Uses of Chlamydomonas incerta-derived 15S-lipoxygenase that simultaneously produces resolvin D5 and protectin Dx

Abstract

The present invention relates to a 15S-fatty acid oxidase derived from Chlamydomonas insulta that simultaneously produces resolvin D5 and protectin Dx, and more specifically, provides a composition for producing resolvin D5 and protectin Dx comprising a 15S-fatty acid oxidase derived from Chlamydomonas insulta or a gene encoding the same as an active ingredient; a method for producing resolvin D5 and protectin Dx comprising the step of treating a substrate with said composition; a recombinant expression vector for producing resolvin D5 and protectin Dx comprising said 15S-fatty acid oxidase gene; and a transformant in which said recombinant expression vector is transformed into a host cell.

Description

Technology Field

[0001] The present invention relates to a Chlamydomonas insulta-derived 15 that simultaneously produces resolvin D5 and protectin Dx. S -Regarding fatty acid oxidases, more specifically 15 derived from Chlamydomonas insultae S - A composition for producing Resolvin D5 and Protectin Dx comprising a fatty acid oxidase or a gene encoding the same as an active ingredient; a method for producing Resolvin D5 and Protectin Dx comprising the step of treating a substrate with the composition; the 15 S - A recombinant expression vector for producing resolvin D5 and protectin Dx containing a fatty acid oxidase gene; and a transformant in which the recombinant expression vector is transformed into a host cell. Background Technology

[0002] Dihydroxyfacials are substances that exist in the lipids of various organisms, are generated from lipids, and are contained in diverse organisms such as animals, plants, microorganisms, and insects. When fatty acids possess hydroxyl groups as functional groups, they exhibit antibacterial, antifungal, and anti-inflammatory activities, making them useful as raw materials for health functional foods, pharmaceuticals, and cosmetics. Among these, omega-3 dihydroxyfacials (DiHFA) produced in animals are utilized as signaling molecules and precursors, and are involved in various complex physiological activities. Omega-3 dihydroxyfacials belong to the lipid regulators, which include mediators that promote inflammation resolution; among omega-3 dihydroxyfacials, these inflammation resolution-promoting mediators include protectin (PT), resolvin (RV), and maresin (MaR).

[0003] Resolvin is an endogenous lipid mediator produced by the combinatorial and double oxidation reactions of lipoxygenase (LOX), and is a substance derived from the omega-3 fatty acids eicosapentaenoic acid, n-3 docosapentaenoic acid, and docosahexaenoic acid. Lipoxygenase acts on the animal-derived unsaturated fatty acids eicosapentaenoic acid and docosahexaenoic acid to convert them into Resolvin E and Resolvin D, respectively. Recently, it has been reported that isomers and analogs of Resolvin also act as potent anti-inflammatory agents. In the human body, Resolvin and its analogs possess functionalities such as the resolution of acute inflammation at the site of infection, inhibition of platelet aggregation, improvement of survival rates and reduction of antibiotic requirements, anti-inflammatory activity, and enhancement of phagocytosis.

[0004] Protectin D1 (PD1, 10R,17S-dihydroxy-4Z,7Z,11E,13E,15Z,19Z-docosahexaenoic acid), the most well-known of protectins, is an endogenous stereoselective lipid mediator derived from docosahexaenoic acid, an omega fatty acid. It is primarily found in tissues such as the retina, lungs, and nervous system. This substance acts as an anti-inflammatory, anticancer, and neuroprotective agent. Studies on stroke patients and animal models of Alzheimer's disease have confirmed that treatment with this substance potentially reduces inflammation caused by oxidative stress and prevents cellular degeneration by inhibiting the induction of apoptosis. Furthermore, it is known to possess the ability to weaken the replication ability of influenza viruses, thereby inhibiting the infectivity of avian influenza viruses such as H5N1, and to resolve inflammation. Considering the efficacy confirmed by the fact that treatment with protectin does not induce harmful effects on host RNA that could cause adverse side effects in host cells, this suggests that this substance, possessing potent anti-inflammatory capabilities in viral or bacterial inflammation, can serve not only as a biomarker for viral infections but also as a novel antiviral agent.

[0005] Lipoxygenases (LOX) are dioxygenation enzymes that catalyze regioselective and stereoselective peroxidation using animal-derived unsaturated fatty acids as substrates. By utilizing polyunsaturated fatty acids containing one or more cis or cis-1,4-pentadiene groups as substrates, they catalyze stereospecificity and reaction specificity through dioxygenation reactions. Regiospecificity varies depending on the type of polyunsaturated fatty acid used as a substrate; specifically, lipoxygenases that generate hydroxyl groups at carbon positions 5, 8, 9, 11, 12, and 15 of arachidonic acid—an animal-derived polyunsaturated fatty acid—form hydroxyl groups only at specific carbon positions in unsaturated fatty acids with 20 or more carbon atoms, such as arachidonic acid. In the case of stereospecificity, due to differences in chirality or hand symmetry... R - Fatty acid oxidase and S - Divided into fatty acid oxidases. Arachidonic acid 15 S - Fatty acid oxidase (hereinafter, 15 S In the case of (named fatty acid oxidase), at the 15th carbon position in 20-carbon unsaturated fatty acids such as arachidonic acid S - Forms a hydroxyl group. Also, in 22-carbon unsaturated fatty acids, at the 17th carbon position S - Forms a hydroxyl group.

[0006] To date, 20-30 step stereoselective chemical synthesis methods have been reported for the synthesis of dihydroxyfacials containing resolvin and protectin analogs, and they are known to be synthesized with a yield of approximately 20%. This method has limitations in that benzene homologues and heavy metals are used and released during the synthesis process, and the pollutants and byproducts produced during this chemical synthesis process do not biodegrade in nature, causing environmental pollution. Furthermore, dihydroxyfacials containing resolvin and protectin analogs synthesized in vivo are biosynthesized through intercellular responses to tissue damage and infection, and have limitations in that they are biosynthesized in small amounts of less than 250 pg / mL through the combined reaction of two or more fatty acid oxidases.

[0007] Recently, according to Non-Patent Literature 1, resolvin D5 at a level of 4.2 mM (1.51 g / L) was produced using a recombinant microorganism containing a double-oxygenating fatty acid oxidase in a whole-cell reaction. According to Non-Patent Literatures 2 and 3, Protectin Dx and Protectin Dx 10-epimer were produced at 0.3 mM (108 mg / L) and 1.2 mM (433 mg / L), respectively, through a two-step bioconversion by a combination reaction of two types of recombinant microorganisms containing a single-oxygenating fatty acid oxidase. However, to date, the production of Protectin Dx by a double-oxygenating fatty acid oxidase has not been reported.

[0008] That is, 15 catalyzing double oxygenation that quantitatively and simultaneously produces Resolvin D5 and Protectin Dx to date S - Fatty acid oxidases have not been reported, and 15 S - No method has been reported for producing resolvin D5 (RvD5) and protectin Dx (PDX) from docosahexaenoic acid and arachidonic acid using fatty acid oxidase. Prior art literature

[0009] D. K. Oh, et al. "Efficient biotransformation of docosahexaenoic acid-rich oils into the lipid mediator resolvin D5 by cells expressing 15S-lipoxygenase using a bioreactor", Bioresor. Technol. 388, 129750 (2023).DK Oh, et al. “Enzymatic formation of protectin Dx and its production by whole-cell reaction using recombinant lipoxygenases”, Catalysts, 12, 1145 (2022).DK Oh, et al. “Biocatalytic synthesis of protectin Dx 10-epimer by serial reactions of arachidonate 8R- and 15S-lipoxygenases”, World J. Microbiol. Biotechnology. 40, 219 (2024). The problem to be solved

[0010] Against this background, the inventors [developed] 15 derived from Chlamydomonas insultae that catalyzes double oxygenation from polyunsaturated fatty acids S The present invention was completed by confirming that resolvin D5 and protectin Dx can be produced simultaneously with high efficiency in a single step using a fatty acid oxidase.

[0011] Accordingly, the objective of the present invention is to obtain Chlamydomonas insulta ( Chlamydomonas incerta 15 containing the amino acid sequence of SEQ ID NO. 1 derived from ) S - A fatty acid oxidase; or a gene containing the nucleotide sequence of SEQ ID NO. 2 encoding the same as the present invention provides a composition for producing resolvin D5 and protectin Dx comprising the active ingredient.

[0012] In addition, another object of the present invention is a method for producing Resolvin D5 and Protectin Dx comprising the step of treating a substrate with the aforementioned composition, wherein

[0013] The present invention provides a method for manufacturing characterized in that the substrate is docosahexanoic acid.

[0014] In addition, another object of the present invention is 15 comprising the nucleotide sequence of SEQ ID NO. 2 S - To provide a recombinant expression vector for the production of resolvin D5 and protectin Dx containing a fatty acid oxidase gene.

[0015] Another objective of the present invention is to provide a transformant in which the aforementioned recombinant expression vector is transformed into a host cell. means of solving the problem

[0016] To solve the aforementioned problem, Chlamydomonas insulta ( Chlamydomonas incerta 15 containing the amino acid sequence of SEQ ID NO. 1 derived from ) S - A fatty acid oxidase; or a gene containing the nucleotide sequence of SEQ ID NO. 2 encoding the same is provided as an active ingredient in a composition for producing resolvin D5 and protectin Dx.

[0017] In addition, the above composition may further include docosahexanoic acid as a substrate.

[0018] At this time, the concentration of the substrate may be 1 mM to 8 mM.

[0019] At this time, the 15 in the above composition S - The concentration of whole cells containing fatty acid oxidase may be 0.1 g / L to 1 g / L.

[0020] Additionally, the present invention provides a method for producing Resolvin D5 and Protectin Dx comprising the step of treating a substrate with the aforementioned composition, wherein

[0021] The present invention provides a method for manufacturing characterized in that the substrate is docosahexanoic acid.

[0022] At this time, the above step may involve further treating with dimethyl sulfoxide as a solvent and further treating with polyvinyl pyrrolidone as a polymer.

[0023] At this time, the concentrations of the dimethyl sulfoxide and polypinylpyrrolidone may be 1 (v / v)% to 5 (v / v)% and 1 (w / v)% to 5 (w / v)%, respectively.

[0024] At this time, the above step may be to carry out the reaction at a pH of 7.0 to 9.0.

[0025] At this time, the above step may be performed at a temperature of 15°C to 40°C.

[0026] At this time, the above manufacturing method may produce Resolvin D5 and Protectin Dx simultaneously in a single step.

[0027] Additionally, the present invention comprises 15 nucleotide sequences of SEQ ID NO. 2. S - Provides a recombinant expression vector for the production of resolvin D5 and protectin Dx containing a fatty acid oxidase gene.

[0028] Furthermore, the present invention provides a transformant in which the aforementioned recombinant expression vector is transformed into a host cell. Effects of the invention

[0029] Dihydroxylated fatty acids, including resolvin D5 and protectin Dx, are expected to be involved in various physiological functions in animals, including humans, as signaling molecules, and the 15 provided in the present invention S- Since the fatty acid oxidase can produce dihydroxylated fatty acids including the above-mentioned resolvin D5 and protectin Dx with high productivity and yield, it can be usefully employed in various industrial fields such as pharmaceuticals, food, and cosmetics, and thus the 15 of the present invention S - Fatty acid oxidase has high utility value. Brief explanation of the drawing

[0030] Figure 1 shows Chlamydomonas insultae. incerta ) Origin 15 S - This is the result of identifying the primary products generated from arachidonic acid through an HPLC chromatogram to determine the site selectivity of fatty acid oxidase. Figure 2 shows Chlamydomonas insulta ( Chlamydomonas incerta ) Origin 15 S - This is the result of confirming the primary products generated from arachidonic acid through an HPLC chromatogram to determine the stereoselectivity of fatty acid oxidase. Figure 3 shows Chlamydomonas insulta ( Chlamydomonas incerta ) Origin 15 S - This is the result of confirming the secondary products generated from arachidonic acid through an HPLC chromatogram to determine the stereoselectivity of fatty acid oxidase. Figure 4 shows Chlamydomonas insulta ( Chlamydomonas incerta ) Origin 15 S - This is the chromatogram result of identifying the reaction products of fatty acid oxidase through LC-MS / MS. Fig. 5 shows Chlamydomonas insulta (using docosahexaenoic acid as a substrate) Chlamydomonas incerta ) Origin 15 S This is the result of analyzing the production of Resolvin D5 and Protectin Dx at different concentrations of the solvent dimethyl sulfoxide and the polymer polyvinylpyrrolidone in a whole-cell reaction using recombinant E. coli expressing fatty acid oxidase. Fig. 6 shows Chlamydomonas insulta ( Chlamydomonas incerta ) Origin 15 SThis is the result of analyzing the production of Resolvin D5 and Protectin Dx at different concentrations of the whole cell or substrate (docosahexaenoic acid) in a whole-cell reaction using recombinant E. coli expressing fatty acid oxidase. Fig. 7 shows Chlamydomonas insultae ( Chlamydomonas incerta ) Origin 15 S This is the result of analyzing the production of Resolvin D5 and Protectin Dx over time in a whole-cell reaction using recombinant E. coli expressing fatty acid oxidase. Specific details for implementing the invention

[0031] The present invention will be described in more detail below.

[0032] Meanwhile, each description and embodiment disclosed herein may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed herein fall within the scope of the invention. Furthermore, the scope of the invention is not to be limited by the specific descriptions provided below.

[0033] Furthermore, a person skilled in the art can recognize or identify a number of equivalents to the specific embodiments of the invention described in this application using only ordinary experiments. Furthermore, such equivalents are intended to be included in the invention.

[0034] As described above, the inventors more effectively 15 through a bioconversion process S -Hydrooxidized fatty acids, 17 S - Hydroxidized fatty acids, including dihydroxylated fatty acids, resolvin D5 and protectin Dx Manufactured. Specifically, the inventors of the present invention (Chlamydomonas insulta ( Chlamydomonas incerta ) Origin 15 S - By cloning fatty acid oxidase to construct a recombinant expression vector and a microorganism transformed therefrom, producing whole cells using them, and then treating them with a substrate, 17 is an eco-friendly biotransformation method S - Hydroxidized docosahexaenoic acid (17S -hydroxy-4Z,7Z,10Z,13Z,15E,19Z-docosahexaenoic acid, 17 S -also known as HDHA) and the final product, resolvin D5 (7 S ,17S-dihydroxy-4 Z ,8 E ,10 Z ,13 Z ,15 E ,19 Z -docosahexaenoic acid) and protectin Dx(10 S ,17 S -dihydroxy-4 Z ,7 Z ,11 E ,13 Z ,15 E ,19 Z -docosahexaenoic acid) was produced with high efficiency.

[0035] In a specific embodiment of the present invention, Chlamydomonas insulta ( Chlamydomonas incerta ) Origin 15 S Recombinant E. coli expressing fatty acid oxidase was prepared for use in a whole-cell reaction.

[0036] In another specific embodiment of the present invention, the Chlamydomonas insulta ( Chlamydomonas incerta ) Origin 15 S - It was identified through Figures 1, 2, 3, and 4 that the fatty acid oxidase is a double oxygenated 15S-fatty acid oxidase.

[0037] Accordingly, the first aspect of the present invention is Chlamydomonas insulta ( Chlamydomonas incerta 15 containing the amino acid sequence of SEQ ID NO. 1 derived from ) S - A fatty acid oxidase; or a gene containing the nucleotide sequence of SEQ ID NO. 2 encoding the same as the active ingredient, is included in a composition for producing resolvin D5 and protectin Dx.

[0038] In the present invention, SEQ ID NO. 1 and SEQ ID NO. 2 are as described in the table below.

[0039] order Sequence number Origin of Chlamydomonas incerta 15 S - Fatty acid oxidase protein MNGAHSPGEVAVWKASIESSAPLLGDTGTRLEIVVIDLDTDRRSEPTNVDSWRPPVLESGPGSSTARSGASSGSGTSGWKREGRLPLPADFLTPGAVLVRKSRTVDGNASVDFIGTIKLVSATKVFHFPVHSWVSSDHDWRVFFEGTAYLPAHTPPSLRDERQRELQELQGTPATRTLERRPADRIYWYQTYDDLSSAGEGGYRPALGATARRPYPRRIATNRGAADGHPDREKPPVKAGDKPWLPYDEQFSFDKAADFNGDTLTAALPAAFSFIAEAGDQRHLTWLNLLPTAVHGLVRNVLRAVLGYAEPPAANFDSFEDVLAFFGEDAASRGSSMAPTQLYPAGQEAAMKGFGAPHDPRNPAPFKTASGAWDFRLNSAAAAAINDQIAADRVGPVPDSATGGPSSGAATAATAFAATAAAATAAGAPAAAITAPPQPGVPNLIGLLGSAVWRRLTNDPSHDINDLLYFPVPRVVDGRPDAWYTDEEYGRQALAGYHPTAITALTQLPEAFGSAIRAHHVEAELQGSSLEALVAAAAGGAKPRLYLIDHWDLSAYWQEAEEEAEAARKAGRKPPSAVQHAGRCLFYLRKDEVTGEDTALVPIAIELAHPGTHKASNGTSAPLPPTAGEVYARSELVASPQTLAVWRLAKAVFRSLDTSIHQLVAHFNRTHAALEPFLIAMRRQMSVMHPITKLMLPHFRYTLNINRNARASLINAGGIIEKTFSAGPFAMRLASAVYGKSWTFAGQALPEDLRERGMLDAAGRPWLDYPFAIDGLDTWAALTAYFDQYVSLYYDGDGAVLEDGELQAWWDEVKTEGHPDIVAFGLKSEQQVWGFTGPIAKRSDLVHVLATIAWLASGHHAAVNFGQYDFTGLILNASSLVRRPMPAPKEPAYKELTGAALGPPQERVFMTYLADPFSAVQVLATVKLLSAHARDEHTLDEANDYIVDPAAREANRAFIAAVKQLESAIETRNADPANWARYGLAAGTAAPLPYTLLMASSPPGVTMRGVPYSVSI 1 Origin of Chlamydomonas incerta 15 S - Gene encoding fatty acid oxidase protein ATGAATGGTGCGCACTCACCGGGAGAAGTGGCAGTTTGGAAGGCTTCAATTGAAAGCTCGGCTCCACTGCTTGGGGATACTGGAACACGTTTGGAAATTGTAGTAATAGATCTTGATACAGATCGTAGATCAGAACCTACTAATGTAGATAGCTGGAGACCACCGGTCCTTGAATCAGGTCCAGGATCGAGTACGGCACGGAGCGGGGCTTCCTCAGGTTCCGGTACATCTGGCTGGAAACGGGAAGGTCGCTTACCTTTGCCAGCAGATTTCTTGACGCCAGGGGCGGTCCTTGTTCGTAAGTCACGGACCGTCGATGGGAATGCATCTGTTGACTTTATTGGAACAATTAAATTAGTTTCCGCCACAAAGGTGTTTCATTTTCCTGTTCATTCATGGGTATCCTCAGATCATGATTGGAGAGTTTTCTTTGAAGGAACAGCGTATCTCCCGGCTCATACACCCCCGTCGCTCCGTGATGAACGTCAACGTGAACTCCAAGAATTGCAAGGTACCCCAGCAACGAGAACTTTAGAACGTCGTCCGGCAGATCGTATTTATTGGTATCAAACATACGATGATCTCAGTAGTGCGGGCGAAGGTGGGTATAGACCAGCACTTGGTGCAACGGCTCGACGTCCTTATCCACGTCGTATTGCAACTAATCGCGGGGCGGCTGATGGACATCCTGATCGTGAAAAGCCACCAGTGAAAGCCGGAGATAAACCATGGCTTCCATATGATGAACAATTTTCGTTTGATAAAGCTGCCGATTTTAATGGGGATACCTTGACAGCAGCCTTACCGGCTGCATTTAGCTTTATAGCCGAAGCAGGAGATCAACGTCATCTTACGTGGCTGAATTTGTTACCGACAGCAGTCCATGGTTTGGTACGGAATGTCTTAAGAGCAGTACTTGGCTATGCCGAACCGCCGGCTGCAAATTTTGATAGTTTTGAAGATGTATTGGCGTTCTTTGGTGAAGATGCTGCCAGTCGTGGTAGTTCTATGGCACCAACCCAATTGTATCCAGCAGGTCAAGAAGCCGCGATGAAAGGATTTGGTGCTCCACATGATCCACGGAATCCAGCTCCATTTAAAACGGCTAGTGGTGCCTGGGATTTTCGTCTGAATTCAGCGGCAGCTGCAGCGATTAATGATCAAATAGCAGCAGATCGCGTAGGACCAGTCCCGGATTCAGCAACAGGTGGTCCGTCATCAGGAGCGGCTACAGCAGCTACTGCATTCGCTGCAACTGCTGCGGCTGCCACTGCGGCTGGGGCACCGGCGGCTGCAATTACAGCGCCCCCACAACCGGGTGTTCCTAATTTAATAGGTCTCCTCGGATCTGCAGTTTGGCGTCGATTAACTAATGATCCAAGTCATGATATTAATGATCTGTTGTATTTTCCTGTTCCACGAGTTGTCGATGGTCGCCCAGATGCGTGGTATACAGACGAAGAATATGGACGTCAAGCTCTTGCCGGTTATCATCCTACAGCGATTACAGCTCTTACTCAATTGCCCGAAGCATTTGGTAGCGCAATAAGAGCTCATCATGTGGAAGCGGAACTGCAAGGTAGTTCTTTGGAAGCACTCGTCGCAGCAGCAGCTGGTGGTGCAAAACCACGTCTTTATTTGATTGATCATTGGGATCTTTCGGCGTATTGGCAAGAAGCAGAAGAAGAAGCTGAAGCCGCACGGAAAGCCGGCAGAAAACCACCATCAGCCGTCCAACATGCAGGTCGTTGTCTTTTCTATTTGCGTAAAGATGAAGTAACAGGCGAAGATACTGCTTTAGTCCCGATCGCAATAGAACTCGCTCATCCTGGTACGCATAAAGCTAGCAATGGGACTTCCGCACCATTGCCCCCAACGGCAGGGGAAGTTTATGCCCGTAGCGAACTCGTAGCGTCTCCACAAACCTTGGCTGTCTGGCGCCTCGCGAAAGCTGTTTTCAGAAGTCTTGATACCAGTATTCATCAATTAGTAGCGCATTTTAATCGTACACATGCCGCATTAGAACCATTTCTGATTGCGATGCGTCGGCAAATGTCCGTGATGCATCCAATTACAAAATTGATGCTCCCTCATTTTAGATATACCCTGAATATTAATCGTAATGCACGTGCGTCACTGATTAATGCAGGTGGTATTATAGAGAAAACGTTTAGTGCCGGCCCGTTTGCTATGAGATTGGCGTCAGCTGTTTATGGTAAATCGTGGACCTTTGCCGGCCAAGCCTTGCCTGAAGATCTCCGCGAAAGAGGGATGCTTGATGCCGCAGGTCGACCGTGGCTTGATTATCCATTTGCTATCGATGGTCTCGATACATGGGCAGCTCTGACGGCATATTTTGATCAATATGTTAGCTTGTATTATGATGGGGATGGGGCCGTTCTCGAAGATGGTGAATTACAAGCGTGGTGGGATGAAGTTAAAACCGAAGGGCATCCTGATATTGTAGCGTTTGGTCTTAAATCCGAACAACAAGTATGGGGATTTACAGGACCAATTGCAAAACGTAGTGATCTTGTACATGTACTTGCTACTATTGCGTGGCTTGCGTCTGGTCATCATGCCGCAGTGAATTTTGGCCAATATGATTTTACAGGACTGATATTAAATGCATCTAGCTTGGTACGTCGCCCGATGCCGGCCCCGAAAGAACCGGCATATAAAGAATTGACTGGTGCTGCTTTAGGTCCACCACAAGAACGGGTATTTATGACGTACCTTGCAGATCCGTTTTCAGCAGTTCAAGTATTAGCTACAGTCAAATTACTCTCTGCTCATGCCCGCGATGAACATACCCTTGATGAAGCAAATGATTATATTGTAGATCCAGCAGCACGAGAGGCGAATCGTGCATTTATTGCAGCGGTTAAACAACTTGAATCAGCGATTGAAACTCGTAATGCGGACCCGGCAAATTGGGCACGTTATGGTCTCGCTGCTGGAACTGCAGCCCCTTTACCTTATACGCTTTTAATGGCCAGTTCCCCACCAGGCGTCACAATGCGTGGTGTTCCCTATAGTGTTTCCATTTAG 2

[0040] In the present invention, the above 15 S - Fatty acid oxidases include the amino acid sequence of SEQ ID NO. 1, and all mutant enzymes capable of achieving the effects intended by the present invention through one or more substitutions, deletions, additions, etc. to the said sequence are included within the scope of the present invention. That is, the above 15 S - The fatty acid oxidase may comprise an amino acid sequence having at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 99%, or 100% identity with respect to the amino acid sequence of SEQ ID NO. 1. Additionally, the above 15 S - The fatty acid oxidase may be a product expressed from a gene containing the nucleotide sequence of SEQ ID NO. 2.

[0041] In the present invention, the above 15 S - The gene encoding fatty acid oxidase is not only composed of the nucleotide sequence of SEQ ID NO. 2, but also includes functional equivalents thereof, that is, all mutants that achieve the purpose of the present invention by inducing one or more mutations such as substitutions or deletions in the said sequence. That is, the said gene may include a nucleotide sequence having at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 99%, or 100% identity with respect to the nucleotide sequence of SEQ ID NO. 2.

[0042] In the present invention, the composition may further include docosahexanoic acid as a substrate.

[0043] In a specific embodiment of the present invention, the 15 STo maximize the production effect of fatty acid oxidases on Resolvin D5 and Protectin Dx, the concentrations of the solvent, polymer, whole cell, and substrate were optimized. As a result, as shown in Figure 5, the optimal concentrations of the solvent, dimethyl sulfoxide, and the polymer, polyvinylpyrrolidone, were found to be 2 (v / v)% and 2 (w / v)%, respectively. Additionally, as shown in Figure 6, it was confirmed that the production of Resolvin D5 and Protectin Dx increased significantly at a whole cell concentration of 0.5 g / L and a substrate concentration of 6 mM.

[0044] Accordingly, in the present invention, the concentration of the substrate may be 1 mM to 8 mM. Preferably, the concentration of the substrate may be 2 mM to 8 mM, more preferably 3 mM to 8 mM, more preferably 4 mM to 7 mM, more preferably 5 mM to 7 mM, and most preferably 6 mM.

[0045] In the present invention, the composition for producing resolvin D5 and protectin Dx is 15 derived from Chlamydomonas insultae S - Containing fatty acid oxidase as an active ingredient, the above 15 S - It may include whole cells containing fatty acid oxidase as an active ingredient.

[0046] Specifically, the above 15 S - It is preferable to culture a transformant transformed with a recombinant expression vector containing a gene encoding the amino acid sequence of SEQ ID NO. 1 or a gene consisting of the nucleotide sequence of SEQ ID NO. 2, and to obtain and use the whole cell containing the fatty acid oxidase.

[0047] As the above recombinant expression vector, any plasmid vector used in the industry for gene recombination may be used, and specifically, it is more preferable to use the pET-28(+)a plasmid, but is not limited thereto.

[0048] In the present invention, the above 15 S - Whole cells containing fatty acid oxidase can be obtained by including the following steps: i) centrifuging the culture medium of the microorganism to recover the first whole cells; ii) washing the recovered whole cells with physiological saline solution; iii) centrifuging the washed whole cells a second time to remove the supernatant and recover the whole cells; and iv) washing the whole cells recovered a second time once more with physiological saline solution. Specifically, in step i), the recovery of whole cells can be performed in a range of approximately 13,000 g using equipment known in the art, such as a centrifuge, and in step ii), the washing of whole cells is suitable to be performed with a sodium chloride solution of 0.85% or less.

[0049] In the present invention, the 15 in the composition S - The concentration of whole cells containing fatty acid oxidase may be 0.1 g / L to 1 g / L. Preferably, the concentration of whole cells may be 0.2 g / L to 0.8 g / L, more preferably 0.3 g / L to 0.7 g / L, even more preferably 0.4 g / L to 0.6 g / L, and most preferably 0.5 g / L.

[0050] In a specific embodiment of the present invention, the 15 S - As a result of confirming the amounts of resolvin D5 and protectin Dx produced by recombinant E. coli expressing fatty acid oxidase, as shown in Figure 7, it was confirmed that 2.29 mM (826 mg / L) resolvin D5 and 1.68 mM (606 mg / L) protectin Dx were produced.

[0051] That is, 15 of the present invention S It was confirmed that resolvin D5 and protectin Dx can be simultaneously produced with high efficiency through a single-step reaction using fatty acid oxidase.

[0052] Accordingly, a second aspect of the present invention is a method for producing Resolvin D5 and Protectin Dx comprising the step of treating a substrate with the composition, wherein

[0053] The present invention relates to a method of manufacturing characterized in that the substrate is docosahexanoic acid.

[0054] The composition and effect of the above composition used in the manufacturing method of the present invention are identical to the composition and effect described in the first aspect, so the description is omitted.

[0055] In the present invention, the step may involve further treating with dimethyl sulfoxide as a solvent and further treating with polyvinyl pyrrolidone as a polymer.

[0056] In the present invention, the concentrations of the dimethyl sulfoxide and polypinylpyrrolidone may be 1 (v / v)% to 5 (v / v)% and 1 (w / v)% to 5 (w / v)%, respectively. Preferably, when the concentration of the dimethyl sulfoxide is 1 (v / v)% to 5 (v / v)%, the concentration of the polypinylpyrrolidone may be, for example, 1 (w / v)% to 4 (w / v)%, 1 (w / v)% to 3 (w / v)%, or 2 (w / v)%. Alternatively, when the concentration of the dimethyl sulfoxide is 1 (v / v)% to 4 (v / v)%, the concentration of the polypinylpyrrolidone may be, for example, 1 (w / v)% to 5 (w / v)%, 1 (w / v)% to 4 (w / v)%, 1 (w / v)% to 3 (w / v)%, or 2 (w / v)%. Still else, when the concentration of the dimethyl sulfoxide is 1 (v / v)% to 3 (v / v)%, the concentration of the polypinylpyrrolidone may be, for example, 1 (w / v)% to 5 (w / v)%, 1 (w / v)% to 4 (w / v)%, 1 (w / v)% to 3 (w / v)%, or 2 (w / v)%. Alternatively, when the concentration of the dimethyl sulfoxide is 2 (v / v)%, the concentration of the polypinylpyrrolidone may be, for example, 1 (w / v)% to 5 (w / v)%, 1 (w / v)% to 4 (w / v)%, 1 (w / v)% to 3 (w / v)%, or 2 (w / v)%. Most preferably, the concentrations of the dimethyl sulfoxide and the polypinylpyrrolidone may be 2 (v / v)% and 2 (w / v)%, respectively.

[0057] In the present invention, the step may be carried out at a pH of 7.0 to 9.0. Preferably, it may be carried out at a pH of around 8.0. To maintain these pH conditions, HEPPS buffer solution may be used as a reaction solvent.

[0058] In the present invention, the step may be carried out at a temperature of 15°C to 40°C. Preferably, it may be carried out at a temperature of 17°C to 35°C, more preferably at 20°C to 30°C, more preferably at 22°C to 27°C, and most preferably at around 25°C. By maintaining these conditions, the production activity of resolvin D5 and protectin Dx can be improved.

[0059] In the present invention, the above step may be performed through a whole-cell reaction.

[0060] In the present invention, the time of the whole-cell reaction can be appropriately controlled according to a conventional method.

[0061] In the present invention, the manufacturing method may produce resolvin D5 and protectin Dx simultaneously in a single step.

[0062] In the present invention, the single reaction production yield of resolvin D5 and protectin Dx using the above manufacturing method may be 700 to 900 mg per liter and 500 to 700 mg per liter, respectively.

[0063] In addition, a third aspect of the present invention comprises 15 including the nucleotide sequence of SEQ ID NO. 2. S - This relates to a recombinant expression vector for the production of resolvin D5 and protectin Dx containing a fatty acid oxidase gene.

[0064] As used in the present invention, the term "recombinant expression vector" refers to a recombinant vector capable of expressing a target peptide in a suitable host cell, and a genetic construct comprising essential regulatory elements linked to function to express a gene insert. The expression vector of the present invention includes expression regulatory elements such as a promoter, an operator, and a start codon, which are elements generally possessed by a suitable expression vector. The start codon and the stop codon are generally considered to be part of the nucleotide sequence encoding the polypeptide, must exhibit function in the individual when the genetic construct is administered, and must be in frame with the coding sequence. The promoter of the vector may be constitutive or inducible.

[0065] Additionally, it may include a signal sequence for the release of the fusion polypeptide to facilitate the separation of the protein from the cell culture medium. A specific initiation signal may also be required for the efficient translation of the inserted nucleic acid sequence. These signals include an ATG start codon and adjacent sequences. In some cases, an exogenous translation regulatory signal that may include an ATG start codon must be provided. These exogenous translation regulatory signals and start codons may be from various natural and synthetic sources. Expression efficiency can be increased by introducing appropriate transcription or translation enhancing factors.

[0066] In the present invention, any conventional expression vector may be used. For example, plasmid DNA, phage DNA, etc. may be used. Specific examples of plasmid DNA include commercial plasmids such as pUC18 and pIDTSAMRT-AMP. Other examples of plasmids that can be used in the present invention include E. coli-derived plasmids (pYG601BR322, pBR325, pUC118 and pUC119), Bacillus subtilis-derived plasmids (pUB110 and pTP5), and yeast-derived plasmids (YEp13, YEp24 and YCp50). Specific examples of phage DNA include λ-phages (Charon4A, Charon21A, EMBL3, EMBL4, λgt10, λgt11, and λZAP). In addition, animal viruses such as retroviruses, adenoviruses, or vaccinia viruses, and insect viruses such as baculoviruses may also be used. In the present invention, it is more preferable to use pET-28a(+), but is not limited thereto. Since the expression levels and modifications of proteins vary depending on the host cell, the host cell most suitable for the purpose should be selected and used.

[0067] Additionally, a fourth aspect of the present invention relates to a transformant in which the recombinant expression vector is transformed into a host cell.

[0068] The transformant of the present invention is obtained by introducing the recombinant expression vector of the present invention into a suitable host. The types of host cells include the genera Esherichia, Pseudomonas, Ralstonia, Alcaligenes, Comamonas, Burkholderia, Agrobacterium, Flabobacterium, Vibrio, Enterobacter, Rhizobium, Gluconobacter, Acinetobacter, Moraxella, Nitrosomonas, Aeromonas, Paracoccus, and Bacillus. Examples include various bacteria of the genera Clostridium, Lactobacillus, Corynebacterium, Arthrobacter, Achromobacter, Micrococcus, Mycobacterium, Streptococcus, Streptomyces, Actinomyces, Nocardia, and Methylobacterium. In addition, other than the above bacteria, yeasts such as Saccharomyces and Candida, as well as various fungi, may be used as host cells. Specifically, the Escherichia coli ER2566 strain may be used, but is not limited thereto.

[0069] As described above, when bacteria such as E. coli are used as host cells, the recombinant expression vector of the present invention is capable of autonomous replication within the host, and at the same time, the promoter, 15S It is desirable to have a composition necessary for the expression of DNA containing a fatty acid oxidase gene and transcription termination sequences, etc.

[0070] As methods for introducing recombinant DNA into bacteria, the calcium chloride method, the electroporation method (Method Enzymol., 194, 182-187 (1990)), the spheroplast method (Proc. Natl. Acad. Sci. USA, 84, 1929-1933 (1978)), and the lithium acetate method (J. Bacteriol., 153, 163-168 (1983)) can be used.

[0071] In the present invention, the above 15 S - The production of fatty acid oxidase involves, for example, culturing a transformant obtained by transforming host cells with a recombinant expression vector containing a gene encoding it, and 15, the gene product, in the culture (cells or supernatant). S - This can be done by generating and accumulating fatty acid oxidases and obtaining the enzyme from the culture.

[0072] The method for culturing the transformant of the present invention can be carried out using a conventional method used for culturing host cells.

[0073] In the present invention, the culture method may utilize any method commonly used for culturing microorganisms, such as batch type, flow batch type, continuous culture, or reactor type. As the medium for the transformant obtained using bacteria such as E. coli as a host, complete medium or synthetic medium, such as LB medium or M9 medium, may be used. Furthermore, by culturing within the aforementioned optimal temperature range, 15 S - Fatty acid oxidase can be accumulated within the cell and recovered.

[0074] As mentioned above, according to the present invention, Chlamydomonas insulta ( Chlamydomonas incerta ) Strain origin 15 SBy using fatty acid oxidase, it is possible to produce Resolvin D5 and Protectin Dx with high yield using dimethyl sulfoxide as a solvent and polyvinylpyrrolidone as a polymer for maximum production. Furthermore, since it can be produced in an environmentally friendly manner compared to materials obtained through chemical synthesis using heavy metals and organic solvents, it is expected to be useful in various industrial fields such as pharmaceuticals, food, and cosmetics.

[0075] Dihydroxylated fatty acids produced according to the present invention are expected to be involved in various physiological functions in animals, including humans, as signaling molecules.

[0076] Preferred embodiments are presented below to aid in understanding the present invention. However, the following embodiments are provided merely to facilitate a better understanding of the invention, and the scope of the invention is not limited by the following embodiments.

[0077] 1. 15 S - Preparation of whole-cell reaction of fatty acid oxidase

[0078] Chlamydomonas insulta ( Chlamydomonas incerta ) Strain origin 15 S - To prepare fatty acid oxidase, Chlamydomonas insulta (with a known sequence) Chlamydomonas incerta DNA synthesis was commissioned to L&C Bio based on the fatty acid oxidase DNA base sequence of SEQ ID NO. 2 derived from ). The synthesized fatty acid oxidase DNA of SEQ ID NO. 2 was provided in the form of a pET28 vector containing the synthesized DNA.

[0079] Microorganisms transformed with the above vector were cultured in 1 L of LB (Luria-Bertani, LB; Difco, Sparks, MD, USA) medium containing 20 μg / mL of kanamycin in a shaking Erlenmeyer flask at 37°C under an aeration condition of 200 rev / min. When the absorbance of the whole cells reached 0.6 to 0.8 at 600 nm, a final concentration of 0.1 mM IPTG (isopropyl-β-D-thiogalactopyranoside, IPTG) was added to induce protein expression of the enzymes, and the culture medium was cultured for 16 hours at 16°C with stirring at 150 revolutions per minute. In addition, the double 15-oxidized lipase produced by overexpression as described above was centrifuged at 6,000 × g for 30 minutes at 4°C using the culture medium of the transformed strain, washed twice with 0.85% sodium chloride (NaCl), and then used as recombinant cells to produce Resolvin D5 and Protectin Dx. The transformed microorganisms were treated with the addition of a 20% glycerin solution and 15 S -Fatty hydroxylated acid, 17 S - After culturing for the production of fatty acids, resolvin D5, and protectin Dx, they were frozen and stored at -70℃ before use.

[0080] 2. 15 S - Identification of fatty acid oxidase

[0081] To identify the fatty acid oxidase, the hydroxylated fatty acid, a primary product generated from arachidonic acid, was confirmed as 15-hydroxyarachidonic acid using HPLC (Fig. 1), and the hydroxylated fatty acid is 15 S - It was confirmed as fatty acid hydroxylation (Fig. 2). Dihydroxylated fatty acid, a secondary product generated from arachidonic acid, was analyzed using HPLC 5 S ,15 S - Arachidonic acid dihydroxy(5 S ,15 S -dihydroxyeicosatetraenoic acid, 5S ,15 S -DiHETE) and 8 S ,15 S - Arachidonic acid dihydroxy(8 S ,15 S -dihydroxyeicosatetraenoic acid, 8 S ,15 S It was confirmed that it is -DiHETE) (Fig. 3). From arachidonic acid 15 S - The chemical structures of all products generated by the fatty acid oxidase reaction were identified by LC-MS / MS (Fig. 4). As a result, the fatty acid oxidase derived from the microorganism Chlamydomonas incerta showed double oxygenation 15 S - Fatty acid oxidase (double-oxygenating 15 S It was found to be lipoxygenase.

[0082] 3. 15 S - Optimization of solvent, polymer, cell, and substrate concentrations in the production of Resolvin D5 and Protectin Dx using fatty acid oxidase

[0083] To determine the optimal concentrations of dimethyl sulfoxide, a solvent, and polyvinylpyrrolidone, a polymer, for increasing the production of the above-mentioned resolvin D5 and protectin Dx, whole-cell reactions were conducted at different concentrations of dimethyl sulfoxide and polyvinylpyrrolidone in 1 mM docosahexaenoic acid at pH 8.0 and a temperature of 25°C for 60 minutes. As a result, it was confirmed that the optimal concentration was 2% for each (Fig. 5).

[0084] In addition, to determine the optimal concentrations of cells and substrates under the optimal concentrations of the solvent dimethyl sulfoxide and the polymer polyvinylpyrrolidone, whole-cell reactions were conducted for 60 minutes at pH 8.0 and a temperature of 25°C with docosahexaenoic acid as the substrate at concentrations ranging from 1 mM to 8 mM. As a result, it was confirmed that the optimal cell concentration was 0.5 g / L and the substrate concentration was 6 mM (Fig. 6).

[0085] 4. 15 S - Confirmation of simultaneous production of Resolvin D5 and Protectin Dx using fatty acid oxidase

[0086] The above 15 S The amounts of resolvin D5 and protectin Dx, respectively, produced by recombinant E. coli expressing fatty acid oxidase using docosahexaenoic acid, an unsaturated fatty acid, as a substrate were determined. A whole-cell reaction was carried out for 90 minutes at pH 8.0 and a temperature of 25°C with 6 mM docosahexaenoic acid as the substrate, and the production levels of resolvin D5 and protectin Dx at each reaction time were determined.

[0087] As a result, as shown in Figure 7, it was confirmed that approximately 4.0 mM (1.44 g / L) of omega-3 dihydroxylated fatty acids containing resolvin D5 and protectin Dx were produced by a whole-cell reaction in which 15S-fatty acid oxidase was expressed. At this time, 2.29 mM (826 mg / L) of resolvin D5 and 1.68 mM (606 mg / L) of protectin Dx were produced, respectively. In particular, the concentration of protectin Dx obtained in the present invention is 5.6 times higher than the 0.3 mM (108 mg / L) produced by a two-step bioconversion by a combination reaction of recombinant microorganisms containing single-oxygenating fatty acid oxidase reported in Non-Patent Literature 2.

Claims

Claim 1 Chlamydomonas insulta ( Chlamydomonas incerta 15 containing the amino acid sequence of SEQ ID NO. 1 derived from ) S A composition for producing Resolvin D5 and Protectin Dx comprising, as an active ingredient, whole cells transformed with a vector comprising a fatty acid oxidase; or a gene comprising the nucleotide sequence of SEQ ID NO. 2 encoding the same. Claim 2 A composition according to claim 1, characterized in that the composition further comprises docosahexanoic acid as a substrate. Claim 3 A composition according to claim 2, characterized in that the concentration of the substrate is 1 mM to 8 mM. Claim 4 A composition according to claim 1, characterized in that the concentration of the whole cell is 0.1 g / L to 1 g / L. Claim 5 A method for manufacturing Resolvin D5 and Protectin Dx comprising the step of treating a substrate with a composition of any one of claims 1 to 4, wherein the substrate is docosahexanoic acid. Claim 6 A manufacturing method according to claim 5, characterized in that the above step further involves treating with dimethyl sulfoxide as a solvent and further treating with polyvinyl pyrrolidone as a polymer. Claim 7 A method of preparation according to claim 6, characterized in that the concentrations of the dimethyl sulfoxide and polypinylpyrrolidone are each 1 (v / v)% to 5 (v / v)% and 1 (w / v)% to 5 (w / v)%. Claim 8 A manufacturing method according to claim 5, wherein the step is characterized by performing the reaction at a pH of 7.0 to 9.

0. Claim 9 A manufacturing method according to claim 5, characterized in that the above step is performed at a temperature of 15℃ to 40℃. Claim 10 In claim 5, the above manufacturing method is characterized by simultaneously producing resolvin D5 and protectin Dx in a single step. Claim 11 15 containing the nucleotide sequence of SEQ ID NO. 2 S - Recombinant expression vector for the production of resolvin D5 and protectin Dx containing fatty acid oxidase genes. Claim 12 A transformant in which a recombinant expression vector according to paragraph 11 has been transformed into a host cell.

Images