidia that infect a host and cause disease. Some of the said microsporidia may cause microsporidiasis when infecting the human body, and preferably, said pathogenic microsporidia Encephalitozoon intestinalis or Enterocytozoon bieneusi It can mean.

[0026] Specifically, the inventors Encephalitozoon intestinalis A primer set consisting of primers and probes specific to the SSU rRNA region was prepared based on multiplex real-time PCR. Unlike traditional PCR, the multiplex real-time PCR-based primer set of the present invention combines amplification and detection into a single step, eliminating the need to detect products using gel electrophoresis, and enables rapid monitoring of PCR results through the accumulation of fluorescence signals, thereby significantly reducing the time required for analysis.

[0027] The present invention provides a primer set for detecting pathogenic microsporidians, comprising primers composed of the nucleotide sequences of SEQ ID NOs. 1, 2 and 4 to 7.

[0028] According to one side, the primer set may additionally include a probe consisting of the nucleotide sequences of SEQ ID NOs. 3, 8 and 9.

[0029] The composition of the primer set for multiplex real-time PCR for the detection of pathogenic microsporidians according to the present invention is as shown in Tables 1 and 2 below, and the reaction conditions are preferably as disclosed in Table 2 below. The composition and reaction conditions of the primer set and the composition containing it described above are merely examples for deriving optimal embodiments and are not limited thereto.

[0030] According to one aspect, a probe composed of the nucleotide sequences of SEQ ID NOs 3, 8 and 9 may include a fluorescent label at the 5' end.

[0031] According to one aspect, the fluorescent labeling material is FAM (6-carboxyfluorescein), Texas Red, fluorescein, HEX (2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein), fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethyl rhodamine, FITC (fluorescein isothiocyanate), Oregon Green, Alexa Fluor, JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-XRhodamine), TET (Tetrachloro-Fluorescein), TRITC (tertramethylrodamine isothiocyanate), It may be one or more selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine series dyes and thiadicarbocyanine.

[0032] According to another embodiment of the present invention, a composition for detecting pathogenic microsporidia is provided, comprising any one of the primer sets.

[0033] According to another embodiment of the present invention, a kit for detecting pathogenic microsporidians comprising the above composition is provided.

[0034] In addition, the present invention may provide a method for providing information for testing the presence of pathogenic microsporidian infection, comprising the steps of isolating genomic DNA and / or RNA from a biological sample of an individual requiring diagnosis of pathogenic microsporidian infection (microsporidianosis), amplifying a target sequence by performing multiplex real-time PCR using any one of the primer set, composition, and kit with said DNA and / or RNA as a template, and detecting the amplified product.

[0035] According to another embodiment of the present invention,

[0036] (1) A step of isolating genomic DNA (gDNA) from a biological sample;

[0037] (2) a step of amplifying the target sequence by performing a real-time PCR reaction using the isolated gDNA as a template and primers and probes of SEQ ID NOs 1 to 9; and

[0038] (3) A step of detecting the amplified product; a method for providing information for testing for pathogenic microsporidia infection is provided.

[0039] In the present invention, the “individual” is not limited to mammals requiring diagnosis of microsporidiasis, but preferably may be a human. Additionally, in the present invention, the “biological sample” is not limited to smear samples, wash samples, etc., from a site in the body where microsporidia can be detected, but preferably may be one or more of sputum, bronchial aspiration and bronchial washing fluid, body fluid, saliva, urine, feces, dermal lesion swab, cerebrospinal fluids, blood, serum, plasma, peripheral blood monocyte, peripheral blood leukocyte, cervical smears, and pharyngeal swab, and most preferably may be feces.

[0040] In the present invention, "multiplex polymerase chain reaction" refers to a PCR technique that simultaneously amplifies multiple genes, unlike single PCR which amplifies a single gene on a single template DNA. In multiplex PCR, multiple primer sets are included in a single PCR mixture; in this case, it is desirable to ensure that the sizes of the amplification products do not overlap by providing specific size ranges for each different DNA sequence. Since multiple types of different primer sets are placed in a single tube and reacted in the multiplex PCR technique, interference and inhibition between primers may occur; therefore, when applying multiplex PCR, the selection of primers for the genes to be amplified is important. Furthermore, since the appropriate annealing temperature may differ for each included primer set, when applying multiplex PCR, optimization of the annealing temperature suitable for multiplex PCR is required so that all PCR primer sets included in the single PCR reaction can effectively anneale.

[0041] In the present invention, "real-time polymerase chain reaction" refers to a PCR technique capable of verifying quantitative information of an amplified gene in real time. In this method, quantitative information can be obtained by measuring and analyzing the phenomenon in which a PNA probe binds to an amplified base sequence to generate fluorescence, and the fluorescence is quenched as it dissociates.

[0042] The kit comprising the primer set of the present invention is preferably used for real-time PCR for the diagnosis of microsporidiasis. In addition to the primer set, the kit may include other substances for properly performing the PCR reaction, and DNA polymerase, buffer solution, dNTPs, etc. may be non-limiting examples.

[0043] In the present invention, "primer" refers to a single-stranded oligonucleotide that can act as a starting point for template-directed DNA synthesis under appropriate conditions in a suitable buffer solution (e.g., four different nucleoside triphosphates and a polymerizer such as DNA, RNA polymerase, or reverse transcriptase) and at a suitable temperature. The appropriate length of the primer may vary depending on the intended use, but is typically 15 to 30 nucleotides. Shorter primer molecules generally require lower temperatures to form a stable hybrid with the template. The primer sequence does not need to be perfectly complementary to the template, but must be sufficiently complementary to hybridize with the template.

[0044] The primers of the present invention can be chemically synthesized using methods known in the art, such as the phosphoramidite solid support method. Additionally, they can be modified by methylation, capping, etc., using known methods. Furthermore, if necessary, the primers of the present invention may include a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. Examples of labels include enzymes (e.g., horseradish peroxidase, alkaline phosphatase), radioisotopes (e.g., 32P), fluorescent molecules, chemical groups (e.g., biotin).

[0045] In the present invention, “quencher” refers to a substance that normally absorbs the fluorescence of a fluorescent labeling substance of a probe, but when the probe is degraded, the fluorescent labeling substance and the quencher separate from each other, allowing the fluorescent labeling substance to emit fluorescence. Preferred examples may be selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1 (black hole quencher 1), BHQ2 (black hole quencher 2), BHQ3 (black hole quencher 3), NFQ (nonfluorescent quencher), dabcyl, Eclipse, DDQ (Deep Dark Quencher), Blackberry Quencher, and Iowa Black.

[0046] In the present invention, an internal control may be optionally used. The internal control serves to verify whether an appropriate polymerase chain reaction has been performed, and preferably, it may be labeled with a fluorescent label different from the primer / probe set for detecting microsporidia.

[0048] Hereinafter, embodiments are described in detail with reference to the attached drawings. However, various modifications may be made to the embodiments, and thus the scope of the patent application is not limited or restricted by these embodiments. It should be understood that all modifications, equivalents, and substitutions to the embodiments are included within the scope of the rights.

[0050] The terms used in the embodiments are for illustrative purposes only and should not be interpreted as intended to be limiting. Singular expressions include plural expressions unless the context clearly indicates otherwise. In this specification, terms such as "comprising" or "having" are intended to indicate the existence of the features, numbers, steps, actions, components, parts, or combinations thereof described in the specification, and should be understood as not precluding the existence or addition of one or more other features, numbers, steps, actions, components, parts, or combinations thereof.

[0052] Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as generally understood by those skilled in the art to which the embodiments pertain. Terms such as those defined in commonly used dictionaries should be interpreted as having a meaning consistent with their meaning in the context of the relevant technology, and should not be interpreted in an ideal or overly formal sense unless explicitly defined in this application.

[0054] In addition, when describing with reference to the attached drawings, identical components are assigned the same reference numeral regardless of drawing symbols, and redundant descriptions thereof are omitted. In describing the embodiments, if it is determined that a detailed description of related prior art could unnecessarily obscure the essence of the embodiments, such detailed description is omitted.

[0056] Example 1. Development of Primers and Probes

[0057] Example 1-1. Design of Primer and Probe for Detecting Enc. intestinalis

[0058] It was decided to use the SSU rRNA gene as the target gene for PCR analysis of Enc. intestinalis. Reference sequences registered in the public database of NCBI were collected and expanded by performing BLAST. As a result, specific detection of Enc. intestinalis was possible at regions with high genetic homology, and the region where the optimal Tm value was secured was identified; based on this, primers and probes were designed. The design process is shown in Figure 1.

[0059] The primers were designed with a melting temperature (Tm) of 55 to 60°C and a length of 18 to 29 mers, and the probes were designed with a Tm of 68 to 70°C and a length of 34 mers or less. The Tm values ​​were verified using Primer Express Software for Real-time PCR (Ver. 3.0.1). The primer and probe information is shown in Table 1 below.

[0060] Target gene Sequence number designation Sequence(5'->3') Amplification product (bp) SSU rRNA 1 Forward primer CACGGGATTGATAGGCATTAGC 84bp 2 Reverse primer CTTCCGCTTCATTCAGACATCC 3 Probe TCCTCCTACACGTCCT

[0061] Examples 1-2. Design of Primer / Probe for Ent. Bieneusi Detection

[0062] For the PCR analysis of Ent. bieneusi, the SSU rRNA gene and the ITS gene were selected as target genes. To specifically detect Ent. bieneusi, reference sequences registered in the publicly available database of NCBI were collected and expanded through BLAST. As a result, the ITS region, which demonstrated specificity in silico, was selected as the target gene region. The design was then considered to enable the detection of ITS groups 1 through 10, which are classified into various groups based on genotype. The design process is illustrated in Figure 2.

[0063] A primer and probe set was designed for the ITS region, where specific detection of Ent. bieneusi is possible in regions with high genetic homology based on DNA sequence BLAST results and optimal Tm values ​​are secured, and this is shown in Table 2.

[0064] Target gene Sequence number designation Sequence(5'->3') Amplification product (bp) ITS 4 Forward primer CCCTACTGCCGCTCGCA 84bp 5 Reverse primer1 CATGKGGAATAGTGGGATTGGT 6 Reverse primer2 CATGKGGAACGAGGGGATG 7 Reverse primer3 CATGGGAAATAGTGGGATTGGT 8 Probe1 AACCTCCRATTTTYCTCACCCATACACA 9 Probe2 CGCAACCTCCGATTTTTCTTACCCATACAC

[0065] Examples 1-3. In silico analysis of primers / probes

[0066] The sequence concordance between the primers and probes designed to confirm cross-reactivity with infectious protozoa, bacteria, and viruses that may cause symptoms similar to pathogenic microsporidia Enc. intestinalis or Ent. bieneusi was analyzed and is shown in Tables 3 and 4 below, respectively. As a result, the concordance rate between the selected protozoa, bacteria, and viruses and the designed primers and probes was low, so it was predicted that no non-specific amplification signals with other species would occur.

[0067] classification pathogen source DNA sequence homology (%) Forward Primer reverse direction primer probe protozoa Enterocytozoon bieneusi AF023245 72.7 69.6 72.2 Encephalitozoon cuniculi NC_003237 77.3 81.8 83.3 Encephalitozoon hellem NC_018479 80.0 79.2 93.8 Cryptosporidium parvum BX526834 77.3 77.3 81.3 Giardia lamblia NC_003555 73.1 63.6 75.0 Cyclospora cayetanensis CM037477 70.8 63.6 70.6 Kudoa septempunctata LC616854 69.2 63.6 66.7 Entamoeba dispar EDU73710 62.5 63.6 75.0 Entamoeba histolytica ENHGA170S 63.6 63.6 68.8 fungi Candida albicans AF051313 62.9 63.6 66.7 Penicillium species WIWV01000083 68.2 77.3 77.8 Aspergillus species CM033101 36.36 18.18 43.75 virus Rotavirus KX420939 62.5 62.2 62.5 Norovirus MW939576 63.6 68.2 81.3 Adenovirus AC_000007 68.2 77.3 81.3 Influenza MK806577 70.8 68.2 75 Enterovirus MN515037 72.7 63.6 68.8 Rhinovirus K02121 63.6 63.6 72.2 SARS-CoV2 NC_045512 72.7 69.6 81.3 bacteria Salmonella Enteritis LSHA01000031 77.3 77.3 81.3 Campylobacter coli CP076513 78.3 75 81.3 Escherichia coli CP042982 79.2 82.6 81.3 Shigella sonnei NZ_MW396859 72.7 81.8 81.3 Bacillus cereus CM000729 81.8 79.2 87.5 Clostridium perfringens CLOCPAA 69.6 68.2 68.8 Listeria monocytogenes CP006858 81.8 79.2 87.5 Staphylococcus aureus NC_021657 59.1 68.2 62.5 Vibrio vulnificus CP046835 86.4 81.8 81.3 Yersinia enterocolitica AM286415 81.8 81.8 87.5

[0068] classification pathogen source DNA sequence homology (%) Forward direction primer Reverse Primer 1 Reverse Primer 2 Reverse Primer 3 Probe 1 Probe 2 protozoa Encephalitozoon intestinalis CP001942 76.5 71.2 76.3 76.9 62.5 70.0 Encephalitozoon cuniculi NC_003237 78.9 79.5 86.8 86.4 60.3 71.0 Encephalitozoon hellem NC_018479 82.4 75.0 81.6 70.8 74.2 71.9 Cryptosporidium parvum BX526834 76.5 75.0 82.5 68.2 72.4 67.7 Giardia lamblia NC_003555 70.6 68.2 71.1 63.6 62.1 61.3 Cyclospora cayetanensis CM037477 66.7 65.9 71.1 59.1 61.3 54.5 Kudoa septempunctata LC616854 70.6 68.0 71.1 68.0 63.8 67.7 Entamoeba dispar EDU73710 58.8 67.3 60.5 61.5 53.6 56.7 Entamoeba histolytica ENHGA170S 72.2 72.9 60.5 70.8 67.9 56.7 fungi Candida albicans AF051313 64.7 70.5 71.1 63.6 58.9 61.3 Penicillium species WIWV01000083 78.9 75.0 77.5 72.7 73.2 66.7 Aspergillus species CM033101 82.4 0.0 78.9 70.5 78.6 66.7 virus Rotavirus KX420939 58.8 70.5 65.8 68.2 67.7 57.6 Norovirus MW939576 77.8 65.9 81.6 63.6 67.9 60.0 Adenovirus AC_000007 78.9 70.5 76.3 63.6 69.6 60.0 Influenza MK806577 64.7 68.8 68.4 62.5 66.7 65.6 Enterovirus MN515037 70.6 67.4 70.0 65.2 65.0 65.6 Rhinovirus K02121 76.5 68.8 65.9 70.8 69.6 66.7 SARS-CoV2 NC_045512 76.5 72.7 73.7 77.3 66.1 64.5 bacteria Salmonella Enteritis LSHA01000031 82.4 75.0 78.9 81.8 70.6 69.4 Campylobacter coli CP076513 76.5 75.0 76.3 72.7 72.4 73.3 Escherichia coli CP042982 88.9 80.4 89.5 78.3 69.6 77.4 Shigella sonnei NZ_MW396859 76.5 70.5 76.3 63.6 69.6 63.3 Bacillus cereus CM000729 82.4 79.5 81.6 72.7 73.2 63.3 Clostridium perfringens CLOCPAA 63.2 68.2 65.0 68.2 60.7 53.3 Listeria monocytogenes CP006858 76.5 80.4 81.6 78.3 71.4 73.3 Staphylococcus aureus NC_021657 58.8 65.9 55.3 59.1 58.3 50.0 Vibrio vulnificus CP046835 82.4 79.5 81.6 72.7 75.0 66.7 Yersinia enterocolitica AM286415 82.4 75.0 81.6 68.2 73.2 66.7

[0070] Example 2. Optimization of Multiplex Real-time RT-PCR Conditions

[0071] Example 2-1. Verification of Primer and Probe Performance

[0072] Primers and probe oligos were synthesized for the detection of Enc. intestinalis, Ent. bieneusi, and an internal control. For the TaqMan probe reporter dyes, FAM was used for Enc. intestinalis, JOE for Ent. bieneusi, and Cy5 for the internal control.

[0073] Real-time PCR amplification curves for each positive sample were examined using the synthesized primer and TaqMan probe sets, and it was confirmed that normal amplification curves were observed only in the genomic DNA, which is the detection target (Fig. 3). The left side of Fig. 3 shows the Enc. intestinalis primer / probe set, and the right side shows the Ent. bieneusi primer / probe set.

[0074] The real-time PCR reaction mixture was prepared by adding 5 μL of template DNA and TE buffer to 1 μL each of forward and reverse primers diluted to 250 nM, 1 μL of TaqMan probe diluted to 100 nM, and 10 μL of 2X Real-time PCR MasterMix (Kogenebiotech) to make the final volume 20 μL. The PCR conditions involved a UDG treatment process at 50°C for 2 minutes to prevent cross-contamination, followed by polymerase activation at 95°C for 10 minutes, and then a total of 40 replicates were performed, with 15 seconds at 95°C and 1 minute at 60°C constituting one replicate.

[0076] Example 2-2. Establishment of Primer and Probe Concentration Conditions

[0077] The optimized primer / probe concentration conditions and PCR inhibition confirmation test data were verified and are presented in Table 5 and Figure 4 below. In Figure 4, the red curve represents Enc. intestilians, the blue curve represents Ent. bieneusi, and the black curve represents the internal positive control, respectively. The experimental results showed that there was no significant difference in the Ct values ​​for target DNA detection between the single-system reaction mixture containing a single primer / probe and the multi-system reaction mixture containing multiple primers / probes, nor was there a significant difference in the shape of the amplification curves (Figure 4 and Table 6).

[0078]

[0079]

[0081] Example 3. Preparation of Positive Standard Material

[0082] The characteristics of the positive standard material were plasmid DNA containing the amplification sequences of each primer, and its preparation method was as follows.

[0083] First, the provided positive sample was amplified using the primers of this kit and then inserted into a vector according to the instructions of the pGEM T-Easy Vector System (Promega, Madison, USA). The cloning vector used was Promega's pGEM-T Easy Vector Systems I (product number A1630). Subsequently, the recombinant DNA was introduced into DH5a (Intron, Korea) cells and cultured, after which the plasmid DNA was extracted.

[0084] After submitting the recombinant plasmid DNA to a specialized sequencing company for bidirectional sequencing analysis using M13 primers, the match between the inserted primers and probes was verified using the NCBI (National Center for Biotechnology Information) Global Align tool or the Geneious program.

[0085] Restriction enzyme treatment was carried out as follows. First, the plasmid with completed base sequence analysis was linearized by treating it with a restriction enzyme. Subsequently, the concentration of the plasmid was measured using a NanoDrop Spectrophotometer. The restriction enzyme used was Enzynomics' Sac I (product number R005M), and the reaction conditions were as shown in Table 7 below. After reacting at 37°C for 1 hour, the enzyme was inactivated by standing at 65°C for 20 minutes. The enzyme-treated DNA was then purified using the Qiaquick PCR purification Kit (Qiagen, Germany) according to the product manual.

[0086] Components Volume (μL) 10X Enzyme buffer 5 Sac Ⅰ 1 Plasmid DNA χ (10 μg) Nuclease-free water χ (up to 50) Final volume 50

[0087] DNA quantification was performed by measuring the plasmid concentration of the purified DNA using a NanoDrop Spectrophotometer, and calculating the copy number using the measured DNA concentration and base sequence length. The formula for calculating the copy number is as follows.

[0088] DNA copy number = (DNA concentration x 6.022 x 10⁻⁶ 23 ) / {plasmid size (vector size + amplification product size) x 1 x 10 9 x 650}

[0089] The amplification curve was confirmed by performing real-time PCR on the positive standard plasmid DNA synthesized in this way and is shown in Fig. 5. In Fig. 5, (a) represents Enc. intestinalis, (b) represents Ent. bieneusi, and (c) represents the internal control.

[0090] The produced positive control group was prepared so that the Ct was in the 23±3 range and is shown in Fig. 6.

[0094] Example 4. Performance Evaluation

[0095] Example 4-1. Specificity

[0096] The specificity of the multiplex real-time PCR system identified above was evaluated through a cross-reaction test. Real-time PCR was performed using nucleic acids from various biological species, including infectious protozoa, viruses, and human genomic DNA that may cause similar symptoms, and the detection results for each sample were analyzed. The cross-reaction test results confirmed that detection reactions occurred in the respective fluorescent channels only for the targets Enc. intestinalis and Ent. bieneusi, while no detection reactions occurred for nucleic acids of other species (Table 8 below). In addition, the internal control (IC) elicited amplification reactions in all samples, confirming the validity of the PCR reaction and verifying the specificity of the reagent.

[0097] classification Pathogen / Animal Species Enc. intestinalis (FAM) Ent. bieneusi (JOE) IC (Cy5) protozoa Encephalitozoon intestinalis + - + Enterocytozoon bieneusi - + + Encephalitozoon cuniculi - - + Encephalitozoon hellem - - + Cryptosporidium parvum - - + Giardia lamblia - - + Cyclospora cayetanensis - - + Kudoa septempunctata - - + Entamoeba dispar - - + Entamoeba histolytica - - + fungi Candida albicans - - + Penicillium species - - + Aspergillus species - - + virus Rotavirus - - + Norovirus GⅠ - - + Norovirus GⅡ - - + Adenovirus 1 - - + Adenovirus 2 - - + Influenza A Virus - - + Influenza B Virus - - + Enterovirus - - + Rhinovirus - - + SARS-CoV2 - - + Coronavirus HKU1 - - + bacteria Salmonella Enteritis - - + Salmonella Typhimurium - - + Campylobacter coli - - + Campylobacter jejuni - - + Campylobacter rectus - - + E.coli O157:H7 - - + E.coli O157:H7 - - + E.coli O78:K80:H12 - - + E.coli O91:H21 - - + E.coli O25:K98:HNM - - + E.coli O78:H11 - - + Shigella boydii - - + Shigella flexneri - - + Shigella sonnei - - + Bacillus cereus - - + Bacillus subtilis - - + Bacillus thuringiensis - - + Clostridium perfringens - - + Listeria monocytogenes - - + Listeria welshimeri - - + Listeria innocua - - + Staphylococcus aureus - - + Vibrio parahaemolyticus - - + Vibrio vulnificus - - + Yersinia enterocolitica - - + Pseudomonas aeruginosa - - + bell Human gDNA - - +

[0098] Example 4-2. Limit of detection

[0099] For the detection limit confirmation test, the prepared positive standard materials were used after sequentially diluting them tenfold (105–100 copies / μL). Standard curves were constructed using the measured Ct values ​​and concentrations, and all results showed R 2 The value was greater than 0.99, and the PCR efficiency calculated from the slope was found to be close to 90%–110%, confirming the linearity and efficiency of the system (Figs. 7 and 8).

[0101] [Formula] PCR Efficiency = 10 (-1 / slope) -1

[0102] The detection limit for each target in the Microsporidia Multiplex Real-time PCR Kit is 1.0 x 10⁻⁶ for both Enc. intestinalis and Ent. bieneusi. 0 It was confirmed as copy / μL and is shown in Table 9 below.

[0103] Positive standard substance concentration (copies / μL) Average Ct value Enc. intestinalis Ent. bieneusi 1.0 X 10 5 20.0 19.3 1.0 X 10 4 23.0 22.4 1.0 X 10 3 25.8 25.3 1.0 X 10 2 28.6 28.2 1.0 X 10 1 31.2 31.3 1.0 X 10 0 34.8 35.6 R 2 0.999 0.999 PCR efficiency 105% 105%

[0104] Example 4-3. Precision

[0105] The precision of the reagents developed in this study was evaluated by inter-day and inter-run repeatability. Three concentrations of positive standard substances were tested for each target, and low, medium, and high concentrations were set based on the detection limit test results. Samples for each target were tested once a day for 5 days, with two replicates per sample concentration. The inter-day coefficient of variation (%) calculated from the precision test results was less than 5%, confirming the precision of the primer set of the present invention (Tables 10 and 11).

[0106] Target Positive standard substance concentration Average Ct value Standard deviation Coefficient of variation (%) Enc. intestinalis High concentration 33.5 0.15 0.00 Intermediate concentration 34.5 0.20 0.01 low concentration 35.4 0.26 0.01 Ent. bieneusi High concentration 34.0 0.20 0.01 Intermediate concentration 35.0 0.21 0.01 low concentration 36.1 0.18 0.00

[0107] Date (day) Positive standard material density Enc. intestinalis Ct value Ent. bieneusi Ct value Repeat 1 Repeat 2 Repeat 1 Repeat 2 1 High concentration 33.3 33.7 34.1 34.2 Intermediate concentration 34.2 34.7 35.3 34.9 low concentration 35.0 35.3 36.1 35.9 2 High concentration 33.3 33.7 34.0 34.0 Intermediate concentration 34.3 34.7 35.3 34.7 low concentration 35.2 36.0 36.0 36.3 3 High concentration 33.5 33.7 34.1 33.8 Intermediate concentration 34.4 34.7 34.7 35.1 low concentration 35.3 35.6 36.3 35.9 4 High concentration 33.5 33.6 33.8 34.4 Intermediate concentration 34.4 34.5 35.1 35.0 low concentration 35.3 35.6 36.2 36.3 5 High concentration 33.5 33.6 34.0 34.0 Intermediate concentration 34.4 34.7 35.0 34.9 low concentration 35.6 35.3 36.1 36.3

[0110] Although the embodiments have been described above with reference to the limited drawings, those skilled in the art can apply various technical modifications and variations based on the above. For example, suitable results may be achieved even if the described techniques are performed in a different order than described, and / or if the components of the described system, structure, device, circuit, etc. are combined or assembled in a form different from described, or replaced or substituted by other components or equivalents.

[0111] Therefore, other implementations, other embodiments, and equivalents to the claims also fall within the scope of the claims set forth below.

[0113] This invention was completed with the support of the internal research project of the institution, “Prevention and Management of Tropical Endemic and Parasitic Diseases” (Project No.: 4837-311).

Claims

Claim 1 A primer set for detecting pathogenic microsporidia, comprising six primers each consisting of the nucleotide sequences of SEQ ID NOs. 1, 2 and 4 to 7. Claim 2 A primer set for detecting pathogenic microsporidians, wherein the primer set further comprises three probes each consisting of the nucleotide sequences of SEQ ID NOs. 3, 8, and 9. Claim 3 In claim 2, a primer set for detecting pathogenic microsporidians, wherein each of the three probes comprises a fluorescent label at the 5' end. Claim 4 In claim 3, the fluorescent labeling substance is FAM (6-carboxyfluorescein), Texas Red, fluorescein, HEX (2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein), fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethyl rhodamine, FITC (fluorescein isothiocyanate), Oregon Green, Alexa Fluor, JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-XRhodamine), TET (Tetrachloro-Fluorescein), TRITC (tertramethylrodamine isothiocyanate), A primer set for detecting pathogenic microsporidians, comprising one or more selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine-based dyes, and thiadicarbocyanine. Claim 5 A composition for detecting pathogenic microsporidians, comprising a primer set according to any one of claims 1 to 4. Claim 6 A kit for detecting pathogenic microsporidians comprising the composition of claim 5. Claim 7 (1) a step of isolating genomic DNA (gDNA) of a biological sample; (2) a step of amplifying a target sequence by performing a real-time PCR reaction using the isolated gDNA as a template and 6 primers each consisting of the nucleotide sequences of SEQ ID NOs. 1, 2 and 4 to 7 and 3 probes each consisting of the nucleotide sequences of SEQ ID NOs. 3, 8 and 9; and (3) a step of detecting the amplified product; comprising a method for providing information for testing for infection with pathogenic microsporidia. Claim 8 In claim 7, the sample of step (1) is one or more selected from the group consisting of sputum, bronchial aspiration and bronchial washing, body fluid, saliva, urine, feces, dermal lesion swab, cerebrospinal fluids, blood, serum, plasma, peripheral blood monocyte, peripheral blood leukocyte, cervical smears and pharyngeal swab, a method for providing information for testing for pathogenic microsporidia infection.

Images