ZNF536 knock-out zebrafish model and uses thereof

Abstract

The present invention relates to a zebrafish model in which the ZNF536 gene is knocked out. It was revealed that abnormal behavioral patterns, such as reduced social interaction observed in patients with neuropsychiatric disorders, and symptoms such as reduced size and function of the cerebellum were also observed in the ZNF536-knocked zebrafish, and that by knocking out the ZNF536 gene in zebrafish, an animal model for neuropsychiatric disorders such as schizophrenia and autism spectrum disorder can be produced. Furthermore, this animal model can be utilized for studying the pathogenesis of neuropsychiatric disorders and for screening therapeutic agents.

Description

Technology Field

[0001] The present invention relates to a zebrafish model of neuropsychiatric disease in which the ZNF536 gene is deleted. Background Technology

[0002] Schizophrenia is a type of neuropsychiatric disorder with a prevalence of about 1%, and while genetic factors such as genetic mutations are known to be the cause of its onset, the mechanism is not well understood. From a genome analysis study conducted on schizophrenia patients in 2014, the ZNF536 gene was suggested as a candidate gene that could be the cause of schizophrenia. The ZNF536 gene is known as a rare genetic variant found not only in schizophrenia but also in patients with other neuropsychiatric disorders such as autism spectrum disorder, bipolar disorder, depression, and attention deficit hyperactivity disorder (ADHD).

[0003] ZNF536, a candidate causative gene, is well-conserved in vertebrates and is presumed to function as a transcription factor. Although prior literature has shown that it inhibits neuronal differentiation by inhibiting the signaling pathway mediated by retinoic acid (RA) (Mol. Cell. Biol., 2009, 29(13), 3633-3643), little is known about its physiological function. In a recent large-scale screening study conducted to identify the functions of genes associated with neuropsychiatric disorders, a ZNF536 knockout (KO) model was created using zebrafish and structural and functional abnormalities in the brain were reported (Cell, 2019, 177(2), 478-491). However, this study has limitations in that it only presents results from the larval stage (6 days post-fertilization, dpf) rather than from adult knockout zebrafish.

[0004] Zebrafish undergo in vitro fertilization, have transparent embryos, allow for the easy acquisition of large quantities of fertilized eggs, and exhibit very rapid early development, with most tissues and organs formed within a single day. The complete genome information of zebrafish is currently publicly available and can be easily searched through genome databases, and as vertebrates, its genomic composition is very similar to that of humans. Due to these characteristics, research on transgenic zebrafish has been steadily conducted, and previous studies have demonstrated that zebrafish are a useful vertebrate model for studying brain development and neurogenesis (Itoh et al., 2003; Kim et al., 2000). In addition, animal models have been used to verify the functions of human candidate genes associated with microcephaly, intellectual disability, and autism (Brooks et al., 2014; Choi et al., 2018; Frosk et al., 2017; Khan et al., 2019; Kim et al., 2012; Kim et al., 2017; May et al., 2015; McCammon et al., 2017; Stankiewicz et al., 2017). In particular, the production of gene knockout zebrafish using CRISPR-Cas9 gene scissors has been very active recently. Transgenic animals with artificially inserted external genes or knockout animals with removed genes can be usefully employed in basic research to elucidate the roles of specific genes in living organisms. In particular, transgenic animals or gene knockout animals in which genes causing specific diseases have been inserted or deleted can be used as model animals to model human diseases. In other words, they are very useful for understanding the pathogenesis of specific diseases or for assessing the potential of therapeutic candidate substances as drugs.

[0005] The inventors confirmed that deleting the ZNF536 gene, one of the candidate genes for the causative effects of neuropsychiatric disorders, reduced social interactions and responses to external stimuli in zebrafish. They also observed a decrease in the size of the cerebellum and a reduction in the size and weakening of the myelin structure, which plays a crucial role in neural activity. Based on these findings, it can be inferred that the deletion of the ZNF536 gene inhibits neural development and leads to abnormal behavioral responses, which are caused by the inhibition of cerebellar development and myelin structure formation. Furthermore, the inventors confirmed that it is possible to produce an animal model exhibiting cognitive impairment and symptoms of neuropsychiatric disorders by deleting the ZNF536 gene. The problem to be solved

[0006] The object of the present invention is to provide a zebrafish model with a ZNF536 gene deletion and its uses. means of solving the problem

[0007] To achieve the above objective, the present invention provides a zebrafish model in which the ZNF536 gene is deleted.

[0008] In addition, the present invention

[0009] 1) a step of manufacturing a ZNF536 gene deletion construct; and

[0010] 2) A method for manufacturing a zebrafish model is provided, comprising the step of introducing the construct of step 1) above into a fertilized egg.

[0011] In addition, the present invention

[0012] 1) A step to check for symptoms in control zebrafish not treated with the test substance;

[0013] 2) a step of treating a zebrafish model with a test substance; and

[0014] 3) A screening method for a treatment for neuropsychiatric disorders is provided, comprising the step of determining whether symptoms recover by comparing the symptoms of a zebrafish model treated with the test substance of step 2) with an untreated control group. Effects of the invention

[0015] The present invention relates to a zebrafish model deficient in ZNF536. By manufacturing a zebrafish model deficient in ZNF536, a candidate causative gene for neuropsychiatric disorders including schizophrenia, and observing behavioral abnormalities such as reduced social interaction and impaired response to external stimuli in the zebrafish model, as well as confirming anatomically that the size of the cerebellum is reduced and the myelin structure is weakened, the ZNF536 gene-deficient zebrafish model can be usefully utilized for studying mechanisms of action related to neuropsychiatric disorders and for screening therapeutic agents for neuropsychiatric disorders. Brief explanation of the drawing

[0016] Figure 1 shows the results of whole-mount in situ hybridization (WISH) performed to confirm the expression pattern of the ZNF536 gene. Figure 1a shows the results 15 days after fertilization, Figure 1b shows the results 24 days after fertilization, Figure 1c shows the results 48 days after fertilization, and Figures 1d and 1e show the results for adult animals. Among the results using the adult brain, Figure 1d shows the dorsal view and Figure 1e shows the lateral view, with the left side of the figure representing the anterior side of the animal. CCe, corpus cerebellum; Dm, medial zone of the dorsal telencephalic area; Dp, posterior zone of the dorsal telencephalic area; f, forebrain; h, hindbrain; Hyp, hypothalamus; LCa, Lobus caudalis; m, midbrain; MO, medulla oblongata; PGZ, periventricular gray zone; PPa, parvocellular preoptic area (anterior part); PPp, parvocellular preoptic area (posterior part); Vd, dorsal zone of ventral telencephalic area; Vv, ventral zone of the ventral telencephalic area. Figure 2 is a schematic diagram of the ZNF536 gene with a 14-bp deletion using the CRISPR-Cas9 system to produce ZNF536-deficient zebrafish. Figure 2a shows the schematic diagram of the ZNF536 gene and the results of comparing the sequence of exon 4 with a 14-bp deletion with the wild type (WT). Figure 2b is a schematic diagram showing the morphology of the ZNF536 gene after the 14-bp deletion, and it can be seen that most of the ZNF536 gene, which is a total of 1430 bp, has been deleted. Figure 3 shows the results of producing ZNF536-deficient zebrafish. Figure 3a is a graph recording the ratio of heterozygous or homozygous ZNF536-deficient zebrafish to wild-type zebrafish, and Figure 3b is the result of comparing the morphology of zebrafish 3 or 6 months after fertilization. Figure 4 shows the experimental results for confirming the feeding activity level of zebrafish. Figure 4a is a photograph of the zebrafish intestine, and Figure 4b is the result of measuring the number of food (rotifers) in the intestine through Figure 4a. Figure 5 shows the results of a novel tank experiment conducted to observe the social interactions of zebrafish. Figure 5a is a photograph showing the distribution of ZNF536-deficient zebrafish and wild-type zebrafish, and Figure 5b shows the results of calculating the time spent in the bottom zone of the tank. Figure 6 shows the results of observing the social interaction of zebrafish by dividing the area where the signal fish is located (social cue) and the area where the experimental fish enters with a transparent acrylic plate, and determining where the experimental fish stays based on the area where the signal fish is located. Figure 6a shows the distribution of fish in the tank, and Figure 6b shows the results of calculating the time spent in a location close to the signal fish. Figure 7 shows the results of testing shoaling behavior to verify the social interaction of zebrafish. Figure 7a shows the distribution of zebrafish within a hemispherical bowl, and Figure 7b shows the results of calculating the distance between each individual. Figure 8 shows the results of an acoustic shock response test performed to observe the response of zebrafish to sound stimuli. Figure 8a is a schematic diagram of the acoustic shock response test process, Figure 8b shows the results of the test using wild-type zebrafish, and Figure 8c shows the results of the test using ZNF536-deficient zebrafish. Figure 9 compares the external appearance and brain size of ZNF536-deficient zebrafish, Figure 9a shows the external appearance of the zebrafish as observed with the naked eye, and Figure 9b shows the brain of the zebrafish as observed with the naked eye. Figure 10 shows the results of hematoxyllin & eosin (H&E) staining on brain thin sections of wild-type zebrafish and ZNF536-deficient zebrafish. Val, lateral division of valvular cerebelli; Vam, medial division of valvular cerebelli. Figure 11 shows the results of performing on-tissue fixation in situ hybridization to confirm the expression of c-fos, a neural marker of the brain, and Purkinje cell marker genes, where Figure 11a shows the neural marker of the brain c-fos It shows gene expression, and Fig. 11b is the marker gene of Purkinje cells. pvalb7 (Parvalbumin 7), ca8 (Carbonic anhydrase 8), aldoca This is the result of confirming the expression of (Aldolase C, fructose-biphosphate a). CCe, corpus cerebellum; Va, valvular cerebelli; TeO, optic tectum. Figure 12 shows the results of observing the myelin structures in wild-type zebrafish and ZNF536 zebrafish. CCe, corpus cerebellum; Va, valvular cerebelli. Specific details for implementing the invention

[0017] The present invention will be described in detail below.

[0018] The present invention provides a zebrafish model in which the ZNF536 gene is knocked out.

[0019] The above ZNF536 gene consists of the nucleotide sequence of Sequence No. 1 in Table 1 and the amino acid sequence of Sequence No. 2.

[0021] Sequence number order Zebrafish ZNF536 cDNA sequence (Sequence No. 1) ATGAAGGAAGGCCAGCAGGTCCCCCCTCCTCCTCCTCCTCCTGCTCGCCTGGCCGGCGAATCTCCTTGGGAATGCAACACCCGCCTCAGGATGGAGGACTCTAGTTTGTGCCTTGGTGTATCCTCGGTGGTCTCAGATGCTGACACCCATCTTAGCAACGCAGTACTTAACGGCCGCTATCCAATCAGTCAGAAACTGCATCAGCTGACTGCTCAGCTGGGTCATGCCTTTCCTGAACTACAGAGTCGCCAGCAGATCCCAGAGGAAAAGGCAGCAACCCCACTGGATGAGAAAACCCATGCTGCCTTAGCTAGTCAGCCAATCAGCAGCCAGATGGCCTTACTGGCCAACCAGCTCAATCGTGACATGGATGTGGGCGCCTTGAGTGGTCTCAATGGCCGTGTTGATTTGCAACAATTTCTCAATGGACAGAATTTAGGAATCATGTCTCAGATGAATGATATTGAAGATGATGCACGCAAGAACCGCAAATATCCCTGTCCTCTTTGTGGCAAGCGATTCCGCTTCAACAGCATTCTGTCACTTCATATGCGTACACACACTGGAGAGAAGCCTTTCAAATGTCCATATTGTGACCACCGAGCTGCTCAGAAGGGTAATCTGAAAATCCACCTCCGCACCCATAAGCTGGGAAATCTTGGTAAGGGCCGTGGTCGTGTACGTGAGGAAAATAGGCTTCTTCATGAACTTGAAGAGAGAGCCATTCTACGTGATAAGCAAATGAGGAACAGCTTGCTGCAGCCACCTCAACCTCTTCCACCCCACTTGGGTATCCAGACTCATAGCCAACAACAGCCTGGCTCTGCCTGTGGCCTGCTCACTCCAACCAGTATTGGTAACTCACCTGAGGGACTGACCCAGCCGTCTGCCTCACCTAAGCCTGCTTCTAACAACCTACAAGATGAGCAAGCCCTCAATCCAGCCCAAGGATACCGGTGCACTTTTTGCAAGGGTAAATTTAAGAAGCGCGAGGAGCTAGACCGCCACATTCGCATTCTCCACAAACCCTACAAATGTACCCTGTGTGAATTTGCTGCTTCACAGGAGGAGGACCTGATCAGCCATGTGGAGAAAACACATATCACCGCTGAATCAGCCCAGGGACAGGGCACAGGAGCTGGCAATGGAGAGAAACCCAGCAATGAATTCCGCTGTGAGGTTTGTGGCCAGGTTTTTAGTCAAGCTTGGTTTCTGAAAGGCCACATGCGGAAACACAAGGACTCCTTTGAACATTGCTGCCAGATCTGTGGACGTCGTTTCAAGGAGCCCTGGTTCCTGAAGAATCACATGAAGGTGCATCTCAACAAGCTGGCCATCAAGAGCAAGCCTCCTGTTGGTGGAGGAGCTGATGATGAAGGACACGCCGTGAACAGCATGAGCAGCCTTGCTCAAGAAGCTCATGCAAACCTGTATTCACGTTATATTTCTTGTTTGCAAAGTGGTTTCCTCACACCCGACAAACAAGGCCTGGCTGAACAGCAGCACCAGATGCTGGCCAAAGCCGGTATTGCTATGAAGGAGAAGGAGATGCTTGGAAAGCTCCTAAGTCCAATGGCCAGCATGGGCCATGGCTTAGGGGAAAATGAAAAGCGATCACTTTTAGGTTGCCTGAACCTAGTGCCCCCTCTGAAGTCTAGCTGTATGGAGCGCTTGCAAGCTGCAGCTAAGGTAGCAGAAATGGACCCCCTAAACAGTTATCAAGCCTGGCAAATCATGGCACGTGGAATGGCAATGGAGCGCTCCTTCATGCCAAAAGAGCAGCACCATGGTGTGCATGGACAAGAAGATGAACTTGCCAATGCAGCTGGGATTGTTCCCTTTGGTAAAGACAAGCCTGACCACCCAACCTTAGGCTCTAATGATGGTTCCAAGCTGAAGCAACATCCTGATGTGCTTCATGGAGTGAAGACAAGTGGAGGCATGATGCCCTTGAAAGATGAAGGTTTAACCTTTGATAGTCACCGTGAGTTCTTGCCTCACCATGGTGGTCTAGGCCTGGGCCAAGGGCTTGAGTACAGCCTAGCCAGCCTAAAGGAGAAAGCAACTGAGTGTCCTGACTGTGGCAGAGTCTTCAGAACCTACCATCAAATGGTGGTCCACTCTCGAGTGCACAACAAGGATCGCCGAACCCTAGAAGACAGCTCCCAGCACATTCTAGATGAACGGCGTGGCTCAGCTAGCGACCCTGAATCTCAGTCCATTAGCCGATCGACTACCCCAGGCTCCTCCAATGTGACAGAGGAAAGTGGTGCTGGAGGCGGACACTCCCAGACAGGCAGTGTGCAGGATGACAGTCCCCACCCTTCCTCTCCATCCTCAGATGTCGGTGATGAGATGGCGAAACCTGTGAGTGCTGTCCAGCCCCCCACTACTCAGCACCGGGACAGGAGTGTGGGTTCAAGCATGAAGGACTGCCCCTACTGTGGCAAATCTTTCCGCACCTCACACCATCTGAAGGTCCACTTAAGAATACACACAGGTGAAAAGCCCTACAGGTGCCCTCACTGTGACTATGCAGGCACTCAATCAGCTTCCCTGAAGTACCACCTGGAGCGCCATCACCGTGAGCGGCAGAACGGAAGTGGGCCCTCGGCCAACCATCCTCCATCATCTGAACACAAGGATGACCACAACAAGAACAGCGGTGGGACAGGGGTTTTTGCTCGTCCTGATGTCCTTCGCGGGGTCTTCAAAGGCATGATGCCCTCTGGTCTTGACTTCAGAGGAGGTCAAATGCTTCCACACCAGTGGGCTCCACCAGGAATGCTCTCACCTAGAGACAGAGATCGTGAAAGGGAGCGCCATGGACCGGGGCCAGAGCCCACCACGGAGAACATGAAGAGTCCCGAGGGACCTGGTTCTGCAGCGGACAGTCCTGCTAGCTTCTCTGACCTCGGTCGGGCCTACCAGAGTATGGTGGGAAATGGAGTCAACTTCCAGGGCTCCCTTCAGGCCTTCATGGACAGCTTTGTGCTCAGCTCTATGAAGAAGGAGAAGGAAATGAGAGAGAGTCAGCTGCACGGTCAGCACTTTAGCCAGGAGAATGCAGAGATCAAGACCAAAAGATCCAGCGAGGCCAACCAGGAAGAAAATCCCACCAGTGACATTAAACCAGCTGAGGGTGGCCGTTCACAGTATGAGCCCCTGGATTTGTCTGTTAGGCCTGAAGCGGGGTCCCTTCCTGGAACCTCTATCACCATCCAGGATAATGTCGCCTGGCATGGTTGCCTCTTCTGCTCCTTCACAACTGCCTCTGTAGAGTTGATGGCCCTCCACCTGCAAGCCAACCACCTGGGTAAAAGCAAATGTGGCCCAGGCAAAGATACTAAGGAGCACCTCATGGGAGAGCCTTCCCATGTGGGCAAAGCTACTGGCTTGGCTCCTCCACCACCAGGCCTTCTTCATCACCATGAGGGAGCCCCGTCCAGGGACAGAGAGACTGAGTCTGGGGATCCAAAGGGACAAGCAGGCTGGTCCAACCATCTGGATCAGCCCCCGCACGGAGCCTCCATGGGAGCATTCTCCAGTGACTTCTACAAGCCCTTTGGTCCTGTGTATGATGGCTCTGCTAGAGGGCCTGTTGGATTTCTGGACCAGCAGCAAATTCAGCCTAACGACATGGGTGGTCAGGGCCCTTTGGATGACCTATCCGACAAGGCTTCCTGCAGTGAGATAGAGGCATCTGAGGAACACGGTGGCCAGTCTGAGGAGGATGAAGTGAGTCGTGACAAATCCTTACCCAACCCCACTGCGACAGAGAGACACATGCATTCAGATGACGAAGAGGAAGCAGATGAAGAAGAGGAGATGGAGATGGGTGATGCTGAGGAGGAGGATCGTAGATCCATGCAAATGCTTCCTGAATCTCCATTGTCAGGAAAGGACATCCAAAGATGCAAGCTAACTGTAGGCCCTCAAAGCTCAGGGCTTTCTCCTCCTCAAGCTCCCACCCCTGAGAAGCAGTGGCAGCAGCAAGCAGGCCTGGGTCTTCTATCTTCAAGCGGTGGTCCCCCTGGCCTGGTTAAGCCTGATCAACCCCACCTCGATCACCAGATGAACATGCTATCTGTCCTGCGGGCCTACAGTTCAGAGAACCTCGCAGCCTTCAACGGAGGTCTTGGTGGAAGCTCCAACGGAGGAAGCGGTGGCACCAGCAACATGAAAAGAAACGACCCCTCTGTTCATCTGTGGGCGGAAGAAGAGGCGTCCCGAAGGTTCGGTCCTGCTCTTACCCCTGAACATAGCCTAACTGACACAGAGATGCAGGACTAA Zebrafish ZNF536 Amino Acid Sequence (Sequence No. 2) MKEGQQVPPPPPPPARLAGESPWECNTRLRMEDSSLCLGVSSVVSDADTHLSNAVLNGRYPISQKLHQLTAQLGHAFPELQSRQQIPEEKAATPLDEKTHAALASQPISSQMALLANQLNRDMDVGALSGLNGRVDLQQFLNGQNLGIMSQMNDIEDDARKNRKYPCPLCGKRFRFNSILSLHMRTHTGEKPFKCPYCDHRAAQKGNLKIHLRTHKLGNLGKGRGRVREENRLLHELEERAILRDKQMRNSLLQPPQPLPPHLGIQTHSQQQPGSACGLLTPTSIGNSPEGLTQPSASPKPASNNLQDEQALNPAQGYRCTFCKGKFKKREELDRHIRILHKPYKCTLCEFAASQEEDLISHVEKTHITAESAQGQGTGAGNGEKPSNEFRCEVCGQVFSQAWFLKGHMRKHKDSFEHCCQICGRRFKEPWFLKNHMKVHLNKLAIKSKPPVGGGADDEGHAVNSMSSLAQEAHANLYSRYISCLQSGFLTPDKQGLAEQQHQMLAKAGIAMKEKEMLGKLLSPMASMGHGLGENEKRSLLGCLNLVPPLKSSCMERLQAAAKVAEMDPLNSYQAWQIMARGMAMERSFMPKEQHHGVHGQEDELANAAGIVPFGKDKPDHPTLGSNDGSKLKQHPDVLHGVKTSGGMMPLKDEGLTFDSHREFLPHHGGLGLGQGLEYSLASLKEKATECPDCGRVFRTYHQMVVHSRVHNKDRRTLEDSSQHILDERRGSASDPESQSISRSTTPGSSNVTEESGAGGGHSQTGSVQDDSPHPSSPSSDVGDEMAKPVSAVQPPTTQHRDRSVGSSMKDCPYCGKSFRTSHHLKVHLRIHTGEKPYRCPHCDYAGTQSASLKYHLERHHRERQNGSGPSANHPPSSEHKDDHNKNSGGTGVFARPDVLRGVFKGMMPSGLDFRGGQMLPHQWAPPGMLSPRDRDRERERHGPGPEPTTENMKSPEGPGSAADSPASFSDLGRAYQSMVGNGVNFQGSLQAFMDSFVLSSMKKEKEMRESQLHGQHFSQENAEIKTKRSSEANQEENPTSDIKPAEGGRSQYEPLDLSVRPEAGSLPGTSITIQDNVAWHGCLFCSFTTASVELMALHLQANHLGKSKCGPGKDTKEHLMGEPSHVGKATGLAPPPPGLLHHHEGAPSRDRETESGDPKGQAGWSNHLDQPPHGASMGAFSSDFYKPFGPVYDGSARGPVGFLDQQQIQPNDMGGQGPLDDLSDKASCSEIEASEEHGGQSEEDEVSRDKSLPNPTATERHMHSDDEEEADEEEEMEMGDAEEEDRRSMQMLPESPLSGKDIQRCKLTVGPQSSGLSPPQAPTPEKQWQQQAGLGLLSSSGGPPGLVKPDQPHLDHQMNMLSVLRAYSSENLAAFNGGLGGSSNGGSGGTSNMKRNDPSVHLWAEEEASRRFGPALTPEHSLTDTEMQD

[0022] The above ZNF536 is a well-conserved zinc finger protein and is known to act as a transcription factor. In addition, it has been found to be present in large quantities in the brain and inhibit brain differentiation (Mol. Cell. Biol., 2009, 29(13), 3633-3643), but little is known about its specific physiological function.

[0023] The above zebrafish model may be a disease model of a neuropsychiatric disorder, and the neuropsychiatric disorder may be autism spectrum disorder, bipolar disorder, depression, attention deficit hyperactivity disorder, or schizophrenia.

[0024] The above zebrafish model may have reduced social interaction.

[0025] The aforementioned social interaction refers to the social behavior of zebrafish and may include colony formation, courtship activities, or aggressive tendencies; however, in the present invention, it refers to the tendency of multiple individuals to form a colony for social purposes.

[0026] The above zebrafish model may have a reduced size of the valve cerebellum.

[0027] The above zebrafish model may have a reduced or inhibited response to sound stimulation.

[0029] In addition, the present invention

[0030] 1) A step of manufacturing a ZNF536 gene deletion construct;

[0031] 2) A method for manufacturing a zebrafish model is provided, comprising the step of introducing the construct of step 1) above into a fertilized egg.

[0032] The above ZNF536 gene may consist of the nucleotide sequence of SEQ ID NO. 1.

[0033] The deletion construct of step 1) above preferably includes a gene scissors, and the gene scissors are preferably selected from the group consisting of CRISPR / Cas9 (clustered regularly interspaced short palindromic repeats / CRISPR-associated protein-9), ZFN (zinc-finger nuclease), and TALEN (transcription activator-like effector nuclease), but are not limited thereto. In addition, the construct containing the gene scissors deletes the ZNF536 gene, wherein the deletion includes both the entire sequence of the ZNF536 gene and the deletion of only a part of the sequence.

[0034] The above zebrafish model may have reduced social interaction.

[0035] The above zebrafish model may have a reduced size of the valve cerebellum.

[0036] The above zebrafish model may have an inhibited response to sound stimulation.

[0038] In addition, the present invention

[0039] 1) A step to check for symptoms in control zebrafish not treated with the test substance;

[0040] 2) a step of treating a zebrafish model with a test substance; and

[0041] 3) A screening method for a neuropsychiatric disease treatment agent is provided, comprising the step of determining whether symptoms recover by comparing a zebrafish model treated with the test substance of step 2) with an untreated control group.

[0042] The above symptoms may be a decrease in anxious behavior, a decrease in response to external stimuli, or a decrease in social interaction, where the external stimuli may be sound stimuli.

[0043] The above-mentioned test substances are natural compounds, synthetic compounds, RNA, DNA, polypeptides, enzymes, proteins,

[0044] It may be any one selected from the group consisting of ligands, antibodies, antigens, metabolites of bacteria or fungi, and bioactive molecules.

[0045] The above neuropsychiatric disorder may be autism spectrum disorder, bipolar disorder, depression, attention deficit hyperactivity disorder, or schizophrenia.

[0047] In a specific embodiment of the present invention, the inventors observed that the ZNF536 gene was highly expressed in the nervous system from the early stages of development and confirmed that the expression levels in the midbrain and cerebellum remained high even after reaching adulthood (Fig. 1). To produce ZNF536-deficient zebrafish, the inventors deleted 14 base pairs (14-bp) of the 4th exon, and as a result, were able to produce zebrafish with multiple deletions of the C2H2 domain of the zinc finger (Fig. 2). After production, wild-type zebrafish and ZNF536-deficient zebrafish were reared together. As a result, the proportion of homozygous ZNF536-deficient zebrafish decreased from day 14 after fertilization, and no homozygous ZNF536-deficient zebrafish were observed after day 19 (Fig. 3a). However, when wild-type zebrafish and ZNF536-deficient zebrafish were separated and reared, ZNF536-deficient zebrafish could be secured even after 3 months (Fig. 3b). To determine the reason for the decrease in the proportion of ZNF536-deficient zebrafish, the inventors conducted a food competition test and found that zebrafish with a ZNF536 gene deficiency were vulnerable to food competition compared to wild-type zebrafish (Fig. 4). Furthermore, through behavioral observations of ZNF536-deficient zebrafish, it was revealed that ZNF536-deficient zebrafish exhibited reduced anxiety behavior toward unfamiliar environments (Fig. 5) and reduced social interaction compared to wild-type zebrafish (Figs. 6 and 7). Additionally, it was confirmed that a deficiency in ZNF536 inhibits the response to external stimuli, particularly sound stimuli (Fig. 8).

[0048] This differs from the responses observed in normal zebrafish, and presuming that this abnormal behavioral pattern is related to abnormal sensory processing, we intended to anatomically observe the brain.

[0049] The inventors first visually observed the body length and shape of the zebrafish and observed that there were no significant external differences, but when the brain was separated and observed, it was confirmed that the brain size of the ZNF536-deficient zebrafish was reduced compared to the wild-type zebrafish, and in particular, the size of the cerebellum was reduced (Fig. 9).

[0050] To observe the brain in more detail, thin sections were prepared and H&E staining was performed. When the brain was observed structurally, it was confirmed that the size of the region called the valvular cerebelli (Va) was reduced (Fig. 10). Since this region is known to perform sensorimotor control, it can be inferred that anatomical changes in the valvular cerebelli may have influenced the behavioral changes in ZNF536-deficient zebrafish.

[0051] To confirm functional differences as well as anatomical differences, we examined the expression levels of neural activity marker genes and Purkinje cells associated with neural activity in the zebrafish brain, and ZNF536-deficient zebrafish, the neural activity marker c-fosThe expression of marker genes for Purkinje cells was reduced, and in particular, a significant decrease in the expression of Purkinje cell marker genes in the valve-cerebellar region was observed (Fig. 11). In addition, the inventors identified the myelin structure associated with the speed of signal transmission in neurons and observed that the myelin structure in the valve-cerebellar region was weakened in ZNF536-deficient zebrafish (Fig. 12). Through this, it can be seen that depleting the ZNF536 gene inhibits the development of the valve-cerebellar region of zebrafish and impairs its function, resulting in abnormal behavioral patterns. Since similarities to human neuropsychiatric disorders can be found through these symptoms, it can be seen that ZNF536-deficient zebrafish are suitable as animal models for neuropsychiatric disorders. Therefore, the ZNF536-deficient zebrafish of the present invention can be usefully utilized as an animal model for neuropsychiatric disease research and as a screening method for neuropsychiatric disease treatments.

[0053] The present invention will be explained in more detail below through specific embodiments.

[0054] However, the following examples are merely illustrative of the present invention, and the content of the present invention is not limited by the following examples.

[0056] <Example 1> Rearing and Management of Zebrafish

[0057] Wild-type zebrafish were maintained in an experimental animal facility. The zebrafish were reared at a temperature of 28.5°C, with lights on from 9:00 AM to 11:00 PM and lights off at other times. Fertilized eggs obtained from the zebrafish were maintained in egg water (egg water, 5 mM NaCl (sodium chloride), 0.17 mM KCl (potassium chloride), 0.33 mM CaCl2 (calcium chloride), 0.33 mM MgSO4 (magnesium sulfide), 0.1% Methylene Blue). All experiments using zebrafish were conducted under the approval of the Animal Ethics Committee of Chungnam National University.

[0059] <Example 2> Confirmation of ZNF536 Expression in Zebrafish

[0060] Whole-mount in situ hybridization (WISH) was performed to determine the spatiotemporal expression patterns of the ZNF536 gene in zebrafish. For whole-mount in situ hybridization, embryos or adults were fixed in 4% paraformaldehyde (PFA) for 1 to 3 days. The fixed samples were dehydrated with methanol and made permeable using proteinase K. Subsequently, antisense digoxigenin-labeled RNA probes were placed with the fixed embryos to allow hybridization. Afterward, unhybridized probes were removed by washing, and the samples were incubated with an anti-DIG Fab fragment antibody conjugated to alkaline kinase. The samples were then photographed using a bright-field microscope.

[0061] Observations revealed that the ZNF536 gene began to be expressed in zebrafish during the segmentation stage. It exhibited brain-specific expression during development and continued to be expressed in brain tissues even after reaching adulthood. In particular, high expression was confirmed in the cerebellum and midbrain.

[0063] <Example 3> Preparation of ZNF536-deficient zebrafish using a CRISPR-Cas9 system.

[0064] The ZNF536 gene sequence was obtained from the NCBI (National Center for Biotechnology Information) database, and the sequence of the sgRNA for the 4th exon of ZNF536 was designed by selecting (GRCz11, ENSDARG00000103648) from CRISPR DESIGN (http: / / crispr.mit.edu / ) (see Fig. 2a).

[0066] sgRNA primer Sequence(5' - 3') Sequence number ZNF536 sgRNA GGAAATCTTGGTAAGGGCCG 3

[0068] The Cas9 expression vector pT3TS-nCas9n was used to synthesize Cas9 mRNA to be injected into single-cell stage zebrafish embryos along with sgRNA, and Cas9 mRNA was synthesized as a tailed poly(A) using the mMESSAGE mMACHINE T3 kit and E. Coli poly(A) polymerase. Cas9 mRNA and ZNF536 sgRNA were injected into single-cell stage embryos. Mutations were verified via T7E1 analysis, and F0 generation fish were raised to adulthood and crossed with wild-types to induce germline mutations. ZNF536 with a 14 bp deletion (a 31 bp deletion accompanied by a 17 bp insertion) was produced via germline transmission. ck109a KO zebrafish (ZNF536 deletion zebrafish) were produced, and due to a 14 bp deletion, the stop codon was created, resulting in a form in which the C2H2 domain of the zinc finger domain is mostly deleted (see Fig. 2b).

[0070] <Example 4> Morphological observation of ZNF536-deficient zebrafish

[0071] No morphological changes were observed in ZNF536-deficient zebrafish during the developmental process, but the proportion of homozygous-deficient zebrafish gradually decreased starting from the 14th day after fertilization during rearing (see Fig. 3a). Subsequently, a small number of homozygous-deficient zebrafish could be secured, but it was confirmed that the homozygous-deficient zebrafish were smaller in body size compared to other individuals (heterozygous or wild type) (see Fig. 3b).

[0072] However, when the defective zebrafish were isolated and reared, it was confirmed that their body size grew to a normal level (see Fig. 3b).

[0073] Based on this, it can be inferred that the growth of ZNF536-deficient zebrafish is inhibited because they cannot consume sufficient food in a group rearing environment.

[0075] <Example 5> Food Competition Experiment

[0076] A food competition experiment was conducted to identify the cause of growth inhibition in defective zebrafish. The experiment was performed on the 14th day after fertilization (14 days post-fertilization, dpf), and prior to the experiment, live prey, rotifers, were fed three times a day for a period of 5 to 13 dpf. Brachionus calyciflorus Zebrafish were given ) to acclimate to the trochozoans. During the food competition experiment, 20 fry were placed in a 60 mm Petri dish with 50 trochozoans for 10 minutes, and the movement of the fry was observed and the number of trochozoans in the fry's gastrointestinal tract was checked to compare the food competition ability between genotypes.

[0077] As a result, more than 80% of homozygous ZNF536-deficient zebrafish were unable to ingest tropilionis, and about 50% of wild-type and heterozygous zebrafish ingested at least one tropilionis (see Fig. 4).

[0078] This confirms that homozygous ZNF536-deficient zebrafish have lower fore-competitive abilities compared to wild-type and heterozygous individuals, suggesting that there may be differences in behavior and brain function.

[0080] <Example 6> Novel tank experiment

[0081] We obtained adult zebrafish through separate rearing and conducted a new tank experiment to measure the anxiety behavior of zebrafish. This experiment involved placing zebrafish in a tank surrounded by opaque white paper and observing and filming them for 15 minutes, dividing the tank into three sections along the vertical axis to observe the movement of the zebrafish.

[0082] Zebrafish feel anxious when exposed to a new environment and tend to congregate mainly at the bottom of the tank; once they become accustomed to it, they tend to move closer to the surface, so it is concluded that zebrafish are exhibiting anxious behavior when they are at the bottom.

[0083] Experimental results showed that when comparing the time wild-type or heterozygous zebrafish stayed at the bottom of the tank with the time homozygous zebrafish stayed at the bottom of the tank, the time homozygous zebrafish stayed at the bottom of the tank was significantly shorter, confirming that ZNF536-deficient zebrafish exhibit relatively less anxious behavior (Fig. 5).

[0085] <Example 7> Verification of Social Interaction - 1

[0086] To observe social interactions using zebrafish, a tank was divided in two; signal fish were placed in one side and experimental fish in the other. A transparent acrylic plate separated the two spaces to allow for interaction between the fish. The space containing the experimental fish was divided into four equal sections, which were designated as the "very close zone" (the zone closest to the signal fish, or "social cue"). During the experiment, three adult zebrafish were used as signal fish, and ZNF536-deficient zebrafish were used as experimental fish. Video recordings were taken for 15 minutes, and behavior was analyzed using Ethovision XT software.

[0087] In the case of wild-type zebrafish, the time spent in the zone closest to the signal fish was longer than 200 seconds, and they rarely moved to distant areas, whereas ZNF536-deficient zebrafish tended to move across all areas rather than staying in one area, and the time spent in the nearby zone was shorter than 100 seconds (Fig. 6). In other words, compared to wild-type zebrafish, ZNF536-deficient zebrafish were found to have a defect in social interaction.

[0089] <Example 8> Verification of Social Interaction - 2

[0090] To verify the social interaction of zebrafish, a shoaling behavior test was conducted. The test was performed by placing three adult zebrafish in a hemispherical container, recording the behavior of the zebrafish for 15 minutes, and then measuring the distance between each individual.

[0091] Typically, zebrafish exhibit gregarious behavior, forming colonies by closing the distance between individuals starting 21 days after fertilization, so it can be concluded that social interaction is more active the closer the distance between individuals is.

[0092] Observations showed that wild-type zebrafish and heterozygous ZNF536 mutant zebrafish tended to form colonies by closing the distance between individuals, whereas homozygous ZNF536 deletion zebrafish tended to spread out rather than gathering in one area (Fig. 7a) and tended to be spaced apart from each other at a distance of about 150 mm (Fig. 7b).

[0093] That is, similar to the results analyzed in Example 7, ZNF536-deficient zebrafish were observed to have reduced social interaction compared to wild-type zebrafish.

[0095] <Example 9> Confirmation of Acoustic Shock Response

[0096] An acoustic startle response assay was performed to observe the response of zebrafish to sound stimuli. For the acoustic startle response assay, zebrafish were placed in a 100 mm culture dish filled with water and allowed to acclimate for 5 minutes. Subsequently, a 1 kHz, 90 dB, 0.5-second sine wave sound was played through a speaker at 1-minute intervals. All behaviors of the zebrafish after being placed in the dish were recorded, and the response to the sound was analyzed by comparing the movements 10 seconds before the sound was produced with the movements 10 seconds after the sound was produced. A schematic diagram of the acoustic startle response assay can be seen in Figure 8a.

[0097] As a result of conducting an acoustic shock response test, in the case of wild-type zebrafish, the movement increased at the moment the sound was produced, and the movement for 10 seconds thereafter also remained at a larger level compared to before the sound was produced (Fig. 8b).

[0098] However, in the case of ZNF536-deficient zebrafish, there was no difference in travel distance except at the moment of sound (Fig. 8c).

[0099] This indicates that ZNF536-deficient zebrafish show a reduced response to sound stimuli compared to wild-type zebrafish, and it is presumed that this abnormal behavioral pattern is related to abnormal sensory processing.

[0101] <Example 10> Anatomical Observation of the Brain

[0102] The brains of zebrafish were anatomically analyzed to determine whether abnormal behavioral patterns, such as a lack of social interaction and a lack of response to external stimuli, were caused by anatomical or functional problems in the brain.

[0103] First, there were no significant external differences in body length and morphology between wild-type zebrafish and ZNF536-deficient zebrafish (Fig. 9a).

[0104] However, when the brain was isolated and observed, it was found that the brain size of ZNF536-deficient zebrafish was reduced compared to wild-type zebrafish, and in particular, the size of the cerebellum was reduced (Fig. 9b).

[0105] To observe this in more detail, 7 μm thick thin sections of the brain were prepared and stained with Haematoxylin & Eosin (H&E) to examine the brain structures in detail. As a result, it was confirmed that the size of a specific region called the valvular cerebelli (Va) was reduced (see Fig. 10). This region is known to be responsible for sensory-motor control.

[0106] In other words, behavioral changes in ZNF536-deficient zebrafish may have occurred due to anatomical changes in the valve cerebellum, which performs sensorimotor control.

[0108] <Example 11> Confirmation of neural marker expression in the brain

[0109] To verify whether there is an actual functional problem, a novel tank experiment was performed as in Example 6 to induce neural activity caused by stress such as anxiety, and then, using zebrafish and a control group, the neural activity marker gene c-fos The expression level and Purkinje cell levels were confirmed and compared.

[0110] To confirm the expression of c-fos and Purkinje cell marker genes, on-tissue fixation in situ hybridization was performed as in Example 2.

[0111] Observation results showed that it is related to neural activity c-fos The expression of the gene was reduced in the forebrain and cerebellum (Fig. 11a).

[0112] In addition, well known as a molecular marker of Purkinje cells pvalb7 (Parvalbumin 7), ca8(Carbonic anhydrase 8), aldoca Upon checking the expression of (Aldolase C, fructose-biphosphate a), it was observed that the expression of Purkinje cell markers in the valve-cerebellar region was significantly reduced (Fig. 11b).

[0113] This indicates that a deficiency in the ZNF536 gene reduces the expression of neuroactive cells in zebrafish.

[0115] <Example 12> Confirmation of Myelin Structure in the Brain

[0116] Neurons, which are nerve cells, are formed as a structure surrounded by myelin, and it is known that this myelin structure accelerates the speed of signal transmission. It is known that increasing the thickness of the myelin leads to improved nerve transmission speed and intelligence, while damage to the myelin can result in a decline in intelligence or paralysis.

[0117] To determine whether changes in myelin structure occurred in ZNF536-deficient zebrafish exhibiting abnormal behavioral patterns, a genetic background in which the gene was manipulated to make the myelin appear fluorescent green ( mbp:mgfpControl zebrafish and ZNF536-deficient zebrafish were produced by crossing zebrafish with others, and the myelin structures of the control and ZNF536-deficient zebrafish were compared. A tissue clearing method was performed to observe myelin structures labeled with fluorescent green. A Binary Tissue Clearing Starter's Kit was used to clear the tissue. Zebrafish were fixed with 4% paraformaldehyde (PFA), and the brain tissue was washed with PBS. The brain tissue was placed immersed in the Starting Solution and left at 4°C; then, it was transferred to the Tissue Clearing Solution, placed in a hybridization incubator at 37°C for one day, and washed with distilled water. This process was repeated once more to obtain clear brain tissue samples, which were observed using a fluorescence microscope.

[0118] Compared to the control group, the myelin structure in the valvular cerebellum was observed to be smaller and weaker in ZNF536 deletion mutants. In other words, it can be seen that the myelin structure is weakened in ZNF536 deletion zebrafish, and this may have led to reduced neural activity.

[0119] When the ZNF536 gene, known as a causative gene for neuropsychiatric disorders, was deleted in zebrafish, the response to external stimuli weakened and social interaction decreased. This is attributed to anatomical and functional abnormalities of the brain; in ZNF536-deficient mutant zebrafish, impaired brain function was observed, including a reduction in the size of the valvular cerebellum, decreased expression of genes involved in neural activity and Purguine cells, and weakened myelin. Therefore, the ZNF536-deficient zebrafish according to the present invention is highly suitable as an animal model for neuropsychiatric disorders such as schizophrenia and autism spectrum disorder.

Claims

Claim 1 Autism spectrum disorder in which the 31 bases at positions 638 through 668 of the ZNF536 gene consisting of SEQ ID NO. 1 are altered to the 17 bases of 5'-cagcacattctagaaga-3'. A zebrafish model, wherein the zebrafish model has a reduced response to sound stimuli, a reduced size of the valvular cerebellum, a reduced number of neurons in the valvular cerebellum, damage to the myelin structure in the valvular cerebellum, and reduced social interaction. Claim 2 delete Claim 3 delete Claim 4 delete Claim 5 delete Claim 6 delete Claim 7 A method for manufacturing a zebrafish model of claim 1, comprising: 1) a step of preparing a construct for changing 31 bases at positions 638 to 668 of the ZNF536 gene composed of sequence number 1 to 17 bases of 5'-cagcacattctagaaga-3'; and 2) a step of introducing the construct of step 1) into a fertilized egg. Claim 8 delete Claim 9 A method for preparing a zebrafish model according to claim 7, wherein step 1) uses sgRNA of SEQ ID NO. 3 to delete the ZNF536 gene. Claim 10 A method for manufacturing a zebrafish model according to claim 7, wherein the zebrafish model exhibits symptoms of autism spectrum disorder. Claim 11 A screening method for an autism spectrum disorder treatment, comprising: 1) a step of confirming symptoms in a control group zebrafish not treated with the test substance; 2) a step of treating the zebrafish model of claim 1 with the test substance; and 3) a step of determining whether symptoms recover by comparing the zebrafish model treated with the test substance in step 2) with an untreated control group. Claim 12 A screening method for autism spectrum disorder according to claim 11, wherein the above symptoms are reduced anxiety behavior, reduced response to external stimuli, or reduced social interaction. Claim 13 delete Claim 14 A screening method for an autism spectrum disorder treatment, wherein, in claim 11, the test substance is any one selected from the group consisting of natural compounds, synthetic compounds, RNA, DNA, polypeptides, enzymes, proteins, ligands, antibodies, antigens, metabolites of bacteria or fungi, and live molecules.

Images