Delivery of biomolecules to PBMCs to modify the immune response
Patent Information
- Application Number
- KR1020217030867
- Authority / Receiving Office
- KR · KR
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2019-12-16
- Filing Date
- 2020-02-27
- Publication Date
- 2026-09-21
- Estimated Expiration
- 2040-02-27
Smart Images

Figure 112021110273168-PCT00005_ABST
Abstract
Description
Technology Field
[0001] Cross-reference regarding related applications
[0002] The present application claims priority to U.S. provisional application No. 62 / 812,225 filed February 28, 2019; European patent application No. 19161964.2 filed March 11, 2019; U.S. provisional application No. 62 / 841,089 filed April 30, 2019; U.S. provisional application No. 62 / 886,799 filed August 14, 2019; U.S. provisional application No. 62 / 933,304 filed November 8, 2019; and U.S. provisional application No. 62 / 948,732 filed December 16, 2019, the full contents of each of which are incorporated herein by reference.
[0003] Submit a list of sequences in an ASCII text file
[0004] The following submission of an ASCII text file is incorporated herein by reference in its entirety: Computer-readable form of sequence listing (CRF) (filename: 750322002241SEQLIST.TXT, date recorded: February 24, 2020, size: 15 KB).
[0005] Technology field
[0006] The present disclosure relates to peripheral blood mononuclear cells (PBMCs) comprising antigens and / or ajuvants, a method for producing such PBMCs, and a method for using such PBMCs to modulate an immune response, for example, in an individual. Background Technology
[0007] Immunotherapy can be divided into two main types of interventions: passive or active. Passive protocols involve the administration of pre-activated and / or engineered cells, disease-specific therapeutic antibodies, and / or cytokines. Active immunotherapy strategies aim to stimulate in vivo immune system effector function. Several current active protocols include vaccination strategies using disease-associated peptides, lysates, or allogeneic whole cells, the infusion of autologous DCs as vehicles for tumor antigen delivery, and the infusion of immune checkpoint modulators. See the literature [Papaioannou, Nikos E., et al. Annals of translational medicine 4.14 (2016)].
[0008] CD8 stimulated by disease-associated antigens + Cytotoxic T lymphocytes (CTL) and CD4 + Helper T (Th) cells have the potential to target and destroy affected cells; however, current methods for inducing endogenous T cell responses have faced problems.
[0009] All references cited herein, including patent applications and publications, are incorporated by reference in their entirety.
[0010] The present invention provides peripheral blood mononuclear cells (PBMCs) containing an antigen for stimulating an immune response in an individual. In some embodiments, the antigen is delivered into the cell using a Cell Squeeze® platform. The inventors unexpectedly discovered that a mixed population of PBMCs has greater efficacy than a pure B cell and T cell population. Furthermore, the present invention is based, at least in part, on the unexpected finding that when PBMCs are administered to an individual, conditioning the PBMCs to an ajuvant increases the activation of the PBMCs' antigen-presenting cells, thereby increasing immune stimulation.
[0011] In some aspects, the present invention provides a plurality of modified PBMCs comprising an antigen, wherein the antigen is exogenous to the modified PBMC. In some embodiments, the present invention provides a plurality of modified PMBCs comprising an antigen, wherein the antigen is exogenous to the modified PBMC and is a cancer antigen, an infectious disease antigen, or a virus-disease-associated antigen. In some aspects, the present invention provides a plurality of conditioned modified PBMCs comprising an antigen, wherein the antigen is exogenous to the modified PBMC. In some embodiments, the present invention provides a plurality of conditioned modified PMBCs comprising an antigen, wherein the antigen is exogenous to the modified PBMC and is a cancer antigen, an infectious disease antigen, or a virus-disease-associated antigen. In some embodiments, the present invention provides a plurality of conditioned modified PBMCs comprising an antigen and an ajuvant, wherein the antigen is exogenous to the modified PBMC.
[0012] In some aspects, the present invention provides a plurality of conditioned PBMCs containing an antigen, prepared by incubating a plurality of PBMCs containing an antigen with an ajuvant for a time sufficient for the PBMCs to be conditioned, thereby producing a plurality of conditioned PBMCs containing the antigen. In some embodiments, the present invention provides a plurality of conditioned PBMCs containing an antigen, prepared by incubating a plurality of PBMCs with an ajuvant for a time sufficient for the PBMCs to be conditioned, before introducing the antigen into the PBMCs, thereby producing a plurality of conditioned PBMCs containing the antigen.
[0013] In some aspects, the present invention provides a plurality of modified PBMCs containing an antigen, prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMC sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient for the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen. In some embodiments, the present invention provides a step comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMC sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating a plurality of perturbed input PBMCs with an antigen for a time sufficient to allow the antigen to enter the perturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating a plurality of modified PBMCs containing the antigen with an ajuvant for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen, provided by a method comprising the steps of: conditioned a plurality of modified PBMCs containing the antigen, prepared incubating a plurality of modified PBMCs containing the antigen with an ajuvant, prepared by a method comprising the steps of conditioned a plurality of modified PBMCs containing the antigen, prepared by a method comprising the steps of conditioned a plurality of modified PBMCs containing the antigen, prepared by a method comprising the steps of conditioned a plurality of modified PBMCs containing the antigen, prepared by a method comprising the steps of conditioned a plurality of modified PBMCs containing the antigen, prepared by a method comprising the steps of conditioned a plurality of modified PBMCs containing the antigen, prepared by a method comprising the steps of conditioned a plurality of modified PBMCs containing the antigen, prepared by a method comprising the steps of conditioned a pluralityIn some embodiments, the present invention provides a plurality of modified PBMCs containing antigens and ajuvants, prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigens and ajuvants to pass through to form a plurality of disturbed input PBMCs; and b) incubating the plurality of disturbed input PBMCs with the antigens and ajuvants for a time sufficient to allow the antigens and ajuvants to enter the disturbed input PBMCs; thereby producing a plurality of modified PBMCs containing antigens and ajuvants.
[0014] In some aspects, the present invention provides a plurality of conditioned modified PBMCs containing an antigen, prepared by a method comprising: a) incubating a plurality of conditioned PBMCs with an ajuvant for a time sufficient for the conditioned PBMCs to be conditioned, thereby producing a plurality of conditioned PBMCs; b) passing a cell suspension containing a plurality of conditioned PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the conditioned PBMCs in the suspension, thereby causing disturbance of the conditioned PBMCs large enough for the antigen to pass through to form a plurality of conditioned disturbed PBMCs; and c) incubating a plurality of conditioned disturbed PBMCs with an antigen for a time sufficient for the antigen to enter the disturbed PBMCs, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the present invention provides a plurality of modified PBMCs comprising an antigen and an ajuvant, prepared by a method comprising: a) passing a cell suspension comprising a plurality of input PBMCs comprising an ajuvant through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; and b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs comprising the antigen and the ajuvant.In some embodiments, the present invention provides a plurality of modified PBMCs comprising an antigen and an ajuvant, prepared by a method comprising: a) passing a cell suspension comprising a plurality of input PBMCs comprising an antigen through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for an ajuvant to pass through to form a plurality of disturbed input PBMCs; and b) incubating the plurality of disturbed input PBMCs with an ajuvant for a sufficient time to allow the ajuvant to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs comprising an antigen and an ajuvant. In some embodiments, a plurality of modified PBMCs comprising an antigen and / or ajuvant as described herein are according to a method further comprising incubating a plurality of modified PBMCs comprising an antigen and / or ajuvant with a second ajuvant for a time sufficient for the modified PBMCs comprising the antigen to be conditioned, thereby producing a plurality of conditioned modified PBMCs comprising the antigen and / or ajuvant. In some embodiments, the method further comprises isolating a plurality of modified PBMCs comprising an antigen and / or ajuvant from a cell suspension before incubating with an ajuvant to conditioned the modified PBMCs. In some embodiments, the method further comprises the step of incubating the input PBMCs and / or modified PBMCs with an agent that enhances the viability and / or function of the modified PBMCs compared to a corresponding modified PBMC prepared without an additional incubation step.
[0015] In some aspects, the present invention provides a composition comprising a plurality of modified PBMCs as described herein for use in a method of treating a human or animal body by surgery, therapy, or diagnosis. In some embodiments, the present invention provides a composition comprising a plurality of modified PBMCs as described herein for use in the treatment of cancer, infectious diseases, or virus-associated diseases.
[0016] In some aspects, the present invention provides a composition comprising a plurality of conditioned modified PBMCs containing an antigen for use as a medicine, wherein the conditioned plurality of modified PBMCs are prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen.In some embodiments, the present invention provides a composition comprising a plurality of conditioned modified PBMCs containing an antigen for use in a method of treating a human or animal body by surgery, therapy or diagnosis, wherein the conditioned plurality of modified PBMCs are prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen.In some embodiments, the present invention provides a composition comprising a plurality of conditioned modified PBMCs containing an antigen for use as a medicine, wherein the conditioned plurality of modified PBMCs are prepared by a method comprising: a) incubating a plurality of conditioned PBMCs with an ajuvant for a time sufficient for the conditioned PBMCs to be conditioned, thereby producing a plurality of conditioned conditioned PBMCs; b) passing a cell suspension containing a plurality of conditioned conditioned PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the conditioned PBMCs in the suspension, thereby causing a disturbance of the conditioned PBMCs large enough for the antigen to pass through, thereby forming a plurality of conditioned disturbed conditioned PBMCs; and c) incubating a plurality of conditioned disturbed conditioned PBMCs with an antigen for a time sufficient for the antigen to enter the disturbed conditioned PBMCs, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the present invention provides a composition comprising a plurality of conditioned modified PBMCs containing an antigen for use in a method of treating a human or animal body, wherein the conditioned plurality of modified PBMCs are prepared by a method comprising: a) incubating a plurality of conditioned PBMCs with an ajuvant for a time sufficient for the conditioned PBMCs to be conditioned, thereby producing a plurality of conditioned conditioned PBMCs; b) passing a cell suspension containing a plurality of conditioned conditioned PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the conditioned PBMCs in the suspension, thereby causing a disturbance of the conditioned PBMCs large enough for the antigen to pass through, thereby forming a plurality of conditioned disturbed conditioned PBMCs; and c) incubating a plurality of conditioned disturbed conditioned PBMCs with an antigen for a time sufficient for the antigen to enter the disturbed conditioned PBMCs, thereby producing a plurality of conditioned modified PBMCs containing the antigen.In some embodiments, the present invention provides a composition comprising a plurality of conditioned modified PBMCs containing an antigen for use in a method for treating cancer, an infectious disease or a virus-associated disease in an individual, wherein the conditioned plurality of modified PBMCs are prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen.In some embodiments, the present invention provides a composition comprising a plurality of conditioned modified PBMCs containing an antigen for use in the treatment of cancer, infectious disease or virus-associated disease in an individual, wherein the conditioned plurality of modified PBMCs are prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen.In some embodiments, the present invention provides a composition comprising a plurality of conditioned modified PBMCs containing an antigen for use in a method for treating HPV-associated disease in an individual, wherein the conditioned plurality of modified PBMCs are prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen.In some embodiments, the present invention provides a composition comprising a plurality of conditioned modified PBMCs containing an antigen for use in the treatment of HPV-associated disease in an individual, wherein the conditioned plurality of modified PBMCs are prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen.
[0017] In some aspects, the present invention provides a use of a composition comprising a plurality of conditioned modified PBMCs containing an antigen in the manufacture of a medicine for treating cancer, an infectious disease or a virus-associated disease in an individual, wherein the conditioned plurality of modified PBMCs comprises: a) passing a cell suspension comprising a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing the antigen; and c) a plurality of modified PBMCs containing antigens are incubated with an ajuvant for a time sufficient for the modified PBMCs containing antigens to be conditioned, thereby producing a plurality of conditioned modified PBMCs containing antigens.In some embodiments, the present invention provides a use of a composition comprising a plurality of conditioned modified PBMCs containing an antigen in the manufacture of a medicine for treating HPV-associated diseases, wherein the conditioned plurality of modified PBMCs are prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen.
[0018] In some aspects, the present invention provides a plurality of antigen-containing conditioned modified PBMCs prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for an antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with an antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the present invention provides a plurality of antigen-containing conditioned modified PBMCs prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for a time sufficient to condition the modified PBMCs containing the antigen, wherein the ajuvant is a CpG ODN, thereby producing a plurality of conditioned modified PBMCs containing the antigen.In some embodiments, the present invention provides a plurality of antigen-containing conditioned modified PBMCs prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for about 1 hour to about 24 hours to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the present invention provides a plurality of antigen-containing conditioned modified PBMCs prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for about 1 hour to about 24 hours so that the modified PBMCs containing the antigen are conditioned, wherein the ajuvant is CpG ODN, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In a preferred embodiment, the ajuvant is CPG 7909.
[0019] In some aspects, the present invention provides a plurality of conditioned modified PBMCs containing human papillomavirus (HPV) antigens, prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs large enough for human papillomavirus (HPV) antigens to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with HPV antigens for a time sufficient to allow HPV antigens to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing HPV antigens; and c) incubating the plurality of modified PBMCs containing HPV antigens with CpG ODN for a time sufficient to condition the modified PBMCs containing HPV antigens, thereby producing a plurality of conditioned modified PBMCs containing HPV antigens.In some embodiments, the present invention provides a plurality of conditioned modified PBMCs containing HPV antigens, prepared by a method comprising: a) passing a cell suspension containing a plurality of conditioned PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the conditioned PBMCs sufficiently large for HPV antigens to pass through to form a plurality of disturbed conditioned PBMCs; b) incubating the plurality of disturbed conditioned PBMCs with HPV antigens for a time sufficient to allow HPV antigens to enter the disturbed conditioned PBMCs, thereby producing a plurality of modified PBMCs containing HPV antigens; and c) incubating the plurality of modified PBMCs containing HPV antigens with a CpG ODN for a time sufficient to condition the modified PBMCs containing HPV antigens, wherein the CpG ODN is CpG 7909, thereby producing a plurality of conditioned modified PBMCs containing HPV antigens.In some embodiments, the present invention provides a plurality of conditioned modified PBMCs containing HPV antigens, prepared by a method comprising: a) passing a cell suspension containing a plurality of conditioned PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the conditioned PBMCs sufficiently large for HPV antigens to pass through to form a plurality of disturbed conditioned PBMCs; b) incubating the plurality of disturbed conditioned PBMCs with HPV antigens for a time sufficient to allow HPV antigens to enter the disturbed conditioned PBMCs, thereby producing a plurality of modified PBMCs containing HPV antigens; and c) incubating the plurality of modified PBMCs containing HPV antigens with CpG ODN for about 1 hour to about 24 hours to condition the modified PBMCs containing HPV antigens, thereby producing a plurality of conditioned modified PBMCs containing HPV antigens.In some embodiments, the present invention comprises: a) passing a cell suspension comprising a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for HPV antigens to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with HPV antigens for a time sufficient to allow HPV antigens to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing HPV antigens; and c) incubate a plurality of modified PBMCs containing HPV antigens with a CpG ODN for about 1 hour to about 24 hours so that the modified PBMCs containing HPV antigens are conditioned, wherein the CpG ODN is CpG 7909, thereby producing a plurality of conditioned modified PBMCs containing HPV antigens, provided by a method comprising the step of conditioned a plurality of modified PBMCs containing HPV antigens.
[0020] In some aspects, the present invention provides a plurality of antigen-containing conditioned modified PBMCs prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with a CpG ODN for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the present invention provides a plurality of antigen-containing conditioned modified PBMCs prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 34 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with a CpG ODN for a time sufficient to condition the modified PBMCs containing the antigen, wherein the CpG ODN is CpG 7909, thereby producing a plurality of conditioned modified PBMCs containing the antigen.In some embodiments, the present invention provides a plurality of antigen-containing conditioned modified PBMCs prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 34 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with a CpG ODN for about 1 hour to about 24 hours to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the present invention provides a plurality of antigen-containing conditioned modified PBMCs prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with a CpG ODN for about 1 hour to about 24 hours to condition the modified PBMCs containing the antigen, wherein the CpG ODN is CpG 7909, thereby producing a plurality of conditioned modified PBMCs containing the antigen.
[0021] In some aspects, the present invention provides a plurality of antigen-containing conditioned modified PBMCs prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with a CpG ODN for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the present invention provides a plurality of antigen-containing conditioned modified PBMCs prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with a CpG ODN for a time sufficient to condition the modified PBMCs containing the antigen, wherein the CpG ODN is CpG 7909, thereby producing a plurality of conditioned modified PBMCs containing the antigen.In some embodiments, the present invention provides a plurality of antigen-containing conditioned modified PBMCs prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with a CpG ODN for about 1 hour to about 24 hours to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the present invention provides a plurality of antigen-containing conditioned modified PBMCs prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with a CpG ODN for about 1 hour to about 24 hours to condition the modified PBMCs containing the antigen, wherein the CpG ODN is CpG 7909, thereby producing a plurality of conditioned modified PBMCs containing the antigen.
[0022] In some aspects, the present invention provides a method for stimulating an immune response in an individual, comprising a) administering to an individual a plurality of modified PBMCs comprising an antigen having any one of the amino acid sequences of sequence identification numbers: 18-25; and b) administering to the individual an ajuvant.
[0023] In some aspects, the present invention provides a method for stimulating an immune response in an individual, comprising a) administering to an individual a plurality of modified PBMCs comprising an antigen comprising the amino acid sequence of SEQ ID NO: 19; and b) administering an ajuvant to the individual. In some aspects, the present invention provides a method for stimulating an immune response in an individual, comprising a) administering to an individual a plurality of modified PBMCs comprising an antigen comprising the amino acid sequence of SEQ ID NO: 23; and b) administering an ajuvant to the individual. In some aspects, the present invention provides a method for stimulating an immune response in an individual, comprising a) administering to an individual a plurality of modified PBMCs comprising an antigen comprising the amino acid sequences of SEQ ID NO: 19 and / or SEQ ID NO: 23; and b) administering an ajuvant to the individual. In some aspects, the present invention provides a method for stimulating an immune response in an individual, comprising a) administering to an individual a plurality of modified PBMCs comprising an antigen consisting of the amino acid sequences of SEQ ID NO: 19 and SEQ ID NO: 23; and b) administering an ajuvant to the individual. In some embodiments, a plurality of antigens are contained within a pool of non-covalently linked peptides. In some embodiments, a plurality of antigens are contained within a pool of non-covalently linked peptides, wherein each peptide comprises one or fewer antigens. In some embodiments, a plurality of antigens are contained within a pool of non-covalently linked peptides, wherein the amino acid sequence of sequence identification number: 19 and the amino acid sequence of sequence identification number: 23 are contained within separate peptides.
[0024] In some aspects, the present invention provides a method for stimulating an immune response in an individual, comprising: a) incubating a plurality of PBMCs containing an antigen with an ajuvant for a time sufficient for the PBMCs to be conditioned, thereby producing a plurality of conditioned PBMCs containing the antigen; and b) administering a plurality of conditioned PBMCs containing the antigen to an individual. In some embodiments, the present invention provides a method for stimulating an immune response in an individual, comprising: a) incubating a plurality of PBMCs with an ajuvant for a time sufficient for the PBMCs to be conditioned, thereby producing a plurality of conditioned PBMCs containing the antigen; b) introducing an antigen into a plurality of PBMCs; and c) administering a plurality of conditioned PBMCs containing the antigen to an individual. In some embodiments, the present invention provides a method for stimulating an immune response in an individual, comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for an antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with an antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen; and d) administering the plurality of conditioned modified PBMCs containing the antigen to an individual. In some embodiments, the method further comprises isolating a plurality of modified PBMCs containing antigens from a cell suspension prior to incubation with an ajuvant.In some embodiments, the present invention provides a method for stimulating an immune response in an individual, comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen and ajuvant to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen and ajuvant for a sufficient time to allow the antigen and ajuvant to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing the antigen and ajuvant; and c) administering the plurality of modified PBMCs to an individual.
[0025] In some aspects, the present invention provides a method for stimulating an immune response in an individual, comprising: a) incubating a plurality of input PBMCs with an ajuvant for a time sufficient for the input PBMCs to be conditioned, thereby producing a plurality of conditioned input PBMCs; b) passing a cell suspension containing a plurality of conditioned input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMCs in the suspension, thereby causing disturbance of the input PBMCs large enough for an antigen to pass through, to form a plurality of conditioned disturbed input PBMCs; c) incubating a plurality of conditioned disturbed input PBMCs with an antigen for a time sufficient for the antigen to enter the disturbed input PBMCs, thereby producing a plurality of conditioned modified PBMCs containing the antigen; and d) administering a plurality of conditioned modified PBMCs to an individual. In some embodiments, the present invention provides a method for stimulating an immune response in an individual, comprising: a) passing a cell suspension containing a plurality of input PBMCs containing an ajuvant through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a sufficient time to allow the antigen to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing the antigen and the ajuvant; and c) administering the plurality of modified PBMCs to an individual.In some embodiments, the present invention provides a method for stimulating an immune response in an individual, comprising: a) passing a cell suspension containing an input PBMC containing an antigen through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMC sufficiently large for an ajuvant to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with an ajuvant for a time sufficient to allow an ajuvant to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing an antigen and an ajuvant; and c) administering the plurality of modified PBMCs to an individual. In some embodiments, the present invention provides a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMC sufficiently large for an antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating a plurality of disrupted injectable PBMCs with an antigen for a sufficient time to allow the antigen to enter the disrupted injectable PBMCs, thereby generating a plurality of modified PBMCs containing the antigen; c) administering the plurality of modified PBMCs to an individual; and d) administering an ajuvant to an individual, thereby providing a method for stimulating an immune response in an individual.In some embodiments, the present invention provides a method for stimulating an immune response in an individual, comprising: a) passing a cell suspension containing an input PBMC containing an antigen through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMC sufficiently large for an ajuvant to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with an ajuvant for a sufficient time to allow the ajuvant to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing the antigen and the ajuvant; and c) administering the plurality of modified PBMCs to an individual; and d) administering the ajuvant to an individual.
[0026] In some aspects, the present invention provides a method for stimulating an immune response in an individual, comprising administering a plurality of PBMCs associated with an antigen to an individual, wherein the plurality of modified PBMCs are prepared by a method comprising: a) incubating a plurality of introduced PBMCs with an antigen for a time sufficient to cause the antigen to associate with the cell surface of the introduced PBMCs, thereby producing a plurality of PBMCs associated with the antigen; and b) administering the plurality of modified PBMCs to an individual. In some embodiments, the method further comprises administering an ajuvant to an individual.
[0027] In some aspects, the present invention provides a method for generating a plurality of conditioned PBMCs containing an antigen, comprising incubating a plurality of PBMCs containing an antigen with an ajuvant for a time sufficient for the PBMCs to be conditioned, thereby generating a plurality of conditioned PBMCs containing the antigen. In some embodiments, the present invention comprises: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating a plurality of disturbed input PBMCs with an antigen for a time sufficient for the antigen to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing the antigen; The present invention provides a method for producing a plurality of modified PBMCs conditioned to contain an antigen, comprising the steps of: c) incubating a plurality of modified PBMCs conditioned to contain an antigen with an ajuvant for a time sufficient for the modified PBMCs conditioned to contain the antigen to be conditioned, thereby producing a plurality of modified PBMCs conditioned to contain the antigen. In some embodiments, the method further comprises isolating a plurality of modified PBMCs conditioned to contain the antigen from a cell suspension prior to incubation with an ajuvant.In some embodiments, the present invention provides a method for generating a plurality of modified PBMCs containing antigens, comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for an antigen to pass through to form a plurality of disturbed input PBMCs; and b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient for the antigen to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing the antigen. In some embodiments, the present invention provides a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for an antigen and an ajuvant to pass through to form a plurality of disturbed input PBMCs; and b) incubating a plurality of disrupted PBMCs with the antigen and ajuvant for a sufficient time to allow the antigen and ajuvant to enter the disrupted PBMCs, thereby generating a plurality of disrupted PBMCs containing the antigen and ajuvant. A method for generating a plurality of disrupted PBMCs containing the antigen and ajuvant is provided.In some embodiments, the present invention provides a method for producing a plurality of conditioned modified PBMCs containing an antigen, comprising: a) incubating a plurality of conditioned PBMCs with an ajuvant for a time sufficient for the conditioned PBMCs to be conditioned, thereby producing a plurality of conditioned PBMCs; b) passing a cell suspension containing a plurality of conditioned PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the conditioned PBMCs in the suspension, thereby causing disturbance of the conditioned PBMCs sufficiently large for the antigen to pass through to form a plurality of conditioned disturbed PBMCs; and c) incubating a plurality of conditioned disturbed PBMCs with an antigen for a time sufficient for the antigen to enter the disturbed PBMCs, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the present invention provides a method for generating a plurality of modified PBMCs comprising an antigen and an ajuvant, comprising: a) passing a cell suspension comprising a plurality of input PBMCs comprising an ajuvant through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; and b) incubating the plurality of disturbed input PBMCs with the antigen for a sufficient time to allow the antigen to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs comprising the antigen and the ajuvant.In some embodiments, the present invention provides a method for producing a plurality of modified PBMCs containing an antigen and an ajuvant, comprising: a) passing a cell suspension containing a plurality of input PBMCs containing an antigen through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for an ajuvant to pass through to form a plurality of disturbed input PBMCs; and b) incubating the plurality of disturbed input PBMCs with an ajuvant for a time sufficient to allow the ajuvant to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing an antigen and an ajuvant. In some embodiments, the method further comprises the step of incubating the input PBMCs and / or modified PBMCs with an agent that enhances the viability and / or function of the modified PBMCs compared to a corresponding modified PBMC produced without an additional incubation step. Brief explanation of the drawing
[0028] FIG. 1a is a schematic diagram of representative cells within a plurality of PBMCs illustrating SQZ-mediated delivery of E6 and / or E7 SLPs; and subsequent processing and presentation of E6 and E7 epitopes on MHC-I, respectively. The representative cells may be any one of the PBMC cell types (e.g., T cells, monocytes, NK cells, and B cells). Figure 1b is a schematic representative diagram of a cohort in dose escalation in which PBMCs containing HPV antigens are administered as monotherapy to individuals with or without co-administration of a CpG ajuvant. The amount in the circle represents the relative dose of modified PBMCs, the arrow represents the administration, the double helix represents the CpG ajuvant, and "AVB" represents the additional vaccine boost. Figure 1c is a schematic representative diagram of a cohort in a dose escalation phase in which PBMC containing HPV antigens and atezolizumab were administered in combination to individuals. The amount in the circle represents the relative dose of modified PBMC, the arrow indicates the administration, and "AVB" indicates an additional vaccine boost. Figure 2a shows the survival rates of subpopulations in splenocytes after incubation (endocytosis) of dextran and SQZ-mediated delivery of dextran under driving pressures of 30, 60, and 90 psi. Figure 2b shows the percentage of cells with dextran delivered by endocytosis or SQZ-mediated delivery under driving pressures of 30, 60, and 90 psi. Figure 3 shows the effects of cell conditioning and co-administration of CpG in an antigen-specific immune response induced by SQZ-loaded B cells or splenocytes with OVA. Figure 4 shows the effects of splenocyte conditioning and co-administration of various concentrations of CpG on an antigen-specific immune response induced by SQZ-loaded, refined splenocytes with OVA. Figure 5 shows the effects of splenocyte conditioning and co-administration of CpG or IFNα on an antigen-specific immune response induced by SQZ-loaded, refined splenocytes with OVA. Figure 6 shows the antigen-specific immune response induced by SQZ-loaded conditioned, refined splenocytes when OVA was administered at different cellular doses as a single dose (Prime) or two doses (Prime-boost). Figure 7 shows antigen-specific immune responses induced by (a) SQZ-loaded OVA conditioned B cells or (b) SQZ-loaded OVA conditioned elaborated splenocytes when administered at different doses as a single dose (prime) or two doses (prime-boost). Figure 8 shows the effect of the conditioning (CpG incubation) period on an antigen-specific immune response induced by SQZ-loaded mature splenocytes with OVA. Figure 9 shows the dose-dependent effect of SQZ-loaded mature splenocytes on inhibiting E7-expressing TC1 tumors. Figure 10a shows the effect of CpG incubation on activation markers in B cell subpopulations within human PBMCs (top) and murine splenocytes (bottom). Figure 10b shows the change in cytokine / chemokine profile when human PBMC or murine splenocytes are incubated with CpG. Figure 11 shows changes in cell composition and MHC-I levels when human PBMCs are subjected to SQZ-mediated delivery at a driving pressure of 60 psi and a constriction width of 3.5 μm or 4 μm. Fig. 12a shows CD3 in human PBMCs applied to SQZ-mediated delivery at a driving pressure of 60 psi and a constriction width of 3.5 μm or 4 μm. + T cells or CD14 + It represents the viability and payload delivery of monocytes. Fig. 12b shows CD20 in human PBMCs applied to SQZ-mediated delivery at a driving pressure of 60 psi and a constriction width of 3.5 μm or 4 μm. + B cells or CD56 + It indicates the viability and payload delivery of NK cells. Figure 13 shows the correlation between delivery (bottom) and stimulation of E7-specific responder cells (top) in a subset of PBMC populations when co-cultured with mature human PBMCs loaded with E7 HPV antigen through an SQZ-mediated process using a 3.5 μm or 4 μm constriction width. Figure 14 shows the stimulation of E7-specific responder cells when co-cultured with mature human PBMCs loaded with E7 HPV antigen through an SQZ-mediated process with a driving pressure of 45 psi or 60 psi and a constriction width of 3.5 μm, 4 μm, or 4.5 μm, wherein the process is performed at RT (top) or on ice (bottom). The top panel of Fig. 15 shows the stimulation of pp65-specific responder cells when co-cultured with SQZ-loaded human PBMCs or SQZ-loaded human PBMCs matured into ajuvants with pp65 (in the presence or absence of 1 μM CpG). The bottom panel of Fig. 15 shows the stimulation of pp65-specific responder cells in the presence of 1 μM CpG when (a) pp65 is co-cultured with SQZ-loaded human PBMCs or pp65 is SQZ-loaded and matured into ajuvant human PBMCs; or (b) pp65 is co-cultured with SQZ-loaded human T cells or pp65 is SQZ-loaded and matured into ajuvant human T cells. Figure 16 shows the effects of (a) PBMC maturation by various ajuvants and (b) the concentration of pp65 antigen used for SQZ loading on the stimulation of pp65-specific responder cells when responders are co-cultured with mature human PBMCs loaded with pp65 CMV antigen. Figure 17 shows the effect of different ajuvant CpG, R837, and R848 on PBMC maturation with incubation times of 3 or 24 hours in the stimulation of pp65-specific responder cells when pp65 CMV antigen is co-cultured with SQZ-loaded mature human PBMCs. Figure 18 shows the effect of conditioning of splenocytes before and after SQZ-mediated loading in an antigen-specific response induced by conditioned murine splenocytes loaded with pp65 CMV antigen. Figure 19 shows the effect on tumor suppression when pp65-loaded splenocytes alone (Group B); chemotherapy (cisplatin) alone (Groups C, D, G); or a combination of pp65-loaded splenocytes and chemotherapy (Groups E, F, H) were administered to mice carrying E7-expressing tumors. Figure 20a shows the efficiency of SQZ-mediated delivery of 3 kDa dextran to a subgroup of human PBMCs at room temperature or on ice. Figure 20b shows the efficiency of SQZ-mediated delivery of 3 kDa dextran to a subgroup of human PBMCs at driving pressures of 50 psi or 70 psi. Figures 21a and b show the effects of splenocyte conditioning or CpG co-administration on tumor suppression (Figure 21a) and survival improvement (Figure 21b) when mice carrying E7-expressing tumors were administered SQZ-loaded refined murine splenocytes with E7 HPV antigen. Figure 22 shows the effect of splenic cell conditioning in the presence or absence of co-administration with CpG or IFNα in an antigen-specific response induced by SQZ-loaded OVA antigens in refined murine splenic cells. Figures 23a-23h show the effect of splenic cell conditioning in the presence or absence of incubation with CpG 1826 on the expression of B cell markers CD86 (Figures 23a-d) and H-2Kb (Figures 23e-h) in SQZ-processed or unprocessed refined murine splenic cells. Figures 24a-24d show the levels of circulating cytokines in untreated mice (Figure 24a), mice injected with 1 μg CpG 1826 IV alone (Figure 24b), mice immunized with e7 SLP SQZ-loaded refined murine splenocytes (Figure 24c), or mice co-injected with e7 SLP SQZ-loaded refined murine splenocytes and co-injected with 1 μg CpG 1826 IV (Figure 24d). Figure 25 shows the circulation kinetics of E7 SLP-loaded SQZ-refined murine splenocytes (M-SQZ-splenocyte-HPV) and unrefined refined murine splenocytes. Figures 26a–26e show the amount of E7-specific T cell infiltration, and Figure 26f shows the tumor volume over time after immunization with E7 SLP into SQZ-loaded refined murine splenocytes or unprocessed refined murine splenocytes. The percentage of CD8+ T cells per viable cell in the tumor environment and the number of CD8+ T cells per tumor mass are presented in Figures 26a and 26d, respectively. The percentage of E7-specific T cells per viable cell in the tumor environment and the number of E7-specific T cells per tumor mass are presented in Figures 26c and 26e, respectively. The percentage of E7-specific T cells per CD8+ T cell in the tumor environment is presented in Figure 26b. Figures 27a-27d show OVA-specific T cells (OT-I CD8) in WT or MHC-I - / - mice stimulated by SQZ-loaded OVA-O + Figures 27a and 27c show the respective OT-I proliferation in the recipient lymph nodes during two replicate experiments. Figures 27b and 27d show the respective OT-I proliferation in the recipient spleen during two replicate experiments. Figures 28a–28e show OT-I CD8 after co-culture with SQZ-loaded OVA-containing murine splenocytes (Figure 28a) or specified subsets of SQZ-loaded OVA-containing murine splenocytes (subsets of B cells, T cells, monocytes, and NK cells for Figures 28b, 28c, 28d, and 28e, respectively). + It represents the proliferation and expression of the activation marker CD69 in T cells. The top panels of Figs. 29a-29f show confocal imaging from the middle of the Z-stack for each sample, demonstrating localization of the plasma membrane (CD45 staining, PM, top panel); localization of FAM-labeled HPV SLP (SLP, 2nd panel from the top); and an overlay showing its relative localization (overlay, 3rd panel from the top), whereas the bottom panel of Fig. 29 shows a trace line across the center of the cell along the white line presented in each overlay panel for SQZ-processed human PBMCs in RPMI (Figs. 29a, 29c, 29e) or SQZ-loaded human PBMCs with FAM-labeled E6, E7, or E6+E7 SLP (Figs. 29b, 29d, 29f, respectively). Figure 30 shows the proliferation of gp100-specific T cells after co-injection of untreated (NC), incubated with (Incub. ctrl), SQZ-loaded with (Squeeze) gp100 SLP, or pulsed with (PP) gp100 SLP B cells, as measured by CFSE dilution (left panel) and subsequent quantification (right panel). Figure 31 shows changes in tumor volume of transplanted TC-1 tumors in mice that were either untreated or prophylactically administered refined splenocytes loaded with E7 SLP and SQZ. TC-1 tumors were transplanted into untreated cohort I on day 0. TC-1 tumors were transplanted into untreated cohort II on day 60. TC-1 tumors were transplanted into mice treated with SQZ-loaded splenocytes on both days 0 and 60. Figure 32 shows the change in tumor volume of transplanted TC-1 tumors after therapeutic treatment with E7 SLP-SQZ-loaded refined splenocytes. Mice were 0.1 x 10⁶ 6 or 1.0 x 10 6Canine SQZ-loaded splenocytes were treated and administered under a single dose of prime (on day 10 post-transplant) or prime and boost regimen (prime on day 10 post-transplant, boost on days 17 and 24). Figures 33a and b show the effects of splenocyte conditioning or CpG co-administration on tumor suppression (Figure 33a) and survival improvement (Figure 33b) when mice carrying E7-expressing tumors were administered SQZ-loaded refined murine splenocytes with HPV E7 antigen. Figure 34 shows the degree of MHC-I presentation of the epitope SIINFEKL (sequence identification number: 54) processed from OVA in splenocyte subpopulations of T cells, B cells, NK cells, and monocytes after SQZ-processing without cargo (SQZ alone) or SQZ-processing in the presence of OVA (SQZ + OVA). Figure 35 shows the dose-dependent efficacy of splenocyte administration in antigen-specific reactions induced by SQZ-loaded refined murine splenocytes with HPV16 E7 antigen. Figures 36a–36c show the amount of E7-specific T cell infiltration, and Figure 36d shows the tumor volume over time after immunizing or leaving untreated with SQZ-loaded, sophisticated murine splenocytes or peptide vaccines containing E7 SLP. The percentage of CD45+ leukocytes per viable cell in the tumor environment, the number of CD8+ T cells among CD45+ cells, and the percentage of E7-specific T cells per CD8+ T cell in the tumor environment are presented in Figures 36a, 36b, and 36c, respectively. Figure 37a shows the number of SQZ-treated cells in a typical study setting versus the number of SQZ-treated cells in a manufacturing setting. Figure 37b shows the viability of PBMCs after incubation with dextran or after SQZ-processing in the presence of dextran. Figure 37c shows the percentage of dextran-positive cells after SQZ-processing or incubation with dextran for PBMCs, as well as component cell types including B cells (CD20+), T cells (CD3+), NK cells (CD56+), and monocytes (CD14+). Figure 38a shows the percentage of CD86-expressing cells in PBMC subpopulations of B cells (CD19+), T cells (CD3+), NK cells (CD56+), and monocytes (CD14+) after leaving PBMCs untreated (NC), processing them with an empty payload (empty SQZ), or loading them with CD86-coding mRNA (SQZ). Figure 38b shows the percentage of IFNα2-expressing cells in PBMC subpopulations of B cells (CD19+), T cells (CD3+), NK cells (CD56+), and monocytes (CD14+) after processing them with an empty payload (empty SQZ) or loading them with IFNα2-coding mRNA (SQZ). Figure 39a shows the percentage of CD86-expression in a PBMC subpopulation of T cells (CD3+) over 72 hours after SQZ-processing PBMCs with an empty payload (empty SQZ) or SQZ-loading with CD86-coding mRNA (SQZ). Figure 39b shows the percentage of 4-1BBL-expressing cells in a PBMC subpopulation of T cells (CD3+) over 72 hours after SQZ-processing PBMCs with an empty payload (empty SQZ) or SQZ-loading with 4-1BBL-coding mRNA (SQZ). Figure 40 shows the amount of eGFP expression in PBMC subpopulations of T cells (CD3+) after SQZ-processing PBMCs with unmodified eGFP mRNA or eGFP mRNA having a 5-methoxyuridine backbone modification (5moU) at mRNA concentrations from 0 μg / mL to 200 μg / mL. Figure 41 shows the degree of secretion of IL-12, IFNα, or IL-2 cytokines by PBMC after leaving PBMC untreated (NC) or after SQZ-processing with mRNA encoding IL-12, IFNα, or IL-2, respectively (SQZ). Figure 42a shows a schematic diagram of signals 1, 2, and 3 from antigen-presenting cells enhanced in stimulating effector immune cell responses. Figure 42b shows the amount of signal 2 effector expression over 48 hours in PBMC subpopulations of B cells (CD19+), T cells (CD3+), NK cells (CD56+), and monocytes (CD14+) after SQZ-processing PBMCs with mRNA encoding CD70 or 4-1BBL, respectively. Figure 42c shows the amount of signal 3 effector secretion by PBMCs over 24 hours after SQZ-processing PBMCs with mRNA encoding IFNα2 or IL-2, respectively. Figure 43a shows the amount of eGFP translation and expression in PBMCs for unstimulated, ConA-stimulated before SQZ-processing, and conA-stimulated after SQZ-processing, where PBMCs were SQZ-processed in the presence of eGFP-coding mRNA. Figure 43b shows the amount of CD86 expression in PBMCs that were not or were stimulated with ConA before SQZ-processing when PBMCs were SQZ-processed in the presence of CD86-coding mRNA. Figure 44a shows a schematic diagram of an experiment investigating whether signal 2 and signal 3 effector mRNAs were translated in elaborated mouse splenocytes after SQZ-loading. Figure 44b shows the expression levels of CD70, CD80, CD86, or OX40L in elaborated murine splenocytes after SQZ-processing in the presence of mRNA encoding CD70, CD80, CD86, or OX40L, respectively. Figure 44c shows the secretion levels of IL-12, IL-2, or IFNα2 by elaborated murine splenocytes after SQZ-processing in the presence of mRNA encoding IL-12, IL-2, or IFNα2, respectively. Figure 45a shows a schematic diagram of an experiment investigating whether SQZ-loading of Signal 2 and Signal 3 effector mRNAs in refined murine splenocytes can enhance the ability to stimulate antigen-specific T cell responses. Figure 45b shows the degree of activation of OVA-specific T cells upon co-culture with refined murine splenocytes SQZ-loaded with OVA peptide and mRNA encoding a Signal 2 effector (CD70, CD80, or CD86). Figure 45c shows the degree of activation of OVA-specific T cells upon co-culture with refined murine splenocytes SQZ-loaded with OVA peptide and mRNA encoding the Signal 3 effector IL-2. Figure 46a shows the amount of activation of antigen-specific responder T cells upon co-culture with SQZ-loaded human PBMCs containing mRNA encoding each antigen (E7, HSV GD1, MART-1, pp65, or influenza M1). Figures 46b and 46c show the amount of translation and expression of E7 or M1 in PBMCs after SQZ-processing the PBMCs in the presence of mRNA encoding E7 or M1, respectively. Figure 47a shows a schematic diagram of an experiment comparing SQZ-loading of mRNA versus the protein type of the antigen in relation to the efficacy of loaded murine splenocytes in stimulating antigen-specific T cell responses. Figure 47b shows the amount of activated OVA-specific T cells upon co-culture with SQZ-loaded murine splenocytes containing OVA protein or OVA-coding mRNA. Figures 48a and 48b respectively show the experimental design and schematic diagram of an experiment to investigate whether the combination of E7-loaded refined splenocytes and anti-CTLA4 administration would induce an improved therapeutic effect on E7-bearing tumor TC1. Figures 48c, 48d, 48e, and 48f show the additive therapeutic effects of the combination of tumor antigen-loaded splenocytes and an immune checkpoint inhibitor in tumor growth inhibition (Figure 48c), delay or inhibition of tumor development (Figures 48d and 48e), and survival improvement (Figure 48f) when HPV E7 antigen-SQZ-loaded refined murine splenocytes were administered to mice bearing E7-expressing tumors with or without additional administration of an anti-CTLA4 antibody. Specific details for implementing the invention
[0029] Antigen-presenting cells (APCs) play a major role in inducing the endogenous activation of CTLs. In this work, the implementation of the Cell Squeeze® platform for manipulating peripheral blood mononuclear cells (PBMCs) for use in modulating immune responses for various indications, including cancer and infectious diseases, is described. By enabling the efficient cytosolic delivery of target antigens and / or ajuvants to PBMCs, this platform has demonstrated the ability to induce highly effective MHC-I presentation of target antigens and stimulation of CTLs in vivo. The inventors discovered that, unexpectedly, a mixed population of PBMCs exhibited greater efficacy than pure B cell and T cell populations alone. Furthermore, the inventors discovered, unexpectedly, that when administered to individuals, conditioned PBMCs with an ajuvant increased the activation of antigen-presenting cells, thereby inducing greater immunostimulation compared to unconditioned antigen-loaded PBMCs.
[0030] In some aspects, the present application provides a modified PBMC comprising an antigen and an ajuvant, wherein the antigen is present within the cell. In some embodiments, the PBMC containing the antigen is incubated in the presence of an ajuvant for a certain period of time before being administered to an individual (i.e., the PBMC is conditioned). In some embodiments, the PBMC is incubated in the presence of an ajuvant for a certain period of time before the antigen is introduced into the PBMC.
[0031] In some embodiments, the modified PBMC is prepared by a) passing an input PBMC cell suspension through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC, thereby causing disturbance of the input PBMC cells sufficiently large for the antigen to pass through to form a disturbed input PBMC; and b) incubating the disturbed input PBMC with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMC; thereby producing a modified PBMC containing the antigen. Additionally, a method is provided for using the modified PBMC to modulate an immune response in an individual, for example, to enhance an immune response in an individual. In some embodiments, the enhanced immune response is directed toward the antigen. In some embodiments, the cell-modified constriction is contained in a microfluidic channel, e.g., any microfluidic channel described herein.
[0032] General skills
[0033] The techniques and procedures described or mentioned herein are generally widely understood and commonly used using ordinary methodologies, e.g., the widely used methodologies described in the following literature: [Molecular Cloning: A Laboratory Manual (Sambrook et al., 4 thed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2012); Current Protocols in Molecular Biology (F.M. Ausubel, et al. eds., 2003); the series Methods in Enzymology (Academic Press, Inc.); PCR 2: A Practical Approach (M.J. MacPherson, B.D. Hames and G.R. Taylor eds., 1995); Antibodies, A Laboratory Manual (Harlow and Lane, eds., 1988); Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications (R.I. Freshney, 6 thed., J. Wiley and Sons, 2010); Oligonucleotide Synthesis (M.J. Gait, ed., 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (J.E. Cellis, ed., Academic Press, 1998); Introduction to Cell and Tissue Culture (J.P. Mather and P.E. Roberts, Plenum Press, 1998); Cell and Tissue Culture: Laboratory Procedures (A. Doyle, J.B. Griffiths, and D.G. Newell, eds., J. Wiley and Sons, 1993-8); Handbook of Experimental Immunology (D.M. Weir and C.C. Blackwell, eds., 1996); Gene Transfer Vectors for Mammalian Cells (J.M. Miller and M.P. Calos, eds., 1987); PCR: The Polymerase Chain Reaction, (Mullis et al., eds., 1994); Current Protocols in Immunology (J.E. Coligan et al., eds., 1991); Short Protocols in Molecular Biology (Ausubel et al., eds., J. Wiley and Sons, 2002); Immunobiology (C.A. Janeway et al., 2004); Antibodies (P. Finch, 1997); Antibodies: A Practical Approach (D. Catty., ed., IRL Press, 1988-1989); Monoclonal Antibodies: A Practical Approach (P.Shepherd and C. Dean, eds., Oxford University Press, 2000); Using Antibodies: A Laboratory Manual (E. Harlow and D. Lane, Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and JD Capra, eds., Harwood Academic Publishers, 1995); and Cancer: Principles and Practice of Oncology (VT DeVita et al., eds., JB Lippincott Company, 2011)].
[0034] definition
[0035] For the interpretation of this specification, the following definitions shall apply, and where appropriate, terms used in the singular form shall also include the plural form, and vice versa. In the event that any definition described below conflicts with any document incorporated herein by reference, the definition described below shall prevail.
[0036] As used herein, the singular form includes multiple referents unless otherwise indicated.
[0037] The aspects and embodiments of the invention described herein include those that "include," "are made up of," and "are essentially made up of" such aspects and embodiments.
[0038] As used herein, the term “approximately” refers to the normal range of error for each value that is readily known to a person skilled in the art. References to “approximately” values or parameters herein include (and describe) embodiments of the values or parameters themselves.
[0039] As used herein, “peripheral blood mononuclear cells” or “PBMC” refers to a heterogeneous population of blood cells having a round nucleus. Examples of cells that may be found in the PBMC population include lymphocytes, such as T cells, B cells, NK cells (including NKT cells and CIK cells), and monocytes, such as macrophages and dendritic cells. As used herein, “multiple PBMCs” refers to a preparation of PBMCs comprising at least two types of blood cells. In some embodiments, the multiple PBMCs comprise two or more of T cells, B cells, NK cells, macrophages, or dendritic cells. In some embodiments, the multiple PBMCs comprise three or more of T cells, B cells, NK cells, macrophages, or dendritic cells. In some embodiments, the multiple PBMCs comprise four or more of T cells, B cells, NK cells, macrophages, or dendritic cells. In some embodiments, the multiple PBMCs comprise T cells, B cells, NK cells, macrophages, and dendritic cells.
[0040] PBMCs may be isolated by means known in the relevant art. For example, PBMCs may be derived from an individual's peripheral blood based on the density of PBMCs compared to other blood cells. In some embodiments, PBMCs are derived from an individual's peripheral blood using a picol (e.g., a picol gradient). In some embodiments, PBMCs are derived from an individual's peripheral blood using an ELUTRA® cell separation system.
[0041] In some embodiments, the PBMC population is isolated from an individual. In some embodiments, a plurality of PBMCs is a self-PBMC population derived from a specific individual, manipulated by any method described herein, and returned to that specific individual. In some embodiments, a plurality of PBMCs is a homologous PBMC population derived from one individual, manipulated by any method described herein, and administered to a second individual.
[0042] In some embodiments, the plurality of PBMCs are reconstituted PBMC preparations. In some embodiments, the plurality of PBMCs may be generated by mixing cells typically found in a PBMC population; for example, by mixing two or more populations of T cells, B cells, NK cells, or monocytes. In some embodiments, the ratio of cells within the population of splenocytes is adjusted (e.g., refined) to better reflect the population profile of human PBMCs. For example, B cells may be taken from the population of splenocytes to better reflect the population of human PBMCs.
[0043] As used herein, the term “pore” refers to an opening in a material, including a hole, tear, cavity, gap, fracture, gap, or perforation. In some examples, (where indicated) this term refers to a pore within the surface of the present disclosure. In other examples, (where indicated) pore may refer to a pore within a cell membrane.
[0044] As used herein, the term “membrane” refers to a selective barrier or sheet containing pores. The term includes a flexible sheet-like structure acting as a boundary or lining. In some examples, the term refers to a surface or filter containing pores. The term is distinct from the term “cell membrane.”
[0045] As used herein, the term "filter" refers to a porous article that allows selective passage through pores. In some examples, this term refers to a surface or membrane containing pores.
[0046] As used herein, the term "non-homogeneous" refers to something that is mixed or non-uniform in terms of structure or composition. In some examples, this term refers to pores that vary in size, shape, or distribution within a given surface.
[0047] As used herein, the term "homogeneity" refers to consistency or uniformity in terms of structure or composition as a whole. In some examples, this term refers to pores that are consistent in size, shape, or distribution within a given surface.
[0048] The term "heterogeneity" when applied to nucleic acid sequences, such as coding and control sequences, generally refers to sequences that are not joined together and / or generally do not associate with a specific cell. Thus, a "heterogeneity" region of a nucleic acid construct or vector is a nucleic acid fragment within another nucleic acid molecule that is not found in nature associated with another molecule, or a nucleic acid fragment attached to such another nucleic acid molecule. For example, a heterogeneity region of a nucleic acid construct may include a coding sequence flanked with a sequence that is not found in nature associated with the coding sequence. Another example of a heterogeneity coding sequence is a construct in which the coding sequence itself is not found in nature (e.g., a synthetic sequence with codons different from a natural gene). Similarly, a cell transformed with a construct that does not normally exist within the cell will be considered heterogeneous for the purposes of the present invention. Allelic variation or naturally occurring mutation events do not produce heterogeneous DNA when used herein.
[0049] The term “heterogeneous” refers to a sequence that is not normally linked together and / or normally associated with a specific cell when relating to amino acid sequences, e.g., peptide sequences and polypeptide sequences. Thus, a “heterogeneous” region of a peptide sequence is a fragment of an amino acid within or attached to another amino acid molecule that is not found in nature associated with another molecule. For example, a heterogeneous region of a peptide construct may include an amino acid sequence of a peptide to which a sequence not found in nature associated with the amino acid sequence of the peptide is flanked. Another example of a heterogeneous peptide sequence is a construct in which the peptide sequence itself is not found in nature (e.g., a synthetic sequence having amino acids different from those encoded by a natural gene). Similarly, a cell transformed with a vector expressing an amino acid construct that is not normally present in the cell will be considered heterogeneous for the purposes of the present invention. Allelic variation or naturally occurring mutation events do not produce heterogeneous peptides as used herein.
[0050] The term "exogenous" refers to an agent delivered from outside the cell (i.e., from outside the cell) when used with respect to a cell, such as an antigen or ajuvant. The cell may or may not have the agent already present, and may or may not produce the agent after the exogenous agent is delivered.
[0051] As used herein, the term "inhibit" may refer to an action that blocks, reduces, eliminates, or otherwise antagonizes the presence or activity of a specific target. Inhibition may refer to partial or complete inhibition. For example, inhibiting an immune response may refer to any action resulting in the blocking, reduction, elimination, or any other antagonistic action of the immune response. In other examples, inhibition of nucleic acid expression may include, but is not limited to, a reduction in nucleic acid transcription, a reduction in mRNA abundance (e.g., silencing mRNA transcription), mRNA degradation, inhibition of mRNA translation, etc.
[0052] As used herein, the term "inhibit" may refer to an action that lowers, reduces, inhibits, restricts, alleviates, or otherwise lowers the presence or activity of a specific target. Inhibition may refer to partial or complete inhibition. For example, inhibiting an immune response may refer to any action that induces an immune response to be lowered, reduced, inhibited, restricted, alleviated, or otherwise lowered. In other examples, inhibition of nucleic acid expression may include, but is not limited to, a reduction in nucleic acid transcription, a reduction in mRNA abundance (e.g., silencing mRNA transcription), mRNA degradation, or inhibition of mRNA translation.
[0053] As used herein, the term "enhance" may refer to an action that improves, boosts, elevates, or otherwise increases the presence or activity of a specific target. For example, enhancing an immune response may refer to any action that improves, enhances, elevates, or otherwise increases an immune response. In one exemplary example, enhancing an immune response may refer to improving, boosting, elevating, or otherwise increasing an immune response using an antigen and / or ajuvant. In another example, enhancing nucleic acid expression may include, but is not limited to, an increase in nucleic acid transcription, an increase in mRNA abundance (e.g., an increase in mRNA transcription), a decrease in mRNA degradation, an increase in mRNA translation, etc.
[0054] As used herein, the term "modulate" may refer to an action that alters, changes, mutates, or otherwise modifies the presence or activity of a specific target. For example, modulating an immune response may refer to any action that induces an immune response to change, change, mutate, or otherwise modify. In other examples, modulating nucleic acid expression may include, but is not limited to, changes in nucleic acid transcription, changes in mRNA abundance (e.g., an increase in mRNA transcription), corresponding changes in mRNA degradation, changes in mRNA translation, etc.
[0055] As used herein, the term "induce" may refer to an action that initiates, triggers, stimulates, establishes, or otherwise produces a result. For example, induction of an immune response may refer to any action that induces the initiation, triggering, stimulating, establishing, or otherwise producing a desired immune response. In other examples, inducing nucleic acid expression may include, but is not limited to, the initiation of nucleic acid transcription, the initiation of mRNA translation, etc.
[0056] As used herein, the term "homology" refers to molecules derived from the same organism. In some examples, this term refers to nucleic acids or proteins that are normally found or expressed in a given organism.
[0057] As used herein, the terms “polynucleotide” or “nucleic acid” refer to polymeric forms of nucleotides of any length that are ribonucleotides or deoxyribonucleotides. Accordingly, these terms include, but are not limited to, polymers comprising single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or purine and pyrimidine bases, or other nucleotide bases that are natural, chemically or biochemically modified, non-natural, or derivatized. The backbone of the polynucleotide may comprise sugar and phosphate groups (typically as found in RNA or DNA), or modified or substituted sugar or phosphate groups. Alternatively, the backbone of the polynucleotide may comprise polymers of synthetic subunits, such as phosphoramidate and phosphorothioate, and thus may be oligodeoxynucleoside phosphoramidate (P-NH2) or mixed phosphoramidate-phosphodiester oligomers. In addition, a double-stranded polynucleotide can be obtained from a single-stranded polynucleotide product of chemical synthesis by synthesizing a complementary strand and annealing the strands under appropriate conditions, or by synthesizing a complementary strand by neogenesis using a DNA polymerase and a suitable primer.
[0058] The terms “polypeptide” and “protein” are used interchangeably to refer to polymers of amino acid residues and are not limited to a minimum length. Such polymers of amino acid residues may contain natural or non-natural amino acid residues and include, but are not limited to, peptides, oligopeptides, dimers, trimers, and multimers of amino acid residues. Both full-length proteins and their fragments are included in this definition. These terms also include post-translational modifications of polypeptides, e.g., glycosylation, sialylation, acetylation, phosphorylation, etc. Furthermore, for the purposes of the present invention, “polypeptide” refers to a protein comprising modifications to its natural sequence, such as deletions, additions, and substitutions (generally conserved in nature), provided that such a protein retains the desired activity. Such modifications may be intentional, such as through site-specific mutagenesis, or accidental, such as through mutations in the host producing the protein or errors resulting from PCR amplification.
[0059] As used herein, the term "azuvant" refers to a substance that directly or indirectly modulates or induces an immune response. Generally, an ajuvant is administered together with an antigen to bring about an enhancement of the immune response to the antigen compared to the antigen alone. In some embodiments, an ajuvant is used to condition multiple PBMCs (e.g., as demonstrated in the examples). Various ajuvants are described herein.
[0060] The terms “CpG oligodeoxynucleotide” and “CpG ODN” refer to DNA molecules containing dinucleotides of cytosine and guanine separated by phosphate (also referred to herein as “CpG” dinucleotide or “CpG”). The CpG ODN of this disclosure contains at least one unmethylated CpG dinucleotide. That is, cytosine within the CpG dinucleotide is not methylated (i.e., not 5-methylcytosine). The CpG ODN may have a partial or complete phosphothioate (PS) backbone.
[0061] As used herein, “pharmaceutical acceptable” or “pharmacologically compatible” means that the substance is not biologically or otherwise undesirable, and, for example, the substance may be included in a pharmaceutical composition administered to a patient without causing any serious undesirable biological effects or interacting in a harmful manner with any other component of the composition containing the substance. Pharmaceutically acceptable carriers or excipients preferably meet the required standards for toxicological and manufacturing tests and / or fall under the inert ingredient guidelines established by the U.S. Food and Drug Administration.
[0062] For any structural and functional features described herein, methods for determining such features are known in the relevant art.
[0063] Modified PBMC, composition, and method for producing modified PBMC
[0064] Modified PBMC
[0065] In certain aspects, a plurality of modified PBMCs containing an antigen are provided, wherein the antigen is exogenous to the modified PBMC. In other aspects, a plurality of modified PMBCs containing an antigen are provided, wherein the antigen is exogenous to the modified PBMC, and the antigen is a cancer antigen, an infectious disease antigen, or a virus-disease-associated antigen. In some aspects, a plurality of conditioned modified PBMCs containing an antigen are provided, wherein the antigen is exogenous to the modified PBMC. In some aspects, a plurality of conditioned modified PMBCs containing an antigen are provided, wherein the antigen is exogenous to the modified PBMC, and the antigen is a cancer antigen, an infectious disease antigen, or a virus-disease-associated antigen. In certain aspects, a plurality of conditioned modified PBMCs containing an antigen and an ajuvant are provided, wherein the antigen is exogenous to the modified PBMC. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs. In some embodiments, a plurality of PBMCs contain nucleic acids encoding the antigen. In some embodiments, a plurality of PBMCs contain mRNA encoding the antigen. In some embodiments, one or more nucleic acids are transported by one or more vehicles, wherein one or more vehicles are delivered to the input PBMC. In some embodiments, the vehicle is a virus or a virus-associated particle. In some embodiments, the virus includes one or more of adenoviruses, adeno-associated viruses (AAVs), baculoviruses, herpes viruses, or retroviruses. In some embodiments, the virus includes AAVs. In some embodiments, the vehicle is a lipid-based vehicle, e.g., a liposome. In some embodiments, the vehicle is a nanoparticle.
[0066] In some aspects, a plurality of modified PBMCs comprising an antigen comprising any one of the amino acid sequences of sequence identification numbers: 18-25 are provided. In other aspects, a plurality of conditioned modified PBMCs comprising an antigen comprising any one of the amino acid sequences of sequence identification numbers: 18-25 are provided.
[0067] In some aspects, a plurality of modified PBMCs comprising an antigen comprising the amino acid sequence of sequence identification number: 19 are provided. In other aspects, a plurality of conditioned modified PBMCs comprising an antigen comprising the amino acid sequence of sequence identification number: 19 are provided. In some aspects, a plurality of modified PBMCs comprising an antigen comprising the amino acid sequence of sequence identification number: 23 are provided. In other aspects, a plurality of conditioned modified PBMCs comprising an antigen comprising the amino acid sequence of sequence identification number: 23 are provided.
[0068] In some aspects, a plurality of conditioned PBMCs containing an antigen are provided, prepared by incubating a plurality of PBMCs containing an antigen with an ajuvant for a time sufficient for the PBMCs to be conditioned, thereby producing a plurality of conditioned PBMCs containing the antigen. In some embodiments, a plurality of conditioned PBMCs containing an antigen are provided, prepared by incubating a plurality of PBMCs with an ajuvant for a time sufficient for the PBMCs to be conditioned before introducing the antigen into the PBMCs, thereby producing a plurality of conditioned PBMCs containing the antigen.
[0069] In some aspects, a plurality of conditioned PBMCs comprising a nucleic acid encoding an antigen (e.g., mRNA) are provided, prepared by incubating a plurality of PBMCs containing an antigen with an ajuvant for a time sufficient for the PBMCs to be conditioned, thereby generating a plurality of conditioned PBMCs containing the antigen. In other aspects, a plurality of conditioned PBMCs comprising a nucleic acid encoding an antigen (e.g., mRNA) are provided, prepared by incubating a plurality of PBMCs with an ajuvant for a time sufficient for the PBMCs to be conditioned before introducing the antigen into the PBMCs, thereby generating a plurality of conditioned PBMCs containing the antigen.
[0070] Antigens and / or ajuvants may be introduced into PBMCs using constriction-mediated delivery (SQZ). Accordingly, in some aspects, a cell suspension comprising a plurality of input PBMCs is passed through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs large enough to allow the antigen to pass through, to form a plurality of disturbed input PBMCs; b) incubate the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen, provided by a method comprising: a) passing a cell suspension comprising a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs large enough to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0071] In some aspects, a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMC large enough for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen. A plurality of conditioned modified PBMCs containing the antigen are provided by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the method further comprises isolating a plurality of modified PBMCs containing antigens from a cell suspension before incubating with an ajuvant to condition the modified PBMCs. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as DNA, cDNA, mRNA, and plasmids, without limitation. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs. In some embodiments, one or more nucleic acids are carried by one or more vehicles, wherein one or more vehicles are delivered to the input PBMC. In some embodiments, the vehicle is a virus or a virus-associated particle. In some embodiments, the virus comprises one or more of adenoviruses, adeno-associated viruses (AAVs), baculoviruses, herpes viruses, or retroviruses. In some embodiments, the virus comprises AAVs.In some embodiments, the vehicle is a lipid-based vehicle, e.g., a liposome. In some embodiments, the vehicle is a nanoparticle.
[0072] In some aspects, a cell suspension comprising a plurality of input PBMCs is passed through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMC large enough for the antigen and ajuvant to pass through to form a plurality of disturbed input PBMCs; and b) incubate the plurality of disturbed input PBMCs with the antigen and ajuvant for a time sufficient to allow the antigen and ajuvant to enter the disturbed input PBMCs, thereby producing a plurality of conditioned modified PBMCs comprising the antigen and ajuvant, provided by a method comprising: a) passing a cell suspension comprising a plurality of input PBMCs with
[0073] In some aspects, a) a plurality of input PBMCs are incubated with an ajuvant for a time sufficient for the input PBMCs to be conditioned, thereby producing a plurality of input PBMCs conditioned by this method; b) a cell suspension containing a plurality of conditioned input PBMCs is passed through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMCs in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of conditioned disturbed input PBMCs; and c) a plurality of conditioned disturbed input PBMCs are incubated with an antigen for a time sufficient for the antigen to enter the disturbed input PBMCs, thereby producing a plurality of conditioned modified PBMCs conditioned by this method. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0074] In a specific aspect, a cell suspension comprising a plurality of input PBMCs comprising an ajuvant is passed through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMC sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; and b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient for the antigen to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs comprising the antigen and the ajuvant, provided by a method comprising: a) passing a cell suspension comprising a plurality of input PBMCs comprising an antigen through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMC sufficiently large for the ajuvant to pass through to form a plurality of disturbed input PBMCs; and b) a plurality of modified PBMCs comprising antigen and ajuvant, prepared by a method comprising the step of incubating a plurality of disturbed injected PBMCs with ajuvant for a sufficient time to allow the ajuvant to enter the disturbed injected PBMCs, thereby producing a plurality of modified PBMCs comprising antigen and ajuvant.
[0075] In some aspects, a cell suspension comprising a plurality of input PBMCs is passed through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubate the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubate the plurality of modified PBMCs containing the antigen with an ajuvant for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0076] In some aspects, a conditioned plurality of modified PBMCs containing human papillomavirus (HPV) antigens are provided, prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs large enough for human papillomavirus (HPV) antigens to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with HPV antigens for a time sufficient to allow HPV antigens to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing HPV antigens; and c) incubating the plurality of modified PBMCs containing HPV antigens with CpG ODN for a time sufficient to condition the modified PBMCs containing HPV antigens, thereby producing a plurality of conditioned modified PBMCs containing HPV antigens. In some embodiments, the HPV antigen comprises one or more proteins. In some embodiments, the HPV antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the HPV antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0077] In some aspects, a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for HPV antigens to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with HPV antigens for a time sufficient to allow HPV antigens to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing HPV antigens; and
[0078] c) A plurality of modified PBMCs containing HPV antigens are provided, prepared by a method comprising the step of incubating a plurality of modified PBMCs containing HPV antigens with a CpG ODN for a time sufficient for the modified PBMCs containing HPV antigens to be conditioned, wherein the CpG ODN is CpG 7909, thereby producing a plurality of modified PBMCs conditioned with HPV antigens. In some embodiments, the HPV antigen comprises one or more proteins. In some embodiments, the HPV antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as DNA, cDNA, mRNA, and plasmids, without limitation. In some embodiments, the HPV antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0079] In some aspects, a cell suspension comprising a plurality of input PBMCs is passed through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for about 1 hour to about 24 hours to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0080] In some aspects, a cell suspension comprising a plurality of input PBMCs is passed through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for HPV antigens to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with HPV antigens for a time sufficient to allow HPV antigens to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs comprising HPV antigens; and c) incubating the plurality of modified PBMCs comprising HPV antigens with CpG ODN for about 1 hour to about 24 hours to condition the modified PBMCs comprising HPV antigens, thereby producing a plurality of conditioned modified PBMCs comprising HPV antigens, provided by a method comprising: a) passing a cell suspension comprising a plurality of input PBMCs comprising a plurality of input PBMCs comprising HPV antigens with a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby producing a plurality of conditioned modified PBMCs comprising HPV antigens. In some embodiments, the HPV antigen comprises one or more proteins. In some embodiments, the HPV antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the HPV antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0081] In some aspects, a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for HPV antigens to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with HPV antigens for a time sufficient to allow HPV antigens to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing HPV antigens; and c) incubate a plurality of modified PBMCs containing HPV antigens with a CpG ODN for about 1 hour to about 24 hours so that the modified PBMCs containing HPV antigens are conditioned, wherein the CpG ODN is CpG 7909, thereby producing conditioned modified PBMCs containing HPV antigens, provided by a method comprising the step of conditioned modified PBMCs containing HPV antigens. In some embodiments, the HPV antigen comprises one or more proteins. In some embodiments, the HPV antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, e.g., DNA, cDNA, mRNA, and plasmids, without limitation. In some embodiments, the HPV antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0082] In some aspects, a cell suspension comprising a plurality of input PBMCs is passed through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubate the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubate the plurality of modified PBMCs containing the antigen with an ajuvant for about 1 hour to about 24 hours so that the modified PBMCs containing the antigen are conditioned, wherein the ajuvant is CpG 7909, thereby producing conditioned modified PBMCs containing the antigen, provided by a method comprising: a) a cell suspension comprising a plurality of input PBMCs containing a plurality of input PBMCs containing a plurality of input PBMCs containing the antigen, wherein the ajuvant is CpG 7909, thereby producing conditioned modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0083] In some embodiments according to any one of the plurality of modified PBMCs described herein, the diameter of the constriction is (a) about 4.2 μm to about 6 μm; or (b) about 4.5 μm. In some embodiments, the HPV antigen is incubated with CpG ODN for (a) about 2 hours to about 10 hours; (b) about 3 hours to about 6 hours; or (c) about 4 hours.
[0084] In some embodiments according to any one of the plurality of modified PBMCs described herein, the diameter of the constriction is about 3 μm to about 6 μm. In some embodiments, the HPV antigen is incubated with CpG ODN for (a) about 2 hours to about 10 hours; (b) about 3 hours to about 6 hours; or (c) about 4 hours.
[0085] In some embodiments according to any one of the plurality of modified PBMCs described herein, the diameter of the constriction is (a) about 4.2 μm to about 6 μm; or (b) about 4.5 μm. In some embodiments, the modified PBMC containing HPV antigen is incubated with CpG ODN for (a) about 2 hours to about 10 hours; (b) about 3 hours to about 6 hours; or (c) about 4 hours.
[0086] In some embodiments according to any one of the plurality of modified PBMCs described herein, the diameter of the constriction is about 3 μm to about 6 μm. In some embodiments, the modified PBMC containing HPV antigen is incubated with CpG ODN for (a) about 2 hours to about 10 hours; (b) about 3 hours to about 6 hours; or (c) about 4 hours.
[0087] In some aspects, a cell suspension comprising a plurality of input PBMCs is passed through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubate the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubate the plurality of modified PBMCs containing the antigen with a CpG ODN for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0088] In some aspects, a cell suspension comprising a plurality of input PBMCs is passed through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubate the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubate the plurality of modified PBMCs containing the antigen with a CpG ODN for a time sufficient to condition the modified PBMCs containing the antigen, wherein the CpG ODN is CpG 7909, thereby producing a plurality of conditioned modified PBMCs containing the antigen, provided by a method comprising: a) a cell suspension comprising a plurality of input PBMCs containing a plurality of input PBMCs containing a plurality of input PBMCs containing the antigen, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby producing a plurality of conditioned modified PBMCs containing the antigen.
[0089] In some aspects, a cell suspension comprising a plurality of input PBMCs is passed through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with a CpG ODN for about 1 hour to about 24 hours to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen, provided by a method comprising: a) a cell suspension comprising a plurality of input PBMCs containing a plurality of input PBMCs containing the antigen, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0090] In some aspects, a cell suspension comprising a plurality of input PBMCs is passed through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubate the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubate the plurality of modified PBMCs containing the antigen with a CpG ODN for about 1 hour to about 24 hours to condition the modified PBMCs containing the antigen, wherein the CpG ODN is CpG 7909, thereby producing a plurality of conditioned modified PBMCs containing the antigen, provided by a method comprising: a) a cell suspension comprising a plurality of input PBMCs containing a plurality of input PBMCs containing the antigen, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0091] In some embodiments according to any one of the plurality of modified PBMCs described herein, the diameter of the constriction is (a) about 4.2 μm to about 6 μm; or (b) about 4.5 μm. In some embodiments, the antigen is incubated with CpG ODN for (a) about 2 hours to about 10 hours; (b) about 3 hours to about 6 hours; or (c) about 4 hours.
[0092] In some embodiments according to any one of the plurality of modified PBMCs described herein, the diameter of the constriction is about 3 μm to about 6 μm. In some embodiments, the HPV antigen is incubated with CpG ODN for (a) about 2 hours to about 10 hours; (b) about 3 hours to about 6 hours; or (c) about 4 hours.
[0093] In some embodiments according to any one of the plurality of modified PBMCs described herein, the diameter of the constriction is (a) about 4.2 μm to about 6 μm; or (b) about 4.5 μm. In some embodiments, the modified PBMC containing the antigen is incubated with CpG ODN for (a) about 2 hours to about 10 hours; (b) about 3 hours to about 6 hours; or (c) about 4 hours.
[0094] In some embodiments according to any one of the plurality of modified PBMCs described herein, the diameter of the constriction is about 3 μm to about 6 μm. In some embodiments, the modified PBMC containing HPV antigen is incubated with CpG ODN for (a) about 2 hours to about 10 hours; (b) about 3 hours to about 6 hours; or (c) about 4 hours.
[0095] In some embodiments according to any one of the plurality of modified PBMCs described herein, the concentration of the antigen incubated with the perturbed input PBMC is about 0.1 μM to about 1 mM and / or the concentration of the ajuvant incubated with the perturbed input PBMC is about 0.1 μM to about 1 mM. In some embodiments, the concentration of the antigen incubated with the perturbed input PBMC is about 0.1 μM to about 10 μM and / or the concentration of the ajuvant incubated with the perturbed input PBMC is about 0.1 μM to about 10 μM. In some embodiments, the concentration of the antigen incubated with the perturbed input PBMC is about 1 μM and / or the concentration of the ajuvant incubated with the perturbed input PBMC is about 1 μM. In some embodiments, the ratio of antigen to ajuvant incubated with the perturbed input PBMC is about 10,000:1 to about 1:10,000. In some embodiments, the ratio of antigen to ajuvant incubated with the perturbed input PBMC is about 200:1. In some embodiments, the ratio of antigen to ajuvant incubated with the perturbed input PBMC is about 20:1. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0096] In some embodiments according to any one of the plurality of modified PBMCs described herein, the method further comprises incubating a plurality of modified PBMCs comprising an antigen and / or an ajuvant with a second ajuvant for a time sufficient for the modified PBMCs comprising the antigen to be conditioned, thereby producing a plurality of conditioned modified PBMCs comprising the antigen and / or an ajuvant. In some embodiments, the method further comprises isolating a plurality of modified PBMCs comprising the antigen and / or an ajuvant from a cell suspension before incubating with an ajuvant to conditioned the modified PBMCs.
[0097] In some embodiments according to any one of the plurality of modified PBMCs described herein, the antigen is present in the cytosol, and the ajuvant is present in vesicles of cells within the plurality of modified PBMCs. In some embodiments, the vesicles are endosomes. In some embodiments, the antigen and / or ajuvant are present in multiple compartments of cells within the plurality of modified PBMCs. In additional embodiments, the antigen and / or ajuvant are present in at least about 70% of the cells within the plurality of PBMCs. In some embodiments, the antigen and / or ajuvant are present in any one of at least about 70%, about 75%, about 80%, about 85%, about 95%, or about 99% of the cells within the plurality of PBMCs. In some embodiments, the antigen is bound to the surface of the cells within the plurality of modified PBMCs. In some embodiments, the antigen and / or ajuvant are present in at least about 70% of each of the T cells, B cells, NK cells, and monocytes within the plurality of PBMCs. In some embodiments, the antigen and / or ajuvant is present in at least about 70%, about 75%, about 80%, about 85%, about 95%, or about 99% of each of the T cells, B cells, NK cells, and monocytes in a plurality of PBMCs. In some embodiments, the antigen and / or ajuvant is present in at least about 70% of one or more of the T cells, B cells, NK cells, or monocytes in a plurality of PBMCs. In some embodiments, the antigen and / or ajuvant is present in at least about 70%, about 75%, about 80%, about 85%, about 95%, or about 99% of one or more of the T cells, B cells, NK cells, or monocytes in a plurality of PBMCs.
[0098] In some embodiments, a composition comprising any one of the plurality of modified PBMCs described herein is provided. In some embodiments, a composition comprising any one of the plurality of modified PBMCs described herein is provided for use as a medicine. In some embodiments, a composition comprising any one of the plurality of modified PBMCs described herein is provided for use in a method of treating a human or animal body by surgery, therapy, or diagnosis. In some embodiments, a composition for use in treating cancer or an infectious disease comprising any one of the plurality of modified PBMCs described herein is provided. In some embodiments, a composition comprising any one of the plurality of modified PBMCs described herein is provided for use in treating cancer, an infectious disease, or a virus-associated disease. In some embodiments, the cancer is any one of head and neck cancer, cervical cancer, vulvar cancer, vaginal cancer, penile cancer, anal cancer, perianal cancer, anogenital cancer, oral cancer, or salivary gland cancer. In some embodiments, the infectious disease is associated with HIV, HPV, EBV, MCV, HBV, or HCV. In some embodiments, there is a pharmaceutical composition comprising any one of the plurality of modified PBMCs described herein and a pharmaceutically acceptable carrier. In some embodiments, the composition is intended for the treatment of cancer or infectious diseases.
[0099] In some embodiments according to any one of the methods, compositions, or plurality of modified PBMCs described herein, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs. In some embodiments, the plurality of PBMCs comprises nucleic acids encoding the antigen. In some embodiments, the plurality of PBMCs comprises mRNA encoding the antigen.
[0100] composition
[0101] In a particular aspect, a composition is provided comprising a plurality of conditioned modified PBMCs containing an antigen for use as a medicine, wherein the conditioned plurality of modified PBMCs are prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0102] In some aspects, a composition comprising a plurality of conditioned modified PBMCs containing an antigen is provided for use in a method of treating a human or animal body by surgery, therapy, or diagnosis, wherein the conditioned plurality of modified PBMCs are prepared by a method comprising: a) passing a cell suspension comprising a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0103] In some aspects, a composition is provided comprising a plurality of conditioned modified PBMCs containing an antigen for use as a medicine, wherein the conditioned plurality of modified PBMCs are prepared by a method comprising: a) incubating a plurality of conditioned PBMCs with an ajuvant for a time sufficient to condition the conditioned PBMCs, thereby producing a plurality of conditioned conditioned PBMCs; b) passing a cell suspension containing a plurality of conditioned conditioned PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the conditioned PBMC in the suspension, thereby causing disturbance of the conditioned PBMCs sufficiently large for the antigen to pass through to form a plurality of conditioned disturbed conditioned PBMCs; and c) incubating a plurality of conditioned disturbed conditioned PBMCs with an antigen for a time sufficient to allow the antigen to enter the disturbed conditioned PBMCs, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0104] In some aspects, a composition is provided comprising a plurality of conditioned modified PBMCs containing an antigen for use in a method of treating a human or animal body, wherein the conditioned plurality of modified PBMCs are prepared by a method comprising: a) incubating a plurality of conditioned PBMCs with an ajuvant for a time sufficient for the conditioned PBMCs to be conditioned, thereby producing a plurality of conditioned conditioned PBMCs; b) passing a cell suspension containing a plurality of conditioned conditioned PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the conditioned PBMC in the suspension, thereby causing disturbance of the conditioned PBMCs sufficiently large for the antigen to pass through to form a plurality of conditioned disturbed conditioned PBMCs; and c) incubating a plurality of conditioned disturbed conditioned PBMCs with an antigen for a time sufficient for the antigen to enter the disturbed conditioned PBMCs, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0105] In some aspects, a composition comprising a plurality of conditioned modified PBMCs containing an antigen is provided for use in a method for treating cancer, infectious disease or virus-associated disease in an individual, wherein the conditioned plurality of modified PBMCs are prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0106] In some aspects, a composition is provided comprising a plurality of conditioned modified PBMCs containing an antigen for use in the treatment of cancer, infectious disease or virus-associated disease in an individual, wherein the conditioned plurality of modified PBMCs are prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0107] In some aspects, a composition comprising a plurality of conditioned modified PBMCs containing an antigen is provided for use in a method for treating HPV-associated disease in an individual, wherein the conditioned plurality of modified PBMCs are prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0108] In some aspects, a composition is provided comprising a plurality of conditioned modified PBMCs containing an antigen for use in the treatment of HPV-associated disease in an individual, wherein the conditioned plurality of modified PBMCs are prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0109] In some aspects, use of a composition comprising a plurality of conditioned modified PBMCs containing an antigen is provided in the manufacture of a medicine for treating cancer, infectious disease or virus-associated disease in an individual, wherein the conditioned plurality of modified PBMCs are prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0110] In some aspects, use of a composition comprising a plurality of conditioned modified PBMCs containing an antigen in the manufacture of a medicine for treating HPV-associated diseases is provided, wherein the conditioned plurality of modified PBMCs are prepared by a method comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0111] In some embodiments according to any one of the compositions described herein, the concentration of the antigen incubated with the perturbed input PBMC is about 0.1 μM to about 1 mM and / or the concentration of the ajuvant incubated with the perturbed input PBMC is about 0.1 μM to about 1 mM. In some embodiments, the concentration of the antigen incubated with the perturbed input PBMC is about 0.1 μM to about 10 μM and / or the concentration of the ajuvant incubated with the perturbed input PBMC is about 0.1 μM to about 10 μM. In some embodiments, the concentration of the antigen incubated with the perturbed input PBMC is about 1 μM and / or the concentration of the ajuvant incubated with the perturbed input PBMC is about 1 μM. In some embodiments, the ratio of antigen to ajuvant incubated with the perturbed input PBMC is about 10,000:1 to about 1:10,000. In some embodiments, the ratio of antigen to ajuvant incubated with the perturbed input PBMC is about 200:1. In some embodiments, the ratio of antigen to ajuvant incubated with the perturbed input PBMC is about 20:1. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0112] In some embodiments according to any one of the compositions described herein, the method further comprises incubating a plurality of modified PBMCs containing an antigen and / or ajuvant with a second ajuvant for a time sufficient for the modified PBMCs containing the antigen to be conditioned, thereby producing a plurality of conditioned modified PBMCs containing the antigen and / or ajuvant. In some embodiments, the method further comprises isolating a plurality of modified PBMCs containing the antigen and / or ajuvant from a cell suspension before incubating with an ajuvant to conditioned the modified PBMCs.
[0113] In some embodiments according to any one of the compositions described herein, the antigen is present in the cytosol, and the ajuvant is present in vesicles of cells within a plurality of modified PBMCs. In some embodiments, the vesicles are endosomes. In some embodiments, the antigen and / or ajuvant are present in multiple compartments of cells within a plurality of modified PBMCs. In additional embodiments, the antigen and / or ajuvant are present in at least about 70% of the cells within a plurality of PBMCs. In some embodiments, the antigen and / or ajuvant are present in any one of at least about 70%, about 75%, about 80%, about 85%, about 95%, or about 99%, or 100% of the cells within a plurality of PBMCs. In some embodiments, the antigen is bound to the surface of cells within a plurality of modified PBMCs.
[0114] In some embodiments according to any one of the methods, compositions, or plurality of modified PBMCs described herein, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs. In some embodiments, the plurality of PBMCs comprises nucleic acids encoding the antigen. In some embodiments, the plurality of PBMCs comprises mRNA encoding the antigen.
[0115] Method for generating multiple modified PBMCs
[0116] In some aspects, a method for generating a plurality of conditioned PBMCs containing an antigen is also provided, comprising incubating a plurality of PBMCs containing an antigen with an ajuvant for a time sufficient for the PBMCs to be conditioned, thereby generating a plurality of conditioned PBMCs containing the antigen.
[0117] In some aspects, there exists a method for producing a plurality of conditioned modified PBMCs containing an antigen, comprising: a) passing a cell suspension containing a plurality of conditioned PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the conditioned PBMC in the suspension, thereby causing disturbance of the conditioned PBMCs large enough for an antigen to pass through to form a plurality of disturbed conditioned PBMCs; b) incubating the plurality of disturbed conditioned PBMCs with an antigen for a time sufficient to allow the antigen to enter the disturbed conditioned PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0118] In some aspects, a method for generating a plurality of modified PBMCs containing an antigen is provided, comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; and b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0119] In some aspects, a method for generating a plurality of modified PBMCs containing antigens and ajuvants is provided, comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs large enough to allow the antigens and ajuvants to pass through, thereby forming a plurality of disturbed input PBMCs; and b) incubating the plurality of disturbed input PBMCs with the antigens and ajuvants for a time sufficient to allow the antigens and ajuvants to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing antigens and ajuvants. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0120] In some aspects, a method for producing a plurality of conditioned modified PBMCs containing an antigen is provided, comprising: a) incubating a plurality of conditioned PBMCs with an ajuvant for a time sufficient for the conditioned PBMCs to be conditioned, thereby producing a plurality of conditioned PBMCs; b) passing a cell suspension containing a plurality of conditioned PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the conditioned PBMCs in the suspension, thereby causing disturbance of the conditioned PBMCs sufficiently large for the antigen to pass through to form a plurality of conditioned disturbed PBMCs; and c) incubating a plurality of conditioned disturbed PBMCs with an antigen for a time sufficient for the antigen to enter the disturbed PBMCs, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0121] In a particular aspect, a method for generating a plurality of modified PBMCs comprising an antigen and an ajuvant is provided, comprising: a) passing a cell suspension comprising a plurality of input PBMCs comprising an ajuvant through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; and b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs comprising the antigen and the ajuvant. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0122] In some aspects, a method for generating a plurality of modified PBMCs containing an antigen and an ajuvant is provided, comprising: a) passing a cell suspension containing a plurality of input PBMCs containing an antigen through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for an ajuvant to pass through to form a plurality of disturbed input PBMCs; and b) incubating the plurality of disturbed input PBMCs with the ajuvant for a sufficient time to allow the ajuvant to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing an antigen and an ajuvant.
[0123] In a particular aspect, a method for producing a plurality of conditioned modified PBMCs containing an antigen is provided, comprising: a) passing a cell suspension containing a plurality of conditioned PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the conditioned PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed conditioned PBMCs; b) incubating the plurality of disturbed conditioned PBMCs with an antigen for a time sufficient to allow the antigen to enter the disturbed conditioned PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0124] In a specific aspect, a method for producing a plurality of conditioned modified PBMCs containing human papillomavirus (HPV) antigens is provided, comprising: a) passing a cell suspension containing a plurality of conditioned PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the conditioned PBMCs sufficiently large for HPV antigens to pass through to form a plurality of disturbed conditioned PBMCs; b) incubating the plurality of disturbed conditioned PBMCs with HPV antigens for a time sufficient to allow human papillomavirus (HPV) antigens to enter the disturbed conditioned PBMCs, thereby producing a plurality of modified PBMCs containing HPV antigens; and c) incubating the plurality of modified PBMCs containing HPV antigens with CpG ODN for a time sufficient to condition the modified PBMCs containing HPV antigens, thereby producing a plurality of conditioned modified PBMCs containing HPV antigens. In some embodiments, the HPV antigen comprises one or more proteins. In some embodiments, the HPV antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the HPV antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0125] In some aspects, a method for producing a plurality of conditioned modified PBMCs containing HPV antigens is provided, comprising: a) passing a cell suspension containing a plurality of conditioned PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the conditioned PBMCs sufficiently large for HPV antigens to pass through to form a plurality of disturbed conditioned PBMCs; b) incubating the plurality of disturbed conditioned PBMCs with HPV antigens for a time sufficient to allow HPV antigens to enter the disturbed conditioned PBMCs, thereby producing a plurality of modified PBMCs containing HPV antigens; and c) incubating the plurality of modified PBMCs containing HPV antigens with a CpG ODN for a time sufficient to condition the modified PBMCs containing HPV antigens, wherein the CpG ODN is CpG 7909, thereby producing a plurality of conditioned modified PBMCs containing HPV antigens. In some embodiments, the HPV antigen comprises one or more proteins. In some embodiments, the HPV antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the HPV antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0126] In some aspects, a method for producing a plurality of conditioned modified PBMCs containing HPV antigens is provided, comprising: a) passing a cell suspension containing a plurality of conditioned PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the conditioned PBMCs sufficiently large for HPV antigens to pass through to form a plurality of disturbed conditioned PBMCs; b) incubating the plurality of disturbed conditioned PBMCs with HPV antigens for a time sufficient to allow HPV antigens to enter the disturbed conditioned PBMCs, thereby producing a plurality of modified PBMCs containing HPV antigens; and c) incubating the plurality of modified PBMCs containing HPV antigens with CpG ODN for about 1 hour to about 24 hours to condition the modified PBMCs containing HPV antigens, thereby producing a plurality of conditioned modified PBMCs containing HPV antigens. In some embodiments, the HPV antigens comprise one or more proteins. In some embodiments, the HPV antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the HPV antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0127] In some aspects, a method for producing a plurality of conditioned modified PBMCs containing HPV antigens is provided, comprising: a) passing a cell suspension containing a plurality of conditioned PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the conditioned PBMCs sufficiently large for HPV antigens to pass through to form a plurality of disturbed conditioned PBMCs; b) incubating the plurality of disturbed conditioned PBMCs with HPV antigens for a time sufficient to allow HPV antigens to enter the disturbed conditioned PBMCs, thereby producing a plurality of modified PBMCs containing HPV antigens; and c) incubating the plurality of modified PBMCs containing HPV antigens with a CpG ODN for about 1 hour to about 24 hours to condition the modified PBMCs containing HPV antigens, wherein the CpG ODN is CpG 7909, thereby producing a plurality of conditioned modified PBMCs containing HPV antigens. In some embodiments, the HPV antigen comprises one or more proteins. In some embodiments, the HPV antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the HPV antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0128] In some aspects, a method for producing a plurality of conditioned modified PBMCs containing an antigen is provided, comprising: a) passing a cell suspension containing a plurality of conditioned PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the conditioned PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed conditioned PBMCs; b) incubating the plurality of disturbed conditioned PBMCs with an antigen for a time sufficient to allow the antigen to enter the disturbed conditioned PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for about 1 hour to about 24 hours so that the modified PBMCs containing the antigen are conditioned, wherein the ajuvant is CpG 7909, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0129] In some embodiments according to any one of the methods described herein, the diameter of the constriction is (a) about 4.2 μm to about 6 μm; or (b) about 4.5 μm. In some embodiments, the diameter of the constriction is about 3 μm to about 6 μm. In some embodiments, a plurality of modified PBMCs containing HPV antigens are incubated with CpG ODN for (a) about 2 hours to about 10 hours; (b) about 3 hours to about 6 hours; or (c) about 4 hours.
[0130] In some embodiments according to any one of the methods described herein, the diameter of the constriction is (a) about 4.2 μm to about 6 μm; or (b) about 4.5 μm. In some embodiments, the diameter of the constriction is about 3 μm to about 6 μm. In some embodiments, a plurality of modified PBMCs containing antigens are incubated with an ajuvant for (a) about 2 hours to about 10 hours; (b) about 3 hours to about 6 hours; or (c) about 4 hours.
[0131] In some aspects, a method for producing a plurality of conditioned modified PBMCs containing an antigen is provided, comprising: a) passing a cell suspension containing a plurality of conditioned PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the conditioned PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed conditioned PBMCs; b) incubating the plurality of disturbed conditioned PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed conditioned PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with a CpG ODN for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0132] In some aspects, a method for producing a plurality of conditioned modified PBMCs containing an antigen is provided, comprising: a) passing a cell suspension containing a plurality of conditioned PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the conditioned PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed conditioned PBMCs; b) incubating the plurality of disturbed conditioned PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed conditioned PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with a CpG ODN for a time sufficient to condition the modified PBMCs containing the antigen, wherein the CpG ODN is CpG 7909, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0133] In some aspects, a method for producing a plurality of conditioned modified PBMCs containing an antigen is provided, comprising: a) passing a cell suspension containing a plurality of conditioned PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the conditioned PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed conditioned PBMCs; b) incubating the plurality of disturbed conditioned PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed conditioned PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; and c) incubating the plurality of modified PBMCs containing the antigen with a CpG ODN for about 1 hour to about 24 hours to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0134] In some aspects, a method for producing a plurality of modified PBMCs conditioned to contain an antigen is provided, comprising: a) passing a cell suspension containing a plurality of modified PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the modified PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed modified PBMCs; b) incubating the plurality of disturbed modified PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed modified PBMCs, thereby producing a plurality of modified PBMCs conditioned to contain the antigen; and c) incubating the plurality of modified PBMCs conditioned to contain the antigen with a CpG ODN for about 1 hour to about 24 hours to condition the modified PBMCs conditioned to contain the antigen, wherein the CpG ODN is CpG 7909, thereby producing a plurality of conditioned modified PBMCs conditioned to contain the antigen. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0135] In some embodiments according to any one of the methods described herein, the diameter of the constriction is (a) about 4.2 μm to about 6 μm; or (b) about 4.5 μm. In some embodiments, the diameter of the constriction is about 3 μm to about 6 μm. In some embodiments, a plurality of modified PBMCs containing antigens are incubated with CpG ODN for (a) about 2 hours to about 10 hours; (b) about 3 hours to about 6 hours; or (c) about 4 hours.
[0136] In some embodiments according to any one of the methods described herein, the diameter of the constriction is (a) about 4.2 μm to about 6 μm; or (b) about 4.5 μm. In some embodiments, the diameter of the constriction is about 3 μm to about 6 μm. In some embodiments, a plurality of modified PBMCs containing antigens are incubated with an ajuvant for (a) about 2 hours to about 10 hours; (b) about 3 hours to about 6 hours; or (c) about 4 hours.
[0137] In some embodiments according to any one of the methods described herein, the concentration of the antigen incubated with the perturbed input PBMC is about 0.1 μM to about 1 mM and / or the concentration of the ajuvant incubated with the perturbed input PBMC is about 0.1 μM to about 1 mM. In some embodiments, the concentration of the antigen incubated with the perturbed input PBMC is about 0.1 μM to about 10 μM and / or the concentration of the ajuvant incubated with the perturbed input PBMC is about 0.1 μM to about 10 μM. In some embodiments, the concentration of the antigen incubated with the perturbed input PBMC is about 1 μM and / or the concentration of the ajuvant incubated with the perturbed input PBMC is about 1 μM. In some embodiments, the ratio of antigen to ajuvant incubated with the perturbed input PBMC is about 10,000:1 to about 1:10,000. In some embodiments, the ratio of antigen to ajuvant incubated with the perturbed input PBMC is about 200:1. In some embodiments, the ratio of antigen to ajuvant incubated with the perturbed input PBMC is about 20:1.
[0138] In some embodiments according to any one of the methods described herein, the method further comprises incubating a plurality of modified PBMCs containing an antigen and / or ajuvant with a second ajuvant for a time sufficient for the modified PBMCs containing the antigen to be conditioned, thereby producing a plurality of conditioned modified PBMCs containing the antigen and / or ajuvant. In some embodiments, the method further comprises isolating a plurality of modified PBMCs containing the antigen and / or ajuvant from a cell suspension before incubating with an ajuvant to conditioned the modified PBMCs.
[0139] In some embodiments according to any one of the methods described herein, the antigen is present in the cytosol, and the ajuvant is present in vesicles of cells within a plurality of modified PBMCs. In some embodiments, the vesicles are endosomes. In some embodiments, the antigen and / or ajuvant are present in multiple compartments of cells within a plurality of modified PBMCs. In additional embodiments, the antigen and / or ajuvant are present in at least about 70% of the cells within a plurality of PBMCs. In some embodiments, the antigen and / or ajuvant are present in any one of at least about 70%, about 75%, about 80%, about 85%, about 95%, or about 99%, or 100% of the cells within a plurality of PBMCs. In some embodiments, the antigen is bound to the surface of cells within a plurality of modified PBMCs. In some embodiments, the antigen and / or ajuvant is present in at least about 70%, about 75%, about 80%, about 85%, about 95%, or about 99%, or 100% of each of the T cells, B cells, NK cells, and monocytes in a plurality of modified PBMCs. In some embodiments, the antigen and / or ajuvant is present in at least about 70%, about 75%, about 80%, about 85%, about 95%, or about 99%, or 100% of one or more of the T cells, B cells, NK cells, or monocytes in a plurality of modified PBMCs.
[0140] In some embodiments according to any one of the methods described herein, the method further comprises the step of incubating the input PBMC and / or modified PBMC with an agent that enhances the viability and / or function of the modified PBMC compared to a corresponding modified PBMC prepared without an additional incubation step.
[0141] Methods to stimulate a response in an individual
[0142] In some aspects, the present invention provides a method for treating and preventing cancer or infectious disease and / or modulating an immune response in an individual having cancer or infectious disease, comprising administering a composition comprising a plurality of modified PBMCs to an individual having cancer or infectious disease, wherein the modified PBMCs contain an antigen associated with cancer or infectious disease within the cell.
[0143] In some embodiments, a method for stimulating an immune response in an individual is provided, comprising administering any one of a plurality of modified PBMCs, compositions, or pharmaceutical compositions described herein to the individual.
[0144] In a specific aspect, a method for stimulating an immune response in an individual is provided, comprising: a) administering a plurality of modified PBMCs containing an antigen having any one of the amino acid sequences of sequence identification numbers: 18-25 to the individual; and b) administering an ajuvant to the individual.
[0145] In a specific aspect, a method for stimulating an immune response in an individual is provided, comprising: a) incubating a plurality of PBMCs containing an antigen with an ajuvant for a time sufficient for the PBMCs to be conditioned, thereby generating a plurality of conditioned PBMCs containing the antigen; and b) administering a plurality of conditioned PBMCs containing the antigen to an individual.
[0146] In some aspects, a method for stimulating an immune response in an individual is provided, comprising: a) incubating a plurality of PBMCs with an ajuvant for a time sufficient for the PBMCs to be conditioned, thereby generating a plurality of conditioned PBMCs containing an antigen; b) introducing an antigen into the plurality of PBMCs; and c) administering the plurality of conditioned PBMCs containing the antigen to an individual.
[0147] In some aspects, a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMC large enough for an antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with an antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing the antigen; c) incubating the plurality of modified PBMCs containing the antigen with an ajuvant for a time sufficient to condition the modified PBMCs containing the antigen, thereby generating a plurality of conditioned modified PBMCs containing the antigen; and d) administering the plurality of conditioned modified PBMCs containing the antigen to the individual. A method for stimulating an immune response in an individual is provided. In some embodiments, the method further comprises isolating a plurality of modified PBMCs containing antigens from a cell suspension prior to incubation with an ajuvant. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0148] In some aspects, a method for stimulating an immune response in an individual is provided, comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen and ajuvant to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen and ajuvant for a time sufficient to allow the antigen and ajuvant to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing the antigen and ajuvant; and c) administering the plurality of modified PBMCs to an individual. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as DNA, cDNA, mRNA, and plasmids, without limitation. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0149] In some aspects, a method for stimulating an immune response in an individual is provided, comprising: a) incubating a plurality of injectable PBMCs with an ajuvant for a time sufficient for the injectable PBMCs to be conditioned, thereby producing a plurality of conditioned injectable PBMCs; b) passing a cell suspension containing a plurality of conditioned injectable PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the injectable PBMCs in the suspension, thereby causing disturbance of the injectable PBMCs large enough for the antigen to pass through to form a plurality of conditioned, disturbed injectable PBMCs; c) incubating a plurality of conditioned, disturbed injectable PBMCs with an antigen for a time sufficient for the antigen to enter the disturbed injectable PBMCs, thereby producing a plurality of conditioned, modified PBMCs containing the antigen; and d) administering a plurality of conditioned, modified PBMCs to an individual. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0150] In some aspects, a method for stimulating an immune response in an individual is provided, comprising: a) passing a cell suspension containing a plurality of input PBMCs containing an ajuvant through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing the antigen and the ajuvant; and c) administering the plurality of modified PBMCs to an individual. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0151] In a specific aspect, a method for stimulating an immune response in an individual is provided, comprising: a) passing a cell suspension containing an input PBMC containing an antigen through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMC large enough for an ajuvant to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with an ajuvant for a time sufficient to allow the ajuvant to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing the antigen and the ajuvant; and c) administering the plurality of modified PBMCs to an individual. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0152] In some aspects, a method for stimulating an immune response in an individual is provided, comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs large enough for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing the antigen; c) administering the plurality of modified PBMCs to an individual; and d) administering an ajuvant to an individual. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0153] In some aspects, a) passing a cell suspension containing an input PBMC containing an antigen through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMC large enough for an ajuvant to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with an ajuvant for a time sufficient to allow the ajuvant to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing the antigen and the ajuvant; and c) administering the plurality of modified PBMCs to an individual; and d) administering the ajuvant to an individual. A method for stimulating an immune response in an individual is provided.
[0154] In some aspects, a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs large enough for HPV antigens to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with HPV antigens for a time sufficient to allow HPV antigens to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing HPV antigens; c) incubating the plurality of modified PBMCs containing HPV antigens with CpG ODN for a time sufficient to condition the modified PBMCs containing HPV antigens, thereby generating a plurality of conditioned modified PBMCs containing HPV antigens; and d) administering the plurality of conditioned modified PBMCs containing HPV antigens to an individual. A method for stimulating an immune response to HPV antigens in an individual is provided. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0155] In some aspects, a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for HPV antigens to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with HPV antigens for a time sufficient to allow HPV antigens to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing HPV antigens; c) incubating the plurality of modified PBMCs containing HPV antigens with CpG ODN for a time sufficient to condition the modified PBMCs containing HPV antigens, wherein the CpG ODN is CpG 7909, thereby generating a plurality of conditioned modified PBMCs containing HPV antigens; A method for stimulating an immune response to an HPV antigen in an individual is provided, comprising the step of d) administering a plurality of conditioned modified PBMCs containing an HPV antigen to the individual. In some embodiments, the HPV antigen comprises one or more proteins. In some embodiments, the HPV antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as DNA, cDNA, mRNA, and plasmids, without limitation. In some embodiments, the HPV antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0156] In some aspects, a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for HPV antigens to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with HPV antigens for a time sufficient to allow HPV antigens to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing HPV antigens; c) incubating the plurality of modified PBMCs containing HPV antigens with CpG ODN for about 1 hour to about 24 hours to condition the modified PBMCs containing HPV antigens, thereby generating a plurality of conditioned modified PBMCs containing HPV antigens; A method for stimulating an immune response to an HPV antigen in an individual is provided, comprising the step of d) administering a plurality of conditioned modified PBMCs containing an HPV antigen to the individual. In some embodiments, the HPV antigen comprises one or more proteins. In some embodiments, the HPV antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as DNA, cDNA, mRNA, and plasmids, without limitation. In some embodiments, the HPV antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0157] In some aspects, a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for HPV antigens to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with HPV antigens for a time sufficient to allow HPV antigens to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing HPV antigens; c) incubating the plurality of modified PBMCs containing HPV antigens with CpG ODN for about 1 hour to about 24 hours so that the modified PBMCs containing HPV antigens are conditioned, wherein the CpG ODN is CpG 7909, thereby generating a plurality of conditioned modified PBMCs containing HPV antigens; A method for stimulating an immune response to an HPV antigen in an individual is provided, comprising the step of d) administering a plurality of conditioned modified PBMCs containing an HPV antigen to the individual. In some embodiments, the HPV antigen comprises one or more proteins. In some embodiments, the HPV antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as DNA, cDNA, mRNA, and plasmids, without limitation. In some embodiments, the HPV antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0158] In some embodiments according to any one of the methods described herein, the diameter of the constriction is about 4 μm to about 10 μm. In some embodiments, the diameter of the constriction is about 3 μm to about 6 μm. In some embodiments, the diameter of the constriction is (a) about 4.2 μm to about 6 μm; or (b) about 4.5 μm. In some embodiments, a plurality of modified PBMCs containing HPV antigens are incubated with CpG ODN for (a) about 2 hours to about 10 hours; (b) about 3 hours to about 6 hours; or (c) about 4 hours.
[0159] In some aspects, a method for stimulating an immune response in an individual is provided, comprising: a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; c) incubating the plurality of modified PBMCs containing the antigen with a CpG ODN for a time sufficient to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen; and d) administering the plurality of conditioned modified PBMCs containing the antigen to an individual. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0160] In some aspects, a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing the antigen; c) incubating the plurality of modified PBMCs containing the antigen with a CpG ODN for a time sufficient to condition the modified PBMCs containing the antigen, wherein the CpG ODN is CpG 7909, thereby generating a plurality of conditioned modified PBMCs containing the antigen; and d) administering the plurality of conditioned modified PBMCs containing the antigen to an individual. A method for stimulating an immune response in an individual is provided. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0161] In some aspects, a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby producing a plurality of modified PBMCs containing the antigen; c) incubating the plurality of modified PBMCs containing the antigen with a CpG ODN for about 1 hour to about 24 hours to condition the modified PBMCs containing the antigen, thereby producing a plurality of conditioned modified PBMCs containing the antigen; and d) administering the plurality of conditioned modified PBMCs containing the antigen to an individual. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0162] In some aspects, a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is about 3 μm to about 10 μm, thereby causing disturbance of the input PBMCs sufficiently large for the antigen to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing the antigen; c) incubating the plurality of modified PBMCs containing the antigen with a CpG ODN for about 1 hour to about 24 hours so that the modified PBMCs containing the antigen are conditioned, wherein the CpG ODN is CpG 7909, thereby generating a plurality of conditioned modified PBMCs containing the antigen; and d) administering the plurality of conditioned modified PBMCs containing the antigen to an individual. A method for stimulating an immune response in an individual is provided. In some embodiments, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0163] In some embodiments according to any one of the methods described herein, the diameter of the constriction is about 4 μm to about 10 μm. In some embodiments, the diameter of the constriction is about 3 μm to about 6 μm. In some embodiments, the diameter of the constriction is (a) about 4.2 μm to about 6 μm; or (b) about 4.5 μm. In some embodiments, a plurality of modified PBMCs containing antigens are incubated with CpG ODN for (a) about 2 hours to about 10 hours; (b) about 3 hours to about 6 hours; or (c) about 4 hours.
[0164] In some embodiments according to any one of the methods described herein, the concentration of the antigen incubated with the perturbed input PBMC is about 0.1 μM to about 1 mM and / or the concentration of the ajuvant incubated with the perturbed input PBMC is about 0.1 μM to about 1 mM. In some embodiments, the concentration of the antigen incubated with the perturbed input PBMC is about 0.1 μM to about 10 μM and / or the concentration of the ajuvant incubated with the perturbed input PBMC is about 0.1 μM to about 10 μM. In some embodiments, the concentration of the antigen incubated with the perturbed input PBMC is about 1 μM and / or the concentration of the ajuvant incubated with the perturbed input PBMC is about 1 μM. In some embodiments, the ratio of antigen to ajuvant incubated with the perturbed input PBMC is about 10,000:1 to about 1:10,000. In some embodiments, the ratio of antigen to ajuvant incubated with the perturbed input PBMC is about 200:1. In some embodiments, the ratio of antigen to ajuvant incubated with the perturbed input PBMC is about 20:1.
[0165] In some embodiments according to any one of the methods described herein, the method further comprises incubating a plurality of modified PBMCs containing an antigen and / or ajuvant with a second ajuvant for a time sufficient for the modified PBMCs containing the antigen to be conditioned, thereby producing a plurality of conditioned modified PBMCs containing the antigen and / or ajuvant. In some embodiments, the method further comprises isolating a plurality of modified PBMCs containing the antigen and / or ajuvant from a cell suspension before incubating with an ajuvant to conditioned the modified PBMCs.
[0166] In some embodiments according to any one of the methods described herein, the antigen is present in the cytosol, and the ajuvant is present in vesicles of cells within a plurality of modified PBMCs. In some embodiments, the vesicles are endosomes. In some embodiments, the antigen and / or ajuvant are present in multiple compartments of cells within a plurality of modified PBMCs. In additional embodiments, the antigen and / or ajuvant are present in at least about 70% of the cells within a plurality of PBMCs. In some embodiments, the antigen and / or ajuvant are present in any one of at least about 70%, about 75%, about 80%, about 85%, about 95%, or about 99%, or 100% of the cells within a plurality of PBMCs. In some embodiments, the antigen is bound to the surface of cells within a plurality of modified PBMCs. In some embodiments, the antigen is present in at least about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 95%, about 99%, or 100% of the cells within a plurality of modified PBMCs. In some embodiments, the antigen is present in at least about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 95%, about 99%, or 100% of one or more types of T cells, B cells, NK cells, or monocytes within a plurality of modified PBMCs. In some embodiments, the antigen is present in at least about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 95%, about 99%, or 100% of each of the T cells, B cells, NK cells, and monocytes in a plurality of modified PBMCs. In some embodiments, the antigen is present in at least about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 95%, about 99%, or 100% of one or more of the T cells, B cells, NK cells, and monocytes in a plurality of modified PBMCs.
[0167] In some embodiments according to any one of the methods described herein, the method further comprises the step of incubating the input PBMC and / or modified PBMC with an agent that enhances the viability and / or function of the modified PBMC compared to a corresponding modified PBMC prepared without an additional incubation step.
[0168] In some embodiments according to any one of the methods described herein, the method further comprises administering a third ajuvant to an individual. In some embodiments, the composition comprising a plurality of modified PBMCs and the third ajuvant are administered simultaneously. In some embodiments, the third ajuvant is administered to the individual before, together with, or after the administration of the plurality of modified PBMCs. In some embodiments, the composition comprising a plurality of modified PBMCs and the third ajuvant is administered sequentially. In some embodiments, the third ajuvant is identical to the stenotic-transfer ajuvant. In some embodiments, the third ajuvant is identical to the conditioned ajuvant. In some embodiments, the third ajuvant is different from the stenotic-transfer ajuvant. In some embodiments, the third ajuvant is different from the conditioned ajuvant.
[0169] In some embodiments, the method comprises multiple administrations of modified PBMC. In some embodiments, the method comprises about 3 to about 9 administrations of modified PBMC. In some embodiments, the method comprises any one of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 administrations of modified PBMC. In some embodiments, the method comprises consecutive administrations of modified PBMC as needed. In some embodiments, the time interval between two consecutive administrations of a plurality of modified PBMCs is about 1 day to about 30 days. In some embodiments, the time interval between two consecutive administrations of a plurality of modified PBMCs is about 21 days. In some embodiments, the time interval between two consecutive administrations of modified immune cells is approximately 1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 14, 16, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or 150 days. In some embodiments, the individual is positive for HLA-A2 expression. In some embodiments, at least one cell within a plurality of modified PBMCs is positive for HLA-A2 expression. In some embodiments, at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 99% of the modified PBMCs are positive for HLA-A2 expression. In some embodiments, at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 99% of the T cells in the modified PBMCs are positive for HLA-A2 expression. In some embodiments, at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 99% of the B cells in the modified PBMCs are positive for HLA-A2 expression.In some embodiments, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 99% of the NK cells in the modified PBMC are positive for HLA-A2 expression. In some embodiments, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 99% of the monocytes in the modified PBMC are positive for HLA-A2 expression.
[0170] In some embodiments, a composition comprising a plurality of modified PBMCs is administered before administering the third ajuvant. For example, a composition comprising a plurality of modified PBMCs is administered about 1 hour to about 1 week before administering the third ajuvant. For example, in some embodiments, a composition comprising a plurality of modified PBMCs is administered about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 6 hours, about 8 hours, about 10 hours, about 12 hours, about 14 hours, about 16 hours, about 18 hours, about 20 hours, about 24 hours, about 30 hours, about 36 hours, about 42 hours, about 48 hours, about 60 hours, about 3 days, about 4 days, about 5 days, about 6 days, or about 7 days before administering the third ajuvant. In some embodiments, a composition comprising a plurality of modified PBMCs is prepared about 1 to about 2 hours, about 2 to about 3 hours, about 3 to about 4 hours, about 4 to about 6 hours, about 6 to about 8 hours, about 8 to about 10 hours, about 10 to about 12 hours, about 12 to about 14 hours, about 14 to about 16 hours, about 16 to about 18 hours, about 18 to about 20 hours, about 20 to about 24 hours, about 24 to about 30 hours, about 30 to about 36 hours, about 36 to about 42 hours, about 42 to about 48 hours, about 48 to about 60 hours, about 60 hours to about 3 days, about 3 to about 4 days, about 4 to about 5 days, about It is administered on 5 to about 6 days, and on about 6 to about 7 days.
[0171] In some embodiments, a composition comprising a plurality of modified PBMCs is administered after the administration of the third ajuvant. For example, a composition comprising a plurality of modified PBMCs is administered about 1 hour to about 1 week after the administration of the third ajuvant. For example, in some embodiments, a composition comprising a plurality of modified PBMCs is administered about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 6 hours, about 8 hours, about 10 hours, about 12 hours, about 14 hours, about 16 hours, about 18 hours, about 20 hours, about 24 hours, about 30 hours, about 36 hours, about 42 hours, about 48 hours, about 60 hours, about 3 days, about 4 days, about 5 days, about 6 days, or about 7 days after the administration of the third ajuvant. In some embodiments, a composition comprising a plurality of modified PBMCs is formed about 1 hour to about 2 hours, about 2 hours to about 3 hours, about 3 hours to about 4 hours, about 4 hours to about 6 hours, about 6 hours to about 8 hours, about 8 hours to about 10 hours, about 10 hours to about 12 hours, about 12 hours to about 14 hours, about 14 hours to about 16 hours, about 16 hours to about 18 hours, about 18 hours to about 20 hours, about 20 hours to about 24 hours, about 24 hours to about 30 hours, about 30 hours to about 36 hours, about 36 hours to about 42 hours, about 42 hours to about 48 hours, about 48 hours to about 60 hours, about 60 hours to about 3 days, about 3 days to about 4 days, about 4 days to about 5 days, about It is administered on 5 to about 6 days, and on about 6 to about 7 days.
[0172] In some embodiments, the third ajuvant is either IFN-α or CpG ODN. In some embodiments, the third ajuvant is CpG 7909.
[0173] In some embodiments according to any one of the methods described herein, a plurality of modified PBMCs are administered before, together with, or after the administration of a therapeutic agent. In some embodiments, the therapeutic agent comprises one or more of an immune checkpoint inhibitor, chemotherapy, or radiotherapy. In some embodiments, the therapeutic agent comprises one or more cytokines.
[0174] Immune checkpoints are modulators of the immune system and check the immune response. Immune checkpoint inhibitors can be used to facilitate the enhancement of the immune response. In some embodiments, a composition comprising a plurality of modified PBMCs is administered in combination with the administration of an immune checkpoint inhibitor. In some embodiments, a composition comprising a plurality of modified PBMCs and an immune checkpoint inhibitor is administered simultaneously. In some embodiments, a composition comprising a plurality of modified PBMCs and an immune checkpoint inhibitor is administered sequentially.
[0175] In some embodiments, a composition comprising a plurality of modified PBMCs is administered before the administration of an immune checkpoint inhibitor. In some embodiments, a composition comprising a plurality of modified PBMCs is administered after the administration of an immune checkpoint inhibitor. For example, a composition comprising a plurality of modified PBMCs is administered about 1 hour to about 1 week before the administration of an immune checkpoint inhibitor. For example, in some embodiments, a composition comprising a plurality of modified PBMCs is administered about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 6 hours, about 8 hours, about 10 hours, about 12 hours, about 14 hours, about 16 hours, about 18 hours, about 20 hours, about 24 hours, about 30 hours, about 36 hours, about 42 hours, about 48 hours, about 60 hours, about 3 days, about 4 days, about 5 days, about 6 days, or about 7 days before the administration of an immune checkpoint inhibitor. In some embodiments, a composition comprising a plurality of modified PBMCs is prepared about 1 to about 2 hours, about 2 to about 3 hours, about 3 to about 4 hours, about 4 to about 6 hours, about 6 to about 8 hours, about 8 to about 10 hours, about 10 to about 12 hours, about 12 to about 14 hours, about 14 to about 16 hours, about 16 to about 18 hours, about 18 to about 20 hours, about 20 to about 24 hours, about 24 to about 30 hours, about 30 to about 36 hours, about 36 to about 42 hours, about 42 to about 48 hours, about 48 to about 60 hours, about 60 hours to about 3 days, about 3 to about 4 days, about 4 to about 5 days, about It is administered on 5 to about 6 days, and on about 6 to about 7 days.
[0176] In some embodiments, a composition comprising a plurality of modified PBMCs is administered about 7, about 10, about 14, about 18, about 21, about 24, about 28, about 30, about 35, about 40, about 45, or about 50 days before administration of an immune checkpoint inhibitor. In some embodiments, a composition comprising a plurality of modified PBMCs is administered about 7 to about 10 days, about 10 to about 14 days, about 14 to about 18 days, about 18 to about 21 days, about 21 to about 24 days, about 24 to about 28 days, about 28 to about 30 days, about 30 to about 35 days, about 35 to about 40 days, about 40 to about 45 days, or about 45 to about 50 days prior to administration of an immune checkpoint inhibitor.
[0177] In some embodiments, a composition comprising a plurality of modified PBMCs is administered after administration of an immune checkpoint inhibitor. For example, a composition comprising a plurality of modified PBMCs is administered about 1 hour to about 1 week after administration of an immune checkpoint inhibitor. For example, in some embodiments, a composition comprising a plurality of modified PBMCs is administered about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 6 hours, about 8 hours, about 10 hours, about 12 hours, about 14 hours, about 16 hours, about 18 hours, about 20 hours, about 24 hours, about 30 hours, about 36 hours, about 42 hours, about 48 hours, about 60 hours, about 3 days, about 4 days, about 5 days, about 6 days, or about 7 days after administration of an immune checkpoint inhibitor. In some embodiments, a composition comprising a plurality of modified PBMCs is formed about 1 hour to about 2 hours, about 2 hours to about 3 hours, about 3 hours to about 4 hours, about 4 hours to about 6 hours, about 6 hours to about 8 hours, about 8 hours to about 10 hours, about 10 hours to about 12 hours, about 12 hours to about 14 hours, about 14 hours to about 16 hours, about 16 hours to about 18 hours, about 18 hours to about 20 hours, about 20 hours to about 24 hours, about 24 hours to about 30 hours, about 30 hours to about 36 hours, about 36 hours to about 42 hours, about 42 hours to about 48 hours, about 48 hours to about 60 hours, about 60 hours to about 3 days, about 3 days to about 4 days, about 4 days to about 5 days, about It is administered on 5 to about 6 days, and on about 6 to about 7 days.
[0178] In some embodiments, a composition comprising a plurality of modified PBMCs is administered about 7, about 10, about 14, about 18, about 21, about 24, about 28, about 30, about 35, about 40, about 45, or about 50 days after administration of an immune checkpoint inhibitor. In some embodiments, a composition comprising a plurality of modified PBMCs is administered about 7 to about 10 days, about 10 to about 14 days, about 14 to about 18 days, about 18 to about 21 days, about 21 to about 24 days, about 24 to about 28 days, about 28 to about 30 days, about 30 to about 35 days, about 35 to about 40 days, about 40 to about 45 days, or about 45 to about 50 days after administration of an immune checkpoint inhibitor.
[0179] In some embodiments, the method comprises multiple administrations of a composition comprising a plurality of modified PBMCs and / or multiple administrations of an immune checkpoint inhibitor. For example, in some embodiments, the method comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 administrations of a composition comprising a plurality of modified PBMCs and / or immune checkpoint inhibitors. For example, in some embodiments, the method comprises fewer than 5, fewer than 10, fewer than 15, fewer than 20, fewer than 25, fewer than 30, fewer than 50, fewer than 75, fewer than 100, or fewer than 200 administrations of a composition comprising a plurality of modified PBMCs and / or immune checkpoint inhibitors.
[0180] An exemplary immune checkpoint inhibitor is, but not limited to, targeted for PD-1, PD-L1, CTLA-4, LAG3, TIM-3, TIGIT, VISTA, TIM1, B7-H4 (VTCN1), or BTLA. In some embodiments, the immune checkpoint inhibitor targets one or more of PD-1, PD-L1, CTLA-4, LAG3, TIM-3, TIGIT, VISTA, TIM1, B7-H4 (VTCN1), or BTLA. In some embodiments, the immune checkpoint inhibitor is one or more of an antibody that binds to PD-1, an antibody that binds to PD-L1, an antibody that binds to CTLA-4, an antibody that binds to LAG3, or an antibody that binds to TIM-3, an antibody that binds to TIGIT, an antibody that binds to VISTA, an antibody that binds to TIM-1, an antibody that binds to B7-H4, or an antibody that binds to BTLA. In additional embodiments, the antibody may be a full-length antibody or any variant, e.g., non-limitingly an antibody fragment, a single-chain variable fragment (ScFv), or an antigen-binding fragment (Fab). In additional embodiments, the antibody may be bispecific, trispecific, or multispecific. In some embodiments, the immune checkpoint inhibitor is one or more chemical compounds that bind to and / or inhibit one or more of PD-1, PD-L1, CTLA-4, LAG3, TIM-3, TIGIT, VISTA, TIM1, B7-H4 (VTCN1), or BTLA. In some embodiments, the immune checkpoint inhibitor is one or more peptides that bind to and / or inhibit one or more of PD-1, PD-L1, CTLA-4, LAG3, TIM-3, TIGIT, VISTA, TIM1, B7-H4 (VTCN1), or BTLA. In some embodiments, the immune checkpoint inhibitor is targeted for PD-1. In some embodiments, immune checkpoint inhibitors are targeted against PD-L1.
[0181] Cytokines may be used in combination with any one of the plurality of modified PBMCs described herein to achieve additive or synergistic effects against cancer, e.g., HPV-associated cancer. In some embodiments, a composition comprising a plurality of modified PBMCs is administered in combination with the administration of one or more cytokines. In some embodiments, the composition comprising a plurality of modified PBMCs and the cytokines are administered simultaneously. In some embodiments, the composition comprising a plurality of modified PBMCs and the cytokines are administered sequentially.
[0182] In some embodiments, a composition containing a plurality of modified PBMCs is administered before the administration of a cytokine. In some embodiments, a composition containing a plurality of modified PBMCs is administered after the administration of a cytokine. For example, a composition containing a plurality of modified PBMCs is administered about 1 hour to about 1 week before the administration of a cytokine. For example, in some embodiments, a composition containing a plurality of modified PBMCs is administered about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 6 hours, about 8 hours, about 10 hours, about 12 hours, about 14 hours, about 16 hours, about 18 hours, about 20 hours, about 24 hours, about 30 hours, about 36 hours, about 42 hours, about 48 hours, about 60 hours, about 3 days, about 4 days, about 5 days, about 6 days, or about 7 days before the administration of a cytokine. In some embodiments, a composition comprising a plurality of modified PBMCs is formed about 1 hour to about 2 hours, about 2 hours to about 3 hours, about 3 hours to about 4 hours, about 4 hours to about 6 hours, about 6 hours to about 8 hours, about 8 hours to about 10 hours, about 10 hours to about 12 hours, about 12 hours to about 14 hours, about 14 hours to about 16 hours, about 16 hours to about 18 hours, about 18 hours to about 20 hours, about 20 hours to about 24 hours, about 24 hours to about 30 hours, about 30 hours to about 36 hours, about 36 hours to about 42 hours, about 42 hours to about 48 hours, about 48 hours to about 60 hours, about 60 hours to about 3 days, about 3 days to about 4 days, about 4 days to about 5 days, about It is administered on 5 to about 6 days, and on about 6 to about 7 days.
[0183] In some embodiments, a composition comprising a plurality of modified PBMCs is administered about 7, 10, 14, 18, 21, 24, 28, 30, 35, 40, 45, or 50 days prior to administration of cytokine. In some embodiments, a composition comprising a plurality of modified PBMCs is administered about 7 to about 10 days, about 10 to about 14 days, about 14 to about 18 days, about 18 to about 21 days, about 21 to about 24 days, about 24 to about 28 days, about 28 to about 30 days, about 30 to about 35 days, about 35 to about 40 days, about 40 to about 45 days, or about 45 to about 50 days prior to administration of a cytokine.
[0184] In some embodiments, a composition containing a plurality of modified PBMCs is administered after administration of a cytokine. For example, a composition containing a plurality of modified PBMCs is administered about 1 hour to about 1 week after administration of a cytokine. For example, in some embodiments, a composition containing a plurality of modified PBMCs is administered about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 6 hours, about 8 hours, about 10 hours, about 12 hours, about 14 hours, about 16 hours, about 18 hours, about 20 hours, about 24 hours, about 30 hours, about 36 hours, about 42 hours, about 48 hours, about 60 hours, about 3 days, about 4 days, about 5 days, about 6 days, or about 7 days after administration of a cytokine. In some embodiments, a composition comprising a plurality of modified PBMCs is formed about 1 hour to about 2 hours, about 2 hours to about 3 hours, about 3 hours to about 4 hours, about 4 hours to about 6 hours, about 6 hours to about 8 hours, about 8 hours to about 10 hours, about 10 hours to about 12 hours, about 12 hours to about 14 hours, about 14 hours to about 16 hours, about 16 hours to about 18 hours, about 18 hours to about 20 hours, about 20 hours to about 24 hours, about 24 hours to about 30 hours, about 30 hours to about 36 hours, about 36 hours to about 42 hours, about 42 hours to about 48 hours, about 48 hours to about 60 hours, about 60 hours to about 3 days, about 3 days to about 4 days, about 4 days to about 5 days, about It is administered on 5 to about 6 days, and on about 6 to about 7 days.
[0185] Exemplary cytokines include, but are not limited to, chemokines, interferons, interleukins, lymphokines, and tumor necrosis factor. In some embodiments, the cytokine enhances a cellular immune response. In some embodiments, the cytokine enhances an antibody response. In some embodiments, the cytokine is a type I cytokine. In some embodiments, the cytokine is a type 2 cytokine. In some embodiments, the cytokine includes one or more of IL-2, IL-15, IL-10, IL-12, IFN-α, or IL-21. In some embodiments, the cytokine includes IL-15.
[0186] Chemotherapy may be used in combination with any one of the plurality of modified PBMCs described herein to achieve additive or synergistic effects against cancer, e.g., HPV-associated cancer. In some embodiments, a composition comprising a plurality of modified PBMCs is administered in combination with the administration of chemotherapy. In some embodiments, the composition comprising a plurality of modified PBMCs and the chemotherapy are administered simultaneously. In some embodiments, the composition comprising a plurality of modified PBMCs and the chemotherapy are administered sequentially.
[0187] In some embodiments, a composition containing a plurality of modified PBMCs is administered before the administration of chemotherapy. In some embodiments, a composition containing a plurality of modified PBMCs is administered after the administration of chemotherapy. For example, a composition containing a plurality of modified PBMCs is administered about 1 hour to about 1 week before the administration of chemotherapy. For example, in some embodiments, a composition containing a plurality of modified PBMCs is administered about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 6 hours, about 8 hours, about 10 hours, about 12 hours, about 14 hours, about 16 hours, about 18 hours, about 20 hours, about 24 hours, about 30 hours, about 36 hours, about 42 hours, about 48 hours, about 60 hours, about 3 days, about 4 days, about 5 days, about 6 days, or about 7 days before the administration of chemotherapy. In some embodiments, a composition comprising a plurality of modified PBMCs is prepared about 1 hour to about 2 hours, about 2 hours to about 3 hours, about 3 hours to about 4 hours, about 4 hours to about 6 hours, about 6 hours to about 8 hours, about 8 hours to about 10 hours, about 10 hours to about 12 hours, about 12 hours to about 14 hours, about 14 hours to about 16 hours, about 16 hours to about 18 hours, about 18 hours to about 20 hours, about 20 hours to about 24 hours, about 24 hours to about 30 hours, about 30 hours to about 36 hours, about 36 hours to about 42 hours, about 42 hours to about 48 hours, about 48 hours to about 60 hours, about 60 hours to about 3 days, about 3 days to about 4 days, about 4 days to about 5 days, about 5 days It is administered on approximately 6 days, or on approximately 6 to 7 days.
[0188] In some embodiments, a composition containing a plurality of modified PBMCs is administered after administration of chemotherapy. For example, a composition containing a plurality of modified PBMCs is administered about 1 hour to about 1 week after administration of chemotherapy. For example, in some embodiments, a composition containing a plurality of modified PBMCs is administered about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 6 hours, about 8 hours, about 10 hours, about 12 hours, about 14 hours, about 16 hours, about 18 hours, about 20 hours, about 24 hours, about 30 hours, about 36 hours, about 42 hours, about 48 hours, about 60 hours, about 3 days, about 4 days, about 5 days, about 6 days, or about 7 days after administration of chemotherapy. In some embodiments, a composition comprising a plurality of modified PBMCs is formed after administration of chemotherapy about 1 hour to about 2 hours, about 2 hours to about 3 hours, about 3 hours to about 4 hours, about 4 hours to about 6 hours, about 6 hours to about 8 hours, about 8 hours to about 10 hours, about 10 hours to about 12 hours, about 12 hours to about 14 hours, about 14 hours to about 16 hours, about 16 hours to about 18 hours, about 18 hours to about 20 hours, about 20 hours to about 24 hours, about 24 hours to about 30 hours, about 30 hours to about 36 hours, about 36 hours to about 42 hours, about 42 hours to about 48 hours, about 48 hours to about 60 hours, about 60 hours to about 3 days, about 3 days to about 4 days, about 4 days to about 5 days, about 5 days It is administered on approximately 6 days, or on approximately 6 to 7 days.
[0189] In some embodiments, a composition comprising a plurality of modified PBMCs is administered about 7 days, about 10 days, about 14 days, about 18 days, about 21 days, about 24 days, about 28 days, about 30 days, about 35 days, about 40 days, about 45 days, or about 50 days after administration of chemotherapy. In some embodiments, a composition comprising a plurality of modified PBMCs is administered about 7 to about 10 days, about 10 to about 14 days, about 14 to about 18 days, about 18 to about 21 days, about 21 to about 24 days, about 24 to about 28 days, about 28 to about 30 days, about 30 to about 35 days, about 35 to about 40 days, about 40 to about 45 days, or about 45 to about 50 days after administration of chemotherapy.
[0190] In some embodiments, the method comprises multiple administrations of a composition containing a plurality of modified PBMCs and / or multiple administrations of chemotherapy. For example, in some embodiments, the method comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 administrations of a composition containing a plurality of modified PBMCs and / or chemotherapy. For example, in some embodiments, the method comprises fewer than 5, fewer than 10, fewer than 15, fewer than 20, fewer than 25, fewer than 30, fewer than 50, fewer than 75, fewer than 100, or fewer than 200 administrations of a composition containing a plurality of modified PBMCs and / or chemotherapy.
[0191] Exemplary chemotherapy may be cell cycle-dependent or cell cycle-independent. In some embodiments, chemotherapy comprises one or more chemotherapy agents. In some embodiments, the chemotherapy agent may target one or more of cell division, DNA, or metabolism in cancer. In some embodiments, the chemotherapy agent is a platinum-based agent, e.g., cisplatin, oxaliplatin, or carboplatin, but not limited to. In some embodiments, the chemotherapy agent is a taxane (e.g., docetaxel or paclitaxel). In some embodiments, the chemotherapy agent is 5-fluorouracil, doxorubicin, or irinotecan. In some embodiments, the chemotherapy agent is one or more of an alkylating agent, an anmetatomite, an antitumor antibiotic, a topoisomerase inhibitor, or a mitotic inhibitor. In some embodiments, chemotherapy comprises cisplatin.
[0192] Radiation therapy may be used in combination with any one of the plurality of modified PBMCs described herein to achieve additive or synergistic effects against cancer, e.g., HPV-associated cancer. In some embodiments, a composition containing a plurality of modified PBMCs is administered in combination with the administration of radiation therapy. In some embodiments, a composition containing a plurality of modified PBMCs and radiation therapy are administered simultaneously. In some embodiments, a composition containing a plurality of modified PBMCs and radiation therapy are administered sequentially. In some embodiments, a composition containing a plurality of modified PBMCs is administered in combination with the administration of radiation therapy, in combination with chemotherapy, and / or in combination with an immune checkpoint inhibitor.
[0193] In some embodiments, a composition containing a plurality of modified PBMCs is administered before the administration of radiotherapy. In some embodiments, a composition containing a plurality of modified PBMCs is administered after the administration of radiotherapy. For example, a composition containing a plurality of modified PBMCs is administered about 1 hour to about 1 week before the administration of radiotherapy. For example, in some embodiments, a composition containing a plurality of modified PBMCs is administered about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 6 hours, about 8 hours, about 10 hours, about 12 hours, about 14 hours, about 16 hours, about 18 hours, about 20 hours, about 24 hours, about 30 hours, about 36 hours, about 42 hours, about 48 hours, about 60 hours, about 3 days, about 4 days, about 5 days, about 6 days, or about 7 days before the administration of radiotherapy. In some embodiments, a composition comprising a plurality of modified PBMCs is prepared about 1 hour to about 2 hours, about 2 hours to about 3 hours, about 3 hours to about 4 hours, about 4 hours to about 6 hours, about 6 hours to about 8 hours, about 8 hours to about 10 hours, about 10 hours to about 12 hours, about 12 hours to about 14 hours, about 14 hours to about 16 hours, about 16 hours to about 18 hours, about 18 hours to about 20 hours, about 20 hours to about 24 hours, about 24 hours to about 30 hours, about 30 hours to about 36 hours, about 36 hours to about 42 hours, about 42 hours to about 48 hours, about 48 hours to about 60 hours, about 60 hours to about 3 days, about 3 days to about 4 days, about 4 days to about 5 days, about 5 days It is administered on approximately 6 days, or on approximately 6 to 7 days.
[0194] In some embodiments, a composition containing a plurality of modified PBMCs is administered after the administration of radiotherapy. For example, a composition containing a plurality of modified PBMCs is administered about 1 hour to about 1 week after the administration of radiotherapy. For example, in some embodiments, a composition containing a plurality of modified PBMCs is administered about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 6 hours, about 8 hours, about 10 hours, about 12 hours, about 14 hours, about 16 hours, about 18 hours, about 20 hours, about 24 hours, about 30 hours, about 36 hours, about 42 hours, about 48 hours, about 60 hours, about 3 days, about 4 days, about 5 days, about 6 days, or about 7 days after the administration of radiotherapy. In some embodiments, a composition comprising a plurality of modified PBMCs is formed after administration of radiotherapy about 1 hour to about 2 hours, about 2 hours to about 3 hours, about 3 hours to about 4 hours, about 4 hours to about 6 hours, about 6 hours to about 8 hours, about 8 hours to about 10 hours, about 10 hours to about 12 hours, about 12 hours to about 14 hours, about 14 hours to about 16 hours, about 16 hours to about 18 hours, about 18 hours to about 20 hours, about 20 hours to about 24 hours, about 24 hours to about 30 hours, about 30 hours to about 36 hours, about 36 hours to about 42 hours, about 42 hours to about 48 hours, about 48 hours to about 60 hours, about 60 hours to about 3 days, about 3 days to about 4 days, about 4 days to about 5 days, about 5 days It is administered on approximately 6 days, or on approximately 6 to 7 days.
[0195] In some embodiments, a composition comprising a plurality of modified PBMCs is administered about 7 days, about 10 days, about 14 days, about 18 days, about 21 days, about 24 days, about 28 days, about 30 days, about 35 days, about 40 days, about 45 days, or about 50 days after administration of radiotherapy. In some embodiments, a composition comprising a plurality of modified PBMCs is administered about 7 to about 10 days, about 10 to about 14 days, about 14 to about 18 days, about 18 to about 21 days, about 21 to about 24 days, about 24 to about 28 days, about 28 to about 30 days, about 30 to about 35 days, about 35 to about 40 days, about 40 to about 45 days, or about 45 to about 50 days after administration of radiotherapy.
[0196] In some embodiments, the method comprises multiple administrations of a composition containing a plurality of modified PBMCs and / or multiple administrations of radiotherapy. For example, in some embodiments, the method comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 administrations of a composition containing a plurality of modified PBMCs and / or radiotherapy. For example, in some embodiments, the method comprises fewer than 5, fewer than 10, fewer than 15, fewer than 20, fewer than 25, fewer than 30, fewer than 50, fewer than 75, fewer than 100, or fewer than 200 administrations of a composition containing a plurality of modified PBMCs and / or radiotherapy.
[0197] In some embodiments, a plurality of PBMCs comprising antigens for use in a method of stimulating an immune response in an individual according to any one of the methods described herein are provided.
[0198] In some methods according to any one of the methods described herein, the method stimulates an immune response to HPV antigens in an individual. Papillomavirus is a small, unenveloped DNA virus with a virion size of approximately 55 nm in diameter. More than 100 HPV genotypes have been fully characterized, and a higher number are estimated to exist. HPV is a known cause of cervical cancer, as well as some vulvar, vaginal, penile, oropharyngeal, anal, and rectal cancers. Most HPV infections are asymptomatic and resolve spontaneously, but persistent infection by one of the oncogenic HPV types can progress to precancerous or cancerous. Other HPV-associated diseases may include common warts, plantar warts, flat warts, anogenital warts, anal lesions, epidermal dysplasia, focal epithelial hyperplasia, oral papillomas, verrucous cysts, laryngeal papillomatosis, squamous intraepithelial lesions (SIL), cervical intraepithelial neoplasms (CIN), vulvar intraepithelial neoplasms (VIN), and vaginal intraepithelial neoplasms (VAIN). Multiple known human papillomavirus (HPV) types cause benign lesions in which a subset is neoplastic. Based on epidemiological and phylogenetic relationships, HPV types are classified into 15 "high-risk types" (HPV 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73, and 82) and 3 "probably high-risk types" (HPV 26, 53, and 66), which together are known to manifest as low- and high-grade cervical changes and cancers, as well as other anogenital cancers, such as vulvar cancer, vaginal cancer, penile cancer, anal cancer, and perianal cancer, and head and neck cancer. Recently, an association between high-risk types HPV 16 and 18 and breast cancer has also been described.Eleven HPV types classified as "low-risk types" (HPV 6, 11, 40, 42, 43, 44, 54, 61, 70, 72, and 81) are known to manifest as benign low-grade cervical changes, genital warts, and recurrent respiratory papillomatosis. Cutaneous HPV types 5, 8, and 92 are associated with skin cancer. In some HPV-associated cancers, the immune system is suppressed, and correspondingly, the anti-tumor response is significantly impaired. See [Suresh and Burtness, Am J Hematol Oncol 13(6):20-27 (2017)].
[0199] In some embodiments according to any one of the methods, compositions, or plurality of modified PBMCs described herein, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs. In some embodiments, the plurality of PBMCs comprises nucleic acids encoding the antigen. In some embodiments, the plurality of PBMCs comprises mRNA encoding the antigen.
[0200] PBMC composition
[0201] As used herein, PBMCs may be isolated from whole blood obtained from an individual by leukocyte ablation. Additionally, a PBMC composition reconstituted by mixing different PBMC pools from the same individual or different individuals is provided. In other examples, PBMCs may also be reconstituted by mixing different cell populations into a mixed cell composition having a generated profile. In some embodiments, the cell population used to reconstitute the PBMC is a mixed cell population (e.g., a mixture of one or more of T cells, B cells, NK cells, or monocytes). In some embodiments, the cell population used to reconstitute the PBMC is a purified cell population (e.g., purified T cells, B cells, NK cells, or monocytes). In further examples, the different cell populations used to reconstitute the PBMC composition may be isolated from the same individual (e.g., autologous) or from different individuals (e.g., homologous and / or heterologous).
[0202] Accordingly, in some embodiments according to any one of the methods, compositions, or plurality of modified PBMCs described herein, the plurality of input PBMCs comprises one or more of T cells, B cells, NK cells, monocytes, dendritic cells, or NK-T cells. In some embodiments, the plurality of input PBMCs comprises T cells, B cells, NK cells, monocytes, dendritic cells, or NK-T cells. In some embodiments, the plurality of input PBMCs comprises one or more of CD3+ T cells, CD20+ B cells, CD14+ monocytes, and CD56+ NK cells. In some embodiments, the plurality of input PBMCs comprises T cells, B cells, NK cells, and monocytes, and the ratio of T cells, B cells, NK cells, and monocytes to the total number of PBMCs in the plurality of input PBMCs is essentially the same as the ratio of T cells, B cells, NK cells, and monocytes to the total number of PBMCs in whole blood. In some embodiments, a plurality of input PBMCs comprise T cells, B cells, NK cells, and monocytes, and the ratio of T cells, B cells, NK cells, and monocytes to the total number of PBMCs in the plurality of input PBMCs is essentially the same as the ratio of T cells, B cells, NK cells, and monocytes to the total number of PBMCs in the leukocyte apheresis product from whole blood. In some embodiments, a plurality of input PBMCs comprise T cells, B cells, NK cells, and monocytes, and the ratio of T cells, B cells, NK cells, and monocytes to the total number of PBMCs in the plurality of input PBMCs differs from the ratio of T cells, B cells, NK cells, and monocytes to the total number of PBMCs in whole blood by one or less of 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, or 50%.In some embodiments, a plurality of input PBMCs comprise T cells, B cells, NK cells, and monocytes, and the ratio of T cells, B cells, NK cells, and monocytes to the total number of PBMCs in the plurality of input PBMCs differs from the ratio of T cells, B cells, NK cells, and monocytes to the total number of PBMCs in whole blood by 10% or less. In some embodiments, a plurality of input PBMCs comprise T cells, B cells, NK cells, and monocytes, and the ratio of T cells, B cells, NK cells, and monocytes to the total number of PBMCs in the plurality of input PBMCs differs from the ratio of T cells, B cells, NK cells, and monocytes to the total number of PBMCs in the leukocyte apheresis product from whole blood by 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, or 50% or less. In some embodiments, a plurality of input PBMCs include T cells, B cells, NK cells, and monocytes, and the ratio of T cells, B cells, NK cells, and monocytes to the total number of PBMCs in the plurality of input PBMCs differs by no more than 10% from the ratio of T cells, B cells, NK cells, and monocytes to the total number of PBMCs in the product of leukocyte ablation from whole blood.
[0203] In some embodiments according to any one of the methods, compositions, or plurality of modified PBMCs described herein, about 25% to about 70% of the modified PBMCs are T cells. In some embodiments, about 2.5% to about 14% of the modified PBMCs are B cells. In some embodiments, about 3.5% to about 35% of the modified PBMCs are NK cells. In some embodiments, about 4% to about 25% of the modified PBMCs are NK cells.
[0204] In some embodiments according to any one of the methods, compositions, or a plurality of modified PBMCs described herein, at least about 90% to about 99% of the input PBMCs consist of T cells, B cells, NK cells, and monocytes. In some embodiments, at least about 80% to about 85%, about 85% to about 90%, about 90% to about 95%, or about 95% to about 99% of the input PBMCs consist of T cells, B cells, NK cells, and monocytes. In some embodiments, at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the injected PBMC consists of T cells, B cells, NK cells, and monocytes. In some embodiments, at least about 90% of the injected PBMC consists of T cells, B cells, NK cells, and monocytes. In some embodiments, the injected PBMC consists of T cells, B cells, NK cells, and monocytes.
[0205] In some embodiments according to any one of the methods, compositions, or plurality of modified PBMCs described herein, at least about 90% to about 99% of the modified PBMCs consist of T cells, B cells, NK cells, and monocytes. In some embodiments, at least about 80% to about 85%, about 85% to about 90%, about 90% to about 95%, or about 95% to about 99% of the modified PBMCs consist of T cells, B cells, NK cells, and monocytes. In some embodiments, at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the modified PBMC consists of T cells, B cells, NK cells, and monocytes. In some embodiments, at least about 90% of the modified PBMC consists of T cells, B cells, NK cells, and monocytes. In some embodiments, the modified PBMC consists of T cells, B cells, NK cells, and monocytes.
[0206] In some embodiments according to any one of the methods, compositions, or a plurality of modified PBMCs described herein, at least about 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75% of the input PBMC is T cells. In some embodiments, at least about 25% of the input PBMC is T cells. In some embodiments, at least about 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 4%, 5%, 6%, 7%, 7.5%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, or 30% of the input PBMC is B cells. In some embodiments, at least about 2.5% of the input PBMC is B cells. In some embodiments, at least about 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 4%, 5%, 6%, 7%, 7.5%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, or 30% of the input PBMC is NK cells. In some embodiments, at least about 3.5% of the input PBMC is NK cells. In some embodiments, at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 12%, 14%, 16%, 18%, 20%, 25%, 30%, 35%, or 40% of the injected PBMC are monocytes. In some embodiments, at least about 4% of the injected PBMC are monocytes. In some embodiments, at least about 25% of the injected PBMC are T cells; at least about 2.5% of the injected PBMC are B cells; at least about 3.5% of the injected PBMC are NK cells; and at least about 4% of the injected PBMC are monocytes.
[0207] In some embodiments according to any one of the method, composition, or plurality of modified PBMCs described herein, at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% of the modified PBMCs are T cells. In some embodiments, at least about 20% of the modified PBMCs are T cells. In some embodiments, at least about 0.25%, 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 4%, 5%, 6%, 7%, 7.5%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, or 30% of the modified PBMC are B cells. In some embodiments, at least about 2% of the modified PBMC are B cells. In some embodiments, at least about 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 4%, 5%, 6%, 7%, 7.5%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, or 30% of the modified PBMC is NK cells. In some embodiments, at least about 3% of the modified PBMC is NK cells. In some embodiments, at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 12%, 14%, 16%, 18%, 20%, 25%, 30%, 35%, or 40% of the modified PBMCs are monocytes. In some embodiments, at least about 3% of the modified PBMCs are monocytes. In some embodiments, at least about 20% of the modified PBMCs are T cells; at least about 2% of the modified PBMCs are B cells; at least about 3% of the modified PBMCs are NK cells; and at least about 3% of the modified PBMCs are monocytes.
[0208] In some embodiments according to any one of the methods, compositions, or a plurality of modified PBMCs described herein, at least one of about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% of the input PBMCs are T cells. In some embodiments, at least about 70% of the input PBMCs are T cells. In some embodiments, at least one of about 5%, 10%, 12%, 14%, 16%, 18%, 20%, 22%, 25%, 30%, 35%, 40%, or 50% of the input PBMCs are B cells. In some embodiments, at least about 14% of the input PBMCs are B cells. In some embodiments, about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or 60% of the input PBMC are NK cells. In some embodiments, about 35% or less of the input PBMC are NK cells. In some embodiments, about 5%, 10%, 12%, 14%, 16%, 18%, 20%, 22%, 25%, 30%, 35%, 40%, or 50% of the input PBMC are monocytes. In some embodiments, about 4% or less of the input PBMC are monocytes. In some embodiments, about 25% or less of the input PBMC are T cells; about 2.5% or less of the input PBMC are B cells; about 3.5% or less of the input PBMC are NK cells; About 4% or less of the injected PBMC are monocytes.
[0209] In some embodiments according to any one of the methods, compositions, or plurality of modified PBMCs described herein, one or less of about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% of the modified PBMCs are T cells. In some embodiments, about 20% or less of the modified PBMCs are T cells. In some embodiments, about 0.25%, 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 4%, 5%, 6%, 7%, 7.5%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, or 30% of the modified PBMC are B cells. In some embodiments, about 2% or less of the modified PBMC are B cells. In some embodiments, about 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 4%, 5%, 6%, 7%, 7.5%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, or 30% of the modified PBMC are NK cells. In some embodiments, about 3% or less of the modified PBMC are NK cells. In some embodiments, about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 12%, 14%, 16%, 18%, 20%, 25%, 30%, 35%, or 40% of the modified PBMCs are monocytes. In some embodiments, about 3% or less of the modified PBMCs are monocytes. In some embodiments, about 20% or less of the modified PBMCs are T cells; about 2% or less of the modified PBMCs are B cells; about 3% or less of the modified PBMCs are NK cells; and about 3% or less of the modified PBMCs are monocytes.
[0210] In some embodiments according to any one of the method, composition or plurality of modified PBMCs described herein, any one of about 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, 45% to 50%, 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, or 70% to 75% of the modified PBMCs is a T cell. In some embodiments, about 25% to about 70% of the modified PBMCs are T cells. In some embodiments, about 1% to 2.5%, 2.5% to 4%, 4% to 6%, 6% to 8%, 8% to 10%, 10% to 12%, 12% to 14%, 14% to 16%, 16% to 20%, or 20% to 25% of the modified PBMC are B cells. In some embodiments, about 2.5% to about 14% of the modified PBMC are B cells. In some embodiments, about 1% to 2%, 2% to 3.5%, 3.5% to 5%, 5% to 8%, 8% to 10%, 10% to 12%, 12% to 14%, 14% to 16%, 16% to 20%, or 20% to 25% of the modified PBMC are B cells. In some embodiments, about 3.5% to about 35% of the modified PBMC are NK cells. In some embodiments, about 2% to 4%, 4% to 6%, 6% to 8%, 8% to 10%, 10% to 12%, 12% to 14%, 14% to 16%, 16% to 20%, 20% to 25%, 25% to 30%, 30% to 35%, or 35% to 40% of the modified PBMCs are monocytes. In some embodiments, about 4% to about 25% of the modified PBMCs are monocytes. In some embodiments, about 25% to about 70% of the modified PBMCs are T cells, about 2.5% to about 14% of the modified PBMCs are B cells, and about 3% of the modified PBMCs.5% to about 35% are NK cells, and about 4% to about 25% of the modified PBMCs are NK cells.
[0211] In some embodiments according to any one of the method, composition or plurality of modified PBMCs described herein, any one of about 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, 45% to 50%, 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, or 70% to 75% of the modified PBMCs is a T cell. In some embodiments, about 25% to about 70% of the modified PBMCs are T cells. In some embodiments, about 1% to 2.5%, 2.5% to 4%, 4% to 6%, 6% to 8%, 8% to 10%, 10% to 12%, 12% to 14%, 14% to 16%, 16% to 20%, or 20% to 25% of the modified PBMC are B cells. In some embodiments, about 2.5% to about 14% of the modified PBMC are B cells. In some embodiments, about 1% to 2%, 2% to 3.5%, 3.5% to 5%, 5% to 8%, 8% to 10%, 10% to 12%, 12% to 14%, 14% to 16%, 16% to 20%, or 20% to 25% of the modified PBMC are NK cells. In some embodiments, about 3.5% to about 35% of the modified PBMC are NK cells. In some embodiments, about 2% to 4%, 4% to 6%, 6% to 8%, 8% to 10%, 10% to 12%, 12% to 14%, 14% to 16%, 16% to 20%, 20% to 25%, 25% to 30%, 30% to 35%, or 35% to 40% of the modified PBMCs are monocytes. In some embodiments, about 4% to about 25% of the modified PBMCs are monocytes. In some embodiments, about 25% to about 70% of the modified PBMCs are T cells, about 2.5% to about 14% of the modified PBMCs are B cells, and about 3% of the modified PBMCs.5% to about 35% are NK cells, and about 4% to about 25% of the modified PBMCs are NK cells.
[0212] As used herein, PBMCs can also be generated after manipulating the composition of a mixed cell population of mononuclear blood cells (e.g., lymphocytes and monocytes). In some cases, the injectable PBMCs are generated after reducing (e.g., depleting) a specific subpopulation (e.g., B cells) within the mixed cell population of mononuclear blood cells. The composition of the mixed cell population of mononuclear blood cells in an individual can be manipulated so that the cell population becomes more closely similar to the product of leukocyte apheresis from whole blood in the same individual. In other examples, the composition of the mixed cell population of mononuclear blood cells (e.g., mouse splenocytes) can also be manipulated so that the cell population becomes more closely similar to human PBMCs isolated from the product of leukocyte apheresis from human whole blood.
[0213] In some embodiments, build-mediated delivery does not differentially adjust the viability of different subgroups (e.g., B cells, T cells, NK cells, or monocytes) within the PBMC in a significant manner. In some embodiments, the conditioning process does not differentially adjust the viability of different subgroups within the PBMC in a significant manner. In some embodiments, the additional addition of an agent (including, but not limited to, a biopreservative or an agent that enhances the function and / or viability of the PBMC) does not differentially adjust the viability of various subgroups within the PBMC in a significant manner. Accordingly, in some embodiments according to any one of the methods, compositions, or multiple modified PBMCs described herein, the percentage of T cells in the multiple modified PBMCs and the percentage of T cells in the multiple input PBMCs differ by about 10% or less in terms of number. In some embodiments, the percentage of T cells in a plurality of modified PBMCs and the percentage of T cells in a plurality of injected PBMCs differ by no more than one of about 5%, 8%, 10%, 12%, 14%, 16%, 18%, or 20% in terms of number. In some embodiments, the percentage of B cells in a plurality of modified PBMCs and the percentage of B cells in a plurality of injected PBMCs differ by no more than about 10% in terms of number. In some embodiments, the percentage of B cells in a plurality of modified PBMCs and the percentage of B cells in a plurality of injected PBMCs differ by no more than one of about 5%, 8%, 10%, 12%, 14%, 16%, 18%, or 20% in terms of number. In some embodiments, the percentage of NK cells in a plurality of modified PBMCs and the percentage of NK cells in a plurality of injected PBMCs differ by no more than about 10% in terms of number.In some embodiments, the percentage of NK cells in a plurality of modified PBMCs and the percentage of NK cells in a plurality of injected PBMCs differ by no more than one of about 5%, 8%, 10%, 12%, 14%, 16%, 18%, or 20% in terms of number. In some embodiments, the percentage of monocytes in a plurality of modified PBMCs and the percentage of monocytes in a plurality of injected PBMCs differ by no more than about 10% in terms of number. In some embodiments, the percentage of monocytes in a plurality of modified PBMCs and the percentage of monocytes in a plurality of injected PBMCs differ by no more than one of 5%, 8%, 10%, 12%, 14%, 16%, 18%, or 20% in terms of number.
[0214] antigen
[0215] In some embodiments according to any one of the methods, compositions, or a plurality of modified PBMCs described herein, the antigen is a disease-associated antigen. In some embodiments, the antigen is derived from a peptide or mRNA isolated from affected cells. In some embodiments, the antigen is a non-self antigen. In some embodiments, the antigen is a tumor antigen, a viral antigen, a bacterial antigen, or a fungal antigen. In some embodiments, the antigen is derived from a lysate, e.g., a lysate of affected cells. In some embodiments, the antigen is derived from a tumor lysate. In some embodiments, the antigen is a tumor antigen or a tumor-associated antigen. In some embodiments, the antigen is associated with cancer. In some embodiments, the cancer is any one of head and neck cancer, cervical cancer, vulvar cancer, vaginal cancer, penile cancer, anal cancer, perianal cancer, anogenital cancer, oral cancer, or salivary gland cancer. In some embodiments, the antigen is a head and neck cancer antigen, a cervical cancer antigen, a vulvar cancer antigen, a vaginal cancer antigen, a penile cancer antigen, an anal cancer antigen, a perianal cancer antigen, an anogenital cancer antigen, an oral cancer antigen, a salivary gland cancer antigen, a breast cancer antigen, a skin cancer antigen, a bladder cancer antigen, a colon cancer, a rectal cancer antigen, an endometrial cancer antigen, a kidney cancer antigen, a leukemia antigen, a lung cancer antigen, a melanoma antigen, a non-Hodgkin lymphoma antigen, a pancreatic cancer antigen, a prostate cancer antigen, or a thyroid cancer antigen. In some embodiments, the cancer is a solid tumor. In some embodiments, the cancer is a blood cancer. In some embodiments, the cancer is a virus-associated cancer. In some embodiments, the cancer is an HPV-associated cancer. In some embodiments, the cancer is a localized cancer. In some embodiments, the cancer is a metastatic cancer. In some embodiments, the antigen is associated with an infectious disease. In some embodiments, the infectious disease is associated with HIV, HPV, EBV, MCV, HBV, or HCV.
[0216] In some embodiments according to any one of the methods, compositions, or a plurality of modified PBMCs described herein, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs.
[0217] In some embodiments according to any one of the methods, compositions, or a plurality of modified PBMCs described herein, the antigen is a human papillomavirus (HPV) antigen. Papillomavirus is a small, unenveloped DNA virus with a virion size of approximately 55 nm in diameter. More than 100 HPV genotypes have been fully characterized, and a higher number are estimated to exist. HPV is a known cause of cervical cancer, as well as some vulvar, vaginal, penile, oropharyngeal, anal, and rectal cancers. Most HPV infections are asymptomatic and resolve spontaneously, but persistent infection by one of the oncogenic HPV types can progress to precancerous or cancerous. Other HPV-associated diseases may include common warts, plantar warts, flat warts, anogenital warts, anal lesions, epidermal dysplasia, focal epithelial hyperplasia, oral papillomas, verrucous cysts, laryngeal papillomatosis, squamous intraepithelial lesions (SIL), cervical intraepithelial neoplasms (CIN), vulvar intraepithelial neoplasms (VIN), and vaginal intraepithelial neoplasms (VAIN). Multiple known human papillomavirus (HPV) types cause benign lesions in which a subset is neoplastic. Based on epidemiological and phylogenetic relationships, HPV types are classified into 15 "high-risk types" (HPV 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73, and 82) and 3 "probably high-risk types" (HPV 26, 53, and 66), which together are known to manifest as low- and high-grade cervical changes and cancers, as well as other anogenital cancers, such as vulvar cancer, vaginal cancer, penile cancer, anal cancer, and perianal cancer, and head and neck cancer. Recently, an association between high-risk types HPV 16 and 18 and breast cancer has also been described.Eleven HPV types classified as "low-risk types" (HPV 6, 11, 40, 42, 43, 44, 54, 61, 70, 72, and 81) are known to manifest as benign low-grade cervical changes, genital warts, and recurrent respiratory papillomatosis. Cutaneous HPV types 5, 8, and 92 are associated with skin cancer. In some HPV-associated cancers, the immune system is suppressed, and correspondingly, the anti-tumor response is significantly impaired. See [Suresh and Burtness, Am J Hematol Oncol 13(6):20-27 (2017)]. In some embodiments, the antigen is a pool of multiple polypeptides that elicit a response to the same and / or different antigens. In some embodiments, an antigen within the pool of multiple antigens does not reduce the immune response to other antigens within the pool of multiple antigens. In some embodiments, the HPV antigen is a polypeptide comprising an antigen HPV epitope and one or more heterogeneous peptide sequences. In some embodiments, the HPV antigen is complexed with itself, with another antigen, or with an ajuvant. In some embodiments, the HPV is HPV-16 or HPV-18. In some embodiments, the HPV antigen consists of an HLA-A2-specific epitope. In some embodiments, the HPV antigen is an HPV E6 antigen or an HPV E7 antigen. In some embodiments, the antigen comprises a peptide derived from HPV E6 and / or E7. In some embodiments, the antigen comprises an HLA-A2-restricted peptide derived from HPV E6 and / or E7. In some embodiments, the HLA-A2-restricted peptide comprises an amino acid sequence of any one of SEQ ID NOs: 1-4. In some embodiments, the HPV antigen comprises an amino acid sequence having at least 90% similarity to any one of SEQ ID NOs: 18-25. In some embodiments, the HPV antigen comprises an amino acid sequence having at least 90% similarity to sequence identification number: 19.In some embodiments, the HPV antigen comprises an amino acid sequence having at least 90% similarity to sequence identification number: 23. In some embodiments, the HPV antigen comprises the amino acid sequence of sequence identification number: 19. In a preferred embodiment, the HPV antigen consists of the amino acid sequence of sequence identification number: 19. In some embodiments, the HPV antigen comprises the amino acid sequence of sequence identification number: 23. In a preferred embodiment, the HPV antigen consists of the amino acid sequence of sequence identification number: 23. In some embodiments, the antigen comprises any one of the amino acid sequences of sequence identification numbers: 18-25. In some embodiments, the antigen is a plurality of antigens comprising one or more of the amino acid sequences of sequence identification numbers: 18-25. In some embodiments, the antigen is a plurality of antigens comprising 2, 3, 4, 5, 6, 7, or 8 of the amino acid sequences of sequence identification numbers: 18-25. In some embodiments, the antigen is a plurality of antigens comprising an amino acid sequence having 90% or more similarity to SEQ ID NO: 19 and an amino acid sequence having 90% or more similarity to SEQ ID NO: 23. In a preferred embodiment, the antigen is a plurality of antigens comprising the amino acid sequence of SEQ ID NO: 19 and the amino acid sequence of SEQ ID NO: 23. In some embodiments, the plurality of antigens are contained within a pool of non-covalently linked peptides. In some embodiments, the plurality of antigens are contained within a pool of non-covalently linked peptides, wherein each peptide contains one or fewer antigens. In some embodiments, the plurality of antigens are contained within a pool of non-covalently linked peptides, wherein the amino acid sequence of SEQ ID NO: 19 and the amino acid sequence of SEQ ID NO: 23 are contained within separate peptides.
[0218] In some embodiments according to any one of the methods, compositions, or multiple modified PBMCs described herein, the modified PBMC comprises a plurality of antigens comprising a plurality of immunogenic epitopes. In further embodiments, after administering a modified PBMC comprising a plurality of antigens comprising a plurality of immunogenic epitopes to an individual, none of the plurality of immunogenic epitopes reduces the immune response to any other immunogenic epitope in the individual. In some embodiments, the antigen is a polypeptide, and the immunogenic epitope is an immunogenic peptide epitope. In some embodiments, the immunogenic peptide epitope is fused to an N-terminal flanking polypeptide and / or a C-terminal flanking polypeptide. In some embodiments, the antigen is a polypeptide comprising an immunogenic peptide epitope and one or more heterogeneous peptide sequences. In some embodiments, the antigen is a polypeptide comprising an immunogenic peptide epitope flanked on the N-terminus and / or C-terminus by a heterogeneous peptide sequence. In some embodiments, the flanking heteropeptide sequence is derived from a disease-associated immunogenic peptide. In some embodiments, the flanking heteropeptide sequence is a non-naturally occurring sequence. In some embodiments, the flanking heteropeptide sequence is derived from an immunogenic synthetic long peptide (SLP). In some embodiments, the N-terminal flanking polypeptide comprises any one of the amino acid sequences of SEQ ID NOs: 5–10 and / or the C-terminal flanking polypeptide comprises any one of the amino acid sequences of SEQ ID NOs: 11–17. In some embodiments, the antigen may be processed into an MHC class I-restriction peptide and / or an MHC class II-restriction peptide.
[0219] Azuvant
[0220] As used herein, the term "azuvant" may refer to a substance that directly or indirectly modulates or elicits an immune response. In some embodiments of the invention, an ajuvant is used to condition a population of PBMCs (i.e., PBMCs are incubated with an ajuvant before being administered to an individual). In some examples, an ajuvant is administered with an antigen to enhance the immune response to the antigen compared to the antigen alone. Thus, an ajuvant may be used to boost the induction of an immune cell response (e.g., a T cell response) to the antigen. In some embodiments, the invention provides PBMCs modified to include an intracellular antigen (e.g., HPV antigen) and an intracellular ajuvant. In some embodiments, as described herein, the perturbed PBMCs are incubated with both the antigen and the ajuvant. Exemplary ajuvants include, but are not limited to, interferon gene stimulators (STING) agonists, retinoic acid-derived gene I (RIG-I) agonists, and agonists for TLR3, TLR4, TLR7, TLR8, and / or TLR9. Exemplary ajuvants include, but are not limited to, CpG ODN, interferon-α (IFN-α), polyinosinic acid:polycythidyl acid (polyI:C), imiquimod (R837), resiquimod (R848), or lipopolysaccharide (LPS). In some embodiments, the ajuvant is CpG ODN, LPS, IFN-α, STING agonist, RIG-I agonist, polyI:C, R837, R848, TLR3 agonist, TLR4 agonist, or TLR9 agonist. In certain embodiments, the ajuvant is CpG ODN. In some embodiments, the ajuvant is CpG ODN. In some embodiments, the CpG ODN is a Class A CpG ODN, a Class B CpG ODN, or a Class C CpG ODN.In some embodiments, the CpG ODN ajuvant comprises one selected from the group consisting of CpG ODN 1018, CpG ODN 1585, CpG ODN 2216, CpG ODN 2336, CpG ODN 1668, CpG ODN 1826, CpG ODN 2006, CpG ODN 2007, CpG ODN BW006, CpG ODN D-SL01, CpG ODN 2395, CpG ODN M362, and CpG ODN D-SL03. In some embodiments, the CpG ODN ajuvant is the CpG ODN 1826 (TCCATGACGTTCCTGACGTT (SEQ ID: 30)) or CpG ODN 2006 (also known as CpG 7909) (TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID: 31)) oligonucleotide. In some embodiments, the ajuvant is CpG 7909. In some embodiments, the RIG-I agonist comprises polyinosinic acid:polycythidyl acid (polyI:C). Multiple ajuvants may also be used with the antigen to enhance the induction of an immune response. In some embodiments, the modified PBMC comprises more than one ajuvant. Multiple ajuvants may also be used with the antigen to enhance the induction of an immune response. In some embodiments, the modified PBMC comprises more than one ajuvant. In some embodiments, the modified PBMC comprises any combination of Azuvant CpG ODN, LPS, IFN-α, STING agonist, RIG-I agonist, poly I:C, R837, R848, TLR3 agonist, TLR4 agonist, or TLR 9 agonist.
[0221] In any embodiment described herein, unless otherwise indicated, an ajuvant may refer to (a) an ajuvant incubated with and passing through a disturbed input PBMC, (b) an ajuvant incubated with a PBMC so that the PBMC is conditioned, or (c) an ajuvant co-administered to an individual with modified PBMC.
[0222] In some embodiments, the concentration of the ajuvant incubated with the perturbed input PBMC is from about 0.01 μM to about 10 mM. For example, in some embodiments, the concentration of the ajuvant incubated with the perturbed input PBMC is any of about 0.01 μM, about 0.1 μM, about 1 μM, about 10 μM, about 100 μM, about 1 mM, or less than about 10 mM. In some embodiments, the concentration of the ajuvant incubated with the perturbed input PBMC is greater than about 10 mM. In some embodiments, the concentration of the ajuvant incubated with the perturbed input PBMC is any of about 0.01 μM to about 0.1 μM, about 0.1 μM to about 1 μM, about 1 μM to about 10 μM, about 10 μM to about 100 μM, about 100 μM to about 1 mM, or 1 mM to about 10 mM. In some embodiments, the concentration of the ajuvant incubated with the perturbed input PBMC is about 0.1 μM to about 1 mM. In some embodiments, the concentration of the ajuvant incubated with the perturbed input PBMC is about 0.1 μM to about 10 μM. In some embodiments, the concentration of the ajuvant incubated with the perturbed input PBMC is 1 μM.
[0223] In some embodiments, the concentration of the antigen incubated with the perturbed input PBMC is about 0.01 μM to about 10 mM. For example, in some embodiments, the concentration of the antigen incubated with the perturbed input PBMC is any of about 0.01 μM, about 0.1 μM, about 1 μM, about 10 μM, about 100 μM, about 1 mM, or less than about 10 mM. In some embodiments, the concentration of the antigen incubated with the perturbed input PBMC is greater than about 10 mM. In some embodiments, the concentration of antigen incubated with the perturbed input PBMC is any of about 0.01 μM to about 0.1 μM, about 0.1 μM to about 1 μM, about 1 μM to about 10 μM, about 10 μM to about 100 μM, about 100 μM to about 1 mM, or 1 mM to about 10 mM. In some embodiments, the concentration of antigen incubated with the perturbed input PBMC is about 0.1 μM to about 1 mM. In some embodiments, the concentration of antigen incubated with the perturbed input PBMC is about 0.1 μM to about 10 μM. In some embodiments, the concentration of antigen incubated with the perturbed input PBMC is 1 μM.
[0224] In some embodiments, the molar ratio of antigen to ajuvant incubated with the perturbed input PBMC is any of about 10,000:1 to about 1:10,000. For example, in some embodiments, the molar ratio of antigen to ajuvant incubated with the perturbed input PBMC is any one of about 10,000:1, about 1,000:1, about 100:1, about 10:1, about 1:1, about 1:10, about 1:100, about 1:1000, or about 1:10,000. In some embodiments, the molar ratio of antigen to ajuvant incubated with the perturbed input PBMC is any of about 10,000:1 to about 1,000:1, about 1,000:1 to about 100:1, about 100:1 to about 10:1, about 10:1 to about 1:1, about 1:1 to about 1:10, about 1:10 to about 1:100, about 1:100 to about 1:1000, and about 1:1000 to about 1:10000. In some embodiments, the molar ratio of antigen to ajuvant incubated with the perturbed input PBMC is about 200:1. In some embodiments, the molar ratio of antigen to ajuvant incubated with the perturbed input PBMC is about 20:1.
[0225] In some embodiments, the modified PBMC contains the ajuvant at a concentration of about 1 nM to about 1 mM. For example, in some embodiments, the modified PBMC contains the ajuvant at a concentration less than any of about 0.01 μM, about 0.1 μM, about 1 μM, about 10 μM, about 100 μM, about 1 mM, or about 10 mM. In some embodiments, the modified PBMC contains the ajuvant at a concentration greater than any of about 10 mM. In some embodiments, the modified PBMC contains the ajuvant at a concentration of about 1 nM to about 10 nM, about 0.1 μM to about 1 μM, about 1 μM to about 10 μM, about 10 μM to about 10 μM, about 10 μM to about 100 μM, about 100 μM to about 1 mM, or any of 1 mM to about 10 mM. In some embodiments, the modified PBMC contains ajuvant at a concentration of about 0.1 μM to about 1 mM. In some embodiments, the modified PBMC contains ajuvant at a concentration of about 1 μM.
[0226] In some embodiments, the modified PBMC contains the antigen at a concentration of about 1 nM to about 1 mM. For example, in some embodiments, the modified PBMC contains the antigen at a concentration less than any of about 0.01 μM, about 0.1 μM, about 1 μM, about 10 μM, about 100 μM, about 1 mM, or about 10 mM. In some embodiments, the modified PBMC contains the antigen at a concentration greater than any of about 10 mM. In some embodiments, the modified PBMC contains the antigen at a concentration of about 1 nM to about 10 nM, about 0.1 μM to about 1 μM, about 1 μM to about 10 μM, about 10 μM to about 10 μM, about 10 μM to about 100 μM, about 100 μM to about 1 mM, or 1 mM to about 10 mM. In some embodiments, the modified PBMC contains the antigen at a concentration of about 0.1 μM to about 1 mM. In some embodiments, the modified PBMC contains the antigen at a concentration of about 1 μM.
[0227] In some embodiments, the modified PBMC comprises a nucleic acid encoding an antigen at a concentration of about 1 nM to about 1 mM. In some embodiments, the modified PBMC comprises a nucleic acid encoding an antigen at any of the following concentrations: about 0.1 nM, about 1 nM, about 0.01 μM, about 0.1 μM, about 1 μM, about 10 μM, about 100 μM, about 1 mM, or less than about 10 mM. In some embodiments, the modified PBMC comprises a nucleic acid encoding an antigen at a concentration greater than about 10 mM. In some embodiments, the modified PBMC comprises a nucleic acid encoding an antigen at a concentration of about 0.1 nM to about 1 nM, about 1 nM to about 10 nM, about 10 nM to about 100 nM, about 0.1 μM to about 1 μM, about 1 μM to about 10 μM, about 10 μM to about 100 μM, about 100 μM to about 1 mM, or 1 mM to about 10 mM. In some embodiments, the modified PBMC comprises a nucleic acid encoding an antigen at a concentration of about 10 nM to about 100 nM. In some embodiments, the modified PBMC comprises a nucleic acid encoding an antigen at a concentration of about 1 nM to about 10 nM. In some embodiments, the modified PBMC comprises a nucleic acid encoding an antigen at a concentration of about 1 nM to about 10 nM. In some embodiments, the modified PBMC comprises an antigen at a concentration of about 50 nM. In some embodiments, the nucleic acid is mRNA.
[0228] In some embodiments, the modified PBMC comprises a nucleic acid encoding an antigen at a concentration of about 0.01 μg / mL to about 10 mg / mL. In some embodiments, the modified PBMC comprises a nucleic acid encoding an antigen at any of the following concentrations: about 0.01 μg / mL, about 0.1 μg / mL, about 1 μg / mL, about 10 μg / mL, about 100 μg / mL, about 1 mg / mL, or less than about 10 mg / mL. In some embodiments, the modified PBMC comprises a nucleic acid encoding an antigen at a concentration greater than about 10 μg / mL. In some embodiments, the modified PBMC comprises a nucleic acid encoding an antigen at any concentration of about 0.001 μg / mL to about 0.1 μg / mL, about 0.1 μg / mL to about 1 μg / mL, about 1 μg / mL to about 10 μg / mL, about 10 μg / mL to about 100 μg / mL, about 100 μg / mL to about 1 mg / mL, or 1 mg / mL to about 10 mg / mL. In some embodiments, the modified PBMC comprises a nucleic acid encoding an antigen at a concentration of about 0.1 μg / mL to about 1 mg / mL. In some embodiments, the modified PBMC contains antigen at a concentration of about 1 μg / mL, about 2 μg / mL, about 5 μg / mL, about 10 μg / mL, about 20 μg / mL, about 25 mg / mL, about 40 μg / mL, about 50 μg / mL, about 70 μg / mL, about 100 μg / mL, about 200 μg / mL, or about 300 μg / mL, or about 500 μg / mL. In some embodiments, the nucleic acid is mRNA.
[0229] In some embodiments, the molar ratio of antigen to ajuvant in the modified PBMC is any of about 10,000:1 to about 1:10,000. For example, in some embodiments, the molar ratio of antigen to ajuvant in the modified PBMC is any one of about 10,000:1, about 1,000:1, about 100:1, about 10:1, about 1:1, about 1:10, about 1:100, about 1:1000, or about 1:10,000. In some embodiments, the molar ratio of antigen to ajuvant in the modified PBMC is any of about 10,000:1 to about 1,000:1, about 1,000:1 to about 100:1, about 100:1 to about 10:1, about 10:1 to about 1:1, about 1:1 to about 1:10, about 1:10 to about 1:100, about 1:100 to about 1:1000, and about 1:1000 to about 1:10000. In some embodiments, the molar ratio of antigen to ajuvant in the modified PBMC is about 200:1. In some embodiments, the molar ratio of antigen to ajuvant in the modified PBMC is about 20:1.
[0230] In some embodiments, the antigen is complexed with itself, with another antigen, or with an ajuvant. In some embodiments, the modified PBMC comprises a) an antigen, b) an antigen and at least one other antigen, and / or c) a complex comprising an antigen and an ajuvant.
[0231] Additional variation of PBMC characteristics
[0232] In some embodiments according to any one of the method, composition, or plurality of modified PBMCs described herein, the plurality of modified PBMCs further comprise an agent that enhances the viability and / or function of the modified PBMCs compared to the corresponding plurality of modified PBMCs that do not comprise the agent. In some embodiments, the plurality of modified PBMCs further comprise an agent that enhances the viability and / or function of the modified PBMCs during freeze-thaw cycles compared to the corresponding plurality of modified PBMCs that do not comprise the agent. In some embodiments, the agent is a cryopreservative and / or a hypothermia preservative. In some embodiments, the cryopreservative or hypothermia preservative causes 10% or 20% or less of cell death in the plurality of PBMCs containing the agent compared to the corresponding plurality of PBMCs that do not comprise the agent, prior to any freeze-thaw cycle. In some embodiments, at least about 70%, about 80%, or about 90% of the plurality of modified PBMCs are viable after up to 1, 2, 3, 4, or 5 freeze-thaw cycles. In some embodiments, the agent is a compound, stabilizer, or cofactor that promotes endocytosis. In some embodiments, the agent is albumin. In some embodiments, the albumin is mouse, bovine, or human albumin. In some embodiments, the agent is human albumin. In some embodiments, the agent is one or more of a divalent metal cation, glucose, ATP, potassium, glycerol, trehalose, D-sucrose, PEG1500, L-arginine, L-glutamine, or EDTA. In some embodiments, the divalent metal cation is Mg 2+ , Zn 2+ or Ca 2+It is one or more of the following. In some embodiments, the agent is one or more of sodium pyruvate, adenine, trehalose, dextrose, mannose, sucrose, human serum albumin (HSA), (DMSO), HEPES, glycerol, glutathione, inosine, sodium dibasic phosphate, sodium monobasic phosphate, sodium metal ion, potassium metal ion, magnesium metal ion, chloride, acetate, gluconate, sucrose, potassium hydroxide, or sodium hydroxide. In some embodiments, the agent is one or more of sodium pyruvate, adenine, Rejuvesol®, trehalose, dextrose, mannose, sucrose, human serum albumin (HSA), PlasmaLyte®, DMSO, Cryostor® CS2, Cryostor® CS5, Cryostor® CS10, Cryostor® CS15, HEPES, glycerol, glutathione, and HypoThermosol®.
[0233] In some embodiments according to any one of the methods, compositions, or plurality of modified PBMCs described herein, the modified PBMC is further modified to increase the expression of one or more of the co-stimulatory molecules. In some embodiments, the co-stimulatory molecules are B7-H2 (ICOSL), B7-1 (CD80), B7-2 (CD86), CD70, LIGHT, HVEM, CD40, 4-1BBL, OX40L, TL1A, GITRL, CD30L, TIM4, SLAM, CD48, CD58, CD155, or CD112. In some embodiments, the plurality of modified PBMCs comprise nucleic acids that induce increased expression of one or more co-stimulatory molecules. In some embodiments, the plurality of modified PBMCs comprise mRNAs that induce increased expression of one or more co-stimulatory molecules. In some embodiments, the co-stimulatory molecules are signaling effectors in stimulating T cell activation.
[0234] In some embodiments according to any one of the methods, compositions, or plurality of modified PBMCs described herein, the modified PBMCs are further modified to increase the expression of one or more cytokines. In some embodiments, the cytokines are one or more of IL-2, IL-12, IL-21, or IFNα2. In some embodiments, the plurality of modified PBMCs comprise nucleic acids that induce increased expression and / or secretion of one or more cytokines. In some embodiments, the cytokines are signaling effectors in stimulating T cell activation.
[0235] In some embodiments according to any one of the methods, compositions, or plurality of modified PBMCs described herein, at least one cell within the plurality of modified PBMCs is positive for HLA-A2 expression. In some embodiments, the modified PBMCs include additional modifications to modulate MHC class I expression. In some embodiments, the modified PBMCs include additional modifications to modulate HLA-A2 MHC class I expression. In some embodiments, the modified PBMCs include additional modifications to modulate MHC class II expression. In some embodiments, the innate immune response carried in an individual in response to administration of the modified PBMCs in a homogeneous environment is reduced compared to the innate immune response carried in an individual in response to administration of the corresponding modified PBMCs that do not include additional modifications in a homogeneous environment. In some embodiments, the circulating half-life of the modified PBMCs in an individual administered with them is increased compared to the circulating half-life of the corresponding modified PBMCs that do not include additional modifications in an individual administered with them. In some embodiments, the circulating half-life in subjects administered with modified PBMCs is increased by about 10%, 25%, 50%, 75%, 100%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 200-fold, or 500-fold or greater than that compared to the circulating half-life in subjects administered with corresponding modified PBMCs that do not contain additional modifications. In some embodiments, the circulating half-life in subjects administered with modified PBMCs is essentially the same as the circulating half-life in subjects administered with corresponding modified PBMCs that do not contain additional modifications.
[0236] In some embodiments according to any one of the methods, compositions, or a plurality of modified PBMCs described herein, the method further comprises the step of incubating the input PBMC and / or modified PBMC with an agent that enhances the viability and / or function of the modified PBMC compared to a corresponding modified PBMC prepared without an additional incubation step.
[0237] PBMC conditioning
[0238] In some embodiments according to any one of the methods, compositions, or plurality of modified PBMCs described herein; the plurality of modified PBMCs are conditioned. In additional embodiments, the plurality of modified PBMCs are matured. In some embodiments, the plurality of PBMCs are conditioned after constriction-mediated delivery. In some embodiments, the plurality of modified PBMCs containing an antigen and / or ajuvant are incubated with a second ajuvant for a time sufficient to condition the modified PBMCs containing the constriction-mediated antigen and / or ajuvant, thereby producing a plurality of conditioned modified PBMCs containing the antigen and / or ajuvant. In some embodiments, the plurality of modified PBMCs containing the antigen and / or ajuvant are isolated from the cell suspension before incubation with the second ajuvant to condition the modified PBMCs. In some embodiments, the plurality of PBMCs are conditioned after constriction-mediated delivery. In some embodiments, a plurality of modified PBMCs comprising a constriction-transfer antigen and / or ajuvant are incubated with a second ajuvant for a time sufficient for the modified PBMCs comprising the constriction-transfer antigen and / or ajuvant to be conditioned, thereby producing a plurality of conditioned modified PBMCs comprising the antigen and / or ajuvant.In some aspects, a) passing a cell suspension containing a plurality of input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMC in the suspension, thereby causing disturbance of the input PBMCs sufficiently large for the antigen and / or ajuvant to pass through to form a plurality of disturbed input PBMCs; b) incubating the plurality of disturbed input PBMCs with the antigen and / or ajuvant for a time sufficient to allow the antigen to enter the disturbed input PBMCs, thereby generating a plurality of modified PBMCs containing the antigen and / or ajuvant; and c) a plurality of modified PBMCs comprising a constriction-transfer antigen and / or ajuvant, incubated with a second ajuvant for a time sufficient for the modified PBMCs comprising the constriction-transfer antigen and / or ajuvant to be conditioned, thereby producing a plurality of conditioned modified PBMCs comprising the antigen and / or ajuvant, provided by a method comprising the step of conditioned ajuvant. In some embodiments, the method further comprises isolating a plurality of modified PBMCs comprising the antigen and / or ajuvant from a cell suspension before incubating with the second ajuvant to conditioned the modified PBMCs. In some embodiments, the constriction-transfer ajuvant is the same as the conditioned ajuvant. In some embodiments, the constriction-transfer ajuvant is different from the conditioned ajuvant.
[0239] In some embodiments, the concentration of the antigen incubated with the modified PBMC is about 0.01 μM to about 10 mM. For example, in some embodiments, the concentration of the antigen incubated with the modified PBMC is any of about 0.01 μM, about 0.1 μM, about 1 μM, about 10 μM, about 100 μM, about 1 mM, or less than about 10 mM. In some embodiments, the concentration of the antigen incubated with the modified PBMC is greater than about 10 mM. In some embodiments, the concentration of the antigen incubated with the modified PBMC is any of about 0.01 μM to about 0.1 μM, about 0.1 μM to about 1 μM, about 1 μM to about 10 μM, about 10 μM to about 100 μM, about 100 μM to about 1 mM, or 1 mM to about 10 mM. In some embodiments, the concentration of the antigen incubated with the modified PBMC is about 0.1 μM to about 1 mM. In some embodiments, the concentration of the antigen incubated with the modified PBMC is about 0.1 μM to about 10 μM. In some embodiments, the concentration of the antigen incubated with the modified PBMC is 1 μM.
[0240] In some embodiments according to any one of the method, composition, or plurality of modified PBMCs described herein, the plurality of modified PBMCs are incubated with an ajuvant for about 1 to about 24 hours so that the modified PBMCs are conditioned. In some embodiments, the plurality of modified PBMCs are incubated with an ajuvant for about 2 to about 10 hours so that the modified PBMCs are conditioned. In some embodiments, the plurality of modified PBMCs are incubated with an ajuvant for about 3 to about 6 hours so that the modified PBMCs are conditioned. In some embodiments, the plurality of modified PBMCs are incubated with an ajuvant for any one of about 1 hour, 2 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, 5 hours, 5.5 hours, 6 hours, 8 hours, 12 hours, 16 hours, 20 hours, or 24 hours so that the modified PBMCs are conditioned. In some embodiments, a plurality of modified PBMCs are incubated with an ajuvant for about 4 hours to condition the modified PBMCs.
[0241] In some embodiments, a plurality of PBMCs are conditioned prior to constriction-mediated delivery. In some embodiments, a plurality of input PBMCs are incubated with an ajuvant for a time sufficient for the input PBMCs to be conditioned, thereby producing a plurality of conditioned input PBMCs. In some embodiments, a) a step of incubating a plurality of input PBMCs with an ajuvant for a time sufficient for the input PBMCs to be conditioned, thereby producing a plurality of conditioned input PBMCs; b) a step of passing a cell suspension containing a plurality of conditioned input PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the input PBMCs in the suspension, thereby causing disturbance of the input PBMCs large enough for the antigen to pass through to form a plurality of conditioned disturbed input PBMCs; and c) incubating a plurality of conditioned, perturbed PBMCs with an antigen for a time sufficient to allow the antigen to enter the perturbed PBMCs, thereby producing a plurality of conditioned, perturbed PBMCs containing the antigen, provided that a plurality of conditioned, perturbed PBMCs containing the antigen are prepared by a method comprising the step of conditioned, perturbed PBMCs containing the antigen are provided. In some embodiments, the method further comprises isolating the plurality of conditioned PBMCs from the conditioned ajuvant before passing the conditioned, perturbed PBMCs into a cell-perturbed constriction.In some embodiments, a plurality of conditioned modified PBMCs containing antigen and / or ajuvant are provided, prepared by a method comprising: a) incubating a plurality of conditioned PBMCs with a conditioned ajuvant for a time sufficient for the conditioned PBMCs to be conditioned, thereby producing a plurality of conditioned PBMCs; b) passing a cell suspension containing a plurality of conditioned PBMCs through a cell-modified constriction, wherein the diameter of the constriction is a function of the diameter of the conditioned PBMCs in the suspension, thereby causing disturbance of the conditioned PBMCs large enough for the antigen and / or ajuvant to pass through, thereby forming a plurality of conditioned disturbed PBMCs; and c) incubating a plurality of conditioned disturbed PBMCs with an antigen and / or ajuvant for a time sufficient for the antigen and / or ajuvant to enter the disturbed PBMCs, thereby producing a plurality of conditioned modified PBMCs containing the antigen and / or ajuvant. In some embodiments, the method further comprises isolating the conditioned multiple input PBMCs from the conditioned ajuvant before passing the conditioned multiple input PBMCs through the cell-modified stenosis. In some embodiments, the stenosis-delivering ajuvant is the same as the conditioned ajuvant. In some embodiments, the stenosis-delivering ajuvant is different from the conditioned ajuvant.
[0242] In some embodiments, the concentration of the antigen incubated with the input PBMC is about 0.01 μM to about 10 mM. For example, in some embodiments, the concentration of the antigen incubated with the input PBMC is any of about 0.01 μM, about 0.1 μM, about 1 μM, about 10 μM, about 100 μM, about 1 mM, or less than about 10 mM. In some embodiments, the concentration of the antigen incubated with the input PBMC is greater than about 10 mM. In some embodiments, the concentration of the antigen incubated with the input PBMC is any of about 0.01 μM to about 0.1 μM, about 0.1 μM to about 1 μM, about 1 μM to about 10 μM, about 10 μM to about 100 μM, about 100 μM to about 1 mM, or 1 mM to about 10 mM. In some embodiments, the concentration of the antigen incubated with the input PBMC is about 0.1 μM to about 1 mM. In some embodiments, the concentration of the antigen incubated with the input PBMC is about 0.1 μM to about 10 μM. In some embodiments, the concentration of the antigen incubated with the input PBMC is 1 μM.
[0243] In some embodiments according to any one of the methods, compositions, or a plurality of modified PBMCs described herein, a plurality of input PBMCs are incubated with an ajuvant for about 1 to about 24 hours so that the input PBMCs are conditioned. In some embodiments, a plurality of input PBMCs are incubated with an ajuvant for about 2 to about 10 hours so that the input PBMCs are conditioned. In some embodiments, a plurality of input PBMCs are incubated with an ajuvant for about 3 to about 6 hours so that the input PBMCs are conditioned. In some embodiments, a plurality of input PBMCs are incubated with an ajuvant for any one of about 1 hour, 2 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, 5 hours, 5.5 hours, 6 hours, 8 hours, 12 hours, 16 hours, 20 hours, or 24 hours so that the input PBMCs are conditioned. In some embodiments, a plurality of input PBMCs are incubated with an ajuvant for about 4 hours to condition the input PBMCs.
[0244] In some embodiments, a plurality of conditioned PBMCs containing an antigen are provided, prepared by incubating a plurality of PBMCs containing an antigen with an ajuvant for a time sufficient for the PBMCs to be conditioned, thereby producing a plurality of conditioned PBMCs containing the antigen. In some embodiments, a plurality of conditioned PBMCs containing an antigen are provided, prepared by incubating a plurality of PBMCs with an ajuvant for a time sufficient for the PBMCs to be conditioned before introducing the antigen into the PBMCs, thereby producing a plurality of conditioned PBMCs containing the antigen.
[0245] In some embodiments according to any one of the method, composition, or plurality of PBMCs described above, the concentration of the antigen incubated with the PBMC is about 0.01 μM to about 10 mM. For example, in some embodiments, the concentration of the antigen incubated with the PBMC is any of about 0.01 μM, about 0.1 μM, about 1 μM, about 10 μM, about 100 μM, about 1 mM, or less than about 10 mM. In some embodiments, the concentration of the antigen incubated with the PBMC is greater than about 10 mM. In some embodiments, the concentration of the antigen incubated with the PBMC is any of about 0.01 μM to about 0.1 μM, about 0.1 μM to about 1 μM, about 1 μM to about 10 μM, about 10 μM to about 100 μM, about 100 μM to about 1 mM, or 1 mM to about 10 mM. In some embodiments, the concentration of the antigen incubated with the PBMC is about 0.1 μM to about 1 mM. In some embodiments, the concentration of the antigen incubated with the PBMC is about 0.1 μM to about 10 μM. In some embodiments, the concentration of the antigen incubated with the PBMC is 1 μM.
[0246] In some embodiments according to any of the conditioned multiple PBMCs described herein, the multiple PBMCs are incubated with an ajuvant for about 1 to about 24 hours to condition the PBMCs. In some embodiments, the multiple PBMCs are incubated with an ajuvant for about 2 to about 10 hours to condition the PBMCs. In some embodiments, the multiple PBMCs are incubated with an ajuvant for about 3 to about 6 hours to condition the PBMCs. In some embodiments, the multiple PBMCs are incubated with an ajuvant for any one of about 1 hour, 2 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, 5 hours, 5.5 hours, 6 hours, 8 hours, 12 hours, 16 hours, 20 hours, or 24 hours to condition the PBMCs. In some embodiments, the multiple PBMCs are incubated with an ajuvant for about 4 hours to condition the PBMCs.
[0247] In some embodiments according to any one of the conditioned multiple PBMCs described herein, one or more co-stimulator molecules are upregulated in the conditioned multiple modified PBMCs compared to the unconditioned multiple modified PBMCs. In some embodiments, one or more co-stimulator molecules are upregulated in a subpopulation of cells in the conditioned multiple modified PBMCs compared to a subpopulation of cells in the unconditioned multiple modified PBMCs. In some embodiments, one or more co-stimulator molecules are upregulated in B cells of the conditioned multiple modified PBMCs compared to B cells in the unconditioned multiple modified PBMCs. In some embodiments, the co-stimulator molecules are CD80 and / or CD86. In some embodiments, the co-stimulator molecules are CD86. In some embodiments, CD80 and / or CD86 are upregulated by more than about 1.2, 1.5, 1.8, 2, 3, 4, 5, 8, or 10 times in conditioned B cells of a plurality of modified PBMCs compared to B cells of a plurality of unconditioned modified PBMCs. In some embodiments, CD80 and / or CD86 are upregulated by any multiple of the following in B cells of a plurality of conditioned modified PBMCs compared to B cells in a plurality of unconditioned modified PBMCs: about 1.2 to about 1.5 times, about 1.5 to about 1.8 times, about 1.8 to about 2 times, about 2 to about 3 times, about 3 to about 4 times, about 4 to about 5 times, about 5 to about 8 times, about 8 to about 10 times, about 10 to about 20 times, about 20 to about 50 times, about 50 to about 100 times, about 100 to about 200 times, about 200 to about 500 times, or more than about 500 times. In some embodiments, the expression of one or more of IFN-γ, IL-6, MCP-1, MIP-1β, IP-10, or TNF-α is increased in a plurality of conditioned modified PBMCs compared to a plurality of unconditioned modified PBMCs.In some embodiments, the expression of one or more of IFN-γ, IL-6, MCP-1, MIP-1β, IP-10, or TNF-α is increased in a subpopulation of cells within a plurality of conditioned modified PBMCs compared to a subpopulation of cells within a plurality of unconditioned modified PBMCs. In some embodiments, the expression of one or more of IFN-γ, IL-6, MCP-1, MIP-1β, IP-10, or TNF-α is increased by more than about 1.2 times, 1.5 times, 1.8 times, 2 times, 3 times, 4 times, 5 times, 8 times, or 10 times in a plurality of conditioned modified PBMCs compared to a plurality of unconditioned modified PBMCs. In some embodiments, the expression of one or more of IFN-γ, IL-6, MCP-1, MIP-1β, IP-10, or TNF-α in a plurality of conditioned modified PBMCs compared to a plurality of unconditioned modified PBMCs is increased by any of the following: about 1.2 to about 1.5 times, about 1.5 to about 1.8 times, about 1.8 to about 2 times, about 2 to about 3 times, about 3 to about 4 times, about 4 to about 5 times, about 5 to about 8 times, about 8 to about 10 times, about 10 to about 20 times, about 20 to about 50 times, about 50 to about 100 times, about 100 to about 200 times, about 200 to about 500 times, or more than about 500 times.
[0248] In some embodiments according to any one of the methods, compositions, or plurality of modified PBMCs described herein, the antigen comprises one or more proteins. In some embodiments, the antigen is encoded by one or more nucleic acids and enters the PBMC in the form of one or more nucleic acids, such as, but not limited to, DNA, cDNA, mRNA, and plasmids. In some embodiments, the antigen is encoded by one or more mRNAs and enters the PBMC in the form of one or more mRNAs. In some embodiments, the plurality of PBMCs comprises nucleic acids encoding the antigen. In some embodiments, the plurality of PBMCs comprises mRNA encoding the antigen.
[0249] Microfluidic systems and their components
[0250] Microfluidic channels providing cell-transformation constrictions
[0251] In some embodiments, the present invention provides a method for modulating an immune response by passing a cell suspension containing PBMCs through a constriction, wherein the constriction modifies the PBMCs, thereby causing disturbance of the PBMCs so that antigens and / or ajuvants enter the PBMCs, wherein the constriction is contained within a microfluidic channel. In some embodiments, multiple constrictions may be arranged in parallel and / or in series within a microfluidic channel. An exemplary microfluidic channel containing cell-modifying constrictions for use in the method disclosed herein is described in WO2013059343. An exemplary surface having pores for use in the method disclosed herein is described in WO2017041050.
[0252] In some embodiments, the microfluidic channel comprises a lumen and is configured to allow PBMC suspended in a buffer to pass through, wherein the microfluidic channel comprises a constriction. The microfluidic channel may be manufactured from any one of a number of materials including silicon, metal (e.g., stainless steel), plastic (e.g., polystyrene), ceramic, glass, crystalline substrate, amorphous substrate, or polymer (e.g., polymethyl methacrylate (PMMA), PDMS, cyclic olefin copolymer (COC), etc.). The fabrication of the microfluidic channel may be performed by any method known in the art, including dry etching, wet etching, photolithography, injection molding, laser ablation, or SU-8 masking.
[0253] In some embodiments, the constriction within the microfluidic channel includes an inlet portion, a center point, and an outlet portion. In some embodiments, the length, depth, and width of the constriction within the microfluidic channel may vary. In some embodiments, the diameter of the constriction within the microfluidic channel is a function of the diameter of the injected PBMC. Methods for determining the diameter of the PBMC are known in the art; for example, high-concentration imaging, cell counting, or flow cytometry. In some embodiments, the diameter of the constriction within the microfluidic channel is about 20% to about 99% of the average diameter of a plurality of injected PBMCs. In some embodiments, the size of the constriction is about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 99% of the average diameter of the PBMC or the average diameter of a subgroup of PBMCs. In some embodiments, the constriction size is about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 99% of the average of the minimum cross-sectional distances of a plurality of injected PBMCs. In some embodiments, the channel includes a constriction width of about 2 μm to about 10 μm or any width or range between these. In some embodiments, the channel includes a constriction width of about 3 μm to about 10 μm. In some embodiments, the channel includes a constriction width of about 3 μm to about 6 μm. In some embodiments, the channel includes a constriction width of about 4.2 μm to about 4.8 μm. For example, the stenotic width may be about 2 μm, about 2.5 μm, about 3 μm, about 3.5 μm, about 4 μm, about 4.5 μm, about 5 μm, about 5.5 μm, about 6 μm, about 6.5 μm, or about 7 μm. In some embodiments, the channel includes a stenotic length of about 10 μm and a stenotic width of about 3.5 μm. In some embodiments, the channel includes a stenotic length of about 10 μm and a stenotic width of about 4 μm.In some embodiments, the channel includes a constriction length of about 10 μm and a constriction width of about 4.5 μm. The cross-sections of the channel, inlet section, center point, and outlet section may also vary. For example, the cross-section may be circular, elliptical, elongated, square, hexagonal, or triangular in terms of shape. The inlet section defines the constriction angle, and the constriction angle is optimized to reduce channel blockage and to enhance the delivery of compounds into the PBMC. The angle of the outlet section may also vary. For example, the angle of the outlet section is configured to reduce the possibility of turbulence that could result in non-laminar flow. In some embodiments, the walls of the inlet section and / or outlet section are straight. In other embodiments, the walls of the inlet section and / or outlet section are curved.
[0254] A surface having pores that provide cell-deformed constrictions
[0255] In some embodiments, the present invention provides a method for modulating an immune response by passing a cell suspension comprising a plurality of PBMCs through a constriction, wherein the constriction modifies the PBMCs and thereby causes disturbance of the PBMCs so that an antigen and / or ajuvant enters the PBMCs, wherein the constriction is a pore or is contained within a pore. In some embodiments, the pore is contained within a surface. An exemplary surface having a pore for use in the method disclosed herein is describe...
Claims
Claim 1 A plurality of conditioned modified PBMCs comprising an antigen, wherein the antigen is exogenous to the modified PBMCs, and the plurality of modified PBMCs have been incubated with an ajuvant for a sufficient time for the plurality of modified PBMCs to be conditioned, the sufficient time being a) 2 to 10 hours, b) 3 to 6 hours, or c) 4 hours, and the conditioned plurality of modified PBMCs exhibit increased expression of (a) one or more co-stimulatory molecules and / or (b) one or more cytokines compared to the corresponding plurality of unconditioned modified PBMCs. Claim 2 In claim 1, a cell suspension containing a plurality of input PBMCs is passed through a cell-modified constriction, thereby inducing disturbance of the input PBMCs so that when an antigen comes into contact with the input PBMCs, it enters the input PBMCs through the disturbance, thereby delivering the antigen into the cells of the plurality of input PBMCs to produce a plurality of modified PBMCs. Claim 3 A plurality of conditioned modified PBMCs comprising an antigen and a first ajuvant, wherein the antigen and the first ajuvant are exogenous to the modified PBMCs, and the plurality of modified PBMCs have been incubated with a second ajuvant for a sufficient time for the plurality of modified PBMCs to be conditioned, the sufficient time being a) 2 to 10 hours, b) 3 to 6 hours, or c) 4 hours, and the conditioned plurality of modified PBMCs exhibit increased expression of (a) one or more co-stimulatory molecules and / or (b) one or more cytokines compared to the corresponding plurality of unconditioned modified PBMCs. Claim 4 In paragraph 3, a cell suspension comprising a plurality of input PBMCs is passed through a cell-modified constriction, thereby inducing disturbance of the input PBMCs so that the antigen and / or the first ajuvant enter the input PBMCs through disturbance when they come into contact with the input PBMCs, thereby delivering the antigen and / or the first ajuvant into the cells of the plurality of input PBMCs to produce a plurality of modified PBMCs, wherein a plurality of modified PBMCs are conditioned. Claim 5 In any one of paragraphs 1 to 4, a plurality of conditioned modified PBMCs comprising two or more of T cells, B cells, NK cells, monocytes, or combinations thereof. Claim 6 A plurality of conditioned modified PBMCs according to any one of claims 1 to 4, wherein, compared to a corresponding modified PBMC that was not incubated with an agent that enhances the viability and / or immune response function of the modified PBMC, the agent is additionally incubated with an agent that enhances the viability and / or immune response function of the modified PBMC, and the agent is a cryopreservation agent, a hypothermia preservative, albumin, a compound that enhances endocytosis, a stabilizer, or a co-factor, and / or the agent is one or more of a divalent metal cation, glucose, ATP, potassium, glycerol, trehalose, D-sucrose, PEG1500, L-arginine, L-glutamine, or EDTA. Claim 7 In any one of claims 1 to 4, a plurality of conditioned deformed PBMCs in which the diameter of the cell-deformed constriction is 10% to 99% of the average diameter of the plurality of injected PBMCs. Claim 8 In any one of claims 1 to 4, a plurality of conditioned modified PBMCs having a diameter of 4.2 μm to 6 μm of cell-deformed constriction. Claim 9 In any one of claims 1 to 4, a cell suspension comprising a plurality of input PBMCs is passed through multiple constrictions, and the multiple constrictions are arranged in series and / or parallel, wherein a plurality of conditioned modified PBMCs. Claim 10 A plurality of conditioned modified PBMCs according to any one of claims 1 to 4, wherein the ajuvant comprises CpG oligodeoxynucleotide (ODN), LPS, IFN-α, STING agonist, RIG-I agonist, poly I:C, R837, R848, TLR3 agonist, TLR4 agonist, or TLR9 agonist. Claim 11 A plurality of conditioned modified PBMCs according to any one of claims 1 to 4, wherein the antigen comprises a disease-associated antigen, an infectious disease antigen, or a cancer antigen. Claim 12 In paragraph 11, a plurality of conditioned modified PBMCs wherein (a) the disease-associated antigen is a human papillomavirus (HPV) antigen, (b) the infectious disease antigen is a hepatitis B virus (HBV) antigen, (c) the cancer antigen is from head and neck cancer, cervical cancer, vulvar cancer, vaginal cancer, penile cancer, anal cancer, perianal cancer, anogenital cancer, oral cancer or salivary gland cancer, or (d) the antigen is any combination of (a) to (c). Claim 13 A pharmaceutical composition for treating cancer in a subject requiring treatment for cancer, comprising a plurality of modified PBMCs conditioned according to any one of claims 1 to 4. Claim 14 A pharmaceutical composition for treating HPV infection or HBV infection in subjects requiring treatment for human papillomavirus (HPV) infection or hepatitis B virus (HBV) infection, comprising a plurality of modified PBMCs conditioned according to any one of claims 1 to 4. Claim 15 A method for generating a plurality of conditioned modified PBMCs containing an antigen, comprising the step of incubating a plurality of PBMCs containing an antigen with an ajuvant for a sufficient time for the plurality of PBMCs to be conditioned, thereby generating a plurality of conditioned modified PBMCs containing the antigen, wherein the sufficient time is a) 2 to 10 hours, b) 3 to 6 hours, or c) 4 hours, and wherein the conditioned plurality of modified PBMCs exhibit increased expression of (a) one or more co-stimulatory molecules and / or (b) one or more cytokines compared to a corresponding plurality of unconditioned modified PBMCs. Claim 16 A method according to claim 15, wherein a cell suspension containing multiple PBMCs is passed through a cell-transformed constriction, thereby inducing disturbance of the PBMCs so that when an antigen comes into contact with the PBMCs, it enters the PBMCs through the disturbance, thereby delivering the antigen into the cells of the multiple PBMCs. Claim 17 A method according to claim 16, wherein the diameter of the cell-deformed constriction is 10% to 99% of the average diameter of the plurality of injected PBMCs. Claim 18 In paragraph 16, a method in which the diameter of the cell-deformed constriction is 4.2 μm to 6 μm. Claim 19 A method according to any one of claims 16 to 18, wherein a cell suspension containing a plurality of input PBMCs is passed through multiple constrictions, and the multiple constrictions are arranged in series and / or parallel. Claim 20 A method according to any one of claims 15 to 18, wherein the ajuvant comprises CpG oligodeoxynucleotide (ODN), LPS, IFN-α, STING agonist, RIG-I agonist, poly I:C, R837, R848, TLR3 agonist, TLR4 agonist, or TLR9 agonist. Claim 21 A method according to any one of claims 15 to 18, wherein the antigen comprises a disease-associated antigen, an infectious disease antigen, or a cancer antigen. Claim 22 delete Claim 23 delete Claim 24 delete Claim 25 delete Claim 26 delete Claim 27 delete Claim 28 delete Claim 29 delete Claim 30 delete Claim 31 delete Claim 32 delete Claim 33 delete Claim 34 delete Claim 35 delete Claim 36 delete Claim 37 delete Claim 38 delete Claim 39 delete Claim 40 delete Claim 41 delete Claim 42 delete Claim 43 delete Claim 44 delete Claim 45 delete Claim 46 delete Claim 47 delete Claim 48 delete Claim 49 delete Claim 50 delete Claim 51 delete Claim 52 delete Claim 53 delete Claim 54 delete Claim 55 delete Claim 56 delete Claim 57 delete Claim 58 delete Claim 59 delete Claim 60 delete Claim 61 delete Claim 62 delete Claim 63 delete Claim 64 delete Claim 65 delete Claim 66 delete Claim 67 delete Claim 68 delete Claim 69 delete Claim 70 delete Claim 71 delete Claim 72 delete Claim 73 delete Claim 74 delete Claim 75 delete Claim 76 delete Claim 77 delete Claim 78 delete Claim 79 delete Claim 80 delete Claim 81 delete Claim 82 delete Claim 83 delete Claim 84 delete Claim 85 delete Claim 86 delete Claim 87 delete Claim 88 delete Claim 89 delete Claim 90 delete Claim 91 delete Claim 92 delete Claim 93 delete
Citation Information
Patent Citations
Delivery of biomolecules to immune cells
KR1020170074235A