CD73 blocking antibody

Abstract

The present invention relates to an antibody that binds to and inhibits CD73, and a fragment thereof. The present invention also relates to a cell that produces such a compound; a method for producing such a compound, and antibodies, fragments, variants, and derivatives thereof; a pharmaceutical composition comprising the same; and a method for diagnosing, treating, or preventing a disease, e.g., cancer, using the compound.

Description

Technology Field

[0001] Cross-reference of related applications

[0002] This application claims priority to U.S. provisional application No. US 62 / 837,214 filed on April 23, 2019, the entire contents of which, including any drawings, are incorporated herein by reference.

[0003] Mention of the sequence list

[0004] This application is filed together with a sequence list in electronic form. The sequence list is provided as a file named "CD73-6_ST25", with a size of 62 KB, created on April 1, 2020. The full text of the sequence list information in electronic form is incorporated herein by reference.

[0005] Field of invention

[0006] The present invention relates to an antibody that binds to and inhibits CD73, and a fragment thereof. The present invention also relates to a cell that produces such a compound; a method for producing such a compound, and the antibody, its fragment, variant, and derivative; a pharmaceutical composition comprising the same; and a method for diagnosing, treating, or preventing a disease, e.g., cancer, using the compound. Background Technology

[0007] CD73 (ecto-5'-nucleotidase) is a 70-kDa glycosylphosphatidylinositol (GPI)-anchored protein that is normally expressed on a subset of hematopoietic cells and endothelial cells. CD73 regulates adenosine triphosphate (ATP) metabolism together with CD39. While CD39 (NTPDase-1) converts ATP to AMP, releasing only trace amounts of ADP, CD73 catalyzes the conversion of AMP to adenosine.

[0008] Adenosine triphosphate (ATP) and its metabolites, AMP and adenosine, play important roles in cellular metabolism, signaling, and immune homeostasis. The release of extracellular adenosine triphosphate (ATP) in response to apoptosis or cellular stress acts to activate immune responses. However, its metabolite, adenosine, possesses immunosuppressive activity. Extracellular adenosine accumulates in cancer tissues and constitutes a key mechanism of tumor immune escape. Among other effects, tumor-derived adenosine significantly inhibits infiltrating effector T cells through adenylylcyclase-activated A2A receptors.

[0009] CD73 expression has been reported in various tumor cells, including leukemia, bladder cancer, glioma, glioblastoma, ovarian cancer, melanoma, prostate cancer, thyroid cancer, esophageal cancer, and breast cancer. CD73 expression has also been associated with metastasis-promoting phenotypes in melanoma and breast cancer. It has been reported that therapy using antibodies binding to murine CD73 can inhibit breast tumor growth and metastasis in mice (Stagg, et al. (2010) Proc. Natl. Acad. Sci. USA 104:1547-1552). It has been revealed that gene deletion of the A2A receptor can induce T cell-dependent tumor rejection (Ohta, et al., ( 2006 Proc Natl Acad Sci USA 103 : 13132 -13137). Overexpression of CD73 on tumor cells or knockdown using siRNA can regulate tumor growth and metastasis (Beavis et al. (2013 Proc. Natl. Acad. Sci. USA 110:14711-716; Stagg et al. (2010), cit.; Jin et al. (2010) Cancer Res. 70: 2245-55). CD73- / - mice are protected from transplanted and spontaneously occurring tumors (Stagg et al. (2010) Cancer Res. 71: 2892-2900). In humans, high CD73 expression may be a negative prognosis for triple-negative breast cancer (Loi et al. (2013) Proc. Natl. Acad. Sci. USA 110: 11091-11096). However, while CD73 is expressed on tumor cells, different cells of the immune system, In particular, it is expressed on CD4 and CD8 T cells, as well as on B cells. In addition, one additional complication is that many antibodies described in the literature generally belong to murine isotypes that can be bound to the Fcγ receptor, making it difficult to isolate any potential blocking effect from Fc-mediated effects.

[0010] Despite long-standing interest in CD73 as a therapeutic target, there remains a need for antibodies that have higher efficacy in inhibiting the enzymatic activity of CD73 and are suitable for use in human therapy.

[0011] The inventors provide an antibody that binds to an epitope present on CD73 expressed on the surface of cells, including tumor cells, and inhibits the enzymatic (ecto-5' nucleotide) activity of the CD73 enzyme. The antibody has a human-derived backbone region having a minimal non-human (e.g., mouse) sequence content. The antibody can bind to CD73 in a dimer manner and can inhibit the enzymatic activity of both soluble CD73 and membrane-bound CD73 protein expressed on the surface of cells. Advantageously, these antibodies can be used as pure CD73 blocking antibodies, for example, these antibodies inhibit the enzymatic activity of membrane-bound CD73 protein expressed on the surface of cells without substantially binding to the Fcγ receptor and / or substantially inducing ADCC toward CD73-expressing cells. Optionally, the antibody retains the Fc domain and retains binding to human FcRn. Antibodies may advantageously have a low risk of immunogenicity; for example, when administered to humans, the likelihood of inducing a human anti-mouse antibody (HAMA) response may be lower or reduced (compared to murine parent antibodies).

[0012] The antibody binds to an epitope present on the human CD73 polypeptide expressed on the surface of cells, including but not limited to tumor cells, and inhibits the enzymatic (etho-5' nucleotide) activity of the CD73 enzyme. The antibody has a particularly advantageous ability to inhibit the inhibition of T cell proliferation mediated by CD73, and consequently, may cause an increase in biological activity, including but not limited to the proliferation of cytotoxic CD4 and / or CD8 T cells, as observed, for example, in a T cell proliferation assay. In one embodiment, inhibition or neutralization of the enzymatic activity of CD73 is confirmed by evaluating the ability of the antibody or antibody fragment to increase T cell proliferation when said T cells are induced to proliferate in vitro (e.g., via TCR co-stimulation) in the presence of AMP (e.g., exogenously added AMP).

[0013] In one embodiment, an antibody or antibody fragment, or its antigen-binding domain, is provided, comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 37 and a light chain variable region comprising an amino acid sequence selected from the group consisting of the amino acid sequences of SEQ ID NOS: 33, 34, 35, or 36. In one embodiment, an antibody or antibody fragment, or its antigen-binding domain, is provided, comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 37 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 33.

[0014] In one embodiment, an antibody or antibody fragment, or its antigen-binding domain, is provided, comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 42 and a light chain variable region comprising an amino acid sequence selected from the group consisting of the amino acid sequences of SEQ ID NOS: 43, 44, 45, or 46. In one embodiment, an antibody or antibody fragment, or its antigen-binding domain, is provided, comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 42 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 43.

[0015] In one embodiment, an anti-CD73 antibody or antibody fragment is provided, comprising a heavy chain having the amino acid sequence of SEQ ID NO: 38 and a light chain having the amino acid sequence of SEQ ID NO: 39.

[0016] In one embodiment, an anti-CD73 antibody or antibody fragment is provided, comprising a heavy chain having the amino acid sequence of SEQ ID NO: 47 and a light chain having the amino acid sequence of SEQ ID NO: 48.

[0017] In one embodiment, an anti-CD73 antigen-binding domain, or a protein comprising the same (e.g., an antibody or antibody fragment, a multispecific binding protein, a bispecific antibody, etc.) is provided, comprising: a heavy chain variable region (VH) comprising backbone FR1, FR2, and FR3 amino acid sequences from the human IGHV1-3 gene having the respective amino acid sequences presented in SEQ ID NOS: 2, 3, and 4; and a light chain variable region (VL) comprising backbone FR1, FR2, and FR3 amino acid sequences from the human IGKV1-33 gene having the respective amino acid sequences presented in SEQ ID NOS: 5, 6, and 7; and a protein comprising the same (e.g., an antibody or antibody fragment, a multispecific binding protein, a bispecific antibody, etc.). The residue at Kabat position 59 (HCDR2) in the heavy chain variable region is optionally a leucine or glutamine residue. The residue at Kabat position 60 (HCDR2) in the heavy chain variable region is optionally a threonine or lysine residue. The residue at Kabat position 97 (HCDR3) in the heavy chain variable region is optionally a glycine or asparagine residue. The residue at Kabat position 30 (LCDR1) in the light chain variable region is optionally a serine or threonine residue. The residue at Kabat position 53 (LCDR2) in the light chain variable region is optionally a threonine or asparagine residue.

[0018] In one embodiment, an anti-CD73 antigen-binding domain, or a protein comprising the same (e.g., an antibody or antibody fragment, a multispecific binding protein, a bispecific antibody, etc.) is provided, comprising: a heavy chain variable region (VH) comprising backbone FR1, FR2, and FR3 amino acid sequences from the human IGHV1-3 gene having the respective amino acid sequences presented in SEQ ID NOS: 2, 8, and 9 (and optionally an additional backbone 4 (FR4) amino acid sequence from the human IGHJ4 gene); and a light chain variable region (VL) comprising CDR1, CDR2, and CDR3 having the respective amino acid sequences presented in SEQ ID NOS: 10, 11, and 7, and backbone FR1, FR2, and FR3 amino acid sequences from the human IGKV1-33 gene (and optionally an additional backbone 4 (FR4) amino acid sequence from the human IGKJ2 gene). In one embodiment, VH further comprises one, two, or three amino acid substitutions at kavat heavy chain positions selected from the group consisting of 59 (HCDR2), 60 (HCDR2), and 97 (HCDR3) in the kavat heavy chain CDR. Optionally, the leucine residue at position 59 is substituted with a glutamine residue. Optionally, the threonine residue at position 60 is substituted with a lysine residue. Optionally, the glycine residue at position 97 is substituted with an asparagine residue. In one embodiment, VL further comprises amino acid substitutions at kavat light chain positions 30 (LCDR1) and / or 53 (LCDR2) in the kavat light chain CDR, optionally additionally, the serine residue at position 30 is substituted with a threonine residue, and optionally additionally, the threonine residue at position 53 is substituted with an asparagine residue.

[0019] In one embodiment, an anti-CD73 antigen-binding domain, or a protein comprising the same (e.g., an antibody or antibody fragment, a multispecific binding protein, a bispecific antibody, etc.) is provided, comprising: a heavy chain variable region (VH) comprising backbone FR1, FR2, and FR3 amino acid sequences from the human IGHV1-3 gene having the respective amino acid sequences presented in SEQ ID NOS: 2, 12, and 13 (and optionally an additional backbone 4 (FR4) amino acid sequence from the human IGHJ4 gene); and a light chain variable region (VL) comprising a backbone FR1, FR2, and FR3 amino acid sequences from the human IGKV1-33 gene having the respective amino acid sequences presented in SEQ ID NOS: 14, 15, and 7 (and optionally an additional backbone 4 (FR4) amino acid sequence from the human IGKJ2 gene).

[0020] In one aspect of any embodiment of the present invention, the heavy chain variable region (VH) may be characterized by comprising one, two, three, four, or five amino acid substitutions at a kavat heavy chain position selected from the group consisting of 2, 30, 48, 69, and 73, and optionally a residue present at a specific position in the human sequence is replaced with a residue present at that specific position in the murine donor sequence; and the light chain variable region (VL) may be characterized by comprising an amino acid substitution at kavat light chain position 67, and optionally a residue present at a specific position in the human sequence is replaced with a residue present at that specific position in the murine donor sequence. In one embodiment, VL comprises a substitution at kavat light chain position 67, and optionally an additional one, two, or three amino acid substitutions at a kavat light chain position selected from the group consisting of 2, 67, and 87, and optionally a residue present at a specific position in the human sequence is replaced with a residue present at that specific position in the murine donor sequence. In one embodiment, the antibody or antibody binding domain comprises a heavy chain variable region comprising amino acid substitutions V2I, T30A, M48I, I69L and T73K and a light chain variable region comprising amino acid substitution S67Y, and the numbering follows the kavat.

[0021] In one embodiment of any of the embodiments of the present invention, the amino acid at position 2 of the carbat heavy chain is isoleucine.

[0022] In one embodiment of any of the embodiments of the present invention, the amino acid at position 30 of the carbat heavy chain is alanine.

[0023] In one embodiment of any of the embodiments of the present invention, the amino acid at position 48 of the kavat heavy chain is isoleucine.

[0024] In one embodiment of any of the embodiments of the present invention, the amino acid at position 69 of the carbat heavy chain is leucine.

[0025] In one embodiment of any of the embodiments of the present invention, the amino acid at position 73 of the carbat heavy chain is lysine.

[0026] In one embodiment, VH comprises an isoleucine residue at kavat position 2, alanine at position 30, isoleucine at position 48, leucine at position 69, and lysine at position 73.

[0027] In one embodiment of any of the embodiments of the present invention, the amino acid at position 67 of the kavat light chain is tyrosine.

[0028] In one embodiment of any of the embodiments of the present invention, the amino acid at position 60 of the kavat light chain is aspartic acid.

[0029] In one embodiment of any of the embodiments of the present invention, the amino acid at position 2 of the kavat light chain is isoleucine.

[0030] In one embodiment of any of the embodiments of the present invention, the amino acid at position 87 of the kavat light chain is phenylalanine.

[0031] In one embodiment, VL comprises a tyrosine residue at kavat position 67; optionally, VL does not include other substitutions by non-human residues in the kavat skeleton and / or has a VL kavat skeleton that is entirely human except for the substitution of residue 67.

[0032] In one embodiment, VL comprises a tyrosine residue at position 67 and aspartic acid at position 60.

[0033] In one embodiment, VL comprises a tyrosine residue at position 67, aspartic acid at position 60, and isoleucine at position 2.

[0034] In one embodiment, VL comprises a tyrosine residue at position 67, aspartic acid at position 60, isoleucine at position 2, and phenylalanine at position 87.

[0035] In one embodiment, an anti-CD73 antigen-binding domain, or a protein (e.g., an antibody or antibody fragment, a multispecific binding protein, a bispecific antibody, etc.) comprising an antigen-binding domain is provided, comprising a heavy chain variable region (VH) having an amino acid sequence that is at least 80%, 90%, 95%, 97%, 98%, or 99% identical to the amino acid sequence of SEQ ID NO: 37, and a light chain variable region (VL) having an amino acid sequence that is at least 80%, 90%, 95%, 97%, 98%, or 99% identical to any of SEQ ID NOS: 33, 34, 35, or 36. In one embodiment, VH comprises CDR1, CDR2, and CDR3 having the respective amino acid sequences presented in SEQ ID NOS: 2, 12, and 13, and VL comprises CDR1, CDR2, and CDR3 having the respective amino acid sequences presented in SEQ ID NOS: 14, 15, and 7. In one embodiment, VH comprises an isoleucine residue at kavat position 2, alanine at position 30, isoleucine at position 48, leucine at position 69, and lysine at position 73. In one embodiment, VL comprises a tyrosine residue at kavat position 67.

[0036] In one embodiment, a heavy chain variable region (VH) comprising CDR1, CDR2, and CDR3 having the respective amino acid sequences presented in SEQ ID NOS: 2, 3, and 4, and a human skeleton (e.g., FR1, FR2, FR3, and FR4 of human origin); A protein (e.g., antibody or antibody fragment, multispecific binding protein, bispecific antibody, etc.) comprising an anti-CD73 antigen-binding domain or an antigen-binding domain is provided, comprising a light chain variable region (VL) comprising CDR1, CDR2, and CDR3 having the respective amino acid sequences presented in SEQ ID NOS: 5, 6, and 7, and a human skeleton (e.g., FR1, FR2, FR3, and FR4 of human origin), wherein (VH) comprises an amino acid sequence that is at least 80%, 90%, 95%, 97%, 98%, or 99% identical to the amino acid sequence of SEQ ID NOS: 37 or 42, and the light chain variable region (VL) comprises an amino acid sequence that is at least 80%, 90%, 95%, 97%, 98%, or 99% identical to any of the amino acid sequences of SEQ ID NOS: 33-36 or 43-46. Includes. Optionally, the residue present at kavat position 59 (HCDR2) in the heavy chain variable region is a leucine or glutamine residue. Optionally, the residue present at kavat position 60 (HCDR2) in the heavy chain variable region is a threonine or lysine residue. Optionally, the residue present at kavat position 97 (HCDR3) in the heavy chain variable region is a glycine or asparagine residue. Optionally, the residue present at kavat position 30 (LCDR1) in the light chain variable region is a serine or threonine residue. Optionally, the residue present at kavat position 53 (LCDR2) in the light chain variable region is a threonine or asparagine residue. In one embodiment, VH comprises an isoleucine residue at kavat position 2, alanine at position 30, isoleucine at position 48, leucine at position 69, and lysine at position 73.In one embodiment, VL contains a tyrosine residue at kavat position 67.

[0037] In any embodiment, VH may be characterized by comprising a human VH recipient backbone amino acid sequence, and VL may comprise a human VL recipient backbone amino acid sequence. In one embodiment, the VH segment of the VH human recipient backbone is from a human IGHV1-3 gene segment, and the J-segment is from a human IGHJ4 gene segment. In one embodiment, the VH human recipient backbone is from a human IGHV1-3*01 gene segment. In one embodiment, the VL domain human recipient backbone is from a human IGKV1-33 gene segment, and optionally, the VL domain human recipient backbone is from a human IGKV1-33*01 gene segment. In one embodiment, the VL domain human recipient backbone comprises a J-segment from a human IGKJ2 gene segment.

[0038] In one embodiment, the antibody or antibody fragment comprises an H4+ VH domain and an L1, L2, L3, or L4 VL domain. In one embodiment, the antibody is antibody H4+L1.

[0039] In one embodiment, an anti-CD73 antigen-binding domain, or a protein (e.g., an antibody or antibody fragment, a multispecific binding protein, a bispecific antibody, etc.) comprising an antigen-binding domain is provided, comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 37 and a light chain variable region comprising the amino acid sequence selected from the group consisting of the amino acid sequences of SEQ ID NO: 33, 34, 35 or 36.

[0040] In one embodiment, an antibody or antibody fragment is provided that binds to human CD73 and neutralizes the ATPase activity of CD73, wherein the antibody or antibody fragment comprises a heavy chain variable region and a light chain variable region of antibody H4+L1.

[0041] In one embodiment, an antibody or antibody fragment is provided that binds to a human CD73 polypeptide and neutralizes the ATPase activity of CD73, wherein the antibody or antibody fragment comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 37 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 33.

[0042] In one embodiment, an antibody or antibody fragment is provided that binds to a human CD73 polypeptide and neutralizes the ATPase activity of CD73, wherein the antibody or antibody fragment comprises a heavy chain having the amino acid sequence of SEQ ID NO: 38 and a light chain having the amino acid sequence of SEQ ID NO: 39.

[0043] In one embodiment, the antibody or antibody fragment comprises a 2H4+ VH domain and a 2L1, 2L2, 2L3, or 2L4 VL domain. In one embodiment, the antibody is antibody 2H4+2L1.

[0044] In one embodiment, an anti-CD73 antigen-binding domain, or a protein comprising an antigen-binding domain (e.g., an antibody or antibody fragment, a multispecific binding protein, a bispecific antibody, etc.) is provided, comprising a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 42 and a light chain variable region comprising an amino acid sequence selected from the group consisting of an amino acid sequence of SEQ ID NO: 43, 44, 45 or 46.

[0045] In one embodiment, an antibody or antibody fragment is provided that binds to human CD73 and neutralizes the ATPase activity of CD73, wherein the antibody or antibody fragment comprises a heavy chain variable region and a light chain variable region of antibody 2H4+2L1.

[0046] In one embodiment, an antibody or antibody fragment is provided that binds to a human CD73 polypeptide and neutralizes the ATPase activity of CD73, wherein the antibody or antibody fragment comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 42 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 43.

[0047] In one embodiment, an antibody or antibody fragment is provided that binds to a human CD73 polypeptide and neutralizes the ATPase activity of CD73, wherein the antibody or antibody fragment comprises a heavy chain having the amino acid sequence of SEQ ID NO: 47 and a light chain having the amino acid sequence of SEQ ID NO: 48.

[0048] In one embodiment, the antibody is non-depleting and neutralizes the enzymatic activity of CD73 in the tumor environment.

[0049] In one embodiment, the antibody is a human IgG1, IgG2, IgG3, or IgG4 isotype antibody. For example, the antibody may be an antibody comprising the Fc domain of a human IgG4 isotype, or an antibody comprising the Fc domain of any human IgG isotype (e.g., IgG1, IgG2, IgG3, or IgG4) modified to reduce or eliminate binding between the Fc domain and a human Fcγ receptor (e.g., CD16), or optionally modified to reduce binding between the Fc domain and a plurality of human Fcγ receptors (e.g., CD16A, CD16B, CD32A, CD32B, and CD64). In one embodiment, the antibody comprises the Fc domain of a human IgG subtype (e.g., IgG1) comprising amino acid modifications that result in a reduction (compared to an antibody comprising the wild-type human IgG1 Fc domain) or substantially complete loss of binding to each of CD16A, CD16B, CD32A, CD32B, and CD64.

[0050] In any embodiment, the antibody heavy chain comprises a human CH1 constant domain and, optionally, a modified human Fc domain of a human IgG1 isotype, and optionally further comprises any one amino acid sequence of SEQ ID NOS: 16, 17, 18, or 19. In any embodiment, the antibody light chain comprises a human light chain constant domain, and optionally, the constant domain is a human kappa domain.

[0051] In one embodiment, the antibody of the present disclosure does not induce or increase the intracellular internalization, or more generally down-regulation, of the CD73 polypeptide expressed on the cell surface, and / or does not rely thereon for its CD73 inhibitory activity. The antibody of the present disclosure may provide greater inhibitory efficacy (the ability to substantially neutralize CD73 enzymatic activity) than antibodies that inhibit CD73 by causing CD73 internalization. Unlike antibodies that inhibit soluble CD73 by other mechanisms (e.g., causing CD73-antibody oligomer formation), the antibody of the present disclosure may inhibit the enzymatic activity of CD73 at high (e.g., 10-fold) excess antibody:enzyme. Furthermore, unlike antibodies (e.g., antibody 7G2) that bind to epitopes on recombinant CD73 that may be modified or absent on cell surface CD73, or have an affinity too low to be converted to efficacy in CD73-expressing cells, the antibody of the present invention binds with high affinity to epitopes present on and / or preserved intact on cell surface CD73, thereby providing an antibody capable of potently neutralizing the enzymatic activity of cellular CD73. The antibody of the present invention inhibits CD73 enzymatic activity in cells, but optionally can also inhibit the ecto-5' nucleotide activity of soluble recombinant CD73 (as observed in cell-free assays using soluble dimeric CD73 polypeptides).

[0052] In one embodiment, the antibody of the present disclosure can inhibit the activity of human CD73 polypeptide without binding to the enzymatic active site of CD73 polypeptide, and / or is a non-competitive inhibitor of CD73, for example, the antibody of the present disclosure inhibits the activity of human CD73 polypeptide without detectably reducing the binding between CD73 polypeptide and its natural substrate.

[0053] In one embodiment, the antibody of the present disclosure loses binding to a CD73 mutant having a substitution at residue K136. In one embodiment, the antibody of the present disclosure has reduced binding to a CD73 mutant having a substitution at residue K136 (for the sequence of SEQ ID NO: 1; and compared to wild-type CD73 containing the amino acid sequence of SEQ ID NO: 1); optionally, the antibody also has reduced binding to CD73 mutants having substitutions at residues A99, E129, K133, E134, and A135 (for the sequence of SEQ ID NO: 1; and compared to wild-type CD73 containing the amino acid sequence of SEQ ID NO: 1); Optionally, the antibody's binding to CD73 mutants having substitutions at residues K97, E125, Q153, and K330 is reduced (for the sequence of SEQ ID NO: 1; and compared to wild-type CD73 containing the amino acid sequence of SEQ ID NO: 1).

[0054] In one embodiment, the antibody binds to an epitope on each CD73 polypeptide chain within the CD73 dimer (i.e., binds to CD73 in an intramer manner), optionally additionally, the epitope is present on the same side of the CD73 dimer. The antibody may thus bind to a CD73 dimer, particularly at a more “closed” position where the antibody binding site is spatially more distant than at an “open” position. With regard to binding to ligand-bound CD73, the antibody described herein may be useful for the treatment of an individual or cancer characterized by (e.g., known or suspected to be characterized by) a tumor environment in which upstream ADP and / or AMP are present at significant levels prior to treatment, for example, when binding to CD73 upon binding to AMP. Antibodies may be useful for treating individuals or cancers having (e.g., known or suspected to have) a tumor environment characterized by high levels of ADP (e.g., generated in dying cells and uptake by CD73 on substrates and cell infiltrates (e.g., TReg cells) yielding high levels of AMP), as well as more generally the presence or levels of AMP, adenosine, CD73 expression or CD73-expressing cells, high (e.g. compared to healthy tissue) number or frequency of CD73-expressing cells and / or high levels of CD73 expression on cells (e.g., evaluated by immunohistochemical assays), high (e.g. compared to healthy tissue) soluble CD73 polypeptide (e.g., evaluated by ELISA or generally any antibody-based detection assay), or the presence or levels of adenosine receptor expression or adenosine-receptor expressing cells.CD73 molecules in the tumor environment may exist in a substrate-bound conformation, and the ability to bind to and inhibit substrate-bound cellular CD73 (e.g., CD73-expressing cells pre-incubated with a substrate such as AMP), in addition to non-substrate-bound CD73, may provide a greater ability to inhibit CD73 in vivo. Optionally, soluble CD73 protein, the number or frequency of CD73-expressing cells, and / or levels of CD73 expression on cells may be evaluated in the tumor environment prior to treatment. Antibodies may have a particular advantage in treating individuals with significant levels of soluble CD73 protein (e.g., high levels compared to baseline), the number or frequency of CD73-expressing cells, and / or levels of CD73 expression on cells in tumor samples.

[0055] Accordingly, in one embodiment, the present disclosure provides a humanized antibody or antibody fragment that binds to a human CD73 polypeptide expressed on a cell surface and inhibits the enzymatic (ecto-5' nucleotide) activity of the CD73 polypeptide, wherein the antibody may bind to a single CD73 polypeptide dimer (a soluble CD73 polypeptide dimer or a CD73 polypeptide dimer expressed by a cell). Optionally, the antibody binds to a first CD73 polypeptide within the dimer by a first antigen-binding domain and binds to a second CD73 polypeptide by a second antigen-binding domain. In one embodiment, the antibody is an allosteric inhibitor of the CD73 polypeptide.

[0056] The epitope on CD73 to which the antibody binds is present on the CD73 polypeptide expressed by various cells, e.g., cancer cells, CD4 T cells, CD8 T cells, B cells, and transfected cells, and binds with high affinity as confirmed by flow cytometry. For example, regarding the binding of the antibody to cells expressing the CD73 polypeptide on their surface, EC is 5 µg / ml or less, optionally 2 µg / ml or less, 1 µg / ml or less, 0.5 µg / ml or less, 0.1 µg / ml or less, or 0.05 µg / ml or less, as confirmed by flow cytometry. 50 It may be characterized by. In one embodiment, the cell is a cell that is engineered to express CD73 on its surface. In one embodiment, the cell that endogenously expresses CD73 on its surface is, for example, a cancer cell, a leukemia cell, a bladder cancer cell, a glioma cell, a glioblastoma cell, an ovarian cancer cell, a melanoma cell, a prostate cancer cell, a thyroid cancer cell, an esophageal cancer cell, or a breast cancer cell.

[0057] In one embodiment, the CD73 neutralizing antibody may be characterized as being capable of causing at least a 60%, 75%, or 80% reduction in the 5'-ectonucleotidase activity of CD73 in cells. In one embodiment, the CD73 neutralizing antibody is characterized by the inhibition of the 5'-ectonucleotidase activity of CD73 expressed in cells at an EC of 1 μg / ml or less, optionally 0.5 μg / ml or less, optionally 0.2 μg / ml or less. 50 It can be characterized by.

[0058] Optionally, inhibition of the 5'-ectonucleotidase activity of CD73 expressed by cells is confirmed by evaluating the neutralization of 5'-ectonucleotidase activity in CD73-expressing cells (e.g., MDA-MB-231 cells) by quantifying the hydrolysis of AMP to adenosine.

[0059] Optionally, inhibition of the 5'-ectonucleotidase activity of CD73 expressed by cells is confirmed by evaluating the ability of an antibody or antibody fragment to increase the proliferation of said T cells (e.g., from a healthy human donor) when said T cells are induced to proliferate in vitro in the presence of AMP (e.g., exogenously added AMP) (e.g., through TCR co-stimulation, stimulation of CD3 and CD28 signaling, e.g., by contacting said T cells with beads functionalized with a CD3 agonist and a CD28 agonist). Optionally, T cell proliferation is evaluated using the assays described in the embodiments of the present invention (see Example 5 and Methods).

[0060] In one embodiment, the anti-CD73 antibody binds to a common epitope present on both soluble CD73 and CD73 expressed on the cell surface.

[0061] In one embodiment, the anti-CD73 antibody binds to an epitope within each CD73 polypeptide in the CD73 dimer (in a dimer manner), for example, the epitope is located on the common plane of the CD73 dimer.

[0062] In one embodiment, the anti-CD73 antibody binds to an epitope on CD73 containing residue K136 (see SEQ ID NO: 1).

[0063] In one embodiment, the anti-CD73 antibody binds to an epitope on CD73 comprising one, two, three, or four residues selected from the group consisting of K97, E125, Q153, and K330 (see SEQ ID NO: 1).

[0064] In one embodiment, the anti-CD73 antibody binds to an epitope on CD73 comprising one, two, three, four, or five residues selected from the group consisting of A99, E129, K133, E134, and A135 (see SEQ ID NO: 1).

[0065] In one embodiment, the anti-CD73 antibody binds at least partially to a domain or segment of an amino acid residue on a human CD73 protein (e.g., CD73 homodimer protein) comprising amino acid residues K97, A99, E125, E129, K133, E134, A135, K136, Q153 and K330 (see SEQ ID NO: 1). In one embodiment, the anti-CD73 antibody binds to an epitope on CD73 comprising at least one, two, three, four, or five, or more of residues selected from the group consisting of K97, A99, E125, E129, K133, E134, A135, K136, Q153 and K330 (see SEQ ID NO: 1).

[0066] In one embodiment, the anti-CD73 antibody has reduced binding to a CD73 polypeptide having a mutation at residue K136 (see SEQ ID NO: 1) compared to a wild-type CD73 polypeptide containing the amino acid sequence of SEQ ID NO: 1; optionally, the mutant CD73 polypeptide has mutation: K136A.

[0067] In one embodiment, the anti-CD73 antibody has reduced binding to a CD73 polypeptide having a mutation at a residue selected from the group consisting of K97, E125, Q153, and K330 (see SEQ ID NO: 1) compared to a wild-type CD73 polypeptide having the amino acid sequence of SEQ ID NO: 1; optionally, the mutant CD73 polypeptide has mutations: K97A, E125A, Q153A, and / or K330A (e.g., K97A, E125A, and K330A; K97A, E125A, and / or Q153A).

[0068] In one embodiment, the anti-CD73 antibody has reduced binding to a CD73 polypeptide having a mutation at a residue selected from the group consisting of A99, E129, K133, E134, and A135 (see SEQ ID NO: 1) compared to a wild-type CD73 polypeptide having the amino acid sequence of SEQ ID NO: 1; optionally, the mutant CD73 polypeptide has mutations: A99S, E129A, K133A, E134N, and A135S.

[0069] In one embodiment, a method of using an antibody in the treatment or prevention of a disease, e.g., an infectious disease or cancer is provided. In one embodiment, the antibody is administered to an individual having cancer in an amount and frequency sufficient to neutralize the activity of CD73 in the tumor microenvironment. In one embodiment, the antibody is administered in an amount and frequency sufficient to reduce the production and / or concentration of adenosine in the tumor microenvironment. In one embodiment, the antibody is administered in an amount and frequency sufficient to increase the production and / or concentration of ATP in the tumor microenvironment. In one embodiment, the antibody is administered in an amount and frequency sufficient to neutralize the activity of CD73 expressed by tumor cells. In one embodiment, the antibody is administered in an amount and frequency sufficient to neutralize the activity of CD73 expressed by CD4 T cells, CD8 T cells and / or B cells.

[0070] Antibodies inhibit the CD73-mediated catabolism of AMP to adenosine, which would be useful, for example, in reducing the concentration of adenosine in the tumor microenvironment. Therefore, these antibodies would be useful, for example, in the treatment of cancer, in reversing the immunosuppressive effects of CD73 and / or adenosine on T cells, B cells, and other cells expressing adenosine receptors. In one embodiment, an anti-CD73 antibody neutralizes the adenosine-mediated inhibition of proliferation, cytokine production, cytotoxicity, and / or NFκB activity in T cells.

[0071] Since the CD73-mediated catabolism of AMP to adenosine is irreversible, whereas the CD73-mediated catabolism of ATP to ADP and ADP to AMP is reversible (by NDK kinase and adenylate kinase, respectively), antibodies that block irreversible CD73-mediated catabolism will increase the pool of AMP and, therefore, will be used to increase the concentrations of ADP and ATP, for example, in the tumor microenvironment. Antibodies may be useful in increasing the formation of ADP from AMP and the formation of ATP from ADP. Since ATP plays an immune-activating role, anti-CD73 antibodies may be useful in activating T cells, for example, in the treatment of cancer.

[0072] Antibodies will be useful for inhibiting the production, amount, and / or concentration of adenosine into the tumor microenvironment.

[0073] Antibodies that neutralize the activity of soluble human CD73 polypeptide dimers can further neutralize CD73 in any other suitable circumstances, for example, in reporter cells created to express CD73, T cells, etc.

[0074] A method for treating an individual is provided, comprising the step of administering a therapeutically active amount of any anti-CD73 antigen-binding compound described herein to an individual (e.g., an individual having a disease, tumor, etc.). In one embodiment, a method for treating an individual is provided, comprising, essentially comprising, or comprising the step of administering a therapeutically active amount of the antigen-binding compound of the present disclosure to an individual (e.g., an individual having a disease, tumor, etc.).

[0075] A method is provided for reducing adenosine produced by CD73-expressing cells (e.g., immune cells and / or tumor cells in an individual) or for neutralizing the enzymatic activity of CD73 in cells in one embodiment, comprising, essentially consisting of, or consisting of the step of contacting CD73-expressing cells with an antigen-binding compound of the present disclosure (e.g., an anti-CD73 antibody or antibody fragment, or a composition comprising the same). In one embodiment, the step of contacting CD73-expressing cells with an antigen-binding compound of the present disclosure comprises administering a therapeutically active amount of the antigen-binding compound to an individual. In one embodiment, the individual has cancer.

[0076] A method is provided for reducing adenosine present in a tumor environment (e.g., in an individual) in one embodiment, comprising, essentially comprising, or comprising the step of administering a therapeutically active amount of a compound of the present disclosure (e.g., an anti-CD73 antibody or antibody fragment, or a composition containing the same) to an individual. In one embodiment, the individual has cancer. Optionally, the individual is a human who has cancer or is susceptible to cancer.

[0077] The antibody is randomly 10 -9 Less than M (better), preferably 10 -10 Less than M, or preferably 10 -11 Binding affinity for human CD73 polypeptide (e.g., CD73 dimer) identified by SPR less than M (e.g., according to the method of the example) (K D ), and / or EC less than 1 µg / ml for human CD73 polypeptide 50 It is characterized by bonding with (better bonding). Optionally, the bonding affinity may be specified as divalent.

[0078] In one embodiment, the antibody has an EC of 0.5 µg / ml or less, optionally 0.2 µg / ml or less, and optionally 0.1 µg / ml or less for binding to cells expressing human CD73 on the cell surface (e.g., tumor cells, MDA-MB-231 cells). 50 has

[0079] EC regarding the neutralization of CD73 enzymatic activity in CD73-expressing cells (e.g., tumor cells, MDA-MB-231 cells) at optionally less than 1 µg / ml (preferably) or optionally less than 0.5 µg / ml. 50 It is characterized by.

[0080] In one embodiment, the antibody is a monoclonal antibody or a fragment thereof having binding specificity and the ability to neutralize the enzymatic activity of CD73 (e.g., identified by evaluating the ability of the antibody or antibody fragment to increase the proliferation of said T cells when said T cells are induced to proliferate in vitro in the presence of AMP (e.g., exogenously added AMP). In one embodiment, the antibody is substantially as potent as, or at least as potent as, the parent antibody having the respective VH and VL amino acid sequences of SEQ ID NOS: 40 and 41 in neutralizing the enzymatic activity of CD73, and optionally the antibody is the EC of the parent antibody 50 EC regarding the neutralization of CD73 enzymatic activity within 1-log and 0.5-log 50 It has. In one embodiment, the antibody is more potent than the parent antibody having the respective VH and VL amino acid sequences of SEQ ID NOS: 40 and 41 in neutralizing the enzymatic activity of CD73, and optionally the antibody has a lower EC regarding the neutralization of the enzymatic activity of CD73 than the parent antibody having the respective VH and VL amino acid sequences of SEQ ID NOS: 40 and 41. 50 has

[0081] In one embodiment, the antibody is substantially as potent as, or at least as potent as, the parent antibody having the respective VH and VL amino acid sequences of SEQ ID NOS: 27 and 28 in neutralizing the enzymatic activity of CD73, and optionally the antibody is the EC of the parent antibody 50 EC regarding the neutralization of CD73 enzymatic activity within 1-log or 0.5-log 50 It has. In one embodiment, the antibody is more potent than the parent antibody having the respective VH and VL amino acid sequences of SEQ ID NOS: 27 and 28 in neutralizing the enzymatic activity of CD73, and optionally the antibody has a lower EC regarding the neutralization of the enzymatic activity of CD73 than the parent antibody having the respective VH and VL amino acid sequences of SEQ ID NOS: 27 and 28. 50 has

[0082] A method for producing a human anti-CD73 antibody or antibody fragment is also provided, comprising isolating and / or recombinant nucleic acids (e.g., a set of nucleic acids) encoding the antibody (or its heavy or light chain) or VH and / or VL domain of the present disclosure, a vector or a set of vectors containing such nucleic acid(s), a cell containing such a vector, and culturing such cell under conditions suitable for the expression of the anti-CD73 antibody or antibody fragment. The present disclosure also relates to compositions, such as pharmaceutically acceptable compositions and kits, comprising such proteins, nucleic acids, vectors, and / or cells and one or more additional components (e.g., various carriers) which may be active or inactive components that promote formulation, delivery, stability, or other properties of the composition. The present disclosure also relates to various new and useful methods for preparing and using such antibodies, nucleic acids, vectors, cells, organisms, and / or compositions, for example, in the modulation of CD73-mediated biological activity, for example, in the treatment of related diseases, particularly cancer.

[0083] This disclosure also provides a method for producing or testing an antibody or antibody fragment that binds to CD73 and neutralizes its enzymatic activity.

[0084] The present disclosure also provides a method for enhancing the activity of lymphocytes (e.g., T cells) in a subject in need, or restoring the activity of lymphocytes (e.g., T cells), or alleviating adenosine-mediated inhibition of lymphocyte activity (e.g., T cells), wherein the method comprises the step of administering an effective amount of any of the aforementioned compositions to a subject. In one embodiment, the subject is a patient suffering from cancer. For example, the patient may have a solid tumor, e.g., colorectal cancer, kidney cancer, ovarian cancer, lung cancer, breast cancer, or malignant melanoma. Alternatively, the patient may have a hematopoietic cancer, e.g., acute myeloid leukemia, chronic myeloid leukemia, multiple myeloma, or non-Hodgkin lymphoma.

[0085] These embodiments are more fully described in the description provided herein, and additional embodiments, features, and advantages will be apparent therefrom. Brief explanation of the drawing

[0086] Figures 1A-1B show humanized variants having H0, H1, H2, H3, and H4 heavy chain variable regions combined with L0, L1, L2, L3, and L4 light chain variable regions, respectively, as tested in transfected cell lines expressing human (Figure 1A) or cynomolgus (Figure 1B) CD73 protein, and titration curves obtained with momurin antibody HPLP. Figure 2 shows the blockade of enzymatic activity of soluble recombinant CD73. The upper left panel (A) shows that high levels of luminescence were measured when ATP and CTG substrates were mixed. When AMP was added to the reaction mixture, the CTG reaction was inhibited, and luminescence decreased. In the presence of rhCD73 protein hydrolyzing AMP, the luminescence level was restored. Blockade of CD73 enzymatic activity by different humanized variants is suggested. Figures 3A–3C and 4A–4C show two series of experiments to compare humanized antibodies in their efficacy in reversing the AMP-mediated inhibition of T cell proliferation. Figures 3A and 4A show the control of T cell proliferation and its inhibition by AMP for each series of experiments. Figures 3B and 4B show the efficacy of the anti-CD73 antibody in restoring CD4+, and Figures 3C and 4C show the efficacy of the anti-CD73 antibody in restoring CD8+ T cell proliferation. Cell proliferation is confirmed by the dilution of the Cell Trace Violet marker. Data are expressed as duplicates + / - standard deviation. Figures 5A–5C show that T cell proliferation is restored by all anti-CD73 Abs. Figure 5A shows the control of T cell subpopulation proliferation and its inhibition by AMP. Figure 5B shows the efficacy of the H4+Lx antibody and the parent antibody HPLP in restoring CD4+ and CD8+ T cell proliferation. Figure 5C shows the efficacy of the 2H4+2Lx antibody (2H4+ chain combined with 2L1, 2L2, 2L3, or 2L4 chain) and the parent antibody 2HP2LP in restoring CD4+ and CD8+ T cell proliferation. Data are expressed as duplicates of + / - standard deviations. Figures 6A and 6B show that T cell proliferation restored by the humanized variant is reproducible in two representative human donors, respectively. The efficacy of the 2H4+2Lx anti-CD73 antibody variant in restoring CD4 and CD8 T cell proliferation is presented. Data are expressed as duplicates of + / - standard deviations. Figure 7 shows that CD4+ T cell proliferation is inhibited by ATP and restored by the 2H4+2Lx antibody variant. Control of CD4+ T cell proliferation and inhibition by 100 μM ATP were tested for two representative donors, D795 (Figure 7A) and D664 (Figure 7B). Data are expressed as duplicates of + / - standard deviations. Specific details for implementing the invention

[0087] Detailed description of the invention

[0088] definition

[0089] As used herein, “one” or “one” may mean one or more. When used in claim(s), when used with the word “comprising,” the word “one” or “one” may mean one or more than one. As used herein, “other” may mean at least a second or more.

[0090] When "including" is used, it may be arbitrarily replaced with "essentially formed" or "formed."

[0091] NT5EHuman CD73, also known as ecto-5'-nucleotide and 5-prime-ribonucleotide phosphohydrolase, EC 3.1.3.5, encoded by a gene, exhibits 5'-nucleotide activity, particularly AMP-nucleosidase, NAD-nucleosidase, and NMN-nucleosidase. CD73 catalyzes the conversion of purine 5-prime mononucleotides to nucleosides at neutral pH, with AMP being the preferred substrate. The enzyme consists of a dimer of two identical 70-kD subunits joined by a glycosyl phosphatidylinositol linker on the outer surface of the plasma membrane. The amino acid sequence of the human CD73 precursor protein (monomer), including the signal sequence at amino acids 1–26, is presented in Genbank under accession number NP_002517 (the full disclosure thereof is incorporated herein by reference) and is as follows:

[0092]

[0093] In the context of this specification, “neutralize the enzymatic activity of CD73” means a process in which the 5’-nucleotide (5’-ectonucleotide) activity of CD73 is inhibited. This includes, in particular, the inhibition of the CD73-mediated production of adenosine, i.e., the inhibition of the CD73-mediated catabolism of AMP to adenosine. This can be measured, for example, in a cell-free assay that measures the ability of a test compound to inhibit the conversion of AMP to adenosine, either directly or indirectly. In one embodiment, the antibody preparation causes at least a 50% reduction in the conversion of AMP to adenosine, at least a 70% reduction in the conversion of AMP to adenosine, or at least an 80% reduction in the conversion of AMP to adenosine, for example, with reference to the assay described herein.

[0094] Whenever "treatment of cancer," etc., is mentioned with respect to an anti-CD73 binder (e.g., antibody) within this entire specification, it means the following: (a) a method of treating cancer comprising the step of administering an anti-CD73 binder (preferably among pharmaceutically acceptable carrier materials) to an individual, mammal, particularly a human, who requires such treatment, in a dose (therapeutic effective amount) that allows for the treatment of cancer, preferably in a dose (amount) specified herein (during at least one treatment); (b) the use of an anti-CD73 binder for the treatment of cancer, or the use of an anti-CD73 binder for use in said treatment (particularly in a human); (c) the use of an anti-CD73 binder for the manufacture of a pharmaceutical preparation for the treatment of cancer, comprising the step of mixing the anti-CD73 binder with a pharmaceutically acceptable carrier, or a method of using an anti-CD73 binder for the manufacture of a pharmaceutical preparation comprising an effective dose of an anti-CD73 binder suitable for the treatment of cancer; or (d) any combination of a), b), and c) according to the subject matter patentable in the country where the present application is filed.

[0095] As used herein, the term “antibody” refers to polyclonal and monoclonal antibodies. Depending on the type of constant domain of the heavy chain, antibodies are designated as one of five major classes: IgA, IgD, IgE, IgG, and IgM. Some of these are further classified into subclasses or isotypes, e.g., IgG1, IgG2, IgG3, IgG4, etc. An exemplary immunoglobulin (antibody) structural unit comprises a tetramer. Each tetramer consists of two identical pairs of polypeptide chains, each pair having one “light” chain (about 25 kDa) and one “heavy” chain (about 50–70 kDa). The N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids, which is primarily responsible for antigen recognition. The term variable light chain (V L ) and variable heavy chain (V H ...) refers to these light chains and heavy chains, respectively. The heavy chain constant domains corresponding to different classes of immunoglobulins are referred to as "alpha," "delta," "epsilon," "gamma," and "mu," respectively. The subunit structures and tertiary conformations of different classes of immunoglobulins are well known. IgG is the exemplary class of antibody to which this specification applies because they are the most common antibodies in physiological situations and because they are the most readily produced in laboratory settings. Optionally, the antibody is a monoclonal antibody. Specific examples of antibodies are humanized, chimeric, human, or or-human-compatible antibodies. "Antibody" also includes any fragment or derivative of any antibody described herein.

[0096] The term "specifically bind" means that the antibody can bind in a competitive binding assay with a binding partner, e.g., CD73, which is evaluated using a recombinant form of the protein, an epitope therein, or a natural protein present on the surface of isolated target cells. Competitive binding assays and other methods for confirming specific binding are further described below and are well known in the art.

[0097] When it is said that an antibody "competes" with a specific monoclonal antibody, this means that the antibody competes with the monoclonal antibody in a binding assay using a recombinant CD73 molecule or a surface-expressed CD73 molecule. For example, if the test antibody reduces the binding of the reference antibody to the CD73 polypeptide or to CD73-expressing cells in a binding assay, the antibody is said to "compete" with the reference antibody, respectively.

[0098] As used herein, the term "affinity" refers to the strength of binding to an epitope of an antibody. The affinity of an antibody is provided by a dissociation constant Kd defined as [Ab]×[Ag] / [Ab-Ag], where [Ab-Ag] is the molar concentration of the antibody-antigen complex, [Ab] is the molar concentration of the unbound antibody, and [Ag] is the molar concentration of the unbound antigen. Affinity constant K ais defined as 1 / Kd. Methods for determining the affinity of mAb can be found in Harlow, et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1988), Coligan et al., eds., Current Protocols in Immunology, Greene Publishing Assoc. and Wiley Interscience, NY, (1992, 1993), and Muller, Meth. Enzymol. 92:589-601 (1983), which are incorporated herein by reference in their entirety. One standard method well known in the art for determining the affinity of mAb is the use of surface plasmon resonance (SPR) screening (e.g., by an assay using a BIAcore™ SPR assay device).

[0099] In the context of this specification, "determinant" indicates a site of interaction or binding on a polypeptide.

[0100] The term "epitope" refers to a determinant of antigenicity and is an area or region on an antigen to which an antibody binds. Protein epitopes may include amino acid residues directly involved in binding, as well as amino acid residues that are effectively blocked by specific antigen-binding antibodies or peptides—that is, amino acid residues within the antibody's "footprint." This is, for example, the simplest form or smallest structural region on a complex antigen molecule that can be combined with an antibody or a receptor. Epitopes can be linear or stereotype / structural. The term "linear epitope" is defined as an epitope composed of adjacent amino acid residues in a linear sequence of amino acids (primary structure). The term "stereotype or structural epitope" is defined as an epitope composed of amino acid residues representing separate parts of a linear sequence of amino acids that are not all adjacent but become adjacent to each other through molecular folding (secondary, tertiary, and / or quaternary structure). Stereotype epitopes are dependent on the tertiary structure. Therefore, the term "three-dimensional" is often used interchangeably with "structural."

[0101] The term “depleted” or “depleting” for CD73-expressing cells means a process, method, or compound that causes death, removal, lysis, or the induction of such death, removal, or lysis, to have a negative effect on the number of these CD73-expressing cells present in a sample or subject.

[0102] The term "internalization," used interchangeably with "intracellular internalization," refers to molecular, biochemical, and cellular events associated with the process of translocation of molecules from the extracellular surface of a cell to the intracellular surface of a cell. The processes responsible for the intracellular internalization of molecules are well known and may include, in particular, the internalization of extracellular molecules (e.g., hormones, antibodies, and small organic molecules); membrane-associated molecules (e.g., cell-surface receptors); and complexes of membrane-associated molecules bound to extracellular molecules (e.g., ligands bound to membrane receptors or antibodies bound to membrane-associated molecules). Accordingly, "induction and / or increase of internalization" includes events in which intracellular internalization is initiated and / or the rate and / or extent of intracellular internalization is increased.

[0103] The term "agent" is used herein to mean a chemical compound, a mixture of chemical compounds, a biological macromolecule, or an extract made from a biological material. The term "therapeutic agent" means an agent having biological activity.

[0104] For the purposes of this invention, “humanized” or “human” antibodies represent antibodies in which one or more constant and variable backbone regions of human immunoglobulins are fused to the binding regions of animal immunoglobulins, e.g., CDRs. Such antibodies are designed to retain the binding specificity of the non-human antibody from which the binding region is derived, but to avoid an immune response to the non-human antibody. Such antibodies may be obtained from “engineered” genetically modified mice or other animals that have been engineered to produce specific human antibodies in response to an antigenic attack (see, e.g., Green et al. (1994) Nature Genet 7:13; Lonberg et al. (1994) Nature 368:856; Taylor et al. (1994) Int Immun 6:579, the entire teachings of which are incorporated herein by reference). Complete human antibodies can also be constructed by phage display techniques, including gene or chromosome transfection methods, all of which are known in the art (see, for example, McCafferty et al. (1990) Nature 348:552-553). Human antibodies may also be generated by activated B cells in vitro (see, for example, U.S. Patents No. 5,567,610 and No. 5,229,275, the entire contents of which are incorporated herein by reference).

[0105] As used in this specification, the term "overvariable region" refers to an amino acid residue of an antibody responsible for antigen binding. Generally, the hypervariable region consists of amino acid residues derived from the "complementarity confirming region" or "CDR" (e.g., residues 24-34 (L1), 50-56 (L2), and 89-97 (L3) of the light chain variable domain, and residues 31-35 (H1), 50-65 (H2), and 95-102 (H3) of the heavy chain variable domain; Kabat et al. 1991) and / or residues derived from the "hypervariable loop" (e.g., residues 26-32 (L1), 50-52 (L2), and 91-96 (L3) of the light chain variable domain, and residues 26-32 (H1), 53-55 (H2), and 96-101 (H3) of the heavy chain variable domain; Chothia and Lesk, J. Mol. Biol 1987;196:901-917), or essential amino acids responsible for antigen binding It includes a similar system for verification. Typically, the numbering of amino acid residues within this region is performed using the method described in Kabat et al., e.g. In this specification, phrases such as “kavat position,” “kavat-numbered variable domain residue,” and “according to kavat” refer to this numbering scheme for a heavy chain variable domain or a light chain variable domain. Using the kavat numbering scheme, the actual linear amino acid sequence of a peptide may contain a few or additional amino acids corresponding to the shortening or insertion of the FR or CDR of the variable domain. For example, a heavy chain variable domain may include a single amino acid insertion after residue 52 of CDR H2 (kavat-according residue 52a) and residues inserted after heavy chain FR residue 82 (e.g., kavat-according residues 82a, 82b, and 82c, etc.). The kavat numbering of residues can be identified for a given antibody by aligning the “standard” kavat numbering sequence with the homology region of the antibody sequence.

[0106] In this specification, "skeleton" or "FR" residues refer to regions of the antibody variable domain excluding those regions defined as CDRs. Each antibody variable domain skeleton may be further subdivided into adjacent regions separated by CDRs (FR1, FR2, FR3, and FR4).

[0107] The terms “Fc domain,” “Fc portion,” and “Fc region” refer to the C-terminal fragment of an antibody heavy chain, e.g., approximately amino acid (aa) 230 to approximately aa 450 of the human γ (gamma) heavy chain, or other types of antibody heavy chains (e.g., α, δ, ε, and μ for human antibodies) or their corresponding sequences in their naturally occurring allotypes. Unless otherwise specified, Kavat amino acid numbering generally accepted for immunoglobulins is used throughout this disclosure (Kabat et al. (1991) Sequences of Protein of Immunological Interest, 5th ed., United States Public Health Service, National Institute of Health, Bethesda, MD).

[0108] The terms "isolated," "purified," or "biologically pure" refer to a substance that is substantially or essentially devoid of the components normally associated with it as they exist in its natural state. Purity and homogeneity are typically verified using analytical chemistry techniques, such as polyacrylamide gel electrophoresis or high-performance liquid-phase chromatography. The dominant protein species present in the preparation is substantially purified.

[0109] The terms “polypeptide,” “peptide,” and “protein” are used interchangeably in this specification to mean a polymer of amino acid residues. These terms apply to naturally occurring amino acid polymers and non-naturally occurring amino acid polymers, including amino acid polymers in which one or more amino acid residues are artificial chemical mimics of the corresponding naturally occurring amino acid.

[0110] For example, when used with respect to a cell, or nucleic acid, protein, or vector, the term "recombinant" means that the cell, nucleic acid, protein, or vector has been modified by the introduction of a heterologous nucleic acid or protein or by a change in a natural nucleic acid or protein, or that the cell is derived from a cell that has been so modified. Thus, for example, a recombinant cell expresses a gene that is not present in the natural (non-recombinant) form of the cell, or expresses a natural gene that would otherwise be abnormally expressed, underexpressed, or not expressed at all.

[0111] In the context of this specification, the term antibody “binding” to a polypeptide or epitope means an antibody that binds to said determinant with specificity and / or affinity.

[0112] When used to describe the relationship between the sequences of two or more polypeptides, the term "identity" or "identical" refers to the degree of sequence relatedness between polypeptides, identified by the number of matching points between strings of two or more amino acid residues. "Identity" measures the percentage of identical matching points between the smaller of two or more gap-aligned sequences (if any) processed by a specific mathematical model or computer program (i.e., an "algorithm"). The identity of related polypeptides can be easily calculated by known methods. Such methods include, without limitation, those described in the following literature: Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part 1, Griffin, AM, and Griffin, HG, eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York, 1991; and Carillo et al., SIAM J. Applied Math. 48, 1073 (1988).

[0113] Methods for verifying identity are designed to provide maximum consistency between the sequences being tested. Methods for verifying identity are described in publicly available computer programs. Computer program methods for verifying identity between two sequences include the GCG program package containing GAP (Devereux et al., Nucl. Acid. Res. 12, 387 (1984); Genetics Computer Group, University of Wisconsin, Madison, Wis.), BLASTP, BLASTN, and FASTA (Altschul et al., J. Mol. Biol. 215, 403-410 (1990)). The BLASTX program is publicly available from the National Center for Biotechnology Information (NCBI) and other sources (BLAST Manual, Altschul et al. NCB / NLM / NIH Bethesda, Md. 20894; Altschul et al., cit.). The well-known Smith-Waterman algorithm can also be used to verify identity.

[0114] Antibody production

[0115] The present invention is partially based on the discovery of a modified human receptor backbone sequence such that the anti-CD73 variable region generated by incorporating the antibody CDR has high efficacy in neutralizing the enzymatic activity of human CD73. The antibody has the advantage of having low or reduced immunogenicity in humans, for example, having a lower ability or likelihood of causing an unwanted immune response directed by an anti-CD73 antibody when administered to humans. Examples of such antibodies of the present disclosure include antibodies comprising an H4+ or 2H4+ VH domain combined with an L1, L2, L3, L4, 2L1, 2L2, 2L3, or 2L4 VL domain. Examples of antibodies of the present disclosure include antibodies comprising a pair of VH and VL domains of any one of antibodies H4+L1, H4+L2, H4+L3, H4+L4, 2H4+L1, 2H4+L2, 2H4+L3, or 2H4+L4.

[0116] In one embodiment, the antibody or antibody fragment binding to the human CD73 polypeptide comprises a VH and VL backbone of human origin (e.g., FR1, FR2, FR3, and FR4). In one embodiment, the antibody or antibody fragment comprises: HCDR1 (heavy chain CDR1) comprising the amino acid sequence SYNMY presented in SEQ ID NO: 2; HCDR2 (heavy chain CDR2) comprising the amino acid sequence YIDPYNGGSSYNQKFKG presented in SEQ ID NO: 12, optionally further comprising a glutamine residue (Q) at position 13 of SEQ ID NO: 12 being substituted with a leucine residue (L), and a lysine residue (K) at position 14 of SEQ ID NO: 12 being optionally substituted with a threonine residue (T); HCDR3 (heavy chain CDR3) comprising the amino acid sequence GYNNYKAWFAY presented in SEQ ID NO: 13, optionally additionally the asparagine residue (N) at position 3 of SEQ ID NO: 13 may be substituted with a glycine residue (G); LCDR1 (light chain CDR1) comprising the amino acid sequence KASQSVTNDVA presented in SEQ ID NO: 14, optionally additionally the threonine residue (T) at position 7 of SEQ ID NO: 14 may be substituted with serine residue(s); LCDR2 (light chain CDR2) comprising the amino acid sequence YASNRYT presented in SEQ ID NO: 15, optionally the asparagine residue (N) at position 4 of SEQ ID NO: 15 may be substituted with a threonine residue (T); LCDR3 (light chain CDR3) containing the amino acid sequence QQDYSSLT presented in SEQ ID NO: 7.

[0117] In one embodiment, HCDR2 comprises the amino acid sequence of Formula I:

[0118] Y - I - D - P - Y - N - G - G - S - S - Y - N - Xaa1- Xaa2- F - K - G (SEQ ID NO: 3), or its subsequence, in the formula Xaa1 is Q (Gln) or L (Leu), and Xaa2 is K (Lys) or T (Thr).

[0119] In one embodiment, HCDR3 comprises the amino acid sequence of Formula II:

[0120] G - Y - Xaa1 - N - Y - K - A - W - F - A - Y (SEQ ID NO: 4), or its subsequence, in which Xaa1 is N (Asp) or G (Gly).

[0121] In one embodiment, LCDR1 comprises the amino acid sequence of Formula III:

[0122] K - A - S - Q - S - V - Xaa1- N - D - V - A (SEQ ID NO: 5),

[0123] Or his subsequence, in the formula Xaa1 is T (Thr) or S (Ser).

[0124] In one embodiment, LCDR2 comprises the amino acid sequence of Formula IV:

[0125] Y - A - S - Xaa1 - R - Y - T (SEQ ID NO: 6),

[0126] Or his subsequence, in the formula Xaa1 is T (Thr) or N (Asn).

[0127] In one embodiment, an isolated antibody binding to a human CD73 polypeptide comprises: HCDR1 containing the amino acid sequence SYNMY presented in SEQ ID NO: 2; HCDR2 containing the amino acid sequence YIDPYNGGSSYNLTFKG presented in SEQ ID NO: 8; HCDR3 containing the amino acid sequence GYGNYKAWFAY presented in SEQ ID NO: 9; LCDR1 containing the amino acid sequence KASQSVSNDVA presented in SEQ ID NO: 10; LCDR2 containing the amino acid sequence YASTRYT presented in SEQ ID NO: 11; and LCDR3 containing the amino acid sequence QQDYSSLT presented in SEQ ID NO: 7.

[0128] In one embodiment, an isolated antibody binding to a human CD73 polypeptide comprises: HCDR1 containing the amino acid sequence SYNMY presented in SEQ ID NO: 2; HCDR2 containing the amino acid sequence YIDPYNGGSSYNQKFKG presented in SEQ ID NO: 12; HCDR3 containing the amino acid sequence GYNNYKAWFAY presented in SEQ ID NO: 13; LCDR1 containing the amino acid sequence KASQSVTNDVA presented in SEQ ID NO: 14; LCDR2 containing the amino acid sequence YASNRYT presented in SEQ ID NO: 15; and LCDR3 containing the amino acid sequence QQDYSSLT presented in SEQ ID NO: 7.

[0129] In one embodiment, the antibody comprises a heavy chain backbone from the human subgroup IGHV1-3 (optional together with IGHJ4), optionally IGHV1-3 is IGHV1-3*01. In one embodiment, the humanized antibody comprises a light chain backbone from the human subgroup IGKV1-33 (optional together with IGKJ2), optionally IGKV1-33*01.

[0130] The antibody may additionally include 1, 2, 3, 4, 5 or more amino acid substitutions across the human heavy chain and / or light chain backbone to improve, for example, the antibody's affinity, stability, or other properties.

[0131] Examples of the VH and VL amino acid sequences of the anti-CD73 antibody are shown in Example 6 (showing the H4+ chain, and Table 5 for the 2H4+2Lx antibody), and Table 1 for the L1-L4 chain.

[0132] In one embodiment, the present invention provides an antigen-binding domain or antibody or antibody fragment that binds to a human CD73 polypeptide, comprising:

[0133] (a) SEQ ID NO:2 containing the amino acid sequence of CDR-H1;

[0134] (b) SEQ ID NOS containing the amino acid sequence of CDR-H2: 3, 8 or 12;

[0135] (c) SEQ ID NOS containing the amino acid sequence of CDR-H3: 4, 9 or 13;

[0136] (d) SEQ ID NOS containing the amino acid sequence of CDR-L1: 5, 10 or 14;

[0137] (e) SEQ ID NOS containing the amino acid sequence of CDR-L2; 6, 11, or 15;

[0138] (f) SEQ ID NO:7 containing the amino acid sequence of CDR-L3; and

[0139] (g) Human heavy and light chain skeletal sequences.

[0140] In one embodiment, the antibody comprises a heavy chain backbone from human subgroup IGHV1-3 together with IGHJ4, optionally the antibody comprises IGHV1-3*01 together with IGHJ4. In one embodiment, the humanized antibody comprises a light chain backbone from human subgroup IGKV1-33, optionally IGKV1-33*01 together with IGKJ2.

[0141] Optionally, in any embodiment, the antibody may be specified as an antibody other than a murine parent antibody, for example, a murine parent antibody having the respective VH and VL of SEQ ID NOS: 27 and 28, or the respective VH and VL of SEQ ID NOS: 40 and 41.

[0142] The human skeleton may optionally contain one or more mutations, for example, reverse mutations to introduce residues present at specific locations in non-human mammals (e.g., mice).

[0143] In one embodiment of any of the embodiments of the present invention, the amino acid at position 2 of the carbat heavy chain is isoleucine.

[0144] In one embodiment of any of the embodiments of the present invention, the amino acid at position 30 of the carbat heavy chain is alanine.

[0145] In one embodiment of any of the embodiments of the present invention, the amino acid at position 48 of the kavat heavy chain is isoleucine.

[0146] In one embodiment of any of the embodiments of the present invention, the amino acid at position 69 of the carbat heavy chain is leucine.

[0147] In one embodiment of any of the embodiments of the present invention, the amino acid at position 73 of the carbat heavy chain is lysine.

[0148] In one embodiment, VH comprises an isoleucine residue at kavat position 2, alanine at position 30, isoleucine at position 48, leucine at position 69, and lysine at position 73.

[0149] In one embodiment of any of the embodiments of the present invention, the amino acid at position 67 of the kavat light chain is tyrosine.

[0150] In one embodiment of any of the embodiments of the present invention, the amino acid at position 60 of the kavat light chain is serine or aspartic acid.

[0151] In one embodiment of any of the embodiments of the present invention, the amino acid at position 2 of the kavat light chain is valine or isoleucine.

[0152] In one embodiment of any of the embodiments of the present invention, the amino acid at position 87 of the kavat light chain is tyrosine or phenylalanine.

[0153] In one embodiment, VL comprises a tyrosine residue at position 67, a serine at position 60, isoleucine at position 2, and tyrosine at position 87.

[0154] In one embodiment of any of the embodiments of the present invention, the amino acid at position 28 of the carbat heavy chain is threonine (T).

[0155] In one embodiment of any of the embodiments of the present invention, the amino acid at position 66 of the kavat heavy chain is arginine (R).

[0156] In one embodiment of any of the embodiments of the present invention, the amino acid at position 67 of the kavat heavy chain is valine (V).

[0157] In one embodiment of any of the embodiments of the present invention, the amino acid at position 71 of the kavat heavy chain is arginine (R).

[0158] In this study, positions in the VH and VL domains are described using the Kabat numbering system (Kabat et al. (1991) Sequences of Protein of Immunological Interest, 5th ed., United States Public Health Service, National Institute of Health, Bethesda, MD).

[0159] In one embodiment, the anti-CD73 antibody comprises a VH domain having at least about 80% sequence identity with the VH domain of SEQ ID NOS: 37 or 42 (e.g., at least about 85%, 90%, 95%, 97%, 98% or 99% identity, or 100% identity).

[0160] In one embodiment, the anti-CD73 antibody or antibody fragment comprises a VL domain having at least about 80% sequence identity (e.g., at least about 85%, 90%, 95%, 97%, 98%, or 99% identity, or 100% identity) with the VL domain of any of SEQ ID NOS: 33-36 or 43-46.

[0161] In one embodiment, the anti-CD73 antibody or antibody fragment comprises a VH domain having at least about 80% sequence identity with the VH domain of SEQ ID NO: 42 (e.g., at least about 85%, 90%, 95%, 97%, 98%, or 99% identity, or 100% identity), and a VL domain having at least about 80% sequence identity with the VL domain of any of SEQ ID NOS: 43-46 (e.g., at least about 85%, 90%, 95%, 97%, 98%, or 99% identity, or 100% identity).

[0162] In one embodiment, the anti-CD73 antibody or antibody fragment comprises a heavy chain having at least about 80% sequence identity (e.g., at least about 85%, 90%, 95%, 97%, 98%, or 99% identity, or 100% identity) with the heavy chain of SEQ ID NO: 38 of the H4+L1 antibody. In one embodiment, the antibody or antibody fragment comprises a light chain having at least about 80% sequence identity (e.g., at least about 85%, 90%, 95%, 97%, 98%, or 99% identity, or 100% identity) with the light chain of SEQ ID NO: 39 of the H4+L1 antibody.

[0163] In one embodiment, the anti-CD73 antibody or antibody fragment comprises a heavy chain having at least about 80% sequence identity (e.g., at least about 85%, 90%, 95%, 97%, 98%, or 99% identity, or 100% identity) with the heavy chain of SEQ ID NO: 47 of the 2H4+2L1 antibody. In one embodiment, the antibody or antibody fragment comprises a light chain having at least about 80% sequence identity (e.g., at least about 85%, 90%, 95%, 97%, 98%, or 99% identity, or 100% identity) with the light chain of SEQ ID NO: 48 of the 2H4+2L1 antibody.

[0164] DNA encoding an antibody can be manufactured and placed in a suitable expression vector for transfection into a suitable host. The host is then used for the recombinant production of the antibody, or a variant thereof, such as a humanized version of a monoclonal antibody, an active fragment of the antibody, a chimeric antibody containing an antigen-recognizing portion of the antibody, or a version containing a detectable moiety.

[0165] The DNA encoding the monoclonal antibody of the present disclosure can be easily isolated and sequenced using conventional procedures (e.g., using an oligonucleotide probe capable of specifically binding to genes encoding the heavy and light chains of a murine antibody). In one embodiment, a nucleic acid encoding the heavy or light chain of an anti-CD73 antibody of any embodiment of the present invention is provided. Once isolated, the DNA can be placed in an expression vector and then transfected into a host cell, such as an E. coli cell, a monkey COS cell, a Chinese hamster ovary (CHO) cell, or, in other cases, a myeloma cell that does not produce immunoglobulin protein, to achieve the synthesis of the monoclonal antibody in the recombinant host cell. Such DNA sequences can be modified for any of a number of purposes, for example, for humanization of the antibody, for production of fragments or derivatives, or for modifying the sequence of the antibody at the antigen-binding site to optimize the binding specificity of the antibody. In one embodiment, provided is an isolated nucleic acid sequence encoding the light chain and / or heavy chain of an antibody, as well as a recombinant host cell containing such nucleic acid (e.g., in its genome). The recombinant expression of antibody-coding DNA in bacteria is well known in the art (e.g., Skerra et al., Curr. Opinion in Immunol., 5, pp. 256 (1993); and see Pluckthun, Immunol. 130, p. 151 (1992)).

[0166] Fragments and derivatives of antibodies (which are encompassed by the terms “antibody” or “antibodies” as used in this application unless otherwise specified or clearly contradicted by the context) may be prepared using techniques known in the art. A “fragment” comprises a portion of an intact antibody, generally comprising an antigen-binding site or a variable region. Examples of antibody fragments include Fab, Fab’, Fab’-SH, F(ab’) 2, and Fv fragments; diabodies; any antibody fragment that is a polypeptide having a primary structure consisting of a single uninterrupted sequence of continuous amino acid residues (referred herein as “single-chain antibody fragment” or “single-chain polypeptide”); and multispecific (e.g., bispecific) antibodies formed from antibody fragments.

[0167] Typically, the anti-CD73 antibodies provided herein are about 10 4 to about 10 11 M -1 (For example, about 10 8 to about 10 10 M -1 ) has an affinity for CD73 polypeptides in the range (e.g., CD73 polypeptides as produced in the embodiments of the present invention). For example, in certain embodiments, the present disclosure has an affinity for CD73, for example, 1 x 10⁶ as identified by surface plasmon resonance (SPR) screening (e.g., by analysis using a BIAcore™ SPR analyzer). -9 Mean dissociation constant less than M (K D The present disclosure provides an anti-CD73 antibody having ). In a more specific exemplary embodiment, the present disclosure provides about 1 x 10 for CD73. -8 M to about 1 x 10 -10 M, or about 1 x 10⁻⁶ -9 M to about 1 x 10 -11 M's K D Provides an anti-CD73 antibody having

[0168] The antibody may be characterized by an average KD of, for example, about 100, 60, 10, 5, or 1 nanomolar or less (i.e., better affinity), preferably sub-nanomolar, or optionally about 500, 200, 100, or 10 picomolar or less. The KD can be determined, for example, by applying the antibody to be tested in a solution after immobilizing recombinantly produced human CD73 protein on a chip surface. In one embodiment, the method further comprises the step (d) of selecting antibodies from (b) that can compete with the control antibody for binding to CD73.

[0169] In one embodiment, the anti-CD73 antibody may be prepared so as not to have substantial binding to human Fcγ receptors (e.g., any one or more of CD16A, CD16B, CD32A, CD32B, and / or CD64). Such antibodies may include various constant regions of heavy chains known to lack or have low binding to Fcγ receptors. Alternatively, an antibody fragment that does not include (or includes part thereof) a constant region, such as an F(ab')2 fragment, may be used to evade Fc receptor binding. Fc receptor binding may be evaluated according to methods known in the art, such as testing the binding of the antibody to the Fc receptor protein in the BIACORE assay. In addition, any antibody IgG isotype in which the Fc portion is generally modified to minimize or eliminate binding to the Fc receptor (e.g., by introducing one, two, three, four, five or more amino acid substitutions) may be used (e.g., see WO 03 / 101485, the disclosure of which is incorporated herein by reference). Assays for evaluating Fc receptor binding are well known in the art, for example, as described in WO 03 / 101485.

[0170] In one embodiment, the antibody may comprise one or more specific mutations in the Fc region resulting in an “Fc-silencing” antibody having minimal interaction with effector cells. Silenced effector function may be obtained by mutations in the Fc region of the antibody and are described below: N297A mutation, LALA mutation (Strohl, W., 2009, Curr. Opin. Biotechnol. Vol. 20(6):685-691); and D265A (Baudino et al., 2008, J. Immunol. 181: 6664-69). Also see Heusser et al., WO2012 / 065950, whose disclosure is incorporated herein by reference. In one embodiment, the antibody comprises one, two, three, or more amino acid substitutions in the hinge region. In one embodiment, the antibody is IgG1 or IgG2 and comprises one, two, or three substitutions on residues 233-236, optionally 233-238 (EU numbering). In one embodiment, the antibody is IgG4 and comprises one, two, or three substitutions on residues 327, 330, and / or 331 (EU numbering). An example of a silenced Fc IgG1 antibody is an LALA mutant containing L234A and L235A mutations in the IgG1 Fc amino acid sequence. Another example of an Fc silenced mutation is a mutation at residue D265, or at D265 and P329, such as the DAPA (D265A, P329A) mutation (US 6,737,056) used in an IgG1 antibody, for example. Another silent IgG1 antibody contains a mutation in residue N297 (e.g., N297A, N297S mutations), which results in a non-glycosylated / non-glycosylated antibody.Other silenced mutations include the following: substitutions at residues L234 and G237 (L234A / G237A); substitutions at residues S228, L235, and R409 (S228P / L235E / R409K,T,M,L); substitutions at residues H268, V309, A330, and A331 (H268Q / V309L / A330S / A331S); substitutions at residues C220, C226, C229, and P238 (C220S / C226S / C229S / P238S); substitutions at residues C226, C229, E233, L234, and L235 (C226S / C229S / E233P / L234V / L235A); Substitutions at residues K322, L235, and L235 (K322A / L234A / L235A); substitutions at residues L234, L235, and P331 (L234F / L235E / P331S); substitutions at residues 234, 235, and 297; substitutions at residues E318, K320, and K322 (L235E / E318A / K320A / K322A); substitutions at residues (V234A, G237A, P238S); substitutions at residues 243 and 264; substitutions at residues 297 and 299; Substitutions such that residues 233, 234, 235, 237, and 238, defined by the EU numbering system, comprise sequences selected from PAAAP, PAAAS, and SAAAS (see WO2011 / 066501).

[0171] In one embodiment, the antibody may contain one or more specific mutations in the Fc region. For example, such an antibody may contain an Fc domain of human IgG1 origin and may contain mutations in kavat residue(s) 234, 235, 237, 330 and / or 331. One example of such an Fc domain includes substitutions in the kavat residues L234, L235, and P331 (e.g., L234A / L235E / P331S or (L234F / L235E / P331S). Another example of such an Fc domain includes substitutions in the kavat residues L234, L235, G237, and P331 (e.g., L234A / L235E / G237A / P331S). Yet another example of such an Fc domain includes substitutions in the kavat residues L234, L235, G237, A330, and P331 (e.g., L234A / L235E / G237A / A330S / P331S). In one embodiment, the antibody includes an L234X1 substitution, an L235X2 substitution, and Optionally comprising a human IgG1 isotype Fc domain containing a P331X3 substitution, wherein X1 is any amino acid residue other than leucine, X2 is any amino acid residue other than leucine, and X3 is any amino acid residue other than proline; optionally X1 is alanine or phenylalanine or a conservative substitution thereof; optionally X2 is glutamic acid or a conservative substitution thereof; and optionally X3 is serine or a conservative substitution thereof.In another embodiment, the antibody comprises an Fc domain of optionally human IgG1 isotype, comprising L234X1 substitution, L235X2 substitution, G237X4 substitution and P331X4 substitution, wherein X1 is any amino acid residue other than leucine, X2 is any amino acid residue other than leucine, X3 is any amino acid residue other than glycine, and X4 is any amino acid residue other than proline; optionally X1 is alanine or phenylalanine or a conservative substitution thereof; optionally X2 is glutamic acid or a conservative substitution thereof; optionally X3 is alanine or a conservative substitution thereof; optionally X4 is serine or a conservative substitution thereof. In another embodiment, the antibody comprises an Fc domain of optionally human IgG1 isotype, comprising L234X1 substitution, L235X2 substitution, G237X4 substitution, G330X4 substitution, and P331X5 substitution, wherein X1 is any amino acid residue other than leucine, X2 is any amino acid residue other than leucine, X3 is any amino acid residue other than glycine, X4 is any amino acid residue other than alanine, and X5 is any amino acid residue other than proline; optionally X1 is alanine or phenylalanine or a conservative substitution thereof; optionally X2 is glutamic acid or a conservative substitution thereof; optionally X3 is alanine or a conservative substitution thereof; optionally X4 is serine or a conservative substitution thereof; optionally X5 is serine or a conservative substitution thereof.

[0172] In the abbreviated nomenclature used herein, the format is wild-type residue:position in polypeptide:mutant residue, where residue positions are indicated according to EU numbering based on kavat.

[0173] In one embodiment, the antibody comprises the following amino acid sequence, or an amino acid sequence that is at least 90%, 95%, or 99% identical thereto, but includes a heavy chain constant region that retains amino acid residues at kavat positions 234, 235, and 331 (underlined):

[0174]

[0175] In one embodiment, the antibody comprises the following amino acid sequence, or an amino acid sequence that is at least 90%, 95%, or 99% identical thereto, but includes a heavy chain constant region that retains amino acid residues at kavat positions 234, 235, and 331 (underlined):

[0176]

[0177] In one embodiment, the antibody comprises the following amino acid sequence, or an amino acid sequence that is at least 90%, 95%, or 99% identical thereto, but includes a heavy chain constant region that retains amino acid residues at kavat positions 234, 235, 237, 330, and 331 (underlined):

[0178]

[0179] In one embodiment, the antibody comprises the following amino acid sequence, or a sequence that is at least 90%, 95%, or 99% identical thereto, but includes a heavy chain constant region that retains amino acid residues at kavat positions 234, 235, 237, and 331 (underlined):

[0180]

[0181] Fc silencing antibodies produce no or little ADCC activity, meaning that Fc silencing antibodies exhibit ADCC activity of less than 50% specific cell lysis. Preferably, the antibody substantially lacks ADCC activity; for example, Fc silencing antibodies exhibit less than 5% or less than 1% ADCC activity (specific cell lysis). Fc silencing antibodies may also result in a lack of FcγR-mediated cross-linking of CD73 on the surface of CD73-expressing cells.

[0182] In one embodiment, the antibody has substitutions on any one, two, three, four, or five or more residues selected from the group consisting of 220, 226, 229, 233, 234, 235, 236, 237, 238, 243, 264, 268, 297, 298, 299, 309, 310, 318, 320, 322, 327, 330, 331, and 409 in the heavy chain constant region (the numbering of residues in the heavy chain constant region follows EU numbering according to Kavat). In one embodiment, the antibody includes substitutions on residues 234, 235, and 322. In one embodiment, the antibody includes substitutions on residues 234, 235, and 331. In one embodiment, the antibody comprises substitutions at residues 234, 235, 237, and 331. In one embodiment, the antibody comprises substitutions at residues 234, 235, 237, 330, and 331. In one embodiment, the Fc domain is of a human IgG1 subtype. Amino acid residues are indicated according to EU numbering based on kavat.

[0183] In one embodiment, the antibody comprises an Fc domain containing amino acid substitutions that increase binding to the human FcRn polypeptide in order to increase the in vivo half-life of the antibody. Exemplary mutations are described in Strohl, W., 2009, Curr. Opin. Biotechnol. Vol. 20(6):685-691, the disclosure of which is incorporated herein by reference. Examples of substitutions used in antibodies of human IgG1 isotypes include substitutions at kavat residues M252, S254, and T256; substitutions at residues T250 and M428; substitution at residue N434; substitutions at residues H433 and N434; substitutions at residues T307, E380, and N434; substitutions at residues T307, E380, and N434; Substitutions at residues M252, S254, T256, H433, N434, and 436; substitution at residue I253; and substitutions at residues P257, N434, D376, and N434. The antigen-binding compound can be evaluated at any time for its ability to inhibit the enzymatic activity of CD73, particularly its ability to inhibit the 5'-nucleotide activity of CD73 and reduce the production of adenosine by CD73-expressing cells, and ultimately restore lymphocyte activity and / or alleviate adenosine-mediated inhibition of lymphocytes.

[0184] The ability of an antibody to inhibit the enzymatic activity of CD73 can be tested in a cell-free assay using recombinant soluble human CD73 (as a dimer) and AMP, wherein the conversion of AMP to adenosine (and / or inhibition thereof) is detected directly or indirectly (e.g., by measuring substrates and products, i.e., AMP, adenosine, and / or phosphate). In one example, AMP and / or adenosine are detected via HPLC before and after incubation of recombinant CD73 and the test compound.

[0185] The CD73-inhibitory activity of antibodies can also be evaluated in any number of other ways. For example, in an indirect assay, the depletion of AMP is detected using a luciferase-based reagent (e.g., the CellTiter-Glo® system available from Promega). In the assay, the luciferase reaction is inhibited by AMP. The addition of the CD73 enzyme to the reaction degrades AMP, thereby reducing inhibition and generating a detectable signal.

[0186] Assays using soluble CD73 will include tests under conditions where the antibody is provided in substantial molar excess (e.g., 10-fold, 20-fold, 50-fold, 100-fold, etc.) to the CD73 polypeptide dimer. When provided in molar excess to the enzyme, the anti-CD73 antibody will no longer be able to form a polymeric complex of the antibody and the CD73 dimer, and then the antibody possessing inhibition of the CD73 enzyme activity can be selected.

[0187] The ability of an antibody to inhibit the 5'-ectonucleotidase enzyme activity of CD73 may also be tested, alternatively or additionally, in a cell assay (using cells expressing CD73). Advantageously, the antibody may first be tested or screened in a cell-free assay to identify an antibody that blocks enzyme activity in order to reduce the likelihood of selecting an antibody that inhibits CD73 by causing internalization of CD73, and then tested in a cell assay as a purified antibody. The cell assay may be performed as shown in the embodiments of this application or as disclosed in PCT Publication WO2016 / 055609, the disclosure of which is incorporated herein by reference. For example, CD73-expressing cells (e.g., MDA-MB-231 cell line) are plated in a flat-bottom 96-well plate and incubated in the presence of an anti-CD73 antibody, as detailed in WO2016 / 055609. AMP is added to the cells (to avoid CD73 downregulation) and incubated at 4°C. Next, the plate is centrifuged and the supernatant is transferred to a flat-bottom 96-well culture plate. Then, the free phosphate produced by the hydrolysis of AMP to adenosine is quantified. A decrease in the hydrolysis of AMP to adenosine in the presence of the antibody indicates that the antibody inhibits cellular CD73.

[0188] In one embodiment, the antibody preparation causes at least a 50% reduction in the enzymatic activity of the CD73 polypeptide, preferably at least a 60%, 70%, or 80% reduction in the enzymatic activity of the CD73 polypeptide (e.g., soluble homodimeric CD73 polypeptide; CD73 expressed by cells).

[0189] The activity of an antibody can also be measured in an indirect assay regarding its ability to regulate lymphocyte activity, for example, the ability to alleviate adenosine-mediated inhibition of lymphocyte activity, or the ability to induce lymphocyte activation. This can be handled, for example, using a cytokine-releasing assay. In another example, the antibody can be evaluated in an indirect assay regarding its ability to regulate lymphocyte proliferation.

[0190] In one embodiment, the antibody neutralizes the 5'-ectonucleotidase activity of the homodimeric human CD73 polypeptide in solution. In one embodiment, the antibody binds to the soluble human CD73 polypeptide and inhibits its enzymatic activity, and in particular, the antibody neutralizes the CD73-mediated catabolism of AMP to adenosine. In one embodiment, the antibody binds to CD73 in a divalent manner. In one embodiment, the antibody is a non-depleting antibody, for example, an Fc-silencing antibody that substantially lacks binding to the human Fcγ receptor. In one embodiment, the antibody neutralizes CD73 in solution without relying on the induction of the CD73 polypeptide:anti-CD73 antibody oligomer.

[0191] In one embodiment, the antibody specifically binds to human CD73 on the surface of a cell and can neutralize the 5'-ectonucleotidase activity of the soluble human CD73 polypeptide. In one embodiment, the antibody does not induce oligomerization of soluble CD73.

[0192] In one embodiment, the antibody can specifically bind to human CD73 on the surface of a cell and neutralize the 5'-ectonucleotidase activity of cellular CD73 (CD73 expressed by the cell). In one embodiment, the antibody specifically binds to and neutralizes the 5'-ectonucleotidase activity of human CD73 on the surface of a cell and is not internalized into CD73-expressing cells upon binding to CD73. The antibody does not cause multimerization and subsequent internalization of CD73. In one embodiment, the antibody can bind to and inhibit the enzymatic activity of a recombinant human CD73 polypeptide in solution, said antibody is not internalized into CD73-expressing cells. In one embodiment, the non-internalizing antibody binds to CD73 in a divalent manner. In one embodiment, the antibody is a non-depleting antibody, for example, an Fc-silencing antibody. Furthermore, the antibody can neutralize the 5'-ectonucleotidase activity of the dimeric human CD73 polypeptide in solution without relying on the induction of the CD73 polypeptide: anti-CD73 antibody oligomer.

[0193] In one embodiment, the antibody specifically binds to the human CD73 polypeptide and inhibits the enzymatic activity of cellular human CD73 (and optionally additionally recombinant soluble human CD73), and the antibody does not induce or increase the intracellular internalization of CD73 in CD73-expressing cells. Preferably, the antibody substantially lacks Fcγ receptor binding (e.g., through its Fc domain).

[0194] In one embodiment, the antibody specifically binds to human CD73 on the surface of cells pre-incubated with AMP and can neutralize its 5'-ectonucleotidase activity. Optionally, neutralization of 5'-ectonucleotidase activity is confirmed by evaluating the neutralization of 5'-ectonucleotidase activity in CD73-expressing cells (e.g., MDA-MB-231 cells) by quantifying the hydrolysis of AMP to adenosine.

[0195] In one embodiment, neutralization of the 5'-ectonucleotidase activity of CD73 expressed by cells is confirmed by evaluating the ability of an antibody to increase T cell proliferation when said T cells are induced to proliferate in vitro in the presence of AMP (e.g., exogenously added AMP) (e.g., through TCR co-stimulation, stimulation of CD3 and CD28 signaling, e.g., by contacting T cells with beads functionalized with CD3 agonists and CD28 agonists). In one embodiment, the neutralization assay of 5'-ectonucleotidase activity is evaluated using the T cell proliferation assay described in the "Methods" section of the Examples.

[0196] Compared to the ability of the anti-CD73 antibody to bind to the wild-type CD73 polypeptide (e.g., SEQ ID NO: 1), the antibody can be characterized by its ability to bind to cells transfected with the CD73 mutant. A decrease in binding between the anti-CD73 antibody and the mutant CD73 polypeptide implies the presence of a decrease in binding affinity (e.g., measured by known methods such as FACS analysis of cells expressing a specific mutant, or by Biacore analysis of binding with the mutant polypeptide) and / or a decrease in the overall binding ability of the anti-CD73 antibody (e.g., demonstrated by a decrease in Bmax in a graph of the anti-CD73 antibody against polypeptide concentration). A significant decrease in binding implies that the mutated residue is directly involved in binding with the anti-CD73 antibody or is located in close proximity to the binding protein when the anti-CD73 antibody binds to CD73.

[0197] In some embodiments, a significant reduction in binding means that the binding affinity and / or ability between the anti-CD73 antibody and the mutant CD73 polypeptide is reduced by more than 40%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, or more than 95% compared to the binding between the antibody and the wild-type CD73 polypeptide. In some embodiments, binding is reduced to a detectable threshold. In some embodiments, a significant reduction in binding is demonstrated when the binding of the anti-CD73 antibody to the mutant CD73 polypeptide is less than 50% of the binding observed between the anti-CD73 antibody and the wild-type CD73 polypeptide (e.g., less than 45%, 40%, 35%, 30%, 25%, 20%, 15%, or 10%).

[0198] In one embodiment, the anti-CD73 antibody has reduced binding to a CD73 polypeptide having a mutation at residue K136 (see SEQ ID NO: 1); optionally, the mutant CD73 polypeptide has mutation: K136A.

[0199] In one embodiment, the anti-CD73 antibody has reduced binding to a CD73 polypeptide having a mutation at a residue selected from the group consisting of: K97, E125, Q153, and K330 (see SEQ ID NO: 1); optionally, the mutant CD73 polypeptide has the following mutations: K97A, E125A, Q153A, and / or K330A (e.g., K97A, E125A, and K330A; K97A, E125A, and / or Q153A).

[0200] In one embodiment, the anti-CD73 antibody has reduced binding to a CD73 polypeptide having a mutation at a residue selected from the group consisting of: A99, E129, K133, E134, and A135 (see SEQ ID NO: 1); optionally, the mutant CD73 polypeptide has the following mutations: A99S, E129A, K133A, E134N, and / or A135S.

[0201] Optionally, in one embodiment, the anti-CD73 antibody does not have reduced binding to a CD73 polypeptide having a mutation at a residue selected from the group consisting of: Q70, R73, A74, A107, and R109 (see SEQ ID NO: 1); optionally, the mutant CD73 polypeptide has the following mutations: A99S, Q70S, R73A, A74E, A107I, and / or R109G.

[0202] In one embodiment, the anti-CD73 antibody binds to an epitope on CD73 containing residue K136 (see SEQ ID NO: 1).

[0203] In one embodiment, the anti-CD73 antibody binds to an epitope on CD73 comprising one, two, three, or four residues selected from the group consisting of K97, E125, Q153, and K330 (see SEQ ID NO: 1).

[0204] In one embodiment, the anti-CD73 antibody binds to an epitope on CD73 comprising one, two, three, four, or five residues selected from the group consisting of A99, E129, K133, E134, and A135 (see SEQ ID NO: 1).

[0205] In one embodiment, the anti-CD73 antibody binds to an epitope on CD73 comprising one, two, three, four, five, or more residues selected from the group consisting of K97, A99, E125, E129, K133, E134, A135, and K136 (see SEQ ID NO: 1). In one embodiment, the anti-CD73 antibody binds to an epitope on CD73 comprising one, two, three, four, five, or more residues selected from the group consisting of K97, A99, E125, E129, K133, E134, A135, K136, Q153, and K330 (see SEQ ID NO: 1).

[0206] Optionally, in one embodiment, the anti-CD73 antibody does not bind to an epitope on CD73 comprising one, two, three, four, or five residues selected from the group consisting of Q70, R73, A74, A107, and R109 (see SEQ ID NO: 1).

[0207] An anti-CD73 antibody is introduced into a pharmaceutical formulation and included at a concentration of 1 mg / mL to 500 mg / mL, wherein the formulation has a pH of 2.0 to 10.0. The formulation may further include a buffer system, preservative(s), isotonic(s), chelating(s), stabilizer, and surfactant. In one embodiment, the pharmaceutical formulation is an aqueous formulation, i.e., a formulation containing water. Such formulations are typically solutions or suspensions. In a further embodiment, the pharmaceutical formulation is an aqueous solution. The term "aqueous formulation" is defined as a formulation containing at least 50% w / w of water. Similarly, the term "aqueous solution" is defined as a solution containing at least 50% w / w of water, and the term "aqueous suspension" is defined as a suspension containing at least 50% w / w of water.

[0208] In another embodiment, the pharmaceutical formulation is a lyophilized formulation, to which a doctor or patient adds a solvent and / or diluent before use.

[0209] In another embodiment, the pharmaceutical formulation is a dry formulation (e.g., freeze-dried or spray-dried) prepared for use without any prior dissolution.

[0210] In a further aspect, the pharmaceutical formulation comprises an aqueous solution of such antibody and a buffer, wherein the antibody is present at a concentration of 1 mg / mL or more, and the formulation has a pH of about 2.0 to about 10.0.

[0211] In another embodiment, the pH of the formulation is a range selected from a list consisting of about 2.0 to about 10.0, about 3.0 to about 9.0, about 4.0 to about 8.5, about 5.0 to about 8.0, and about 5.5 to about 7.5.

[0212] In additional embodiments, the buffer is selected from the group consisting of sodium acetate, sodium carbonate, citrate, glycylglycine, histidine, glycine, lysine, arginine, sodium dihydrogen phosphate, disodium hydrogen phosphate, sodium phosphate, and tris(hydroxymethyl)-aminomethane, bicine, trisine, malic acid, succinate, maleic acid, fumaric acid, tartaric acid, aspartic acid, or mixtures thereof. Each of these specific buffers constitutes an alternative embodiment.

[0213] In additional embodiments, the formulation further comprises a pharmaceutically acceptable preservative. In additional embodiments, the formulation further comprises an isotonic agent. In additional embodiments, the formulation also comprises a chelating agent. In additional embodiments, the formulation further comprises a stabilizer. In additional embodiments, the formulation further comprises a surfactant. For convenience, Remington: The Science and Practice of Pharmacy , 19 th Refer to edition, 1995.

[0214] It is possible for other components to be present in peptide pharmaceutical formulations. These additional components may include humectants, emulsifiers, antioxidants, extenders, isotonic modifiers, chelating agents, metal ions, oily vehicles, proteins (e.g., human serum albumin, gelatin, or proteins), and zwitterions (e.g., amino acids such as betaine, taurine, arginine, glycine, lysine, and histidine). Of course, these additional components must not adversely affect the overall stability of the pharmaceutical formulation.

[0215] A pharmaceutical composition containing antibodies may be administered to a patient requiring such treatment at several sites, e.g., local sites, e.g., skin and mucosal sites; at sites bypassing absorption, e.g., artery, vein, or heart; and at sites involving absorption, e.g., skin, subcutaneous, muscle, or abdominal. The pharmaceutical composition may be administered to a patient requiring such treatment through several routes of administration, e.g., subcutaneous, intramuscular, intraperitoneal, intravenous, tongue, sublingual, buccal, mouth, oral, gastric and intestinal, nose, lungs, e.g., bronchioles and alveoli or a combination thereof; epithelium, dermis, transdermal, vagina, rectum, eye, e.g., conjunctiva; ureters, and parenterals.

[0216] Diagnosis and Treatment of Malignant Tumors

[0217] A method for treating an individual, particularly a human patient, using an anti-CD73 antibody or antibody fragment as described herein is also provided. In one embodiment, this disclosure provides the use of an antibody or antibody fragment as described herein in the preparation of a pharmaceutical composition to be administered to a human patient. Typically, the patient has cancer or an infectious disease (e.g., a viral or bacterial infection) or is at risk thereof.

[0218] For example, in one embodiment, a method is provided for restoring or enhancing the activity of immune cells (e.g., lymphocytes) in a person in need, the method comprising the step of administering the neutralizing anti-CD73 antibody of the present disclosure to said patient. In one embodiment, the method aims to increase the activity of immune cells (e.g., T cells) in a patient having a disease such as cancer or an infectious disease that is caused by or characterized by increased immune cell activity and / or infiltration of the disease site (e.g., tumor environment or infection site), or by immunosuppression, immunosuppressive cells, or, for example, CD4 T cells, CD8 T cells, or B cells.

[0219] The method will be particularly useful for treating individuals with tumors suspected of being due to a lack of recognition by the immune system (immune escape) of the tumor microenvironment (and CD73-mediated adenosine production therein). The tumor environment may be characterized, for example, by CD73-expressing immune cells, e.g., CD4 T cells, CD8 T cells, B cells, and / or CD73-expressing tumor cells.

[0220] The above methods and anti-CD73 antibodies can be used for the treatment and / or prevention of various cancers and other proliferative diseases. Since these methods operate by reducing adenosine, which inhibits the anti-tumor activity of lymphocytes, and possibly by increasing ATP, which can increase the anti-tumor activity of lymphocytes, these especiallyIt is applicable to a wide range of cancers, including solid tumors, where adenosine within the tumor microenvironment can play a strong role in suppressing anti-tumor immune responses. In one embodiment, a human patient treated with an anti-CD73 antibody has liver cancer, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, breast cancer, lung cancer, non-small cell lung cancer (NSCLC), castration-resistant prostate cancer (CRPC), multiple myeloma, uterine cancer, colon cancer, rectal cancer, cancer of the anal region, gastric cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tube, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, non-Hodgkin lymphoma, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid, cancer of the parathyroid, cancer of the adrenal gland, soft tissue sarcoma, cancer of the urethra, cancer of the penis, solid tumor of a child, lymphocytic lymphoma, cancer of the bladder, cancer of the kidney or ureter, carcinoma of the renal pelvis, neoplasm of the central nervous system (CNS), primary CNS lymphoma, tumor angiogenesis, vertebral axis tumor, brainstem glioma, pituitary adenoma, Hematopoietic malignancies including Kaposi's sarcoma, epidermal carcinoma, squamous cell carcinoma, and asbestos-induced environmental cancers, e.g., multiple myeloma, B-cell lymphoma, Hodgkin lymphoma / primary mediastinal B-cell lymphoma, non-Hodgkin lymphoma, acute myeloid lymphoma, chronic myeloid leukemia, chronic lymphocytic leukemia, follicular lymphoma, diffuse large B-cell lymphoma, Burkitt lymphoma, immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma, mantle cell lymphoma, acute lymphoblastic leukemia, mycosis fungoides, anaplastic large cell lymphoma, T-cell lymphoma, and precursor T-lymphoblastic lymphoma, and any combination of said cancers. This disclosure is also applicable to the treatment of metastatic cancer. Patients may be tested or selected for one or more of the clinical attributes described above before, during, or after treatment.

[0221] Since the above method and anti-CD73 antibody work by reducing adenosine, which inhibits the activity and / or infiltration of immune cells (e.g., lymphocytes), and possibly by increasing ATP, which can further increase the activity of lymphocytes, they are preferably applicable to a wide range of infectious diseases, including any infection caused by infection by viruses, bacteria, protozoa, fungi, or molds.

[0222] In one embodiment, the anti-CD73 antibody is used to neutralize the enzymatic activity of CD73, at least EC 50 , arbitrarily EC 70 , arbitrarily, substantially EC 100 It is administered in an amount effective to acquire and / or maintain the blood concentration of in the subject (e.g., for 1, 2, 3, and 4 weeks, and / or prior to subsequent administration of the antigen-binding compound). In one embodiment, the active amount of the anti-CD73 antibody is for the neutralization of the enzymatic activity of CD73 in the subject's extravascular tissues EC 50 , arbitrarily EC 70 , arbitrarily, substantially EC 100 It is an amount effective for achieving. In one embodiment, the activity of the anti-CD73 antibody is an EC for inhibiting the neutralization of CD73 enzymatic activity. 50 , arbitrarily EC 70 , arbitrarily, substantially EC 100 It is a valid amount to achieve (or maintain) in the object.

[0223] In one embodiment, an anti-CD73 antibody is used to inhibit the CD73-mediated catabolism of AMP to adenosine (e.g., by evaluating the neutralization of 5' ectonucleotidase activity in MDA-MB-231 cells by quantifying the hydrolysis of AMP to adenosine) at least EC in individuals 50 , arbitrarily EC 70 , arbitrarily, substantially EC 100It is administered in an amount effective to achieve and / or maintain the blood concentration of (e.g., for 1, 2, 3, and 4 weeks, and / or until subsequent administration of the anti-CD73 antibody). In one embodiment, the amount of the anti-CD73 antibody is EC10 to inhibit the CD73-mediated catabolism of AMP to adenosine in the extravascular tissues of the individual. 50 , arbitrarily EC 70 , arbitrarily, substantially EC 100 It is an amount effective for achieving (or maintaining).

[0224] In one embodiment, a method for treating or preventing cancer in an individual is provided, the method comprising the step of administering an anti-CD73 antibody to an individual having the disease in an amount that is higher than the concentration required for 50%, 70%, or complete (e.g., 90%) receptor-saturated CD73-expressing cells in the circulatory system (e.g., when evaluated in PBMCs) to be obtained or maintained in the circulatory system, optionally in extravascular tissue of interest (e.g., tumor or tumor environment) for a specified period. Optionally, the achieved concentration is at least 20%, 50%, or 100% higher than the concentration required for specified receptor saturation.

[0225] In one embodiment, a method for treating or preventing cancer in an individual is provided, the method comprising administering an anti-CD73 antibody to the individual for binding to CD73-expressing cells EC 50 , arbitrarily EC 70 or arbitrarily EC 100 The step includes administering an amount that is higher, in the circulatory system, or optionally in extravascular tissue of interest (e.g., tumor or tumor environment), to be obtained or maintained for a specified period (e.g., evaluated by titrating an anti-CD73 antibody on CD73-expressing cells, e.g., MDA-MB-231 cells). Optionally, the achieved concentration is EC10 for binding to CD73-expressing cells. 50 , arbitrarily EC70 or arbitrarily EC 100 It is at least 20%, 50%, or 100% higher.

[0226] In any embodiment, the antibody is EC10 for binding to CD73-expressing cells among human PBMCs at, for example, 0.5-100 ng / mL, optionally 1-100 ng / mL, optionally 30-100 ng / mL, for example, about 30-90 ng / mL (e.g., evaluated by titrating the anti-CD73 antibody on CD73-expressing cells, e.g., MDA-MB-231 cells). 50 , arbitrarily EC 70 or arbitrarily EC 100 Can have.

[0227] EC for the neutralization of CD73 enzymatic activity by anti-CD73 antibodies 50 It may be, for example, about 0.01 µg / ml to 1 µg / ml, optionally 0.1 µg / ml to 10 µg / ml, or optionally 0.1 µg / ml to 1 µg / ml. For example, EC 50 The amount may be about 0.1 µg / ml, about 0.2 µg / ml, or about 0.3 µg / ml. Accordingly, the amount of this anti-CD73 antibody is administered to achieve and / or maintain a blood concentration of, for example, at least 0.1 µg / ml, optionally at least 0.2 µg / ml, optionally at least 1 µg / ml, or optionally at least 2 µg / ml.

[0228] When tissues outside the vascular structure are targeted (in the tumor environment, e.g., in the treatment of solid tumors), it is considered that typically about 10 times higher doses are required compared to the doses that provide corresponding concentrations in circulation. The amount of anti-CD73 antibody administered to achieve (and / or maintain) circulating (blood) concentrations of about 1 µg / ml, 2 µg / ml, 10 µg / ml, or 20 µg / ml is expected to achieve (and / or maintain) extravascular tissue (e.g., tumor tissue) concentrations of about 0.1 µg / ml, 0.2 µg / ml, 1 µg / ml, and 2 µg / ml, respectively.

[0229] In one embodiment, the anti-CD73 antibody is administered in an amount that achieves and / or maintains a tissue (e.g., tumor environment) concentration of, for example, at least 0.1 µg / ml, optionally at least 0.2 µg / ml, optionally at least 1 µg / ml, or optionally at least 2 µg / ml. The antibody may be administered in an amount that achieves and / or maintains a blood concentration of, for example, at least about 1 µg / ml, 2 µg / ml, 10 µg / ml, or 20 µg / ml, for example, 1-100 µg / ml, 10-100 µg / ml, 1-50 µg / ml, 1-20 µg / ml, or 1-10 µg / ml. The amount administered may be adjusted to provide maintenance of the desired concentration for a specific period after administration (e.g., 1, 2, 3, 4 weeks, etc.).

[0230] In some embodiments, at least EC for neutralizing the enzymatic activity of CD73 70 or EC 100 A predetermined amount of anti-CD73 antibody is administered to obtain a concentration in blood (serum) or extravascular tissue (e.g., tumor environment) corresponding to the above. The antibody may be administered in an amount that achieves and / or maintains a blood or extravascular tissue (e.g., tumor environment) concentration of, for example, at least about 1 µg / ml, 2 µg / ml, 10 µg / ml, or 20 µg / ml.

[0231] EC 50 , EC 70 or EC 100 It can be evaluated, for example, by a cell assay regarding the neutralization of CD73 enzymatic activity (e.g., neutralization of 5' ectonucleotidase activity in MDA-MB-231 cells by quantifying the hydrolysis of AMP to adenosine). Regarding the neutralization of CD73 enzymatic activity, "EC 50" refers to the efficient concentration of the anti-CD73 antibody that produces 50% of its maximum response or effect regarding the neutralization of enzyme activity. In relation to the neutralization of CD73 enzyme activity, "EC 70 " refers to the efficient concentration of the anti-CD73 antibody that produces 70% of its maximum response or effect. In relation to the neutralization of CD73 enzymatic activity, "EC 100 " refers to the efficient concentration of the anti-CD73 antibody that produces its substantial maximum response or effect regarding the neutralization of enzyme activity.

[0232] In some embodiments, particularly for the treatment of solid tumors, the achieved concentration is at least EC₀ for the neutralization of enzyme activity 50 , optionally about, or at least about EC 100 It is designed to result in a concentration in the corresponding tissue (outside of the vascular structure, e.g., tumor or tumor environment).

[0233] In one embodiment, the amount of anti-CD73 antibody is 1 to 20 mg per kg of body weight. In one embodiment, the amount is administered to the individual every week, every two weeks, every month, or every two months.

[0234] In one embodiment, a method for treating a human individual is provided, comprising the step of administering an effective amount of the anti-CD73 antibody of the present disclosure to the individual for at least one administration cycle (optional at least two, three, or four administration cycles), wherein the cycle is a period of eight weeks or less, and for each of the at least one cycle, one, two, three, or four doses of the anti-CD73 antibody are administered at a dose of 1-20 mg per kg of body weight. In one embodiment, the anti-CD73 antibody is administered by intravenous infusion.

[0235] A suitable treatment protocol for treating a human includes, for example, the step of administering to a patient an amount of an anti-CD73 antibody as disclosed herein, wherein the method comprises at least one administration cycle in which at least one dose of the anti-CD73 antibody is administered. Optionally, at least 2, 3, 4, 5, 6, 7, or 8 doses of the anti-CD73 antibody are administered. In one embodiment, the administration cycle is 2 to 8 weeks.

[0236] Patients with cancer may be treated with anti-CD73 antibodies with or without a pre-detection step to evaluate the expression of CD73 on cells (e.g., tumor cells, CD4 T cells, CD8 T cells, B cells) in the tumor microenvironment. Optionally, the treatment method may include a step of detecting CD73 nucleic acids or polypeptides in biological samples from an individual-derived tumor (e.g., cancer tissue or cancer-proximate or peri-cancer tissue, cancer-adjacent tissue, adjacent non-tumor tissue, or normal adjacent tissue). Confirmation that the biological sample contains cells expressing CD73 (e.g., expressing CD73 at a high level and high intensity of staining with anti-CD73 antibodies compared to a reference, e.g., healthy tissue) indicates that the patient has cancer that may have a strong benefit from treatment with anti-CD73 antibodies. In one embodiment, the method comprises the steps of confirming the expression level of CD73 nucleic acids or polypeptides in the biological sample and comparing that level to a reference level corresponding to a healthy individual. Confirmation that a biological sample contains cells expressing CD73 nucleic acid or polypeptide at increased levels compared to a reference level (e.g., healthy tissue) means that the patient has cancer that can be advantageously treated using the anti-CD73 antibody of this disclosure. Optionally, detection of CD73 polypeptide in a biological sample includes the step of detecting CD73 polypeptide expressed on the surface of malignant cells, or CD4 T cells, CD8 T cells, or B cells.

[0237] Determining whether an individual has cancer characterized by cells expressing the CD73 polypeptide may include the steps of obtaining a biological sample (e.g., performing a biopsy) from an individual containing cells derived from a cancer environment (e.g., a tumor or tumor-adjacent tissue), contacting said cells with an antibody that binds to the CD73 polypeptide, and detecting whether the cells express CD73 on their surface. Optionally, determining whether an individual has cells expressing CD73 includes the step of performing an immunohistochemical assay.

[0238] The antibody composition may advantageously be used in combination with one or more other therapeutic agents, including agents typically used for the specific therapeutic purpose for which the antibody is administered. The additional therapeutic agents will be administered in the amounts and therapeutic regimens typically used for the agent in monotherapy for the specific disease or condition typically treated. These therapeutic agents include, without limitation, anticancer agents and chemotherapy agents.

[0239] In one embodiment, the anti-CD73 antibody enhances the efficacy of an agent that neutralizes the inhibitory activity of human PD-1, for example, an agent that inhibits the interaction between PD-1 and PD-L1. Accordingly, in one embodiment, the second or additional second therapeutic agent is an antibody or other agent that neutralizes the inhibitory activity of human PD-1.

[0240] Programmed Death 1 (PD-1) (also known as "Programmed Cell Death 1") is an inhibitory member of the CD28 family of receptors. The complete human PD-1 sequence can be identified under GenBank Accession No. U64863. Inhibition or neutralization of the inhibitory activity of PD-1 may involve the use of polypeptide agonists (e.g., antibodies, polypeptides fused to the Fc domain, immunoadhesives, etc.) that prevent PD-L1-induced PD-1 signaling. At least six agonists blocking the PD-1 / PD-L1 pathway are currently on the market or under clinical evaluation. One agonist is BMS-936558 (nivolumab / ONO-4538, Bristol-Myers Squibb; formerly MDX-1106). Nivolumab (trademark Opdivo®) is an FDA-approved whole-human IgG4 anti-PD-L1 mAb that inhibits the binding of PD-L1 ligands to both PD-1 and CD80, and is described as antibody 5C4 in WO 2006 / 121168, the disclosure incorporated herein by reference. In patients with melanoma, the most significant OR was observed at a dose of 3 mg / kg, whereas for other cancer types, it was 10 mg / kg. Nivolumab is generally administered at 10 mg / kg every 3 weeks until cancer progression. The terms "to reduce the inhibitory activity of human PD-1," "to neutralize PD-1," or "to neutralize the inhibitory activity of human PD-1" refer to the process in which PD-1 is inhibited in its signaling ability resulting from the interaction of PD-1 with one or more of its binding partners, such as PD-L1 or PD-L2. An agent that neutralizes the inhibitory activity of PD-1 reduces, blocks, inhibits, cancels, or interferes with signaling resulting from the interaction of PD-1 with one or more of its binding partners, such as PD-L1 or PD-L2.Thus, these agents can reduce negative co-stimulatory signals mediated by or through cell surface proteins expressed on T lymphocytes to enhance T-cell effector functions, such as proliferation, cytokine production, and / or cytotoxicity.

[0241] MK-3475 (Merck human IgG4 anti-PD1 mAb), also known as lamprolizumab or pembrolizumab (trademark Keytruda®), has been approved by the FDA for the treatment of melanoma and is being tested in other cancers. Pembrolizumab was tested at 2 mg / kg or 10 mg / kg every 2 or 3 weeks until disease progression. MK-3475, also known as Merck 3745 or SCH-900475, is also described in WO 2009 / 114335.

[0242] MPDL3280A / RG7446 (Atezolizumab, brand name Tecentriq™, anti-PD-L1, Roche / Genentech) is a human anti-PD-L1 mAb containing an engineered Fc domain designed to optimize efficacy and safety by minimizing FcγR binding and resulting antibody-dependent cytotoxicity (ADCC). MPDL3280A at doses ≤1, 10, 15, and 25 mg / kg were administered every 3 weeks for up to 1 year. In Phase 3, MPDL3280A is administered at 1200 mg via intravenous infusion every 3 weeks in NSCLC.

[0243] AMP-224 (Amplimmune and GSK) is an immunoadhesion containing a PD-L2 extracellular domain fused to an Fc domain. Other examples of agents that neutralize PD-1 may include antibodies (anti-PD-L2 antibodies) that bind to PD-L2 and block the interaction between PD-1 and PD-L2.

[0244] Fidlizumab (CT-011; CureTech) (a humanized IgG1 anti-PD1 mAb from CureTech / Teva) is another example, and the agent was tested in 30 patients with rituximab-sensitive relapsed FL, who were treated with 3 mg / kg intravenous CT-011 every 4 weeks for 4 weeks in combination with 375 mg / kg of rituximab weekly for 4 weeks, starting 2 weeks after the first infusion of CT-011.

[0245] Additional disclosed PD-1 antibodies and other PD-1 inhibitors include AMP-224 (a B7-DC / IgG1 fusion protein patented by GSK), AMP-514 described in WO 2012 / 145493, the antibody MEDI-4736 (dulvalumab, trade name Imfinzi™, anti-PD-L1 developed by AstraZeneca / Medimmune) described in WO 2011 / 066389 and US 2013 / 034559, the antibody YW243.55.S70 (anti-PD-L1) described in WO 2010 / 077634, MDX-1105, also known as BMS-936559, an anti-PD-L1 antibody developed by Bristol-Myers Squibb described in WO 2007 / 005874, and WO 2006 / 121168, Includes antibodies and inhibitors described in WO 2009 / 014708, WO 2009 / 114335 and WO 2013 / 019906 (disclosures thereof incorporated herein by reference). Further examples of anti-PD1 are disclosed in WO 2015 / 085847 (Shanghai Hengrui Pharmaceutical Co. Ltd.), exemplarily antibodies having light chain variable domains CDR 1, 2, and 3 of SEQ ID NO: 6, SEQ ID NO: 7, and / or SEQ ID NO: 8, and antibody heavy chain variable domains CDR 1, 2, and 3 of SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5, respectively, wherein SEQ ID NO references are numberings according to WO 2015 / 085847, disclosures thereof incorporated herein by reference. An antibody that competes with either of these antibodies for binding to PD-1 or PD-L1 may also be used. In some embodiments, the PD-1 neutralizing agent is an anti-PD-L1 mAb that inhibits the binding of PD-L1 to PD-1. In some embodiments, the PD-1 neutralizing agent is an anti-PD1 antibody that inhibits the binding of PD-1 to PD-L1. An exemplary anti-PD-1 antibody is pemprolizumab (Merck & Co.It is marketed as Keytruda™ by [Name], and also by reference WO 2009 / 114335, the disclosure of which is incorporated herein by reference. An exemplary anti-PD-L1 antibody is MEDI-4736 (durvalumab, trademark Imfinzi™, an anti-PD-L1 developed by AstraZeneca / Medimmune).

[0246] In a treatment method, the CD73-binding compound and the second therapeutic agent may be administered individually, together, sequentially, or as a cocktail. In some embodiments, the antigen-binding compound is administered prior to the administration of the second therapeutic agent. For example, the CD73-binding compound may be administered approximately 0 to 30 days prior to the administration of the second therapeutic agent. In some embodiments, the CD73-binding compound is administered approximately 30 minutes to about 2 weeks, about 30 minutes to about 1 week, about 1 hour to about 2 hours, about 2 hours to about 4 hours, about 4 hours to about 6 hours, about 6 hours to about 8 hours, about 8 hours to 1 day, or about 1 to 5 days prior to the administration of the second therapeutic agent. In some embodiments, the CD73-binding compound is administered simultaneously with the administration of the therapeutic agent. In some embodiments, the CD73-binding compound is administered after the administration of the second therapeutic agent. For example, the CD73-binding compound may be administered approximately 0 to 30 days after the administration of the second therapeutic agent. In some embodiments, the CD73-binding compound is administered approximately 30 minutes to about 2 weeks, approximately 30 minutes to about 1 week, approximately 1 hour to about 2 hours, approximately 2 hours to about 4 hours, approximately 4 hours to about 6 hours, approximately 6 hours to about 8 hours, approximately 8 hours to 1 day, or approximately 1 to 5 days after the administration of the second therapeutic agent.

[0247] Examples

[0248] method

[0249] Cloning, Production, and Purification of Recombinant huCD73

[0250] Molecular biology

[0251] The huCD73 protein was cloned from MIAPACA-2 cDNA using the following primers: TACGACTCACAAGCTTGCCGCCACCATGTGTCCCCGAGCCGCGCG (SEQ ID NO: 20) (forward) and CCGCCCCGACTCTAGAtcaGTGATGGTGATGATGGTGcttgatccgaccttcaactg (SEQ ID NO: 21) (reverse). The purified PCR product was then cloned into an expression vector using the InFusion Cloning System. For the purification step, a 6xHis tag was added to the C-terminal portion of the protein.

[0252] Amino acid sequence of cloned huCD73:

[0253]

[0254] Expression and Purification of huCD73 Protein

[0255] After verification of the cloned sequence, cells were nucleated, and the resulting pool was subsequently subcloned to obtain cell clones producing the huCD73 protein. The supernatant derived from the huCD73 clones grown on rollers was recovered, purified using a Ni-NTA column, and eluted with 250 mM imidazole. The purified protein was then loaded onto an S200 size exclusion chromatography column. The purified protein corresponding to the dimer was formulated in Tris 20 mM pH 7.5, NaCl 120 mM, and CaCl 24 mM buffer for enzymatic activity assay, with 20% glycerol added to the formulation buffer.

[0256] SPR analysis to evaluate Ab KD for recombinant CD73 protein

[0257] SPR measurements were performed on a Biacore™ T200 instrument at 25°C. Protein-A (GE Healthcare) was immobilized on the Sensor Chip CM5 (GE Healthcare). The chip surface was activated with EDC / NHS (N-ethyl-N'-(3-dimethylaminopropyl)carbodiamide hydrochloride and N-hydroxysuccinimide) (Biacore™, GE Healthcare). Protein-A was diluted to 10 µg / mL in coupling buffer (10 mM acetate, pH 5.6) and injected until an appropriate immobilization level was reached (i.e., 2000 RU). Deactivation of residual activators was performed using 100 mM ethanolamine pH 8 (Biacore™, GE Healthcare). Affinity studies were performed according to the standard capture-kinetics protocol recommended by the manufacturer (Biacore™ GE Healthcare kinetic wizard). Serial dilutions of human recombinant soluble CD73 protein ranging from 1.23 to 300 nM were sequentially injected into the captured anti-CD73 antibody, dissociated for 10 minutes, and then regenerated. The entire set of sensograms was analyzed using a 1:1 kinetic coupling model. Fitted. Calculates the affinity, kinetic coupling, and dissociation rate constants.

[0258] Flow cytometry analysis evaluating anti-CD73 recognition by antibodies

[0259] 10 who were re-entered by FCSB 5MDA-MB-231 cells were dispensed into round-bottom 96W microplates (50 μL / well). The dosage range of anti-CD73 mAb was added to the plate, and the cells were incubated at +5 ± 3°C for 1 hour. The cells were washed three times in FCSB by spinning the plate at 400g for 3 minutes at 4°C. PE-conjugated goat F(ab')2 anti-human IgG (H+L) secondary antibody diluted in FCSB was added to the cells, and the plate was further incubated at +5 ± 3°C for 30 minutes. The cells were washed three times as described above and analyzed by flow cytometry.

[0260] Plot the median fluorescence intensity versus mAb concentration on a graph, and EC 50 It was calculated using the GraphPad Prism™ program.

[0261] In vitro enzyme assay using recombinant human or cyanomolgus CD73

[0262] Briefly, recombinant human or cynomolgus CD73 was incubated in a white 96W flat-bottom microplate in the presence of anti-CD73 or isotype control mAbs within the dosage range. The plates were incubated at +37 ± 1°C for 1 hour. ATP (12.5 μM) and AMP (125 μM) were added to each well, and the plates were incubated at +37 ± 1°C for an additional 30 minutes. Luciferase / luciferin-containing CellTiter-Glo™ (Promega) was added to the wells, the plates were incubated in a dark room at room temperature for 5 minutes, and the emitted light was measured using an Enspire™ instrument (Perkin Elmer).

[0263] ㆍ Condition:

[0264] ㆍ ATP+AMP: Maximum luciferase inhibition (100%)

[0265] ㆍ CD73+ATP+AMP: No luciferase inhibition (0%)

[0266] Residual enzyme activity versus anti-CD73 Ab concentration was plotted on a graph using GraphPad Prism7™ software.

[0267] T cell proliferation assay

[0268] Peripheral blood was obtained from healthy donors, and mononuclear cells were isolated on a Ficoll gradient. Lymphocytes were further concentrated on a 52% Percoll™ gradient (cell pellet) and stained with 2 μM CellTrace™ Violet (Thermofisher). 5x10 4 Up to 1x10 5 Stained cells were distributed into 96-well round-bottom plates and incubated with anti-CD73 Ab at 37°C for 1 hour, and activated for 3 to 5 days with the addition of anti-CD3 / anti-CD28-coated beads. Inhibition of T cell proliferation was achieved by adding 200 μM AMP. The ability of the Ab to block T cell proliferation and the immunosuppressive effects of AMP was evaluated by flow cytometry by quantifying dye dilution in proliferating T cells. The percentage of proliferating T cells versus the concentration of anti-CD73 Ab was plotted on a graph using GraphPad Prism™ software. Several experiments were performed on whole PBMCs from healthy donors or cancer patients; the protocols were as described above, except that T cell inhibition was achieved by the addition of 0.5 to 1 mM ATP.

[0269] To compare donors or patients, T cell proliferation was normalized using the following formula:

[0270]

[0271] Allogeneic Mixed Lymphocyte Reaction (MLR) Assay

[0272] Monocytes from healthy donors were isolated on a picol gradient, and the monocytes were purified by immunomagnetic screening using CD14 micro beads (Miltenyi Biotec). Monocytes were differentiated into dendritic cells (MoDCs) by incubation for 5–7 days in the presence of GM-CSF (400 ng / mL) and IL-4 (20 ng / mL). On the day of DC retrieval, CD4+ T cells from allogeneic donors were purified by immunomagnetic depletion of non-CD4+ T cells (Miltenyi Biotec) and stained with Cell Trace™ Violet. DCs (10 4 cells / well) and T cells (5x10 4 Cells / well) were mixed in a 96W round-bottom microplate in the presence of a dose range of anti-huCD73 Ab and a fixed dose of ATP. The ability of the Ab to reverse T cell proliferation and ATP-mediated inhibition was evaluated as described for the T cell proliferation assay.

[0273] Example 1: Modeling and Generation of Anti-huCD73 Antibody Using Human Skeletal Sequence

[0274] The parent antibody 3C12 described in PCT Publication WO2016 / 055609, having VH and VL amino acid sequences of SEQ ID NO: 27 and 28 respectively, was modified by introducing a heavy chain backbone (FR1, FR2, FR3) from the human subgroup IGHV1-3*01 into the VH along with IGHJ4*01 (FR4), and a light chain backbone (FR1, FR2, FR3) from the human subgroup IGKV1-33*01 into the VL along with IGKJ2*01 (FR4).

[0275] We superimposed three-dimensional models based on different human VH and VL gene segments and meticulously examined every single amino acid difference. In silico ( in silicoThe molecular design was challenged using 3D models of both the chimeric (HPLP) and humanized (HOL0) antibodies. Intramolecular and extraramolecular connections between residues were also evaluated to identify and avoid the breakdown of any critical low-energy bonds.

[0276] The VH and VL sequences of each designed domain were cloned into vectors containing the huIgG1-derived constant domain and the huCk constant domain, respectively, with L234A / L235E / G237A / A330S / P331S substitutions. The two obtained vectors were co-transfected into CHO cell lines. Antibodies were produced in CHO medium using an established pool of cells. The antibodies were subsequently purified using Protein A. The heavy and light chain sequences used to model the chimeric Fab version of 3C12 having a human IgG1 constant region, including the Fc domain containing the L234A / L235E / G237A / A330S / P331S substitution (maintaining N297-linked glycosylation), were as follows:

[0277] HP Fab heavy print (variable domain underlined)

[0278]

[0279] LP Fab light chain (variable domain underlined)

[0280]

[0281] H0 Fab heavy chain (variable domain underlined)

[0282]

[0283] L0 Fab light chain (variable domain underlined)

[0284]

[0285] The sequences of the heavy chain variable region and light chain variable region of the HPLP parent antibody are presented below:

[0286] HP VH

[0287]

[0288] LP VL

[0289]

[0290] Reprint design

[0291] To investigate whether residue I2 (also position 2 according to Kavat numbering) forms a hydrophobic bond with CDR_H3-Y109 and plays a role in CDR_H3 positioning or flexibility, the valine residue at position 2 was substituted with isoleucine. The V2 and I2 side chains do not match in the two models. V2 also forms a hydrophobic bond with H0-Y109 (Kavat Y108), but the Y109 position is slightly modified, and H0-Y109 forms an h-bond with LC-Y55 (Kavat Y54). Y55 is the CDR_L2 residue. The V2 substitution may affect the positions of both CDR_H3 and CDR_L2.

[0292] To investigate whether residues at positions 28 and 30 (skeleton 1, also positions 28 and 30 according to kavat) affect binding to the antigen, these positions were substituted with alanine. The parent antibody has the sequence YAFA compared to the YTFT of the H0L0 antibody. Residues A28 and A30 are exposed on the molecular surface near the paratop. Threonine at position 28 appears likely to have a negative effect on binding to the antigen. On the other hand, A30 did not appear to be dangerous.

[0293] To investigate whether the residue at position 44 (also known as kavat 44) plays a role at the VH / VL interface, this residue was reverse-mutated to preserve the serine present in the parent antibody. The parent antibody has the sequence GKS compared to the GQR of the H0L0 antibody. R44 is located at the VH / VL interface very close to the L45 side chain.

[0294] To investigate whether the residue at position 48 (also kavat 48) is important, this residue was reverse-mutated to preserve the residue present in the parent antibody. The parent antibody has the sequence WIG compared to WMG of the H0L0 antibody. I48 and M48 appear to occupy a critical position immediately below CDR_H2 and are involved in the complex hydrophobic network.

[0295] To investigate the importance of residues at positions 67 (Kavat position 66) and 68 (Kavat position 67), these residues were reverse-mutated to preserve the residues present in the parent antibody. The parent antibody has the sequence KAT compared to RVT in the H0L0 antibody. The loop between F64 (Kavat F63) and K67 / R67 (Kavat K66 / R66) exhibits very different forms in the two models. A68 (Kavat 67) is a vernier residue.

[0296] To investigate the role of the residue at Abnum position 70 (kabat position 69), this residue was reverse-mutated to preserve the leucine present in the parent antibody. The parent antibody has the sequence TLT compared to the TIT of the H0L0 antibody. L70 and I70 (kabats L69 and I69) are involved in the complex hydrophobic network.

[0297] To investigate the role of the residue at position 72 (Kavat 71), this residue was reverse-mutated to preserve the serine present in the parent antibody. The parent antibody has the sequence TVD compared to the TRD of the H0L0 antibody. V72 and R72 (Kavat V71 and R71) occupy the critical position immediately below CDR_H2. The terminal hydrophilic side chain of residue V72 is projected onto the molecular surface and forms an h-bond with N55 (Kavat N54). N55 occupies the same position in both models. However, the h-bond with R72 (Kavat R71) can reduce the flexibility of the corresponding loop. Consequently, the effect of replacing parental valine with arginine at H0L0 on antigen binding cannot be predicted.

[0298] To investigate whether the residue at position 74 (kabat 73) affects binding to the antigen, this residue was reverse-mutated to preserve the serine present in the parent antibody. The parent antibody has the sequence DKS compared to DTS in the H0L0 antibody. K74 and T74 (kabat K73 and T73) are exposed on the molecular surface near the paratop, and they may be involved in antigen binding.

[0299] The first heavy chain variant (H1) having the amino acid sequence presented in SEQ ID NO: 29 had V2I and T73K substitutions. The second heavy chain variant (H2) having the amino acid sequence presented in SEQ ID NO: 30 had V2I, T28A, R71V, and T73K substitutions. The third heavy chain variant (H3) having the amino acid sequence presented in SEQ ID NO: 31 had the substitutions V2I, T28A, M48I, R66K, V67A, R71V, and T73K. The fourth heavy chain variant (H4) having the amino acid sequence presented in SEQ ID NO: 32 had the substitutions V2I, T28A, T30A, M48I, R66K, V67A, I69L, R71V, and T73K. The numbering of substitutions follows the kavat.

[0300] Light chain design

[0301] The parent antibody has the sequence DVVM compared to DIQM of the H0L0 antibody. Residue V2 forms a hydrophobic bond with A25. Residue I2 may be exposed on the paratop surface, but its effect on the paratop tissue cannot be predicted. I2 does not form a hydrophobic bond with A25, which may slightly alter the position of CDR-L1. Therefore, the isoleucine of residue 2 was substituted with valine.

[0302] The parent antibody has the sequence PDR compared to PSR in the H0L0 antibody. Residue R61 occupies the rotamer position. The loops are oriented in the same way but do not overlap (lateral translation corresponding to the overall translation of the entire domain). In the parent antibody, D60 forms salt cross-linking and h-bonds with CDR-L2-R54. In the H0L0 antibody, residue S60 does not contact R54. R54 occupies the rotamer position. Contact with D60 may be important for conferring a specific and suitable position to the CDR-L2 residue. Therefore, in the H0L0 antibody, the aspartate residue at position 60 was substituted with serine.

[0303] The parent antibody has the sequence GYG compared to GSG in the H0L0 antibody. To investigate whether residue Y67 contributes to paratop, serine in the H0L0 antibody was replaced with tyrosine.

[0304] The parent antibody has the sequence YFC compared to YYC in the H0L0 antibody. Y87 does not appear to form h-bonds with adjacent residues, but the role of these residues should be investigated, and the tyrosine at position 87 in H0L0 has been substituted with phenylalanine.

[0305] The first light chain variant (L1) having the amino acid sequence of SEQ ID NO: 33 had the S67Y substitution. The second light chain variant (L2) having the amino acid sequence of SEQ ID NO: 34 had the S60D and S67Y substitutions. The third light chain variant (L3) having the amino acid sequence presented in SEQ ID NO: 35 had the substitutions I2V, S60D, and S67Y. The fourth light chain variant (L4) having the amino acid sequence presented in SEQ ID NO: 36 had the substitutions I2V, S60D, S67Y, and Y87F.

[0306] The amino acid sequences of the variable regions of the heavy chain ("H:" in Table 1) and light chain ("L" in Table 1) are presented in Table 1 below.

[0307] Table 1

[0308]

[0309] Antibodies with heavy and light chain combinations presented in Table 2 below were produced.

[0310] Table 2

[0311]

[0312] Example 2: Binding to soluble CD73 protein by SPR

[0313] The antibodies of Table 2 in Example 1 were tested for binding to human soluble dimeric CD73 protein, cloned, produced, and purified. The affinity and binding and dissociation constants of the humanized variants were evaluated by SPR analysis. Table 3 summarizes all calculated constants.

[0314] The H0L0 antibody, possessing the fully human IGHV1-3*01 and IGHJ4*01 heavy chain backbones and the fully human IGKV1-33*01 and IGKJ2*01 light chain backbones, resulted in a KD of 65 nM. As shown in Table 3, the humanized variants HxL0 (H1L0, H2L0, H3L0, and H4L0) exhibited binding constants equivalent to other variants but had faster dissociation profiles. Consequently, the KD of the HxL0 variants was higher than that observed for all other variants (Table 3). Thus, the introduction of the full human IGKV1-33*01 and IGKJ2*01 light chain amino acid sequences in the humanized variants appears to be detrimental to the affinity of the humanized antibody for CD73.

[0315] However, all other humanized variants had affinities for CD73 similar to the chimeric parent 3C12 antibody (0.68 nM). In particular, all heavy chains containing the heavy chain backbones of the fully human non-variant IGHV1-3*01 and IGHJ4*01 provided high affinity binding to CD73.

[0316] Table 3

[0317]

[0318] Example 3: Binding to cells expressing human CD73 by flow cytometry

[0319] The binding of the humanized antibodies in Table 2 was tested for binding to CD73-expressing cells by flow cytometry. Fig. 1As shown in [figure], all tested antibodies recognized the human CD73 protein. Binding efficacy for huCD73 was similar between the humanized variants and the chimeric format, except for H0L0, H2L0, and H3L0, which were less efficient than the parent antibody. These observations follow SPR data showing lower affinity for the HxL0 variants (H1L0, H2L0, H3L0, and H4L0). Consequently, all heavy chains containing the unmodified full human IGHV1-3*01 and IGHJ4*01 heavy chain backbones provided excellent binding to CD73-expressing cells comparable to the parent antibody.

[0320] Example 4: In vitro enzyme assay using recombinant soluble human CD73 protein

[0321] The efficacy of a humanized variant inhibiting the enzymatic activity of recombinant CD73 protein was compared with the parent antibody ( Fig. 2 ).

[0322] As shown in Fig. 2 (Panel A), a high level of luminescence was measured when ATP and CTG substrates were mixed. When AMP was added to the reaction mixture, the CTG reaction was inhibited and luminescence decreased. In the presence of the rhCD73 protein, which hydrolyzes AMP, the luminescence level was restored. Blocking of CD73 enzyme activity by the humanized variant is shown in Fig. 2.

[0323] The results showed that, with the exception of the L0 variant (H0L0, H1L0, H2L0, H3L0, and H4L0) which had reduced activity compared to the parent antibody, all humanized variants exhibited strong inhibition of the enzymatic activity of soluble CD73 protein. However, surprisingly, for most antibodies, the efficacy was somewhat lower than that of the parent antibody. Only H1L4 and all H4 variants blocked enzyme activity with efficacy similar to the parent antibody.

[0324] These experiments showed that, independently of the number of reverse mutations on the heavy chain, the absence of mutations on the light chain when using the IGKV1-33*01 and IGKJ2*01 sequences as the recipient backbone resulted in a significant reduction in the ability to inhibit the activity of soluble CD73 protein.

[0325] Optimal efficacy of blocking CD73 protein activity was achieved using H1L4 and H4Lx variants other than H4L0 (i.e., H4L1, H4L2, H4L3, and H4L4).

[0326] Example 5: T cell proliferation assay

[0327] Two series of experiments were conducted to determine the concentration of AMP capable of inhibiting T cell proliferation, the concentration that induces a high inhibitory effect, and the concentration that allows for the recovery of proliferation in the presence of the mother 3C12 antibody. The enriched lymphocyte fraction was incubated for 3 days in the presence of anti-CD3 / anti-CD28 beads and a dosage range of AMP (50 μM to 1.6 mM to 50 μM). The best percentages of recovery of CD4+ and CD8+ T cells were observed in the two series of experiments at AMP concentrations of 0.2 to 0.8 mM and 0.2 to 1 mM, respectively.

[0328] The ability of the humanized variant and the parent antibody was evaluated in two series of experiments comparing the ability to restore T cell proliferation inhibited by 0.8 mM AMP.

[0329] Fig. 3 As shown in [figure], with the exception of the HxL0 variant, the chimeric and humanized antibodies were able to restore T cell proliferation (for both CD4+ and CD8+ subgroups). Despite their ability to restore proliferation, the efficacy of most humanized variants was lower compared to the parent antibody. Although the H0L4, H1L4, and H4L4 variants did not achieve the full efficacy of the parent antibody, they demonstrated a similar level of efficacy.

[0330] Experiment 2 was conducted under identical experimental conditions, except that the L0 variant was replaced with an isotype control. The results Fig. 4 Presents in.

[0331] Except for the HxL0 variant, similar to that shown in Figure 3, the chimeric and humanized antibodies were able to restore T cell proliferation (for both CD4+ and CD8+ subgroups). However, despite their ability to restore proliferation, the efficacy of most humanized variants was somewhat lower compared to the parent antibody. The H0L4, H1L4, and H4L4 variants approached the efficiency of the parent antibody the most.

[0332] Example 6: Design of a new skeleton and CDR variant

[0333] Surprisingly, the above examples showed no direct correlation between flow cytometry titration and efficacy in inhibiting the enzymatic activity of CD73. Interestingly, while H1, H2, H3, and H4 variants were essentially indistinguishable based on binding affinity to the recombinant CD73 protein in SPR assays and flow cytometry on CD73-expressing cells, H2 and H3 variants were less potent than the H4 variant in the functional assay for the ability to restore T cell proliferation in Example 5. One possibility is that mutations introduced into the H2 and H3 backbones, which were detrimental to efficacy in inhibiting CD73 (but not detrimental to binding affinity to CD73), were compensated for by mutations introduced into the H4 variant backbone. Consequently, new variants with substitutions in the heavy chain backbone and / or CDR residues were designed. Based on these observations, substitutions in the H2, H3, and H4 chains were classified into residues considered important for function, residues that do not affect function, residues that have a negative effect on function, and residues that restore function.

[0334] A new heavy chain variant designated as "H4+" having the amino acid sequence presented below (sequence 37; bolded, amino acid substitution of Kavat CDR) was designed and combined with L1, L2, L3, and L4 light chains (of sequences 33, 34, 35, and 36, respectively) to produce four new antibodies, H4+L1, H4+L2, H4+L3, and H4+L4.

[0335] H4+ VH:

[0336]

[0337] The amino acid sequence of the entire H4+ heavy chain containing the human IgG1 Fc domain with L234A / L235E / G237A / A330S / P331S substitutions is presented below:

[0338]

[0339] The H4+L1 antibody contained an L1 light chain including a human Ckappa domain, and its full sequence is shown below:

[0340]

[0341] To investigate how the same backbone substitution affects antibodies that differ in their heavy and light chain CDRs, a series of four additional antibodies were produced with a common heavy chain and one of four different light chains. The common heavy chain designated "2H4+" had glutamine at kavat position 59 (Q59) in HCDR2 (i.e., L59Q substitution compared to the H4+ chain), lysine at kavat residue 60 (K60) in HCDR2 (i.e., T60K substitution compared to the H4+ chain), and asparagine at kavat position 97 (N97) in HCDR3 (i.e., G97N substitution compared to the H4+ chain). The four light chains designated as 2L1, 2L2, 2L3, and 2L4 each had the same backbone residues as the L1, L2, L3, and L4 chains, and their CDRs differed from the L1-L4 chains due to the presence of threonine at kavat position 30 (T30) in LCDR1 (i.e., S30T substitution compared to the L1-L4 chains) and asparagine at kavat residue 53 (N53) in LCDR2 (i.e., T53N substitution compared to the L1-L4 chains). The four new antibodies generated were named 2H4+2L1, 2H4+2L2, 2H4+2L3, and 2H4+2L4 (see Table 4). Parent antibodies sharing the CDR in the murine backbone were produced with heavy and light chain variable regions designated as 2HP and 2LP (amino acid sequences shown in Table 5 below).

[0342] As in Example 1, all antibodies were produced as human IgG1 isotypes having L234A / L235E / G237A / A330S / P331S substitutions that reduce Fc receptor binding.

[0343] Table 4

[0344]

[0345] Table 5

[0346]

[0347] The amino acid sequence of the entire 2H4+ heavy chain containing the human IgG1 Fc domain with L234A / L235E / G237A / A330S / P331S substitutions is presented below:

[0348]

[0349] The amino acid sequence of the entire 2L1 light chain of an antibody containing a human Ckappa domain is presented below:

[0350]

[0351] Example 7: Study of novel variants in an in vitro enzyme assay using recombinant CD73 protein

[0352] Using the method described in Example 4, the efficacy of humanized variants inhibiting the enzymatic activity of recombinant CD73 protein was compared with that of the parent antibody. All novel humanized variants produced in Example 6 strongly inhibited the activity of CD73 protein.

[0353] The H4+Lx antibodies were as effective as their parent counterparts. In addition, all 2H4+2Lx variants (2H4+L1, 2H4+L2, 2H4+L3, and 2H4+L4) showed increased efficacy in CD73 inhibition compared to the H4+Lx variants. The 2H4+2Lx variants inhibited CD73 activity with efficacy similar to that of the parent 2HP2LP antibody.

[0354] Further experiments were performed using different concentrations of CD73 protein (50, 100, 200, 400 ng / mL). The purpose of these experiments was to investigate the ability of humanized antibodies to block the activity of large amounts of CD73 protein. Again, the 2H4+2Lx variant was as potent as the parent 2HP2LP antibody.

[0355] Example 8: Study of a novel variant for the efficacy of cyanomorphic acid on CD73 protein

[0356] Experiments on recombinant rec cyCD73 protein were performed with 2H1Lx and 2H4+2Lx variants. The experimental conditions were the same as those for experiments on human protein, except for the concentration of the cyCD73 protein used (400 ng / mL).

[0357] The efficacy of the humanized variant in blocking the enzymatic activity of the cyCD73 protein was identical to that of the parent (chimeric) antibody's enzyme.

[0358] Example 9: Study of a novel variant in a T cell proliferation assay

[0359] Humanized variants of different antibodies were tested for their ability to restore T cell proliferation inhibited by AMP.

[0360] Fig. 5A indicates the inhibitory effect of AMP on T cell proliferation. All humanized variants potently blocked the inhibitory effect of AMP on T cell proliferation ( Figs. 5B and C Most humanized variants generally appear to be as effective as their chimeric parent counterparts in reversing AMP-mediated T cell suppression, but the 2H4+2Lx variants were the most potent of all variants, and surprisingly, they were much more potent than the parent 2HP2LP antibody in blocking the inhibitory effect of AMP.

[0361] Example 10: Comparative study of novel variants in T cell proliferation assays in two human donors

[0362] Based on previously obtained results, the 2H4 + 2Lx humanized variant was further characterized in a series of additional T cell proliferation experiments.

[0363] Fig. 6A and 6BFigures 6 and 6 represent the results obtained from T cell proliferation assays using cells from two healthy donors, respectively. As previously observed, the 2H4+2Lx variants were more potent than the parent 2HP2LP in restoring T cell proliferation (Figures 6A and B, right panel). No clear difference was observed between the different 2H4+2Lx variants. Therefore, once again, the 2H4+2Lx variants were more potent than the parent 2HP2LP antibody in blocking the inhibitory effect of AMP.

[0364] In summary, the results obtained from the T cell proliferation assay indicate that the humanized variants with H4+ and H4+ chain backbones are the most potent antibody variants, and that the 2H4+2Lx variant has the greatest efficacy among all antibodies.

[0365] Example 11: Study of a novel variant in an allogeneic mixed lymphocyte reaction (MLR) assay

[0366] The 2H4+2Lx antibody variant was tested in allogeneic MLR to confirm the previously obtained results in the T cell proliferation assay. 2 pieces Regarding human donor samples Fig. 7 As shown in [figure], T cell proliferation was inhibited by adding 100 μM of ATP (which is broken down into ADP and AMP by CD39).

[0367] As shown in the left panel of Fig. 7, T cell proliferation was inhibited by the addition of ATP. T cell proliferation was restored in the presence of the anti-CD73 antibody (middle and right panels). All 2H4+2Lx humanized variants were able to restore T cell proliferation with efficacy comparable to or superior to that of the parent 2HP2LP antibody. All 2H4+2Lx variants were more potent than the parent 2HP2LP in restoring T cell proliferation in these settings. These results were consistent with those obtained from a T cell proliferation assay using AMP as an inhibitor.

[0368] In summary, substitutions introduced into the H4+ and 2H4+ variable regions, along with substitutions introduced into the L1 and 2L1 chains (and L2, L3, L4, 2L2, 2L3, 2L4 chains), appear to restore (and even improve) the important functional properties of their parent murine antibodies, but possess a human backbone region and therefore have a lower risk of immunogenicity in humans. The 2H4+2Lx antibody is the most potent.

[0369] One possible explanation for the surprising finding that binding affinity for CD73 was not directly correlated with efficacy in the functional inhibition of CD73 activity may be related to the fact that these antibodies bind to CD73 and act as allosteric inhibitors. Antibodies bind to CD73 via intradimer binding with a 1:1 stoichiometry between the intact full-length antibody and the CD73 dimer. Previous structural studies of CD73 have shown that enzymatic activity requires extensive N-terminal domain rotation that defines the enzyme's open (inactive) and closed (active, substrate-bound) states (Knapp et al., 2012 Structure 20(12):2161-73). Based on the crystal structure of the parent anti-CD73 F(ab) complexed with the ectodomain of CD73, and considering the 1:1 stoichiometry between the intact antibody and the CD73 dimer, steric hindrance is expected to make it difficult for the intact antibody to bind to the open isoform of CD73. Instead, the intact antibody restricts CD73 in an intermediate state where AMP cannot be hydrolyzed. Therefore, since CD73 is bound by the antibody while in an energetically unstable form, small changes in the rigidity of the antibody structure here can affect the antibody's ability to adapt to changing forms of the CD73 dimer. Therefore, these changes may affect the ability of antibodies to inhibit CD73 activity in the presence of a substrate. However, these small changes in the antibody structure will not be observed in other binding assays performed additionally in the absence of SPR or substrates. The heavy and light chain variable regions described herein appear capable of capturing (and even improving) the entire CD73 interaction kinetics of the parent antibody while incorporating the human backbone.

[0370] All referenced literature, including publications, patent applications, and patents cited herein, is incorporated herein by reference in its entirety (to the maximum extent permitted by law), regardless of the incorporation of any specific document provided separately elsewhere in this specification. Each referenced literature is individually and specifically indicated to be incorporated by reference and is described in its entirety in this specification.

[0371] The use of the terms “one,” “one,” “he,” and similar references shall be interpreted to encompass both the singular and plural forms unless otherwise indicated herein or explicitly contradicted by the context.

[0372] Unless otherwise specified, all exact values ​​provided herein represent corresponding approximations (for example, all exact exemplary values ​​provided for a particular factor or measurement may also be considered to provide corresponding approximations, modified to “approximately” where appropriate).

[0373] Descriptions of any aspect or embodiment in this specification that use terms such as “comprising,” “having,” “comprising,” or “containing” in relation to an element or elements are intended to provide support for similar aspects or embodiments in this specification that are “consisted of,” “essentially composed of,” or “comprising” a specific element or elements, unless otherwise stated or clearly contradicted by the context (for example, a composition described in this specification as comprising a specific enzyme should be understood as also describing a composition comprising that element, unless otherwise stated or clearly contradicted by the context).

[0374] Any use of any example or exemplary language provided in this specification (e.g., “e.g., for example”) is intended merely to better illustrate the invention and does not imply any limitation of the scope of the invention unless otherwise claimed. No language in the specification should be interpreted as implying any non-claimed element is essential to the practice of the invention.

Claims

Claim 1 An antibody or antibody fragment capable of specifically binding to a human CD73 polypeptide, wherein the antibody or antibody fragment comprises a heavy chain variable region (VH) comprising the amino acid sequence of SEQ ID NO: 42 (2H4+ chain), and a light chain variable region (VL) comprising the amino acid sequence selected from the group consisting of SEQ ID NOS: 43 (2L1 chain), 44 (2L2 chain), 45 (2L3 chain) and 46 (2L4 chain). Claim 2 The antibody or antibody fragment of claim 1, wherein the antibody or antibody fragment comprises a heavy chain variable region (VH) comprising the amino acid sequence of SEQ ID NO: 42 (2H4+ chain), and a light chain variable region (VL) comprising the amino acid sequence of SEQ ID NO: 43 (2L1 chain). Claim 3 The antibody or antibody fragment of claim 1, wherein the antibody or antibody fragment comprises a heavy chain having the amino acid sequence of SEQ ID NO: 47 and a light chain having the amino acid sequence of SEQ ID NO:

48. Claim 4 In claim 1, the antibody or antibody fragment is an antibody or antibody fragment capable of neutralizing the 5'-ectonucleotidase activity of CD73 polypeptide. Claim 5 The antibody or antibody fragment of claim 1, wherein the antibody or antibody fragment comprises a heavy chain variable region (VH) comprising the amino acid sequence of SEQ ID NO: 42, and a light chain variable region (VL) comprising the amino acid sequence of SEQ ID NO:

43. Claim 6 An antibody or antibody fragment, wherein VH comprises the backbone FR1, FR2, and FR3 amino acid sequences from the human IGHV1-3 gene, and VL comprises the backbone FR1, FR2, and FR3 amino acid sequences from the human IGKV1-33 gene. Claim 7 An antibody or antibody fragment, wherein VH comprises CDR1, CDR2, and CDR3 having the respective amino acid sequences presented in SEQ ID NOS: 2, 12, and 13; and VL comprises CDR1, CDR2, and CDR3 having the respective amino acid sequences presented in SEQ ID NOS: 14, 15, and 7. Claim 8 In claim 5, VH is an antibody or antibody fragment comprising an isoleucine residue at kavat position 2, alanine at position 30, isoleucine at position 48, leucine at position 69, and lysine at position 73. Claim 9 In claim 5, the amino acid at position 67 of the carbat VL is tyrosine, an antibody or antibody fragment. Claim 10 A pharmaceutical composition for use in the treatment of cancer or infectious diseases, comprising an antibody or antibody fragment according to any one of claims 1 to 9, and a pharmaceutically acceptable carrier. Claim 11 A nucleic acid or set of nucleic acids encoding VH and / or VL of an antibody or antibody fragment according to any one of claims 1 to 9. Claim 12 A pharmaceutical composition according to claim 10, wherein the cancer is leukemia, bladder cancer, glioma, glioblastoma, ovarian cancer, melanoma, prostate cancer, thyroid cancer, stomach cancer, esophageal cancer, pancreatic cancer, or breast cancer. Claim 13 delete Claim 14 delete Claim 15 delete Claim 16 delete Claim 17 delete Claim 18 delete Claim 19 delete Claim 20 delete Claim 21 delete Claim 22 delete Claim 23 delete Claim 24 delete Claim 25 delete Claim 26 delete Claim 27 delete Claim 28 delete Claim 29 delete Claim 30 delete Claim 31 delete Claim 32 delete Claim 33 delete Claim 34 delete Claim 35 delete Claim 36 delete Claim 37 delete Claim 38 delete Claim 39 delete Claim 40 delete Claim 41 delete Claim 42 delete

Images