Novel fungus Talaromyces pauper and use thereof
Patent Information
- Application Number
- KR1020240027790
- Authority / Receiving Office
- KR · KR
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2024-02-27
- Publication Date
- 2026-09-21
- Estimated Expiration
- 2044-02-27
Smart Images

Figure 112024022276380-PAT00001_ABST
Abstract
Description
Technology Field
[0001] The present invention relates to a novel strain of Thalaromyces puffer and its uses. Background Technology
[0002] Various microorganisms, such as bacteria, fungi, yeast, and algae, exist in nature, and research utilizing them is ongoing. The fields of application for microorganisms are very diverse, including, most notably, therapeutic agents in the medical field, health functional foods in the food industry, and cosmetic compositions in the beauty industry.
[0003] Although hundreds of thousands of species of microorganisms have been discovered and reported to date, new strains continue to be reported, and the discovery of new strains can lead to the invention of new uses utilizing them. For example, Lactobacillus, a lactic acid bacterium, is a representative microorganism utilized in various fields. Its uses are very diverse, such as being used in animal feed in Korean registered patent No. 10-1795499 and as an obesity treatment in Korean registered patent No. 10-1736033.
[0004] Among these, freshwater fungi play an important role in the ecological environment and provide nutrients to other aquatic organisms. They are known as a natural source of secondary metabolites with diverse structures and promising biological activities, and it is estimated that there are more than 1.5 million species on Earth. However, freshwater fungi, particularly the genus Talaromyces, have rarely been reported in Korea.
[0005] Oxidative stress caused by reactive oxygen species (ROS) poses a major threat to healthy tissue cells. ROS are a group of oxygen-containing free radicals and peroxygen compounds that are essential for maintaining the body's normal physiological functions. When ROS are overproduced, the balance of oxidation and antioxidant systems is disrupted, which can damage healthy tissue cells. Consequently, ROS and the resulting oxidative stress are not only associated with various chronic metabolic diseases, including diabetes, heart disease, and neurological disorders; furthermore, high ROS levels can accelerate skin aging and cause melanocyte proliferation and pigmentation.
[0006] The present invention is intended to utilize the bioactivity of fungi inhabiting Korean soil, and to identify the function of a newly discovered species of Thalaromyces inhabiting Korean soil. The problem to be solved
[0007] The present invention aims to provide a microbial composition comprising a novel strain of Talaromyces puffere isolated from soil and a substance derived from said strain, and a pharmaceutical composition, cosmetic composition, etc., comprising said strain having antibacterial, anti-inflammatory, or antioxidant effects. means of solving the problem
[0008] The present disclosure covers Thalaromyces puffer ( Talaromyces pauper ) Provides CNUFC CY2212 (Deposit No.: KCTC15802BP).
[0009] The present disclosure provides a microbial composition comprising, as an active ingredient, one or more selected from the group consisting of Talaromyces puffer according to one embodiment of the present disclosure, a culture medium of the strain, and a culture filtrate of the strain.
[0010] The present disclosure provides a pharmaceutical composition for antibacterial, anti-inflammatory, or antioxidant purposes comprising a microbial composition according to one embodiment of the present disclosure.
[0011] The above pharmaceutical composition may be prepared in a formulation selected from tablets, pills, powders, granules, coated tablets, hard or soft capsules, solutions, suspensions or emulsions, injections, aerosols, topical preparations, suppositories, and sterile injectable solutions.
[0012] The present disclosure provides a health functional food comprising a microbial composition according to one embodiment of the present disclosure.
[0013] The above health functional food may be used for antibacterial, anti-inflammatory, or antioxidant purposes.
[0014] The present disclosure provides a cosmetic composition comprising a microbial composition according to one embodiment of the present disclosure.
[0015] The above cosmetic composition may be used for antibacterial, anti-inflammatory, or antioxidant purposes.
[0016] The above cosmetic composition may be prepared in a formulation selected from the group consisting of solution, topical ointment, cream, foam, nourishing lotion, softening lotion, pack, softening water, emulsion, makeup base, essence, soap, liquid cleanser, bath additive, sunscreen cream, sun oil, suspension, emulsion, paste, gel, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation, patch, and spray.
[0017] The present disclosure provides a feed comprising a microbial composition according to one embodiment of the present disclosure.
[0018] The above feed may be used for antibacterial, anti-inflammatory, or antioxidant purposes. Effects of the invention
[0019] A microbial composition comprising Thalaromyces puffer and a substance derived from said strain according to the present invention can inhibit the production of reactive oxygen species and nitric oxide, and has excellent antibacterial, antioxidant, or anti-inflammatory effects, and can be utilized as a necessary preparation in various fields such as pharmaceuticals, food, and cosmetics. Brief explanation of the drawing
[0020] Figure 1 shows the morphology of Thalaromyces puffer CNUFC CY2212, where a, f: colonies on Czapeck yeast autolysate agar (CYA). b, g: malt extract agar (MEA). c, h: yeast extract sucrose agar (YES). d: oatmeal agar (OA). e: dichloran 18% glycerol agar (DG18). I: CYAS. J: colonies on creatine sucrose agar (CREA). (ae, ij: front view, fh: back view). K: colony texture on DG 18. LO: conidiophores. P: conidia (scale bar: 10 μm). Figure 2 shows the results of the maximum likelihood analysis (ML) through the combination of ITS, BenA, CaM, and RPB2 sequence data of Talaromyces. Branches with a value of 100% ML BS and 1 PP were highlighted as thick branches, while branches with a value of 70% or more ML BS and 95% or more PP were indicated above or below the branches. In this case, Talaromyces dendriticus CBS 660.80 was used as the outgroup. Figure 3 shows the cell viability of RAW 264.7 cells treated with the crude ethyl acetate extract of Thalaromyces puffer. Figure 4 shows the levels of nitric oxide following treatment with ethyl acetate crude extract and lipopolysaccharide (LPS) of Thalaromyces puffer. Figures 5 and 6 show the mean fluorescence intensity (MFI) data of DCF (dihydroethidium) measured using FACSCalibur (Becton, Dickinson and Company, Franklin Lakes, NJ). Figure 7 shows the results regarding the antifungal activity of strain CNUFC CY2212 against the fungal pathogens Botrytis cinerea EML-SBO1 (A) and Colletotrichum gloeosporioides EML-CG001 (B). (C and D are controls for each strain.) Specific details for implementing the invention
[0021] The present invention will be described in detail below with reference to the attached tables or drawings.
[0022] Where drawings are provided, they are provided as examples to ensure that the concept of the present invention is sufficiently conveyed to those skilled in the art. Accordingly, the present invention is not limited to the drawings presented and may be embodied in other forms, and the drawings may be exaggerated to clarify the concept of the present invention.
[0023] Terms such as first, second, etc. may be used to describe various components, but said components should not be limited by said terms. These terms are used solely for the purpose of distinguishing one component from another. For example, without departing from the scope of the present invention, the first component may be named the second component, and similarly, the second component may be named the first component.
[0024] Unless otherwise defined, technical and scientific terms used herein have the meaning commonly understood by those skilled in the art to which this invention pertains, and descriptions of known functions and configurations that could unnecessarily obscure the essence of the invention are omitted in the following description and attached drawings.
[0025] Additionally, the singular form used in the specification of the present invention may be intended to include the plural form unless specifically indicated otherwise in the context.
[0026] Additionally, units used in the specification of the present invention without special mention are based on weight, and for example, units of % or ratio mean weight % or weight ratio.
[0027] Furthermore, in the specification of the present invention, the expression “comprising” is an open description having an equivalent meaning to expressions such as “comprising,” “containing,” “having,” or “characterizing,” and does not exclude elements, materials, or processes not additionally listed. Also, the expression “substantially comprising…” means that other elements, materials, or processes not listed together with the specified elements, materials, or processes may be present in an amount that does not impermissibly affect at least one basic and novel technical concept of the invention. Additionally, the expression “consists of” means that only the described elements, materials, or processes are present.
[0028] In the specification of the present invention, the terms “sample” or “sample” refer to an object for analysis and are used with the same meaning throughout the specification.
[0029] In this specification, the term "included as an active ingredient" means that the extract of this specification is added to an extent capable of producing the effects mentioned above, and includes formulation in various forms by adding various components as auxiliary ingredients for drug delivery and stabilization, etc.
[0030] In the specification of the present invention, the term "anti-inflammatory" may be used interchangeably with "inflammation suppression or improvement" and may refer to any action in which the immune response is alleviated and NO production is suppressed.
[0031] In the specification of the present invention, the term "antimicrobial" may mean any action that reduces, prevents, inhibits, or eliminates the growth or survival of bacteria or fungi.
[0032] The Thalaromyces strains isolated and identified in the present disclosure and their uses are described in detail below.
[0033] The present disclosure provides Talaromyces pauper CNUFC CY2212 (accession number: KCTC15802BP), said strain having excellent antibacterial, antioxidant, and anti-inflammatory effects and can be used as a composition in various fields such as pharmaceuticals, food, and cosmetics.
[0034] Specifically, the strain and the strain-derived substance can inhibit the formation of oxidants, such as nitric oxide (NO), which are overproduced in macrophages as a result of an inflammatory response, thereby preventing cell damage and potentially intervening in pathological processes that cause inflammation and cancer.
[0035] In addition, the strain and strain-derived material can suppress the generation of free radicals that occur as an inflammatory response persists, and can suppress the generation of reactive oxygen species, which are highly reactive and react rapidly with biomolecules to cause lipid oxidation, protein denaturation, DNA damage, etc.
[0036] In addition, the strain and the strain-derived material may have antifungal activity against one or more fungi selected from the group consisting of Botrytis cinerea, Colletotrichum gloeosporioides, Candida albicans, Aspergillus niger, Fusarium oxysporum, Fusarium solani, Fusarium verticillioides, Fusarium semitectum, Alternaria alternata, and Curvularia lunata, but are not limited thereto.
[0037] The present disclosure provides a microbial composition comprising, as an active ingredient, one or more selected from the group consisting of Thalaromyces puffer according to one embodiment of the present disclosure, a culture medium of said strain, and a culture filtrate of said strain. The microbial composition may be prepared in a form used in various fields, such as pharmaceutical compositions, health functional foods, cosmetics, and animal feed, for antibacterial, anti-inflammatory, or antioxidant purposes.
[0038] The “culture medium” of the above-mentioned Talaromyces puffer refers to the entire medium containing the said strain, its metabolites, excess nutrients, etc., obtained by culturing said strain for a certain period in a medium capable of supplying nutrients so that the Talaromyces puffer strain can grow and survive in a test tube.
[0039] In addition, the “culture filtrate” of the above-mentioned Thalaromyces puffere is a concept that includes the supernatant from which the strain has been removed after culture, as well as their extracts and fractions. The liquid from which the bacterial cells have been removed in the culture medium is also referred to as the “supernatant” or “cell-free supernatant.” It can be obtained by leaving the culture medium undisturbed for a certain period of time to obtain only the liquid from the upper layer excluding the portion that has settled at the bottom, by removing the bacterial cells through filtration, or by centrifuging the culture medium to remove the sediment at the bottom and obtaining only the liquid from the top. The above-mentioned known filtration methods are not limited to these, but may include, for example, filtration using a filter mesh or microfilter, centrifugation, or filtration using a separatory funnel.
[0040] According to one embodiment, the present disclosure provides a pharmaceutical composition for antibacterial, anti-inflammatory, or antioxidant purposes comprising a microbial composition according to one embodiment of the present disclosure.
[0041] The pharmaceutical composition of the present disclosure has excellent antibacterial, anti-inflammatory, or antioxidant effects and can be applied to diseases related to oxidative stress. Pathological conditions of oxidative stress-related cells may include, but are not limited to, mitochondrial dysfunction, lysosome and proteasome dysfunction, oxidation of nucleic acids (e.g., RNA and DNA), initiation of apoptosis, lipid peroxideization, and disruption of the membrane lipid environment.
[0042] Diseases to which the pharmaceutical composition of the present disclosure can be applied include diseases selected from the group consisting of stroke, myocardial infarction, diabetic vascular disorder, hyperlipidemia, diabetes, epilepsy, Parkinson's disease, and dementia, as well as inflammatory diseases such as arthritis, rhinitis, hepatitis, keratitis, gastritis, enteritis, nephritis, bronchitis, pleuritis, peritonitis, spondylitis, pancreatitis, inflammatory pain, dermatitis, and inflammatory pain, but are not limited thereto, and the pharmaceutical composition according to the present invention can be used to alleviate diseases or symptoms caused by reactive oxygen species.
[0043] The pharmaceutical composition of the present disclosure may have antimicrobial activity against one or more plant pathogenic microorganisms selected from Botrytis cinerea, Colletotrichum gloeosporioides, Fusarium oxysporum, Pythium ultimum, Rhizoctonia solani, and Sclerotinia sclerotiorum, but is not limited thereto.
[0044] In addition to containing the active ingredient, the pharmaceutical composition of the present disclosure may further include suitable carriers, excipients, and diluents commonly used in pharmaceutical compositions.
[0045] Carriers, excipients, and diluents that may be included in the above pharmaceutical composition are, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. When formulating the above composition, it may be prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.
[0046] The pharmaceutical composition of the present disclosure may be formulated into various forms according to conventional methods and used. Suitable formulations include oral formulations such as tablets, pills, powders, granules, coated tablets, hard or soft capsules, solutions, suspensions or emulsions, injections, and aerosols, among which granules and powder pellets are most preferred. Other formulations include topical preparations, suppositories, and sterile injectable solutions, but are not limited thereto.
[0047] The above pharmaceutical composition may be prepared into a suitable formulation using a pharmaceutically inert organic or inorganic carrier. That is, if the formulation is a tablet, coated tablet, sugar-coated tablet, or hard capsule, it may include lactose, sucrose, starch or its derivatives, talc, calcium carbonate, gelatin, stearic acid, or its salt. Additionally, if the formulation is a soft capsule, it may include vegetable oil, wax, fat, semi-solid and liquid polyols. Furthermore, if the formulation is in the form of a solution or syrup, it may include water, polyol, glycerol, and vegetable oil, etc.
[0048] The pharmaceutical composition of the present disclosure may further include, in addition to the carriers mentioned above, preservatives, stabilizers, wetting agents, emulsifiers, solvents, sweeteners, coloring agents, osmotic pressure regulators, antioxidants, etc.
[0049] The pharmaceutical composition of the present disclosure may be administered to mammals such as rats, mice, livestock, and humans by various routes, such as oral or parenteral, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dura mater, or intracerebrovascular injection. Preferably, it may be administered by oral administration via feeding.
[0050] In addition, the appropriate dosage of the above pharmaceutical composition may be prescribed in various ways depending on factors such as the formulation method, mode of administration, patient's age, body weight, gender, pathological condition, diet, time of administration, route of administration, excretion rate, and response sensitivity. The dosage of the above pharmaceutical composition is within the range of 0.001 to 100 mg / kg for adults. Furthermore, in the case of a topical preparation, it is preferable to apply an amount of 1.0 to 3.0 ml once to five times a day for adults and continue for at least one month. However, the above dosage does not limit the scope of the present invention.
[0051] The present disclosure provides a health functional food comprising a microbial composition according to one embodiment of the present disclosure.
[0052] According to one embodiment, the health functional food may be used for antibacterial, anti-inflammatory, or antioxidant purposes.
[0053] The terms “food” or “food composition” in the present disclosure include meat, sausage, bread, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, vitamin complexes, health functional foods, and health foods, and include all foods in the ordinary sense.
[0054] The above-mentioned health functional food is synonymous with food for special health use (FosHU) and refers to a food with high medical or therapeutic effects that is processed to efficiently exhibit bio-regulatory functions in addition to providing nutrition. Here, "functionality" means obtaining useful effects for health purposes, such as regulating nutrients or physiological actions regarding the structure and function of the human body. The food of the present invention can be manufactured by methods commonly used in the industry, and during such manufacturing, raw materials and ingredients commonly added in the industry may be added. Furthermore, the formulation of the food may be manufactured without restriction as long as it is a formulation recognized as a food, and the health functional food according to the present invention may be in the form of powder, granules, tablets, capsules, or beverages.
[0055] The aforementioned health food refers to a food that has active effects on maintaining or promoting health compared to general food, and health supplement food refers to a food intended for the purpose of supporting health. In some cases, the terms health functional food, health food, and health supplement food are used interchangeably.
[0056] The above food composition may further include a physiologically acceptable carrier, the type of carrier is not particularly limited, and any carrier commonly used in the relevant technical field may be used.
[0057] In addition, the above food composition may include additional ingredients that are commonly used in food compositions to improve odor, taste, visual appearance, etc. For example, it may include vitamins A, C, D, E, B1, B2, B6, B12, niacin, biotin, folate, pantothenic acid, etc. In addition, it may include minerals such as zinc (Zn), iron (Fe), calcium (Ca), chromium (Cr), magnesium (Mg), manganese (Mn), copper (Cu), chromium (Cr), and rubidium (Rb). In addition, it may include amino acids such as lysine, tryptophan, cysteine, and valine.
[0058] In addition, the above food composition may include food additives such as preservatives (potassium sorbate, sodium benzoate, salicylic acid, sodium dehydroacetate, etc.), disinfectants (bleaching powder and high-grade bleaching powder, sodium hypochlorite, etc.), antioxidants (butylhydroxyanisole (BHA), butylhydroxytoluene (BHT), etc.), coloring agents (tar dyes, etc.), colorants (sodium nitrite, sodium nitrite, etc.), bleaching agents (sodium sulfite), seasonings (MSG, etc.), sweeteners (dulcin, cyclamate, saccharin, sodium, etc.), flavorings (vanillin, lactones, etc.), leavening agents (alum, potassium hydrogen tartrate, etc.), reinforcing agents, emulsifiers, thickeners (sizing agents), coating agents, gum bases, antifoaming agents, solvents, and improvers. The above additives may be selected according to the type of food and used in appropriate amounts.
[0059] The food composition of the present disclosure may further comprise food-grade acceptable food additives, may be used in combination with other foods or food ingredients, and may be appropriately used according to conventional methods. The mixed amount of the active ingredient may be appropriately determined according to its intended use (prevention, health, or therapeutic treatment).
[0060] The present disclosure provides a cosmetic composition comprising a microbial composition according to one embodiment of the present disclosure.
[0061] According to one embodiment, the cosmetic composition may be used for antibacterial, anti-inflammatory, or antioxidant purposes.
[0062] Specifically, the cosmetic composition of the present disclosure can prevent or inhibit skin aging due to antibacterial, anti-inflammatory, or antioxidant effects.
[0063] In this specification, the term "skin aging" refers collectively to tangible and intangible changes that occur in the skin as one ages, such as, for example, thinning of the epidermis, decrease in the number of cells or blood vessels in the dermis, DNA damage repair ability, cell turnover cycle, wound healing, skin barrier function, maintenance of moisture in the epidermis, sweat secretion, sebum secretion, vitamin D production, defense against physical damage, ability to remove chemical substances, immune response, sensory function, and thermoregulation. Additionally, the aging may be aging caused by reactive oxygen species.
[0064] A cosmetic composition according to a preferred embodiment of the present disclosure may be prepared in a formulation selected from the group consisting of a solution, topical ointment, cream, foam, nourishing lotion, softening lotion, pack, softening water, emulsion, makeup base, essence, soap, liquid cleanser, bath additive, sunscreen cream, sun oil, suspension, emulsion, paste, gel, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation, patch, and spray, but is not limited thereto.
[0065] In addition, the cosmetic composition of the present disclosure may further include one or more cosmetically acceptable carriers that are incorporated into general skin cosmetics in addition to the functional substances described above, and may appropriately incorporate, for example, oils, water, surfactants, moisturizers, lower alcohols, thickeners, chelating agents, colorants, preservatives, fragrances, etc. as conventional ingredients, but is not limited thereto.
[0066] At this time, the cosmetically acceptable carrier included in the cosmetic composition of the present disclosure may be selected in various ways depending on the formulation of the cosmetic composition. For example, when the formulation of the present invention is an ointment, paste, cream, or gel, animal oil, vegetable oil, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide, etc. may be used as carrier components, but are not limited thereto, and these may be used alone or mixed in two or more types.
[0067] In addition, when the formulation of the present disclosure is a solution or an emulsion, a solvent, a solubilizing agent, or an emulsifying agent may be used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, etc. may be used, and in particular, cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil and sesame oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan may be used, but are not limited thereto, and these may be used alone or in a mixture of two or more types.
[0068] In addition, when the formulation of the above cosmetic composition is a suspension, liquid diluents such as water, ethanol, or propylene glycol, suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, or tracant may be used as carrier components, but are not limited thereto, and these may be used alone or in a mixture of two or more types.
[0069] In addition, when the formulation of the above cosmetic composition is soap, alkali metal salts of fatty acids, fatty acid hemiester salts, fatty acid protein hydrolyzates, isethionates, lanolin derivatives, aliphatic alcohols, vegetable oils, glycerol, sugars, etc. may be used as carrier components, but are not limited thereto, and these may be used alone or mixed in two or more types.
[0070] The present disclosure provides a feed composition comprising a microbial composition according to one embodiment of the present disclosure.
[0071] According to one embodiment, the feed composition may be used for antibacterial, anti-inflammatory, or antioxidant purposes.
[0072] The term “feed” in the present disclosure may mean any natural or artificial prescribed food, meal, etc., or the components of said meal, for or suitable for animals to eat, consume, and digest.
[0073] The feed composition of the present disclosure may include a feed additive. The feed additive of the present invention corresponds to a supplementary feed under the Feed Management Act.
[0074] The above feed composition is not particularly limited in type, and feed commonly used in the relevant technical field may be used. Non-limiting examples of the above feed include plant-based feeds such as grains, root vegetables, food processing by-products, algae, fibers, pharmaceutical by-products, oils and fats, starches, meal or grain by-products; and animal-based feeds such as proteins, inorganic substances, oils and fats, minerals, oils and fats, single-cell proteins, zooplankton, or food waste. These may be used individually or in a mixture of two or more types.
[0075] Accordingly, the microbial composition of the present disclosure can be formulated in various fields such as pharmaceutical compositions, health functional foods, cosmetic compositions, and animal feed, and can be used for the prevention or treatment of various diseases or aging that may be caused by excessive inflammatory responses and the generation of free radicals.
[0076] The contents of the present invention will be explained in more detail below through examples. The examples are intended only to explain the present invention in more detail, and the scope of the rights of the present invention is not limited by them.
[0078] [Example 1] Identification of Fungi
[0079] Example 1-1. Sampling and Isolation for the Identification of a New Fungus
[0080] Soil samples were collected from Gunryang-ri, Cheongyang, Chungnam, South Korea (36°44′00.2″ N 126°78′18.0″ E). The samples were placed in polyethylene bags and stored at room temperature until transport to the laboratory. Subsequently, 1 g of the sample was taken and mixed with 9 mL of sterile distilled water. Then, the mixture was 10 *?*1 from 10 *?*5 Stepwise dilutions were prepared by serially diluting the solution tenfold. For each dilution, 100 μL aliquots were applied to Petri dish plates containing potato glucose agar (PDA; Becton, Dickinson and Co., Sparks, MD) and malt extract agar (MEA; Becton) supplemented with neomycin (50 mg / L). Each plate was incubated at 25°C for 5 to 10 days.
[0081] Subsequently, individual colonies of various types were selected and transferred to PDA plates, and subcultured until a pure culture was obtained to acquire pure isolates.
[0082] Ex-type biological cultures were stored in the Fungalium of the Environmental Microbiology Laboratory (CNUFC) at Chonnam National University.
[0084] Example 1-2. Morphological Analysis
[0085] For detailed morphological studies, the isolated strains were inoculated in a 3-point manner onto Petri dish plates plated with Czapek yeast autolysate agar (CYA), malt extract agar (MEA), yeast extract sucrose agar (YES), oatmeal agar (OA), dichloran 18% glycerol (DG18) agar, CYA supplemented with 5% NaCl (CYAS), and creatine sucrose agar (CREA), respectively.
[0086] Each plate was incubated at 20, 25, 30, and 37°C for 7 days.
[0087] The above-mentioned preparation of the medium, inoculation, and culture were performed according to the method disclosed in the literature of Yilmaz et al.
[0088] The characteristics of each colony were recorded after 7 days.
[0089] After culture, the strain was mounted in a lactic acid solution (Merck, Germany), and excess conidia were removed with 96% ethanol.
[0090] Next, digital images were obtained using an Olympus BX53 microscope equipped with a DIC optical device (Olympus, Tokyo, Japan), and the results are shown in Fig. 1.
[0092] Examples 1-3. Morphological analysis results
[0093] The results of the morphological analysis of Talaromyces pauper (accession number: KCTC15802BP), newly isolated and identified in the present invention, are summarized in Table 1 below.
[0094] Talaromyces pauper: Fungal Index IF900635
[0095] characteristic CNUFC CY2212 (isolated and identified in the present invention) CYA The colony grew from the center, the margins were flat, the mycelium was white, there was no spore formation, no exudate, no soluble pigment, and the inverted center was pale yellow. YES The colonies emerge from the center, have low and flat margins, the mycelium is white, spore formation is absent or rare, there are no soluble pigments or exudates, and the underside is brownish-orange in the center, discolored to light orange near the margins. MEA Colonies are low and flat with low and flat margins; the mycelium is white and yellow, no spore formation, no soluble pigment, no exudate, inverted yellowish-white. OA The colony is slightly raised from the center, the mycelium is white and yellow, the texture is velvety and cohesive, there is no spore formation, no soluble pigments, no exudate, and the underside is colorless. DG18 The colonies do not grow well, are slightly raised in the center, have low and flat margins, and the spores and mycelia are white and green, lacking soluble pigments and containing exudates, with the underside being dark green. CREA Moderate growth, no acid production Size (diameter) after 7 days at a specific temperature 21-24 mm (CYA, 25℃)16-18 mm (CYA, 20℃)21-24 mm (CYA, 30℃)13-15 mm (CYA, 37℃)32-36 mm (MEA, 25℃)20-23 mm (YES, 25℃)26-30 mm (OA, 25℃)13-17 mm (CREA, 25℃)No growth (CYAS, 25℃)7-10 mm (DG18, 25℃) Size (diameter) after 7 days at 25 °C in CYA Not growing Conidiophores (DG18) Biverticillate and monooverticillate Stem (DG18) Short, rough walls, (11-)15-46.5 × 2-3.5 μm Metulae (DG18) 2-4, 9-15.5 × 2-3.5 μm Phialides (DG18) Acerose, 8-15 × 2-3 μm, 3-8 pyalides per meth. Conidia (DG18) Subglobose to broadly ellipsoidal, fusiform 3-5 × 2.5-3.5 μm, Fruiting body (Ascomata) (DG18) Not observed
[0096] Extracellular culture results showed that Thalaromyces pupae exhibited excellent spore formation in CREA and DG18 media, but inferior spore formation in CYA, MEA, YES, and OA media. Additionally, while the shape and size of Phialides and Metulae were similar in DG18 and CREA media, conidia were found to be slightly smaller in CREA media, measuring 2.5-4 × 2-3 μm.
[0098] Examples 1-4. DNA extraction, PCR, and sequencing
[0099] The isolated strains were cultured on PDA covered with cellophane at 25°C for 5-7 days.
[0100] Afterwards, Solg TM Genome DNA was extracted from fungal mycelia using a Genome DNA prep kit (Solgent, Daejeon, Korea) and stored at -20℃.
[0101] Protocols for the gene and amplification region were used in accordance with those disclosed in the following literature, respectively.
[0102] The rRNA ITS(The internal transcribed spacer) regulates the V9G / ITS4 sequence [White TJ, Bruns TD, Lee SB and Taylor JW(1990) Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics. In: Innis, MA, Gelfand, DH, Sninsky, JJ and White TJ, Eds., PCR Protocols: A Guide to Methods and Applications, Academic Press, New York, 315-322; de Hoog GS, Gerrits of the End AH(1998). Molecular diagnostics of clinical strains of filamentous Basidiomycetes. Mycoses, 41(5-6):183-189]
[0103] [Aveskamp MM, Verkley GJM, de Gruyter J, Murace MA, Perello A, Woudenberg JHC, Groenewald [Aveskamp MM, Verkley GJM, de Gruyter J, Murace MA, Perello A, Woudenberg JHC, Groenewald JZ, Crous PW(2009). DNA phylogeny reveals polyphyly of Phoma section Peyronellaeae and multiple taxonomic novelties. Mycologia, 101: 363-382].
[0104] The Calmodulin (CaM) gene was amplified using primer pairs CF1M / CF4 [Peterson SW. (2008). Phylogenetic analysis of Aspergillus species using DNA sequences from four loci. Mycologia, 100: 205-226].
[0105] The primer pair RPB2-5F / RPB2-7cR was used for the amplification of the RPB2 gene region [Liu YJ, Whelen S, Hall BD (1999). Phylogenetic relationships among ascomycetes: evidence from an RNA polymerase II subunit. Mol. Biol. Evol. 16: 1799-1808].
[0106] PCR amplification was performed according to the contents disclosed in the literature by Nguyen et al. and Yilmaz et al. [Yilmaz N, Visagie CM, Houbraken J, Frisvad JC, Samson RA (2014). Polyphasic taxonomy of the genus Talaromyces. Stud. Mycol. 78: 175-341]. The PCR products were purified using the Accuprep PCR Purification Kit (Bioneer Corp., Daejeon, Korea) according to the manufacturer's instructions. DNA sequencing was performed using an ABI PRISM 3730XL Genetic Analyzer (Applied Biosystems, California, USA).
[0108] Examples 1-5. Phylogenetic analysis
[0109] Each generated sequence was checked for the presence of ambiguous bases and assembled using the Lasergene SeqMan (DNASTAR, Inc., Madison, WI, USA) program.
[0110] The edited sequences were subjected to a BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) search against the nucleic acid database of NCBI GenBank to search for the closest related species.
[0111] Sequences of all registered Talaromyces species were downloaded from Genbank. Each sequence was aligned using MAFFT (http: / / mafft.cbrc.jp / alignment / server), and phylogenetic reconstruction using maximum likelihood analysis (ML) was performed with 1,000 bootstrap clones using RAxML-HPC2 in XSEDE on the CIPRES portal (https: / / www.phylo.org / portal2), using a GTR + G + I evolutionary model.
[0112] The results of the phylogenetic analysis were visualized using FigTree ver. 1.3.1, and the sequences newly obtained through the present invention were deposited in the NCBI GenBank database and assigned the accession numbers shown in Table 2 below.
[0114] GenBank accession numbers of fungi used for phylogenetic analysis Taxon name Strain no. GenBank accession no. ITS BenA CaM RPB2 Talaromyces aculeatus CBS 289.48 T KF741995 KF741929 KF741975 MH793099 Talaromyces adpressus CBS 140620 T KU866657 KU866844 KU866741 KU867001 Talaromyces alveolaris CBS 142379 T LT558969 LT559086 LT795596 LT795597 Talaromyces amestolkiae CBS 132696 T JX315660 JX315623 KF741937 JX315698 Talaromyces angelicae KACC 46611 T KF183638 KF183640 KJ885259 KX961275 Talaromyces annesophieae CBS 142939 T MF574592 MF590098 MF590104 MN969199 Talaromyces apiculatus CBS 312.59 T JN899375 KF741916 KF741950 KM023287 Talaromyces aurantiacus CBS 314.59 T JN899380 KF741917 KF741951 KX961285 Talaromyces australis CBS 137102 T KF741991 KF741922 KF741971 KX961284 Talaromyces beijingensis CBS 140617 T KU866649 KU866837 KU866733 KU866993 Talaromyces brevis CBS 141833 T MN864269 MN863338 MN863315 MN863328 Talaromyces cnidii KACC 46617 T KF183639 KF183641 KJ885266 KM023299 Talaromyces derxii CBS 412.89 T JN899327 JX494306 KF741959 KM023282 Talaromyces dendriticus CBS 660.80 T JN899339 JX091391 KF741965 KM023286 Talaromyces dimorphus AS3.15692 T KY007095 KY007111 KY007103 KY112593 Talaromyces duclauxii CBS 322.48 T JN899342 JX091384 KF741955 JN121491 Talaromyces euchlorocarpius PF 1203 T AB176617 KJ865733 KJ885271 KM023303 Talaromyces flavovirens CBS 102801 T JN899392 JX091376 KF741933 KX961283 Talaromyces flavus CBS 310.38 T JN899360 JX494302 KF741949 JF417426 Talaromyces francoae CBS 113134 T KX011510 KX011489 KX011501 MN969188 Talaromyces fusiformis CBS 140637 T KU866656 KU866843 KU866740 KU867000 Talaromyces galapagensis CBS 751.74 T JN899358 JX091388 KF741966 KX961280 Talaromyces indigoticus CBS 100534 T JN899331 JX494308 KF741931 KX961278 Talaromyces intermedius CBS 152.65 T JN899332 JX091387 KJ885290 KX961282 Talaromyces kendrickii CBS 136666 T KF741987 KF741921 KF741967 MN969158 Talaromyces lentulus AS3.15689 T KY007088 KY007104 KY007096 KY112586 Talaromyces liani CBS 225.66 T JN899395 JX091380 KJ885257 KX961277 Talaromyces mae AS3.15690 T KY007090 KY007106 KY007098 KY112588 Talaromyces mangshanicus HMAS 248733 T KX447531 KX447530 KX447528 KX447527 Talaromyces marneffei CBS 388.87 T JN899344 JX091389 KF741958 KM023283 Talaromyces muroii CBS 756.96 T MN431394 KJ865727 KJ885274 KX961276 Talaromyces mycothecae URM 7622 T MF278326 LT855561 LT855564 LT855567 Talaromyces neofusisporus AS3.15415 T KP765385 KP765381 KP765383 MN969165 Talaromyces oumae-annae CBS 138208 T KJ775720 KJ775213 KJ775425 KX961281 Talaromyces panamensis CBS 128.89 T JN899362 HQ156948 KF741936 KM023284 Talaromyces pinophilus CBS 631.66 T JN899382 JX091381 KF741964 KM023291 Talaromyces pratensis NRRL 62170 MH793075 MH792948 MH793012 MH793139 Talaromyces purpureogenus CBS 286.36 T JN899372 JX315639 KF741947 JX315709 Talaromyces qii AS3.15414 T KP765384 KP765380 KP765382 MN969164 Talaromyces ruber CBS 132704 T JX315662 JX315629 KF741938 JX315700 Talaromyces rubicundus CBS 342.59 T JN899384 JX494309 KF741956 KM023296 Talaromyces sayulitensis CBS 138204 T KJ775713 KJ775206 KJ775422 MN969146 Talaromyces siamensis CBS 475.88 T JN899385 JX091379 KF741960 KM023279 Talaromyces soli NRRL 62165 T MH793074 MH792947 MH793011 MH793138 Talaromyces stellenboschensis CBS 135665 T JX091471 JX091605 JX140683 MN969157 Talaromyces stipitatus CBS 375.48 T JN899348 KM111288 KF741957 KM023280 Talaromyces stollii CBS 408.93 T JX315674 JX315633 JX315646 JX315712 Talaromyces thailandensis CBS 133147 T JX898041 JX494294 KF741940 KM023307 Talaromyces verruculosus DTO 264-I8 T KF741994 KF741928 KF741944 KM023306 Talaromyces viridis CBS 114.72 T AF285782 JX494310 KF741935 JN121430 Talaromyces wushanicus CS17-05 T MZ356356 MZ361347 MZ361354 MZ361361 Talaromyces xishaensis CGMCC 3.17995 T KU644580 KU644581 KU644582
[0115] CBS: Culture collection of the Westerdijk Fungal Biodiversity Institute, The Netherlands.
[0116] CNUFC: Chonnam National University Fungal Collection, Gwangju, South Korea;
[0117] DAOM: Agriculture Canada and Agri-Food Canada Culture Collection, Ottawa, ON, Canada;
[0118] DTO: Internal Culture Collection of the CBS-Fungal Biodiversity Center;
[0119] FMR: Facultat de Medicina i Ciencies de la Salut, Reus, Spain;
[0120] KACC: Korean Agricultural Culture Collection, Republic of Korea;
[0121] NRRL: Agricultural Research Service Culture Collection, Peoria, Illinois, US;
[0122] T : Standard (ex-type) strain.
[0124] 실시예 1-6. 계통 분석 결과(Phylogenetic analysis)
[0125] The four loci, ITS, BenA, CaM, and RPB2, consist of 584, 497, 576, and 878 characters, respectively, and their specific sequences are shown in Table 3 below. For the multiplex gene analysis, Talaromyces dendriticus CBS 386.48 was used as the outgroup, and the results are shown in Figure 2. In the development of multiplex gene phylogeny, it can be confirmed that the taxa form distinct clusters.
[0126] Talaromyces pauper CNUFC CY2212_ITS AAGGATCATTACCGAGTGCGGGCCCTCGCGGCCCAACCTCCCACCCTTGTCTCTATACACCTGTTGCTTTGGCGGGCCCACCGGGGCCACCTGGTCGCCGGGGGACGTCCGTCCCCGGGCCCGCGCCCGCCGAAGCGCTCTGTGAACCCTGATGAAGATGGGCTGTCTGAGTACTATGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGTGTGGTCCCCCCGGGGACCTGCCCGAAAGGCAGCGGCGACGTCCGTCTGGTCCTCGAGCGTATGGGGCTCTGTCACTCGCTCGGGAAGGACCTGCGGGGGTTGGTCACCACCATATTTTACCACGGTTGACCTCGGATCAGGTAGGAGTTACCCGCTGAACTTAAGCATATCAATA Talaromyces pauper CNUFC CY2212_BenA gene TGCTGCTTTCTGGTGAGTTTGACTCGACCCAAACTTTCTATCATTGTCGCGACAAAAGCTGACTTTTCCAGGCAAATCATCTCTGCTGAGCACGGTCTCGACGGCTCTGGTGTGTAAGTATTTACGATTCGAATCCAACTACAATCCGACAATATCTGATCATCAACAGCTACAATGGCTCCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTCAGACCAATCCACCATATAACGGGACAAAACTCATAATGGTATAGGCCTCCGGCAACAAATATGTCCCCCGTGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTCCGCGCTGGTCCCTTTGGTCAGCTCTTCCGTCCCGACAACT Talaromyces pauper CNUFC CY2212_RPB2 gene CGTTGAAACAAACCGCGAAGTGGTTCTTAACGTGGGTCTCAAGCCAGCCACTCTTACAGGTGGTTTTGAAATATGCTCTCGCTACTGGAAACTGGGGTGAACAGAAGAAGGCAATGAGCTCGAAAGCAGGTGTTTCTCAAGTGCTCAGTCGATACACCTTTGCCTCTACTTTGTCTCATTTGAGACGTACCAACACACCTATTGGTCGTGACGGAAAAA TCGCCAAGCCTCGTCAGCTACATAACACTCACTGGGGTCTGGTCTGTCCTGCCGAGACTCCTGAGGGTCAAGCTTGTGGTTTGGTCAAGAACTTGGCTTTGATGTGTTCTATCACTGTGGGTTCTCCTAGCGAGCCTATTGTTGATTTCATGATTCAGCGAAACATGGAAGTGCTTGAGGAATTCGAACCGCTAGTTACGCCTCATGCCACCAAGGTCT TTGTCAAATGGTGTTTGGGTCGGTGTTCATCGTGACCCAGCCCATTTGGTCAGCACTGTCCAGTCACTGCGTCGACGGAATATGATTTCACACGAAGTCAGTTTAGTTCGTGATATTCGTGACCGGGAGTTCAAGATTTTTACGGATGCCGGTCGTGTTTGTCGACCACTTTTCGTTATTGACAACGATCCACGAAGCGAGAATTGCGGCTTCTTTAGTAC TCAACAAAGACCATATTCGCAGACTTGAAGCAGACCGTGAGCTTCCACCAGACCTCGACCCCGAAGAACGAAGGGAACAGTACTACGGTTGGGAGGGCCTTGTCAAATCGGGTGTTATTGAGTACGTTGATGCTGAAGAAGAAGAAACTATCATGATTGCCATGTCTCCTGAGGATCTCGAAATCTCGAAACAACTACAAGCCGGTTATGCTCTGCCCG
[0128] Examples 1-7. Fermentation, Extraction, and Separation
[0129] The strain *Thalaromyces puffere* was cultured on potato glucose agar (PDA) at 5°C for 7 days. Five 6.5 mm mycelial agar pieces were placed in 100 mL of potato glucose liquid medium (PDB) contained in a 500 mL Erlenmeyer flask, sterilized at 121°C for 15 minutes, and then incubated in a horizontal shaker incubator at 25°C at 150 rpm for 14 days. The culture medium was filtered to obtain the filtrate. The mixture was extracted three times with ethyl acetate (EtOAc), and the ethyl acetate layer was concentrated under vacuum in a rotary evaporator to obtain the ethyl acetate crude extract of *Thalaromyces puffere*.
[0131] Examples 1-8. Cell viability analysis
[0132] RAW 264.7 cells at 5% CO 2, It was cultured in DMEM medium containing 10% (v / v) fetal bovine serum (FBS), antibiotics and antifungals, and 10 mM HEPES buffer (Gibco, Big Cabin, OK) at 37℃.
[0133] 5×10 of the above cells in a 96-well plate 3 After seeding cells / wells and incubating overnight, the ethyl acetate extract of *Thalaromyces puffer* prepared in Examples 1-7 was diluted to an initial concentration of 50 μg / mL relative to the total medium, and then five different concentrations of the extract were treated to the cells for 24 hours by serially diluting them fourfold. Afterward, after washing with phosphate-buffered saline (PBS), the cells were treated with 100 mL of a 20:1 mixture of 3-(4,5-dimethylthiazole-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) and phenazine methosulfate (PMS, Sigma-Aldrich, Burlington, MA) for 30 minutes to 2 hours.
[0134] To investigate the cell viability of the cultured cells, the number of cells was measured by calculating the absorbance at 490 nm using a microplate reader (Molecular Devices, San Jose, CA). The number of surviving cells is shown as a percentage in Figure 3 compared to a control group (Con) that was not treated with the crude ethyl acetate extract of *Thalaromyces puffer*. As a result, it was confirmed that in all groups treated with the extract, the cell viability remained above 100% regardless of concentration, and no cytotoxicity was exhibited even when the extract was treated at a concentration of 50 μg / mL.
[0136] Example 2-1. Measurement of Anti-inflammatory Effect of Novel Talaromyces pauper CNUFC CY2212 (Nitric Oxide Inhibition Analysis)
[0137] 1×10⁶ RAW 264.7 cells in a 48-well plate 4 Cells were seeded into wells and treated with the crude ethyl acetate extract (50 μg / mL) of Thalaromyces puffer prepared in Examples 1-7 for 1 hour, followed by additional treatment with lipopolysaccharide (LPS, 100 ng / mL) for 24 hours. 50 mL of sulfanilamide solution (Promega, Madison, WI) was added to the cell culture supernatant and incubated at room temperature for 10 minutes. Subsequently, the supernatant was mixed with 50 mL of NED solution (Promega) and incubated at room temperature for 10 minutes.
[0138] To investigate the level of nitric oxide production in the cultured cells, the amount of nitrite produced was analyzed by calculating the absorbance at 540 nm using a microplate reader (Molecular Devices), and the concentration of nitric oxide is shown in Figure 4. As a result, it was confirmed that nitric oxide production was strongly inhibited in the group treated with the extract at a concentration of 50 μg / mL compared to the group not treated with the crude ethyl acetate extract of Thalaromyces puffer after LPS treatment.
[0140] Example 2-2. Measurement of Antioxidant Effect of Novel Talaromyces pauper CNUFC CY2212 (Reactive Oxygen Species Scavenging Analysis)
[0141] 1×10⁶ RAW 264.7 cells in a 48-well plate 4 Cells were seeded into wells and treated with the crude ethyl acetate extract (50 μg / mL) of Thalaromyces puffer prepared in Examples 1-7 for 1 hour, followed by additional treatment with lipopolysaccharide (LPS, 100 ng / mL) for 24 hours. Cells were collected, washed with PBS, and then 10 μM of the fluorescent probe 2,7-dichlorodihydrofluorescein diacetate (DCFH-DA, Sigma-Aldrich, Burlington, MA) was added and incubated for 30 minutes. Afterward, the cells were washed with PBS, and dead cells positively stained with propidium iodide (2 mg / mL, Sigma-Aldrich) were excluded. The mean fluorescence intensity (MFI) of DCF (dihydroethidium) was analyzed using a FACSCalibur (Becton, Dickinson and Company, Franklin Lakes, NJ), and the results are shown in Figures 5 and 6.
[0142] According to Figures 5 and 6, it can be seen that reactive oxygen species were strongly inhibited in the group treated with the extract at a concentration of 50 μg / mL compared to the group not treated with the crude ethyl acetate extract of Thalaromyces puffer after LPS treatment. This demonstrates that the extract can effectively reduce oxidative stress in macrophages.
[0144] Example 3. Measurement of Antifungal Activity of Novel Talaromyces pauper CNUFC CY2212
[0145] The antifungal activity of strain CNUFC CY2212 was evaluated using a double culture method on PDA medium. The evaluation was performed using a substitution culture method in which a mycelial plug of CNUFC CY2212 (diameter 6.5 mm) was placed in the center of a PDA plate, and the fungal pathogens Botrytis cinerea EML-SBO1 (left) and Colletotrichum gloeosporioides EML-CG001 (right) were placed on the opposite side. All plates were incubated in a dark room at 25°C for 5–7 days, and each experiment was repeated three times. The control group consisted of the fungal pathogens alone.
[0146] As shown in Figure 7, strain CNUFC CY2212 inhibited the mycelial growth of fungal pathogens Botrytis cinerea EML-SBO1 (A) and Colletotrichum gloeosporioides EML-CG001 (B) on PDA medium (C and D are controls for each strain). Talaromyces pauper CNUFC CY2212 inhibited the mycelial growth of Botrytis cinerea and Colletotrichum gloeosporioides by 53.3% and 31.8%, respectively.
[0147] As shown in the above results, through the present invention, Talaromyces pauper CNUFC CY2212 was isolated and identified as a novel species from fungi inhabiting domestic soil, and it was confirmed to exhibit antioxidant effects such as nitric oxide inhibition and reactive oxygen species removal, as well as antifungal activity.
[0148] Foregoing, specific parts of the content of the present invention have been described in detail. It will be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the present invention. Accordingly, the actual scope of the present invention is defined by the appended claims and their equivalents.
[0150] Depository Name: Korea Research Institute of Biotechnology and Bioengineering Biological Resources Center (KCTC) Trustee Number: KCTC15802BP Date of Deposit: 2024-02-01
Claims
Claim 1 Thalaromyces puffer ( Talaromyces pauper ) CNUFC CY2212 (Deposit No.: KCTC15802BP) Claim 2 A microbial composition comprising one or more active ingredients selected from the group consisting of Thalaromyces puffer according to claim 1, a culture medium of said strain, and a culture filtrate of said strain. Claim 3 A pharmaceutical composition for antifungal, anti-inflammatory, or antioxidant purposes comprising a microbial composition according to paragraph 2. Claim 4 In paragraph 3, the pharmaceutical composition is a pharmaceutical composition for antifungal, anti-inflammatory, or antioxidant purposes, prepared in a formulation selected from tablets, pills, powders, granules, coated tablets, hard or soft capsules, solutions, suspensions or emulsions, injections, aerosols, topical preparations, suppositories, and sterile injectable solutions. Claim 5 Health functional food containing a microbial composition pursuant to Paragraph 2 Claim 6 In paragraph 5, the above-mentioned health functional food is a health functional food used for antifungal, anti-inflammatory, or antioxidant purposes. Claim 7 Cosmetic composition comprising a microbial composition according to paragraph 2 Claim 8 In claim 7, the cosmetic composition is for antifungal, anti-inflammatory, or antioxidant use. Claim 9 In claim 7, the cosmetic composition is prepared in a formulation selected from the group consisting of a solution, an external ointment, a cream, a foam, a nourishing lotion, a softening lotion, a pack, a softening water, a lotion, a makeup base, an essence, a soap, a liquid cleanser, a bath additive, a sunscreen cream, a sun oil, a suspension, an emulsion, a paste, a gel, a lotion, a powder, a soap, a surfactant-containing cleansing product, an oil, a powder foundation, an emulsion foundation, a wax foundation, a patch, and a spray. Claim 10 Feed comprising a microbial composition according to paragraph 2 Claim 11 In paragraph 10, the above feed is for antifungal, anti-inflammatory, or antioxidant use.
Citation Information
Patent Citations
Novel fungus Talaromyces gwangjuensis, Talaromyces koreana and Talaromyces teleomorha, and use thereof
KR1020230032484A
Novel fungus Talaromyces gwangjuensis, Talaromyces koreana and Talaromyces teleomorha, and use thereof
KR102627089B1
Composition for antioxidation or skin whitening containing 21-o-angeloyltheasapogenol e3 ingredient derived from green tea seed
WO2015005512A1