Composition for detecting Streptococcus infantis CX-4 strain and uses thereof

KR103021671B1Active Publication Date: 2026-09-21COSMAX INC
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
KR1020240087047
Authority / Receiving Office
KR · KR
Patent Type
Patents
Current Assignee / Owner
Filing Date
2024-07-02
Publication Date
2026-09-21
Estimated Expiration
2044-07-02

Smart Images

  • Figure 112024071808587-PAT00006_ABST
    Figure 112024071808587-PAT00006_ABST
Patent Text Reader

Abstract

The present invention provides a composition for detecting the Streptococcus infantis CX-4 strain, a primer set, and a detection method using the same. The composition can rapidly and accurately detect or identify the Streptococcus infantis CX-4 strain with high detection specificity at the strain or species level.
Need to check novelty before this filing date? Find Prior Art

Description

Technology Field

[0001] This invention relates to a composition for identifying microorganisms at the level of specific strains and the use thereof. Background Technology

[0003] The skin is the largest organ of the human body that comes into contact with the external environment. It has the key function of protecting the body from external stimuli and preventing moisture from evaporating. Along with other organs such as the intestines, the skin is home to various microorganisms, including bacteria, fungi, small larvae, and viruses, which inhabit the skin while maintaining specialized functions. These microorganisms present on the skin and their entire genetic information (genome) are defined as the skin microbiome.

[0004] Research on the skin microbiome has become possible with the development of Next Generation Sequencing (NGS) analysis methods. In particular, the use of 16S rRNA gene primers allows for the cataloging and processing of the bacterial composition of the microbial community.

[0005] While this 16S rRNA gene-based NGS analysis method has the advantage of being able to detect all microorganisms in a specific environment, it currently has limitations in that it takes at least a week and cannot detect specific strains using 16S rRNA genes. Additionally, there is a disadvantage in that detecting specific strains using NGS is costly. Prior art literature

[0007] (Patent Document 0001) KR 10-2167386 B1 The problem to be solved

[0008] This specification describes Streptococcus infantis ( Streptococcus infantisThis invention relates to a molecular marker based on Whole Genome Sequence (WGS) data that can identify the CX-4 strain at the strain or species level. By using the said molecular marker, the Streptococcus infantis CX-4 strain can be identified relatively quickly and accurately through nucleic acid amplification reactions such as PCR (polymerase chain reaction).

[0009] One aspect comprises Streptococcus infantis deposited under accession number KCCM12642P, comprising one or more preparations selected from the following: Streptococcus infantis The present invention provides a composition for detecting the CX-4 strain:

[0010] (1) A preparation capable of specifically detecting a polynucleotide composed of SEQ ID NO. 1 or a polynucleotide complementary thereof;

[0011] (2) A preparation capable of specifically detecting a polynucleotide composed of SEQ ID NO. 2 or a polynucleotide complementary thereof;

[0012] (3) A preparation capable of specifically detecting a polynucleotide composed of SEQ ID NO. 3 or a polynucleotide complementary thereof;

[0013] (4) A preparation capable of specifically detecting a polynucleotide composed of SEQ ID NO. 4 or a polynucleotide complementary thereof; and

[0014] (5) A preparation capable of specifically detecting a polynucleotide composed of sequence number 5 or a polynucleotide complementary thereto.

[0015] Another aspect is Streptococcus infantis deposited under accession number KCCM12642P selected from the following ( Streptococcus infantis ) To provide a primer set for the detection of the CX-4 strain:

[0016] (i) A first primer set consisting of a forward primer represented by SEQ ID NO. 6 and a reverse primer represented by SEQ ID NO. 7;

[0017] (ii) A second primer set consisting of a forward primer represented by SEQ ID NO. 8 and a reverse primer represented by SEQ ID NO. 9;

[0018] (iii) A third primer set consisting of a forward primer represented by SEQ ID NO. 10 and a reverse primer represented by SEQ ID NO. 11;

[0019] (iv) a fourth primer set consisting of a forward primer represented by SEQ ID NO. 12 and a reverse primer represented by SEQ ID NO. 13; and

[0020] (v) A fifth primer set consisting of a forward primer designated as SEQ ID NO. 14 and a reverse primer designated as SEQ ID NO. 15.

[0021] Another aspect is Streptococcus infantis deposited under accession number KCCM12642P, comprising a composition according to one aspect ( Streptococcus infantis It is to provide a kit for detecting the CX-4 strain.

[0022] Another aspect is a composition, primer set, or kit according to one aspect, using Streptococcus infantis deposited under accession number KCCM12642P ( Streptococcus infantis The purpose is to provide a method for detecting the CX-4 strain. means of solving the problem

[0024] One aspect comprises Streptococcus infantis deposited under accession number KCCM12642P, comprising one or more preparations selected from the following: Streptococcus infantis ) Provides a composition for detecting the CX-4 strain:

[0025] (1) A preparation capable of specifically detecting a polynucleotide composed of SEQ ID NO. 1 or a polynucleotide complementary thereof;

[0026] (2) A preparation capable of specifically detecting a polynucleotide composed of SEQ ID NO. 2 or a polynucleotide complementary thereof;

[0027] (3) A preparation capable of specifically detecting a polynucleotide composed of SEQ ID NO. 3 or a polynucleotide complementary thereof;

[0028] (4) A preparation capable of specifically detecting a polynucleotide composed of SEQ ID NO. 4 or a polynucleotide complementary thereof; and

[0029] (5) A preparation capable of specifically detecting a polynucleotide composed of sequence number 5 or a polynucleotide complementary thereto.

[0030] Streptococcus infantis deposited under the above accession number KCCM12642P ( Streptococcus infantis The CX-4 strain is disclosed in Korean Patent No. 10-2167386.

[0031] A polynucleotide composed of any one of SEQ ID NOs 1 to 5 or a polynucleotide complementary thereof may be a partial sequence of the whole genome sequence of the Streptococcus infantis CX-4 strain deposited under accession number KCCM12642P. The whole genome includes all genetic information of the microorganism, such as chromosomal DNA and plasmid DNA.

[0032] The above sequence number 1 may be a sequence at positions 184 to 398 of the complete sequence of the chromosomal DNA of the CX-4 strain.

[0033] The above sequence number 2 may be a sequence at the 46,001st to 46,072nd position of the complete sequence of the chromosomal DNA of the CX-4 strain.

[0034] The above sequence number 3 may be a sequence at positions 46,048 to 46,133 of the complete sequence of the chromosomal DNA of the CX-4 strain.

[0035] The above sequence number 4 may be a sequence at positions 46,067 to 46,163 of the complete sequence of the chromosomal DNA of the CX-4 strain.

[0036] The above sequence number 5 may be a sequence at positions 357,457 to 357,580 of the complete sequence of the chromosomal DNA of the CX-4 strain.

[0037] A polynucleotide composed of any one of SEQ ID NOs 1 to 5 or a polynucleotide complementary thereof may be a whole-genome sequencing (WGS)-based molecular marker capable of identifying the Streptococcus infantis CX-4 strain at the strain or species level. The term "molecular marker" refers to a molecule having characteristics capable of confirming the existence or state of a living organism or substance. For example, a specific DNA base sequence may be used as a molecular marker capable of determining the presence or absence of a specific strain. If any one of SEQ ID NOs 1 to 5 or a sequence complementary thereof is present in the nucleic acid sequence of the microorganism to be analyzed, the microorganism may be identified as the Streptococcus infantis CX-4 strain.

[0038] In addition, since the polynucleotide composed of any one of SEQ ID NOs 1 to 5 or its complementary polynucleotide is a whole-genome sequencing (WGS) based molecular marker, it has significantly superior detection specificity compared to the existing 16S rRNA gene-based NGS analysis method, which cannot detect specific strains. Therefore, by utilizing the above molecular marker, it is possible to distinguish the Streptococcus infantis CX-4 strain from microorganisms belonging to closely related strains or species that cannot be distinguished by general physiological or chemical differences.

[0039] In addition, if a preparation capable of specifically detecting a polynucleotide composed of any one of SEQ ID NOs 1 to 5 or a polynucleotide complementary thereof is used, a specific strain can be identified by detecting a molecular marker of relatively short length of less than 300 bp, so the time and cost can be significantly reduced compared to the existing NGS analysis method that identifies 16S rRNA genes of hundreds to thousands of bp length.

[0040] Accordingly, a preparation capable of specifically detecting a polynucleotide composed of any one of SEQ ID NOs 1 to 5 or a polynucleotide complementary thereof may be a preparation capable of detecting or distinguishing the Streptococcus infantis CX-4 strain. The said preparation can specifically detect only the Streptococcus infantis CX-4 strain, distinguishing it even from microorganisms that differ in detailed lineage from the Streptococcus infantis CX-4 strain. Accordingly, the composition according to one aspect above is the Streptococcus infantis ( deposited under accession number KCCM12642P) Streptococcus infantis It may be a composition for identifying CX-4 strains.

[0041] The above preparation is not limited in type as long as it is a substance capable of specifically binding to the polynucleotide or its complementary polynucleotide. The above preparation may be a primer or probe that specifically binds to the polynucleotide or its complementary polynucleotide, but is not limited thereto.

[0042] The above "primer" is a short single-stranded oligonucleotide that serves as a starting point for the formation of another polymer strand complementary to the template during DNA synthesis. The primer used in the nucleic acid amplification reaction may include a primer set consisting of a forward primer and a reverse primer. The length of the primer may be 15 to 40 nt, 15 to 30 nt, 15 to 25 nt, 18 to 40 nt, 18 to 30 nt, or 18 to 25 nt, but is not limited thereto.

[0043] When a nucleic acid amplification reaction is performed using a primer that specifically binds to a polynucleotide composed of any one of SEQ ID NOs 1 to 5 or a polynucleotide complementary thereof, the Streptococcus infantis CX-4 strain can be specifically identified based on the presence or absence of an amplification product.

[0044] In one embodiment, the primer may be one or more selected from the following:

[0045] (i) A first primer set consisting of a forward primer represented by SEQ ID NO. 6 and a reverse primer represented by SEQ ID NO. 7;

[0046] (ii) A second primer set consisting of a forward primer represented by SEQ ID NO. 8 and a reverse primer represented by SEQ ID NO. 9;

[0047] (iii) A third primer set consisting of a forward primer represented by SEQ ID NO. 10 and a reverse primer represented by SEQ ID NO. 11;

[0048] (iv) a fourth primer set consisting of a forward primer represented by SEQ ID NO. 12 and a reverse primer represented by SEQ ID NO. 13; and

[0049] (v) A fifth primer set consisting of a forward primer designated as SEQ ID NO. 14 and a reverse primer designated as SEQ ID NO. 15.

[0050] The above "probe" refers to a DNA or RNA fragment complementary to a specific base sequence of DNA or RNA, and is labeled with a radioactive element, staining agent, fluorescence, etc., so that the presence or absence of the specific base sequence can be confirmed. The length of the probe may be 10 to 500 bp, 10 to 300 bp, 10 to 200 bp, 10 to 100 bp, 50 to 500 bp, 50 to 300 bp, 50 to 200 bp, 50 to 100 bp, 100 to 500 bp, 100 to 300 bp, or 100 to 200 bp, but is not limited thereto.

[0051] When hybridization is performed using a probe that specifically binds to a polynucleotide composed of any one of SEQ ID NOs 1 to 5 or a polynucleotide complementary thereof, the Streptococcus infantis CX-4 strain can be specifically identified through the presence or absence of hybridization.

[0052] In one embodiment, the probe may be an oligonucleotide composed of a sequence of at least 10, at least 20, at least 30, at least 40, at least 50, at least 100, at least 150, or at least 200 consecutive nucleotides that are complementary to part or all of 'a polynucleotide composed of any one of sequence numbers 1 to 5 or a polynucleotide complementary thereto'.

[0053] In one embodiment, the probe may be an oligonucleotide composed of a nucleotide sequence of length 213 nt that is complementary to the polynucleotide composed of sequence number 1 or a polynucleotide complementary thereto.

[0054] In one embodiment, the probe may be an oligonucleotide composed of a nucleotide sequence of length 70 nt that is complementary to the polynucleotide composed of sequence number 2 or a polynucleotide complementary thereto.

[0055] In one embodiment, the probe may be an oligonucleotide composed of a nucleotide sequence of length 84 nt that is complementary to the polynucleotide composed of sequence no. 3 or a polynucleotide complementary thereto.

[0056] In one embodiment, the probe may be an oligonucleotide composed of a nucleotide sequence of length 95 nt that is complementary to the polynucleotide composed of sequence number 4 or a polynucleotide complementary thereto.

[0057] In one embodiment, the probe may be an oligonucleotide composed of a nucleotide sequence of length 122 nt that is complementary to the polynucleotide composed of sequence number 5 or a polynucleotide complementary thereto.

[0058] The primer or probe may be chemically synthesized using known methods. The primer or probe may additionally include one or more labels selected from radioactive elements, chromophores, chemiluminescent groups, fluorescent groups, and magnetic particles connected to the 5'-terminus or 3'-terminus.

[0059] The above "label" or "detectable label" may mean any chemical moiety bonded to a nucleotide or a nucleotide polymer, and said bond may be a covalent or non-covalent bond. Such detectable labels are known in the art. Non-limiting examples of said detectable labels include, 32 P or 35 Radioactive elements such as S; linker molecules such as biotin, avidin, streptavidin, HRP (horseradish peroxidase), protein A, protein G, antibodies or fragments thereof, FLAG tags, myc tags; enzymes such as peroxidase and luciferase; electron donors and acceptors; dyes such as Cy5 and Cy3; magnetic particles (MP) such as iron oxide nanoparticles and gold nanoparticles.

[0061] Another aspect is Streptococcus infantis deposited under accession number KCCM12642P selected from the following ( Streptococcus infantis ) Provides a primer set for detecting the CX-4 strain:

[0062] (i) A first primer set consisting of a forward primer represented by SEQ ID NO. 6 and a reverse primer represented by SEQ ID NO. 7;

[0063] (ii) A second primer set consisting of a forward primer represented by SEQ ID NO. 8 and a reverse primer represented by SEQ ID NO. 9;

[0064] (iii) A third primer set consisting of a forward primer represented by SEQ ID NO. 10 and a reverse primer represented by SEQ ID NO. 11;

[0065] (iv) a fourth primer set consisting of a forward primer represented by SEQ ID NO. 12 and a reverse primer represented by SEQ ID NO. 13; and

[0066] (v) A fifth primer set consisting of a forward primer designated as SEQ ID NO. 14 and a reverse primer designated as SEQ ID NO. 15.

[0067] The forward primer represented by SEQ ID NO 6 above has a length of 20 bp, a melting temperature (Tm) of about 57°C, and a GC% of about 50%.

[0068] The reverse primer represented by SEQ ID NO 7 above has a length of 22 bp, a Tm of about 58°C, and a GC% of about 45%.

[0069] The forward primer represented by SEQ ID NO 8 above has a length of 20 bp, a Tm of about 59°C, and a GC% of about 50%.

[0070] The reverse primer represented by SEQ ID NO 9 above has a length of 21 bp, a Tm of about 58°C, and a GC% of about 43%.

[0071] The forward primer represented by SEQ ID NO 10 has a length of 21 bp, a Tm of about 58°C, and a GC% of about 43%.

[0072] The reverse primer represented by SEQ ID NO 11 above has a length of 20 bp, a Tm of about 55°C, and a GC% of about 45%.

[0073] The forward primer represented by SEQ ID NO 12 above has a length of 20 bp, a Tm of about 58°C, and a GC% of about 45%.

[0074] The reverse primer represented by SEQ ID NO 13 above has a length of 23 bp, a Tm of about 57°C, and a GC% of about 39%.

[0075] The forward primer represented by SEQ ID NO 14 has a length of 20 bp, a Tm of about 58°C, and a GC% of about 50%.

[0076] The reverse primer represented by SEQ ID NO 15 above has a length of 20 bp, a Tm of about 58°C, and a GC% of about 50%.

[0077] When performing a nucleic acid amplification reaction using the above primer set, Streptococcus infantis ( Streptococcus infantis The amplification product can be detected only when the CX-4 strain is present.

[0078] In one embodiment, when PCR is performed using any one of the first to fifth primer sets, under one condition having the same annealing temperature and time, Streptococcus oralis belonging to the same genus but different species ( Streptococcus oralis ) YM-13, Streptococcus mitis( Streptococcus mitis ) CX-8 strain, Streptococcus pneumoniae( Streptococcus pneumoniae For the CX-1 strain, no PCR product is synthesized at all, and only Streptococcus infantis ( Streptococcus infantis It was confirmed that PCR products were synthesized only from the CX-4 strain. Through this, it was found that even if strains of the same genus are present in the sample, only the Streptococcus infantis CX-4 strain can be specifically and clearly detected and identified at the species level.

[0079] In one embodiment, when PCR is performed using any one of the first to fifth primer sets, under one condition having the same annealing temperature and time, Streptococcus infantis (which belongs to the same species but is a different strain) Streptococcus infantis For the KACC 13835 strain, no PCR product was synthesized at all, and only Streptococcus infantis ( Streptococcus infantisIt was confirmed that PCR products were synthesized only from the CX-4 strain. Through this, it was found that even if strains of the same species are present in the sample, only the Streptococcus infantis CX-4 strain can be specifically and clearly detected and identified at the strain level.

[0081] Another aspect is Streptococcus infantis deposited under accession number KCCM12642P, comprising a composition according to one aspect ( Streptococcus infantis ) Provides a kit for detecting the CX-4 strain.

[0082] The above kit may additionally include reagents necessary for nucleic acid amplification reactions.

[0083] The above nucleic acid amplification reaction may be used without limitation as long as it is a nucleic acid amplification technology known in the art. The above nucleic acid amplification reaction may be, for example, PCR (polymerase chain reaction). The above PCR may include, but is not limited to, Real-Time PCR, RT-PCR (Reverse Transcriptase Polymerase Chain Reaction), qRT-PCR (quantitative Real-Time Polymerase Chain Reaction), etc. Accordingly, the above kit may be a PCR kit.

[0084] The reagents required for the above nucleic acid amplification reaction may include DNA polymerase, dNTPs, buffer solution, etc.

[0085] The above kit may additionally include a user guide describing the optimal reaction execution conditions.

[0087] Another aspect is a composition, primer set, or kit according to one aspect, using Streptococcus infantis deposited under accession number KCCM12642P ( Streptococcus infantis ) Provides a method for detecting the CX-4 strain.

[0088] The above detection may be performed by one or more methods selected from PCR analysis, DNA sequencing, microarray hybridization, DAF (DNA Amplification Fingerprinting), Northern blot, and Southern blot, but is not limited thereto.

[0089] In one embodiment, the method comprises the step of isolating nucleic acid from a sample;

[0090] A step of performing a nucleic acid amplification reaction using the above nucleic acid as a template and a primer set according to one aspect; and

[0091] It may include a step of detecting the amplification product generated by the above nucleic acid amplification reaction.

[0092] The above sample may be a strain subject to analysis, or a substance expected to contain the said strain.

[0093] The above nucleic acid may be DNA or RNA. The above nucleic acid may be DNA. The above DNA may include genomic DNA (gDNA). The above DNA may include chromosomal DNA and plasmid DNA (pDNA). The above genomic DNA may refer to chromosomal DNA.

[0094] Methods known in the art may be used to isolate nucleic acids from the above sample.

[0095] The above nucleic acid amplification reaction may be used without limitation as long as it is a nucleic acid amplification technique known in the art. The above nucleic acid amplification reaction may be, for example, PCR. The above PCR may include, but is not limited to, real-time PCR, RT-PCR, qRT-PCR, etc.

[0096] The annealing temperature of the nucleic acid amplification reaction above may be 50 to 70°C, 52 to 60°C, 52 to 58°C, 52 to 56°C, 54 to 60°C, 54 to 58°C, 54 to 56°C, or about 55°C.

[0097] Detection of the amplified product can be performed using DNA chips, gel electrophoresis, radiometric measurement, fluorescence measurement, phosphorescence measurement, magnetic field measurement, etc., but is not limited thereto.

[0098] In the above detection step, if an amplification product is detected, the sample is Streptococcus infantis deposited under accession number KCCM12642P ( Streptococcus infantis It may be determined that it is a CX-4 strain, or that the strain is present in the sample.

[0099] Therefore, the above method is for Streptococcus infantis deposited under accession number KCCM12642P ( Streptococcus infantis This could be a method to identify the CX-4 strain.

[0101] Redundant content is omitted out of consideration for the complexity of this specification, and terms not otherwise defined in this specification have the meanings commonly used in the technical field to which this invention belongs. Effects of the invention

[0103] Since the composition according to one aspect utilizes whole-genome sequencing (WGS)-based molecular markers, Streptococcus infantis ( Streptococcus infantis ) The CX-4 strain can be rapidly and accurately detected or identified with high detection specificity at the strain or species level. Brief explanation of the drawing

[0105] Figure 1 shows the result of verifying the first primer set for detecting Streptococcus infantis CX-4, which was finally selected, with NCBI Primer Blast. Figure 2 shows the result of verifying the second primer set for the detection of Streptococcus infantis CX-4 using NCBI Primer Blast. Figure 3 shows the result of verifying the third primer set for the detection of Streptococcus infantis CX-4 using NCBI Primer Blast. Figure 4 shows the result of verifying the final selected fourth primer set for Streptococcus infantis CX-4 detection with NCBI Primer Blast. Figure 5 shows the result of verifying the final selected fifth primer set for Streptococcus infantis CX-4 detection with NCBI Primer Blast. Figure 6 is the electrophoresis result of the PCR product using the first primer set for the detection of Streptococcus infantis CX-4. Figure 7 is the electrophoresis result of the PCR product using the second primer set for the detection of Streptococcus infantis CX-4. Figure 8 is the electrophoresis result of the PCR product using the third primer set for the detection of Streptococcus infantis CX-4. Figure 9 is the electrophoresis result of the PCR product using the fourth primer set for the detection of Streptococcus infantis CX-4. Figure 10 is the electrophoresis result of the PCR product using the fifth primer set for the detection of Streptococcus infantis CX-4. Specific details for implementing the invention

[0106] The following examples will be explained in more detail. However, these examples are intended to illustrate one or more specific examples, and the scope of the present invention is not limited to these examples.

[0108] Example 1: Preparation of Primer

[0109] Streptococcus infantis ( Streptococcus infantisPrimers capable of specifically detecting the CX-4 strain (accession number: KCCM12642P) were prepared.

[0110] First, whole genome sequences of microorganisms belonging to closely related strains or species that cannot be distinguished by general physiological or chemical differences were collected from the NCBI (National Center for Biotechnology Information). The target strains and comparison strains are shown in Table 1 below.

[0111] Genus Species Strain Target strain Streptococcus infantis CX-4 Comparison strain 1 Streptococcus infantis KACC 13835 Comparison strain 2 Streptococcus oralis YM-13 Comparison strain 3 Streptococcus mitis CX-8 Comparison strain 4 Streptococcus pneumoniae CX-1

[0112] After performing fragmentation of the whole genome information of the strains in Table 1 in units of 10 to 500 bp, the fragmented sequences were numbered using Linux commands. In addition, sequence information for the remaining regions was collected by excluding regions with identical sequences using NCBI's Nucleotide Blast. Subsequently, candidate primers were designed using primer design systems such as NCBI Primer Blast from the regions containing rare sequences.

[0114] Example 2: In-silico PCR of candidate primers

[0115] Prior to designing the primers selected as candidates in Example 1, theoretical primers were verified through in-silico PCR using a server.

[0116] Figure 1 shows the result of confirming the first primer set for detecting Streptococcus infantis CX-4, which was finally selected, using NCBI Primer Blast. The first primer set can specifically detect a 213 bp long sequence at positions 184 to 398 of the full-length sequence of the genomic DNA of the Streptococcus infantis CX-4 strain. The 213 bp long sequence is shown in SEQ ID NO. 1.

[0117] Figure 2 shows the results of verifying the second primer set for detecting Streptococcus infantis CX-4 using NCBI Primer Blast. The second primer set can specifically detect a 70 bp sequence at positions 46,001 to 46,072 of the full-length sequence of the genomic DNA of the Streptococcus infantis CX-4 strain. The 70 bp sequence is shown in SEQ ID NO. 2.

[0118] Figure 3 shows the results of verifying the third primer set for detecting Streptococcus infantis CX-4 using NCBI Primer Blast. The third primer set can specifically detect an 84 bp sequence at positions 46,048 to 46,133 of the full-length sequence of the genomic DNA of the Streptococcus infantis CX-4 strain. The 84 bp sequence is shown in SEQ ID NO. 3.

[0119] Figure 4 shows the results of verifying the finally selected fourth primer set for detecting Streptococcus infantis CX-4 using NCBI Primer Blast. The fourth primer set can specifically detect a 95 bp sequence at positions 46,067 to 46,163 of the full-length sequence of the genomic DNA of the Streptococcus infantis CX-4 strain. The 95 bp sequence is shown in SEQ ID NO. 4.

[0120] Figure 5 shows the result of confirming the final selected fifth primer set for detecting Streptococcus infantis CX-4 using NCBI Primer Blast. The fifth primer set can specifically detect a 122 bp sequence at positions 357,457 to 357,580 of the full-length sequence of the genomic DNA of the Streptococcus infantis CX-4 strain. The 122 bp sequence is shown in SEQ ID NO. 5.

[0122] Example 3: Primer verification PCR performed at optimal temperature

[0123] For the five primer sets finally selected in Example 2, primer validation experiments were conducted via PCR using the genomic DNA (gDNA) of the target strain and the comparison strain as templates at the optimal temperature. Information on the five primer sets is shown in Table 2 below.

[0124] Target strain Primer set direction Sequence (5'->3') Sequence number annealing temperature Amplification product Streptococcus infantis CX-4 1st Primer Set Forward TGGCTATCGGTTTCCAAGTC 6 55℃ 213 bp (Sequence No. 1) Reverse TGGCCCAAATATTTCCATCTCC 7 2nd Primer Set Forward ATGCCAAGGTGCCTTTATGC 8 55℃ 70 bp (sequence number 2) Reverse AGCGCTTGTTTTACAAAGGTG 9 3rd Primer Set Forward ACCACCTTTGTAAAACAAGCG 10 55℃ 84 bp (sequence number 3) Reverse TTTTTCGGTACTGGAGTCAG 11 4th Primer Set Forward CGCTTGCAATCTTGCATCTT 12 55℃ 95 bp (sequence number 4) Reverse TGGATGATTTTGAGGATCTTGTG 13 5th Primer Set Forward GTAGACCTTGCCATTGCCTT 14 55℃ 122 bp (sequence number 5) Reverse GAATGGCCAGTAGTTGTGCT 15

[0126] Example 4: Confirmation of Specific Reaction of Primer

[0127] Experiments were conducted to verify whether the finally selected primers specifically bind only to the target strains.

[0128] Specifically, Streptococcus infantis CX-4, Streptococcus infantis KACC 13835 Streptococcus oralis YM-13, Streptococcus mitis CX-8, Streptococcus pneumonia CX-1 PCR was performed on each genomic DNA (gDNA); DNA of an environmental sample; and a negative control using five sets of primers. Total DNA from the skin was used as the DNA of the environmental sample. Sterile distilled water (SDW) was used as the negative control.

[0129] Figure 6 is the electrophoresis result of the PCR product using the first primer set for the detection of Streptococcus infantis CX-4.

[0130] Figure 7 is the electrophoresis result of the PCR product using the second primer set for the detection of Streptococcus infantis CX-4.

[0131] Figure 8 is the electrophoresis result of the PCR product using the third primer set for the detection of Streptococcus infantis CX-4.

[0132] Figure 9 is the electrophoresis result of the PCR product using the fourth primer set for the detection of Streptococcus infantis CX-4.

[0133] Figure 10 is the electrophoresis result of the PCR product using the fifth primer set for the detection of Streptococcus infantis CX-4.

[0134] As a result, as shown in FIGS. 6 to 10, all five primer sets were Streptococcus infantis ( Streptococcus infantis DNA bands could be observed only in the PCR product using CX-4 as a sample.

[0135] Streptococcus infantis ( Streptococcus infantis The optimal PCR amplification conditions for detecting the CX-4 strain are shown in Table 3 below.

[0136] temperature hour cycling Pre-denaturation 95℃ 3 minutes 1 cycle Denaturation 95℃ 30 seconds 30 cycles Annealing 55℃ 30 seconds Extension 72℃ 30 seconds Final Extension 72℃ 3 minutes 1 cycle Hold 4℃ ∞

Claims

Claim 1 Streptococcus infantis deposited under accession number KCCM12642P, comprising one or more primer sets selected from the following ( Streptococcus infantis Composition for detecting CX-4 strain: (i) a first primer set consisting of a forward primer represented by SEQ ID NO. 6 and a reverse primer represented by SEQ ID NO. 7; (ii) a second primer set consisting of a forward primer represented by SEQ ID NO. 8 and a reverse primer represented by SEQ ID NO. 9; (iii) a third primer set consisting of a forward primer represented by SEQ ID NO. 10 and a reverse primer represented by SEQ ID NO. 11; (iv) a fourth primer set consisting of a forward primer represented by SEQ ID NO. 12 and a reverse primer represented by SEQ ID NO. 13; and (v) a fifth primer set consisting of a forward primer represented by SEQ ID NO. 14 and a reverse primer represented by SEQ ID NO.

15. Claim 2 delete Claim 3 delete Claim 4 delete Claim 5 Streptococcus infantis deposited under accession number KCCM12642P selected from the following ( Streptococcus infantis Primer set for detecting CX-4 strain: (i) a first primer set consisting of a forward primer indicated by SEQ ID NO. 6 and a reverse primer indicated by SEQ ID NO. 7; (ii) a second primer set consisting of a forward primer indicated by SEQ ID NO. 8 and a reverse primer indicated by SEQ ID NO. 9; (iii) a third primer set consisting of a forward primer indicated by SEQ ID NO. 10 and a reverse primer indicated by SEQ ID NO. 11; (iv) a fourth primer set consisting of a forward primer indicated by SEQ ID NO. 12 and a reverse primer indicated by SEQ ID NO. 13; and (v) a fifth primer set consisting of a forward primer indicated by SEQ ID NO. 14 and a reverse primer indicated by SEQ ID NO.

15. Claim 6 Streptococcus infantis deposited under accession number KCCM12642P, comprising the composition of claim 1 ( Streptococcus infantis ) Kit for detecting CX-4 strain. Claim 7 A kit according to claim 6, further comprising a reagent required for a nucleic acid amplification reaction. Claim 8 Streptococcus infantis deposited under accession number KCCM12642P, comprising the steps of: isolating nucleic acid from a sample; performing a nucleic acid amplification reaction using the nucleic acid as a template and the primer set of claim 5; and detecting an amplification product generated by the nucleic acid amplification reaction. Streptococcus infantis Method for detecting CX-4 strain. Claim 9 A method according to claim 8, wherein the nucleic acid is DNA. Claim 10 In claim 8, where an amplification product is detected, the sample is Streptococcus infantis deposited under accession number KCCM12642P ( Streptococcus infantis A method of determining that the strain is CX-4, or determining that the strain is present in the sample.

Citation Information

Patent Citations

  • Composition for strengthening skin barrier, moisturizing skin or anti-aging

    KR102167386B1

  • MNP marker combination of streptococcus pneumonia, primer pair combination, kit and uses thereof

    WO2023077488A1