Composition for improving skin, comprising Rhododendron weyrichii Maxim. Extract as effective components, Cosmetic composition and Food functional composition including the same

Abstract

The present invention relates to a skin-improving composition comprising an extract of Rhododendron yedoense var. poukhanense as an active ingredient. More specifically, the invention relates to a composition that is effective in improving the skin by containing extracts of the stem, leaves, and branches of Rhododendron yedoense var. poukhanense as active ingredients, thereby increasing cell survival rates by inhibiting apoptosis caused by oxidative stress, and by suppressing reactive oxygen species through increased mitochondrial DNA synthesis and functional activation.

Description

Technology Field

[0001] The present invention relates to a skin-improving composition containing a rhododendron extract as an active ingredient, a skin-improving cosmetic composition and a health functional food composition containing the same. Background Technology

[0003] Since the skin is the first indicator of the degree of aging, many people are striving to prevent it through various methods. In particular, Reactive Oxygen Species (ROS), generated by ultraviolet rays, stress, and environmental pollutants, are considered the most significant cause of skin aging and contribute to wrinkles, atopic dermatitis, and skin inflammation. Therefore, existing cosmetic formulations aim to mitigate damage caused by ROS by utilizing antioxidants to combine with or neutralize free radicals.

[0004] Meanwhile, skin cells stimulating external sources require high energy to defend themselves. In the case of the dermis, it is known that energy is primarily supplied through the process of oxidative phosphorylation in mitochondria. If energy production decreases, the body fails to receive sufficient energy for the synthesis of collagen and elastic fibers, as well as for the synthesis of antioxidant enzymes. This can lead to reduced expression of collagen and elastic fibers, resulting in the formation of skin wrinkles.

[0005] Furthermore, if reactive oxygen species increase due to mitochondrial dysfunction, these substances can promote melanin production, induce pigmentation, and oxidize proteins, fats, cell membranes, and nucleic acids within the skin, potentially further accelerating skin aging.

[0006] Furthermore, unlike nuclear DNA, mitochondrial DNA lacks its own repair mechanism and histone proteins that protect DNA, making it relatively susceptible to damage. Consequently, when mitochondrial DNA damage and dysfunction occur due to aging and reactive oxygen species, energy production decreases, and simultaneously, electron leakage increases, leading to the generation of more reactive oxygen species. These increased reactive oxygen species then target mitochondria, causing mitochondrial dysfunction and resulting in the generation of excessive reactive oxygen species (Prahl, S., et al., 2008, 32.1-4: 245-255).

[0007] Against this technological backdrop, promoting mitochondrial energy production through mitochondrial protection and functional activation can be suggested as a method to inhibit oxidative stress and prevent skin aging. The problem to be solved

[0009] Accordingly, the objective of the present invention is to provide a composition that improves the skin by utilizing natural substances from the Korean rosebay, which is eco-friendly, protects skin cells by inhibiting cell death from oxidative stress, and suppresses free radicals by increasing mitochondrial DNA synthesis and activating function within skin cells.

[0010] An additional objective of the present invention is to provide an eco-friendly cosmetic composition for skin improvement that is harmless to the human body.

[0011] Another objective of the present invention is to provide an eco-friendly health functional food composition for skin improvement that is harmless to the human body. means of solving the problem

[0013] To achieve the above objective, the present invention provides a skin-improving composition comprising a rhododendron extract as an active ingredient.

[0014] According to one embodiment of the present invention, it is preferable that the skin improvement is antioxidant and anti-aging.

[0015] According to one embodiment of the present invention, the composition is preferably for protecting skin cells against oxidative stress.

[0016] According to one embodiment of the present invention, the composition is preferably for improving skin by protecting mitochondria and activating their functions.

[0017] According to one embodiment of the present invention, the composition is preferably for improving skin wrinkles.

[0018] According to one embodiment of the present invention, the composition is preferably for promoting skin vitality.

[0019] According to one embodiment of the present invention, the composition is preferably for improving skin by reducing reactive oxygen species (ROS).

[0020] According to one embodiment of the present invention, the composition preferably contains a rhododendron extract in an amount of 0.0001 to 10% by weight relative to the total weight of the composition.

[0021] According to one embodiment of the present invention, the extract of the Korean rhododendron is preferably extracted with water, an organic solvent, or a mixture thereof.

[0022] According to one embodiment of the present invention, the organic solvent is preferably one or more selected from methanol, ethanol, propyl alcohol, butyl alcohol, glycerin, propylene glycol, and butylene glycol.

[0023] According to one embodiment of the present invention, it is preferable that the composition be used as a cosmetic composition.

[0024] According to one embodiment of the present invention, it is preferable that the cosmetic composition is a formulation selected from the group consisting of an aqueous solution, a suspension, an emulsion, a paste, a gel, a cream, a lotion, a powder, a soap, a surfactant-containing cleansing product, an oil, a powder foundation, an emulsion foundation, a wax foundation, and a spray.

[0025] According to one embodiment of the present invention, the cosmetic composition is preferably one of the color cosmetic formulations selected from water-in-oil type and water-in-oil type makeup bases, foundations, skin covers, lipsticks, lip glosses, face powders, two-way cakes, eyeshadows, cheek colors, and eyebrow pencils.

[0026] According to one embodiment of the present invention, it is preferable that the composition is a health functional food composition.

[0027] According to one embodiment of the present invention, the health functional food composition is preferably in the form of a capsule, tablet, granule, powder, or beverage. Effects of the invention

[0029] The composition according to the present invention exhibits a cell-protective effect by inhibiting apoptosis from oxidative stress and increasing cell survival rate, thereby exhibiting skin elasticity, anti-wrinkle, and anti-aging effects.

[0030] The composition according to the present invention has the effect of protecting mitochondria and improving the skin by increasing mitochondrial DNA synthesis in response to oxidative stress and activating functions by increasing ATP production, which is a major function.

[0031] In addition, the composition according to the present invention has the effect of increasing skin vitality by increasing ATP production, which is a major function of mitochondria.

[0032] In addition, the composition according to the present invention reduces the amount of ROS generated, thereby exhibiting the effect of improving skin problems such as wrinkles, atopy, and dermatitis.

[0033] The composition according to the present invention exhibits the effect of preventing skin cell aging.

[0034] The composition according to the present invention has safety that does not adversely affect skin cells, and since it provides antioxidant effects and prevents skin cell aging, it can be widely applied to topical skin preparations, cosmetic compositions, and pharmaceutical compositions. Brief explanation of the drawing

[0036] Figure 1 shows the results of confirming cytotoxicity of human normal fibroblasts treated with extracts of the stem, leaves, and branches of Rhododendron yedoense var. poukhanense using an MTT assay. (Human normal fibroblasts without any treatment were used as the control group, and human normal fibroblasts treated with DMSO were used as the negative control.) Figure 2 shows the results of confirming the cytoprotective effect against hydrogen peroxide on human normal fibroblasts treated with extracts of the stem, leaf, and branch of Rhododendron yedoense var. poukhanense using an MTT assay. (Human normal fibroblasts without any treatment were used as the control group, human normal fibroblasts treated with hydrogen peroxide only were used as the negative control group, and human normal fibroblasts treated with hydrogen peroxide and 10 μM ascorbic acid were used as the positive control group.) Figure 3 shows the results of measuring the mitochondrial DNA copy number of human normal fibroblasts treated with extracts of the stem, leaf, and branch of Rhododendron yedoense var. poukhanense using real-time PCR. (Human normal fibroblasts without any treatment were used as the control group, human normal fibroblasts treated only with hydrogen peroxide were used as the negative control group, and human normal fibroblasts treated with hydrogen peroxide and 10 μM ascorbic acid were used as the positive control group.) Figure 4 shows the results of measuring mitochondrial ATP synthesis in human normal fibroblasts treated with extracts of the stem, leaves, and branches of Rhododendron yedoense var. poukhanense. (Human normal fibroblasts without any treatment were used as the control group, human normal fibroblasts treated only with hydrogen peroxide were used as the negative control group, and human normal fibroblasts treated with hydrogen peroxide and 10 μM as the positive control group.) Figure 5 shows the results of measuring the amount of ROS produced in human normal fibroblasts treated with extracts of the stem, leaf, and branch of Rhododendron yedoense var. poukhanense using DCF-DA. (Human normal fibroblasts without any treatment were used as the control group, human normal fibroblasts treated only with hydrogen peroxide were used as the negative control group, and human normal fibroblasts treated with hydrogen peroxide and 10 μM ascorbic acid were used as the positive control group.) Specific details for implementing the invention

[0037] Hereinafter, the contents of the present invention will be explained in detail through the following examples. These examples are solely for the purpose of illustrating the present invention, and the scope of the present invention is not limited by these examples.

[0038] The composition according to the present invention is a skin-improving composition comprising a rhododendron extract as an active ingredient.

[0039] In the present invention, the term "for skin improvement" is a concept that encompasses all of the following: skin protection and improvement of skin condition, skin whitening, prevention or improvement of skin aging and wrinkles, skin moisturization, inhibition of sebum secretion, improvement of acne, pore reduction, skin protection and alleviation of inflammatory reactions of the skin, anti-inflammatory, skin barrier function, improvement of moisturization, enhancement of skin vitality, protection of the skin from ultraviolet rays, antioxidant and anti-aging effects.

[0040] In this invention, the concept of "skin" includes not only the face but also the scalp and the entire body.

[0041] Here, "containing as an active ingredient" means that it contains an amount of Rhododendron extract capable of exhibiting skin-improving effects.

[0042] Rhododendron weyrichii Maxim. is a deciduous broad-leaved shrub belonging to the family Rhododendronaceae, order Ericales, and class Dicotyledon. It is 3 to 6 cm tall. The leaves grow in clusters of three at the tips of branches and are broadly ovate.

[0043] Although all parts of the aforementioned Rhododendron can be used, including flowers, seeds, roots, leaves, and stems, the roots are particularly suitable for use and are preferably used after drying.

[0044] According to one embodiment of the present invention, the skin improvement is preferably antioxidant and anti-aging.

[0045] In this invention, the term "antioxidant" refers to inhibiting the generation of reactive oxygen species, the accumulation of which can lead to tissue cell aging and degenerative diseases.

[0046] In the present invention, the term "aging" refers to the occurrence of skin wrinkles, decreased skin elasticity, skin dryness, pigmentation, or reduced skin regenerative capacity resulting from a decline in cellular function due to internal or external factors within the skin, and the term "anti-aging" refers to preventing aging.

[0047] According to one embodiment of the present invention, the composition is preferably for protecting skin cells against oxidative stress.

[0048] In this invention, the term "oxidative stress" refers to a state in which the biological oxidation balance is disrupted due to an excess of reactive oxygen species in the body.

[0049] According to one embodiment of the present invention, the composition is preferably for improving skin by protecting mitochondria and activating their functions.

[0050] In the present invention, the term "protection of mitochondria and activation of function" refers to protecting mitochondria and continuously maintaining and activating their function through the synthesis of mitochondrial DNA and / or the synthesis of mitochondrial ATP.

[0051] According to one embodiment of the present invention, the composition is preferably for improving skin wrinkles.

[0052] According to one embodiment of the present invention, the composition is preferably for promoting skin vitality.

[0053] According to one embodiment of the present invention, the composition is preferably for improving skin by reducing reactive oxygen species (ROS).

[0054] In this invention, the term "reactive oxygen species (ROS)" refers to chemical substances containing chemically activated, i.e., unstable oxygen; generally, it is a collective term for molecules containing oxygen that have a higher chemical reactivity relative to oxygen, and is oxygen with strong oxidizing power that attacks biological tissues and damages cells.

[0055] According to one embodiment of the present invention, the composition preferably comprises 0.0001 to 10% by weight of a Rhododendron extract based on the total weight of the composition.

[0056] If the extract of the Korean rose of Sharon is included in an amount of less than 0.0001% by weight, it may be difficult to exhibit antioxidant and anti-aging effects, and if it is included in an amount of 10% or more by weight, the stability of the formulation, such as discoloration or change of odor, may be reduced, resulting in minimal antioxidant and anti-aging effects, and the scent may be unpleasant when manufactured into cosmetics, etc.

[0057] According to one embodiment of the present invention, the extraction method in the present invention is not particularly limited and includes, for example, cold maceration extraction, ultrasonic extraction, reflux extraction, hot water extraction, etc. Here, in the case of hot water extraction, a hot water extract is obtained by heating at 80 to 100°C for 8 to 48 hours in a hot water distiller. In the case of cold water extraction, for example, the tissue culture itself or its dried powder is mixed with cold water (15 to 25°C) and extracted for 3 days to obtain a cold water extract.

[0058] Alternatively, it may be prepared by a method of extraction using water, an organic solvent, or a mixture of solvents thereof. The extracted liquid may be used immediately or after concentration and / or drying. When extracting using an organic solvent, an organic solvent such as methanol, ethanol, isopropanol, butanol, ethylene, acetone, hexane, ether, chloroform, ethyl acetate, butyl acetate, dichloromethane, N,N-dimethylformamide (DMF), dimethyl sulfoxide (DMSO), 1,3-butylene glycol, propylene glycol, or a mixture thereof may be used, and extraction may be performed at room temperature or under heating conditions where the active ingredients of the herbal medicine are not destroyed or are minimized.

[0059] In one embodiment of the present invention, the extract of the Korean rhododendron is preferably extracted with water, an organic solvent, or a mixture thereof.

[0060] In particular, in the present invention, an ethanol extract, preferably a 20-80% ethanol extract, and as one embodiment, an 80% ethanol extract is preferred, and the extraction method is obtained by mixing with 80% ethanol and stirring for 3 days. In the present invention, the extract may be used after concentration or dilution, and a distillate of the extract may also be used.

[0062] According to one embodiment of the present invention, the organic solvent is preferably one or more selected from methanol, ethanol, propyl alcohol, butyl alcohol, glycerin, propylene glycol, and butylene glycol.

[0063] According to one embodiment of the present invention, it is preferable that the composition be used as a cosmetic composition.

[0064] According to one embodiment of the present invention, it is preferable that the cosmetic composition is a formulation selected from the group consisting of an aqueous solution, a suspension, an emulsion, a paste, a gel, a cream, a lotion, a powder, a soap, a surfactant-containing cleansing product, an oil, a powder foundation, an emulsion foundation, a wax foundation, and a spray.

[0065] According to one embodiment of the present invention, the cosmetic composition is preferably one of the color cosmetic formulations selected from water-in-oil type and water-in-oil type makeup bases, foundations, skin covers, lipsticks, lip glosses, face powders, two-way cakes, eyeshadows, cheek colors, and eyebrow pencils.

[0066] According to one embodiment of the present invention, it is preferable that the composition is a health functional food composition.

[0067] According to one embodiment of the present invention, the health functional food composition is preferably in the form of a capsule, tablet, granule, powder, or beverage.

[0068] The above cosmetic composition may include a carrier acceptable in cosmetic formulations. Here, "carrier acceptable in cosmetic formulations" refers to a compound or composition that is already known and in use or is to be developed in the future, which can be included in cosmetic formulations and does not have toxicity, instability, or irritation beyond what the human body can tolerate when in contact with the skin.

[0069] The carrier may be included in the cosmetic composition of the present invention in an amount of about 1% by weight to about 99.99% by weight, preferably about 90% by weight to about 99.99% by weight of the composition, based on the total weight thereof. However, since the above ratio varies depending on the formulation described below in which the cosmetic composition of the present invention is prepared, as well as on the specific application site (face, neck, etc.) or the preferred amount of application thereof, the above ratio should not be understood as limiting the scope of the present invention in any aspect.

[0070] Examples of the above carriers include alcohol, oil, surfactant, fatty acid, silicone oil, wetting agent, humectant, viscosity modifier, emulsion, stabilizer, UV scattering agent, UV absorber, colorant, fragrance, etc. Since compounds / compositions that can be used as the above alcohol, oil, surfactant, fatty acid, silicone oil, wetting agent, humectant, viscosity modifier, emulsion, stabilizer, UV scattering agent, UV absorber, colorant, fragrance, etc. are already known in the art, a person skilled in the art can select and use an appropriate substance / composition.

[0071] In one embodiment of the present invention, the cosmetic composition according to the present invention may include, in addition to the active ingredients, glycerin, butylene glycol, propylene glycol, polyoxyethylene hydrogenated castor oil, ethanol, triethanolamine, etc., and may include trace amounts of preservatives, fragrances, coloring agents, purified water, etc., as needed.

[0072] In addition, it may further include conventionally well-known physiologically active ingredients or other placental cell cultures or extracts.

[0073] In the present invention, the concept of skin includes not only the face but also the scalp and the entire body. Cosmetic compositions applicable to the scalp include shampoos, rinses, treatments, and hair growth agents, and can be manufactured in various forms for use as body cleansers applicable to the entire body.

[0074] The method for manufacturing a cosmetic composition according to the present invention is not limited to the aforementioned manufacturing method, and a person skilled in the art to which the present invention belongs may manufacture it by a method that partially modifies the above manufacturing method.

[0075] In addition, the cosmetic composition of the present invention may further contain auxiliary agents commonly used in the fields of cosmetics or dermatology, such as fatty substances, organic solvents, solvents, thickeners and gelling agents, emollients, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, surfactants, water, ionic or nonionic emulsifiers, fillers, metal ion chelating agents and chelating agents, preservatives, vitamins, blockers, humectants, essential oils, dyes, pigments, hydrophilic or lipophilic active agents, lipid vesicles, or any other ingredients commonly used in cosmetics. Furthermore, the above ingredients may be introduced in amounts commonly used in the field of dermatology.

[0076] According to another embodiment of the present invention, the health beverage composition of the present invention has no particular limitations on the liquid components other than containing the fraction as an essential component in the indicated proportion, and may contain various flavoring agents or natural carbohydrates as additional components, as in conventional beverages. Examples of the natural carbohydrates include monosaccharides, e.g., glucose, fructose, etc.; disaccharides, e.g., maltose, sucrose, etc.; and polysaccharides, e.g., dextrin, cyclodextrin, etc., as well as conventional sugars and sugar alcohols such as xylitol, sorbitol, erythritol, etc. As flavoring agents other than those described above, natural flavoring agents (thaumatin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) may be advantageously used. Furthermore, the proportion of the natural carbohydrates is generally about 1 to 20 g or about 5 to 12 g per 100 ml of the composition of the present invention.

[0077] In addition to the above, the composition of the present invention may contain various nutritional agents, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and promoters (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc.

[0078] In addition, the compositions of the present invention may contain fruit pulp for the production of natural fruit juices, fruit juice beverages, and vegetable beverages. These ingredients may be used independently or in combination. The proportion of these additives is generally selected in the range of 0 to about 20 parts by weight per 100 parts by weight of the composition of the present invention.

[0080] The present invention will be described in detail below according to the following examples. However, the following examples are intended only to explain the invention in more detail and should not be interpreted as a method of limiting the scope of the invention.

[0082] Example 1: Preparation of Rhododendron extract

[0083] Dried Rhododendron yedoense var. poukhanense was crushed into powder, and then immersed in twice the amount of 80% ethanol for more than 24 hours to extract the active ingredients. The extract thus obtained was filtered through filter paper, and then the solvent was removed using a rotary vacuum concentrator to prepare the extract.

[0085] [Test Example 1: Evaluation of Cytotoxicity of Rhododendron Extract]

[0086] In this test example, to confirm the cytotoxicity of the Rhododendron yedoense var. poukhanense extract, stem, leaf, and branch extracts of Rhododendron yedoense var. poukhanense were applied to human normal fibroblasts (CCD986sk) at different concentrations, and cell viability was measured.

[0087] 1 x 10⁶ human normal skin fibroblasts (CCD-986sk) 4After dispensing the cells into a 96-well plate at a cell / well concentration, the cells were cultured for 24 hours at 37°C under 5% CO2 conditions. After removing all the culture medium, 100 μL of samples prepared by diluting the stem, leaf, and branch extracts of Rhododendron yedoense var. poukhanense according to Example 1 to 0, 10, 50, 100, and 200 μg / mL, respectively, were added to each well in serum-free medium and cultured for an additional 24 hours. Subsequently, 100 μL of a 0.5 mg / ml MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) solution was added to each well and reacted for 3 hours. The resulting formazan was then dissolved in 200 μL of DMSO, and the absorbance was measured at a wavelength of 540 nm using a micro-plate reader. The cell viability of the sample-treated group was calculated relative to the normal control group, with the cell viability of the well with no treatment set to 100%, and the results are shown in Figure 1.

[0088] As a result of the experiment, no significant cytotoxic effects were observed in human normal fibroblasts treated with the extracts of Rhododendron yedoense var. poukhanense at 100 μg / mL of the stem, leaf, and branch extracts, respectively (Fig. 1). Therefore, Rhododendron yedoense var. poukhanense stem, leaf, and branch extracts at a concentration of 100 μg / mL were selected and used in the following experiment.

[0090] [Test Example 2: Confirmation of Cell Protective Effect of Rhododendron Extract]

[0091] In this experimental example, the protective effect of Rhododendron yedoense var. poukhanense extract against cell damage caused by oxidative stress was measured using a modified MTT method. Human normal skin fibroblasts (CCD-986sk) were 1 x 10⁶ 4Cells were dispensed into a 96-well plate at a concentration of cells / well and cultured for 24 hours at 37°C under 5% CO2 conditions. After removing the culture medium, the cells were treated with the stem, leaf, and branch extracts of Rhododendron yedoense var. poukhanense, prepared according to Example 1 and diluted to a concentration of 100 μg / mL, in serum-free medium, and cultured for an additional 24 hours. After the culture was completed, 800 μM hydrogen peroxide (H2O2) was applied for 3 hours to induce intracellular oxidative stress. After 3 hours, 100 μL of MTT solution at a concentration of 0.5 mg / mL was applied to each well and reacted for 3 hours; subsequently, the resulting formazan was dissolved in 100 μL of DMSO, and the absorbance was measured at a wavelength of 540 nm using a micro-plate reader. For the normal control group, wells that were not treated with the sample and hydrogen peroxide were used, and the cell viability of the normal control group was set to 100%. The cell viability of the hydrogen peroxide-only treatment group (negative control group), the sample and hydrogen peroxide treatment group, and the Ascorbic acid 10 μM treatment group were calculated relative to the normal control group, and the results are shown in Figure 2.

[0092] As a result of the experiment, in the case of the negative control group, cell viability decreased to 64.5% due to increased oxidative stress caused by hydrogen peroxide (H2O2); however, in the case of human normal fibroblasts treated with extracts of the stem, leaves, and branches of Rhododendron yedoense var. poukhanense, including 10 μM ascorbic acid, cell viability reduced by hydrogen peroxide (H2O2) was restored, demonstrating a cytoprotective effect. Figure 2 shows the results confirming the cytoprotective effect of Rhododendron yedoense var. poukhanense branch extract and Rhododendron yedoense var. poukhanense leaf extract on human normal fibroblasts treated at a concentration of 100 μg / mL.

[0094] [Test Example 3: Confirmation of the effect of Rhododendron extract on mitochondrial DNA synthesis]

[0095] In this study, we aimed to investigate the effect of Rhododendron yedoense extract on mitochondrial DNA synthesis. Human normal skin fibroblasts (CCD-986sk) were 1 x 10⁶ 5 After dispensing into a 6-well plate at cells / well concentration, 37 , cultured for 24 hours under 5% CO2 conditions. After removing the culture medium, the stem, leaf, and branch extracts of Rhododendron yedoense var. poukhanense, prepared according to Example 1 and diluted to a concentration of 100 μg / mL, were applied to the cells in serum-free medium and cultured for an additional 24 hours. After the culture was completed, 100 μM hydrogen peroxide (H2O2) was applied for 1 hour to induce intracellular oxidative stress. After 1 hour, 1 After washing with PBS, genomic DNA was extracted. Quantitative real-time PCR was performed on 50 ng of the extracted DNA using Power SYBR Green Supermix® (Thermo Fisher Scientific) and primers (COX II F: CAGGCCGACTAAATCAAGCAAC, R: CTAGGACAATGGGCATAAAGCT, Cyclophilin AF: TTCCTCCTTTCACAGAATTATTCCA, R: CCGCCAGTGCCATTATGG).

[0096] The number of intracellular mitochondria was measured by calculating the number of mitochondrial DNA copies by dividing the amount of COX II (Cytochrome oxidase subunit II) synthesized in mitochondria by the amount of cyclophilin A produced in the nucleus. As a normal control, the number of mitochondrial DNA copies of the sample and the group not treated with hydrogen peroxide was set to 1. The number of mitochondrial DNA copies of the group treated only with hydrogen peroxide (negative control) and the group treated with both the sample and hydrogen peroxide were calculated relative to the normal control, and the results are shown in Figure 3.

[0097] As a result of the experiment, the copy number of mitochondrial DNA (mtDNA) in the negative control group treated with hydrogen peroxide decreased by 0.49-fold compared to the normal control group. Additionally, in the experimental group treated with 10 μM ascorbic acid, the copy number decreased by 0.62-fold compared to the normal control group, a level similar to that of the negative control group. When samples at a concentration of 100 μg / mL of extracts from the stem, leaves, and branches of Rhododendron yedoense var. poukhanense were treated, the copy number of mitochondrial DNA (mtDNA) increased to the same level as that of the normal control group. An increase in the copy number of mitochondrial DNA (mtDNA) is a direct indicator showing increased mitochondrial production; while 10 μM ascorbic acid (Vit C) did not significantly increase mitochondrial DNA synthesis, it was confirmed that the extracts from the stem, leaves, and branches of Rhododendron yedoense var. poukhanense increased mitochondrial production.

[0099] [Test Example 4: Confirmation of the effect of Rhododendron extract on mitochondrial ATP synthesis]

[0100] In this study, since the primary function of mitochondria is ATP synthesis, we aimed to investigate the effect of Rhododendron yedoense var. poukhanense extract on ATP synthesis within mitochondria. Human normal fibroblasts, CCD-986sk, were placed in a 12-well plate at a rate of 5 x 10⁶ 4Cells were inoculated at a concentration of cells / well and cultured for 24 hours at 37°C under 5% CO2 conditions. Afterward, the culture medium was removed, and 1 ml of each of the stem, leaf, and branch extracts of Rhododendron yedoense var. poukhanense, prepared according to Example 1 and diluted to a concentration of 100 μg / mL respectively, was added to serum-free medium and cultured for an additional 24 hours. Subsequently, cells treated with 100 μM hydrogen peroxide for 1 hour were washed with PBS, and distilled water at 100°C was added and mixed several times to collect the cells. 10 µl of the supernatant obtained by centrifuging the collected cells at 12,000 xg for 5 minutes at 4°C was added to 90 µl of a pre-prepared ATP assay mixture, and the absorbance values ​​were measured. For the normal control group, wells that were not treated with the sample and hydrogen peroxide were used, and the cell viability of the normal control group was set to 100%. The amount of ATP in the hydrogen peroxide-only treatment group (negative control group) and the sample and hydrogen peroxide treatment group was calculated relative to the normal control group, and the results are shown in Figure 4.

[0101] Experimental results confirmed that the level of ATP synthesis in human normal fibroblasts, which had decreased to 65.8% due to hydrogen peroxide (H2O2) compared to the control group, increased to a level higher than that of the normal control group after treatment with extracts of the stems, leaves, and branches of the Korean rhododendron.

[0103] [Test Example 5: Confirmation of the effect of Rhododendron extract on ROS generation]

[0104] Reactive oxygen species generated within cells were measured using 2',7'-dichlorodihydrofluorescein diacetate (H2DCF-DA). H2DCF-DA is a lipid-soluble substance that easily permeates into cells and is hydrolyzed by esterase to produce the fluorescent substance DCF (dichlorofluorescein). Therefore, the amount of reactive oxygen species generated can be measured by measuring this. Cells obtained through substance treatment and hydrogen peroxide (H2O2) treatment were washed twice with DPBS, 100 μL of H2DCF-DA diluted to a concentration of 25 μM was added, and after incubation for 45 minutes under conditions of 37°C and 5% CO2, the fluorescence intensity of DCF initially oxidized to reactive oxygen species was measured using a fluorescence plate reader (Ex = 485 nm, Em = 530 nm). With the ROS generation level of the well treated only with hydrogen peroxide (negative control) set to 100%, the amount of ROS generated in the group not treated with either the sample or hydrogen peroxide and the group treated with the sample and hydrogen peroxide was calculated and is shown in Figure 5.

[0105] Here, the above sample refers to the stem, leaf, and branch extracts of the Rhododendron yedoense var. poukhanense, prepared according to Example 1 and diluted to a concentration of 100 μg / mL each.

[0106] As a result of the experiment, it was confirmed that the level of ROS production in human normal fibroblasts, which was increased by hydrogen peroxide (H2O2), decreased to 62.1%, 61.3%, and 64.7%, which is similar to the level of the control group that received no treatment.

[0107] According to the experimental results of Test Examples 1, 2, 3, 4, and 5, it was confirmed that treatment with the extract of the Korean rhododendron according to the present invention has the effect of protecting cells from hydrogen peroxide (H2O2), increasing the biosynthesis of mitochondrial DNA, synthesizing ATP which is the main function of mitochondria, and reducing the production of ROS. Therefore, it can be expected that the composition according to the present invention can effectively improve skin antioxidant activity and aging induced by oxidative stress in the skin.

[0109] Hereinafter, based on the results of the experimental examples described above, various formulation examples using the extract of the Korean rosebay are presented. However, these formulation examples are intended to explain the present invention, and it is obvious to those skilled in the art that the formulations of the present invention are not limited to these formulation examples.

[0111] <Formulation Example 1> Skin toner Ingredient name Content (weight%) Rhododendron extract 0.1 glycerin 5.0 1,3-Butylene Glycol 3.0 ethanol 5.0 polyoxyethylene nonylphenyl ether 0.5 spices Appropriate amount antiseptic Appropriate amount purified water Appropriate amount

[0113] <Formulation Example 2> Astringent lotion Ingredient name Content (weight%) Rhododendron extract 0.1 glycerin 3.0 Citric acid 0.1 ethanol 10.0 Polyoxyethylene oleyl ether 1.0 Sorbitol 2.0 spices Appropriate amount Bongbuje Appropriate amount purified water Appropriate amount

[0115] <Formulation Example 3> Lotion (emulsion) Ingredient name Content (weight%) Rhododendron extract 0.1 glycerin 5.0 1,3-Butylene Glycol 8.0 Squalan 10.0 Polyoxyethylene sorbitan monooleic acid 2.0 Triethanolamine 1.5 Glyceryl stearate 0.5 Stearylglycyrrhetinate 0.2 Carboxyvinyl polymer 0.1 Arginine 0.1 spices Appropriate amount antiseptic Appropriate amount purified water Appropriate amount

[0117] <Formulation Example 4> Cream Ingredient name Content (weight%) Rhododendron extract 0.1 glycerin 5.0 stearic acid 8.0 Squalan 5.0 Self-emulsifying monostearic acid glycerin 2.5 Polyoxyethylene sorbitan monostearic acid 1.5 Propylene glycol 4.0 Stearylglycyrrhetinate 0.2 vaseline 2.0 antioxidants Appropriate amount spices Appropriate amount antiseptic Appropriate amount purified water Appropriate amount

[0119] <Formulation Example 5> Health Drink Ingredient name Content (weight%) Rhododendron extract 0.5 Citric acid 10 Oligosaccharides 1.0 Plum concentrate 0.02 Taurine 0.01 spices Appropriate amount antiseptic Appropriate amount purified water Appropriate amount

Claims

Claim 1 A composition for enhancing skin vitality characterized by containing a rhododendron extract as an active ingredient. Claim 2 delete Claim 3 delete Claim 4 A composition for enhancing skin vitality according to claim 1, characterized in that the composition is for enhancing skin vitality by maintaining mitochondrial function and activating function. Claim 5 delete Claim 6 delete Claim 7 delete Claim 8 A composition for enhancing skin vitality according to claim 1, characterized in that the composition comprises a rhododendron extract in an amount of 0.0001 to 10% by weight relative to the total weight of the composition. Claim 9 A composition for enhancing skin vitality according to claim 1, characterized in that the above-mentioned extract of the Korean rose is extracted with water, an organic solvent, or a mixture thereof. Claim 10 A composition for promoting skin vitality according to claim 9, characterized in that the organic solvent is one or more selected from methanol, ethanol, propyl alcohol, butyl alcohol, glycerin, propylene glycol, and butylene glycol. Claim 11 A cosmetic composition for promoting skin vitality, characterized by comprising a composition according to any one of claims 1, 4, and 8 to 10. Claim 12 A cosmetic composition for enhancing skin vitality according to claim 11, characterized in that the cosmetic composition is any one formulation selected from the group consisting of an aqueous solution, a suspension, an emulsion, a paste, a gel, a cream, a lotion, a powder, a soap, a surfactant-containing cleansing product, an oil, a powder foundation, an emulsion foundation, a wax foundation, and a spray. Claim 13 A cosmetic composition for enhancing skin vitality according to claim 11, characterized in that the cosmetic composition is any one formulation selected from color cosmetic formulations consisting of water-in-oil type and water-in-oil type makeup bases, foundations, skin covers, lipsticks, lip glosses, face powders, two-way cakes, eyeshadows, cheek colors, and eyebrow pencils. Claim 14 A health functional food composition for promoting skin vitality, characterized by comprising a composition according to any one of claims 1, 4, and 8 to 10. Claim 15 A health functional food composition for promoting skin vitality according to claim 14, characterized in that the health functional food composition is in the form of a capsule, tablet, granule, powder, or beverage.

Images