Marker composition for identifying Abies koreana and Abies nephrolepis and identification method using the same

Abstract

The present invention relates to a marker composition for identifying Korean fir and Abies nephrolepis, and a method for identification using the same. In this invention, a rapid and reliable SNP-based diagnostic method was developed to distinguish between Korean fir (Abies koreana) and Abies nephrolepis, despite limited genomic resources. By utilizing the stability of mitochondrial DNA and maternal inheritance, accurate species identification is enabled using allele-specific primers and real-time PCR. Compared to existing methods, this method is simpler, faster, and more accessible, making it highly suitable for forest management, conservation, and commercial applications. Although limited to a small sample size, this invention demonstrates the potential of molecular markers to resolve taxonomic ambiguity even in species with insufficient genomic data. Further validation and expansion of the SNP markers will enhance the practical utility of this method and secure a wider range of applications.

Description

Technology Field

[0001] The present invention relates to a marker composition for identifying Korean fir and spruce trees and a method of identification using the same. Background Technology

[0003] Industrialization has led to sustained and accelerated global warming through increased carbon dioxide emissions (Filonchyk et al., 2024). Various abnormal weather phenomena associated with global warming, such as heatwaves, droughts, sea level rise, rising winter temperatures, and increased frequency and intensity of typhoons, have resulted in widespread habitat loss (IPCC, 2018). Species inhabiting ecosystems particularly sensitive to warming, such as alpine regions, are at risk of habitat loss and population decline, which could potentially lead to extinction (IPCC, 2018). As severe biodiversity loss due to climate change is predicted, there is a growing need for various studies to manage vulnerable species and ecosystems.

[0004] Meanwhile, Korean fir ( Abies koreana ) and other coniferous (Abies) species inhabit vulnerable alpine regions (Koo and Kim 2020). Korean fir was first reported as an endemic species of Korea in 1920 and is distributed in high-altitude areas above 1,000m above sea level in southern regions, including Hallasan, Jirisan, Deogyusan, and Gayasan. However, this species rarely forms forests. Generally, it exists as scattered individual trees or confined to small areas, but on Hallasan, it forms a vast, pure forest, making it the world's only large-scale Korean fir ( Abies koreana) represents a forest (Kong 2006; Kim et al. 2007). Due to its limited distribution and vulnerability to climate change, Korean fir is classified as an endangered species by the International Union for Conservation of Nature (IUCN) (Kim et al. 2020; Seo and Lim 2024). This species forms unique forest communities, particularly on Jeju Island, at altitudes of 1,000–1,950 m above sea level, and plays an important role in maintaining the stability of the subalpine ecosystem. Meanwhile, Abies koreana ( Abies nephrolepis , Trautv. Ex Maxim., Khingan fir) is more widely distributed throughout Northeast Asia and contributes significantly to forest ecosystem services and timber production in temperate regions (Lim and Kim 2020; Lee et al. 2021). Both species are valuable sources of bioactive compounds and essential oils and are applied in the pharmaceutical and cosmetic industries (Jeong et al. 2007; Ancuceanu et al. 2023). However, rapid mortality has been observed due to environmental stress, including biological and abiotic stress (Lee et al. 2023; Kim et al. 2024). Therefore, conservation efforts are essential to protect the vulnerable ecosystems of the subalpine zones where these species are found.

[0005] However, morphological similarities among conifer species and potential hybridization complicate accurate identification, hindering conservation efforts, forestry management, and commercial utilization, particularly in seed production and seedling certification programs. Traditional identification methods based on subtle morphological characteristics, such as cone characteristics, needle arrangement, and bark patterns, are often unreliable due to environmental factors and phenotypic plasticity (Yang 2015; Kim et al. 2017). Misidentification in natural populations and cultivated specimens complicates conservation strategies and genetic resource management.

[0006] Molecular markers provide highly useful information for the analysis of intraspecific and interspecific variation, and because they can be determined regardless of phenotype, they allow for unbiased comparison of adaptations, genetic bases, and evolutionary processes (Bachmann, 1994). Molecular markers have also emerged as a powerful tool for resolving taxonomic ambiguities among closely related plant species. Among these markers, single nucleotide polymorphisms (SNPs) are particularly valuable due to their abundance and high stability across the genome. SNPs detect minute genetic variations, facilitating accurate species identification and variety differentiation (Mammadov et al., 2012; Semagn et al., 2014). The application of SNP markers has revolutionized genetics research in the forestry sector, enabling more accurate assessment of genetic diversity, population structure, and evolutionary relationships (Xia et al., 2019; Wang et al., 2023; Wu et al., 2024). Spruce ( Abies nordmanniana In the case of ), a large pool of SNPs was identified by combining various approaches, and a significant number of them included potential sub-applications including pedigree reconstruction, clone identification, and genome selection (Ousmael et al. 2023).

[0007] Despite the effectiveness of molecular marker methods, their practical application in routine species identification is limited due to the often complex laboratory procedures and the need for specialized knowledge. There is a need for a fast, reliable, and user-friendly SNP detection system that can be easily applied in various environments, including field conditions. To address this issue, various SNP detection technologies, including competitive allele-specific PCR (KASP) and allele-specific PCR (AS-PCR), have been developed, each offering advantages in terms of sensitivity, throughput, and cost-effectiveness (Myakishev et al., 2001; Semagn et al., 2014). KASP is a uniform fluorescence-based genotyping technique that enables high-throughput and cost-effective SNP analysis. This method is suitable for large-scale genotyping projects as it detects SNP variants using allele-specific primers and a FRET (Fluorescence Resonance Energy Transfer) quenching system (Kumpatla et al. 2012; Semagn et al. 2014).

[0008] In this invention, using competitive allele-specific labeled photoluminescence (CALLE) technology (Invirustech 2020), the Korean fir tree ( Abies koreana ) and fir tree( Abies nephrolepis We developed a rapid and reliable species-specific DNA marker to distinguish ). Mitochondrial DNA is maternally inherited and exhibits low heterogeneous expression, making it a stable and reliable genetic marker for speciation. Finally, distinct species-specific single nucleotide polymorphisms (SNPs), specifically TG substitutions at two nucleotide positions, were identified through PCR amplification and sequencing of the nad5 intron 1 region. This marker combines allele-specific amplification with labeled light emission to provide a simple and efficient method suitable for both laboratory and field applications. Prior art literature

[0010] Jour. Korean For. Soc. Vol. 100, no. 4, pp. 577~584 (2011) The problem to be solved

[0011] One objective of the present invention to solve the above problems is to provide a primer set for identifying Korean fir and spruce.

[0012] In addition, one objective of the present invention to solve the above problems is to provide a kit for identifying Korean fir and spruce.

[0013] Finally, one objective of the present invention to solve the above problems is to provide a method for distinguishing between Korean fir and spruce. means of solving the problem

[0015] To achieve the above objectives, the present invention provides a primer set for identifying Korean fir and spruce, comprising a primer pair represented by SEQ ID NOs 1 and 3 or a primer pair represented by SEQ ID NOs 2 and 3 as active ingredients.

[0016] In one embodiment of the present invention, the "pair of sequence numbers 1 and 3" may be capable of identifying a fir tree.

[0017] In one embodiment of the present invention, the "pair of sequence numbers 2 and 3" may be capable of identifying a fir tree.

[0018] In addition, to achieve the above objectives, the present invention provides a kit for identifying Korean fir and Abies koreana, comprising the primer set and an amplification reagent, wherein the amplification reagent comprises one or more selected from the group consisting of a dNTP mixture, DNA polymerase, and a buffer solution.

[0019] In addition, to achieve the above objectives, the present invention comprises the step of (a) isolating DNA from a sample of Korean fir or spruce to obtain sample DNA;

[0020] (b) a step of obtaining a PCR product by performing a polymerase chain reaction (PCR) with the sample DNA obtained in step (a) above and a marker composition for identifying Korean fir and Abies koreana comprising a primer set represented by SEQ ID NOs. 1 and 3 or a primer set represented by SEQ ID NOs. 2 and 3; and

[0021] (c) a step of analyzing the above PCR product to determine whether it is a Korean fir or a spruce;

[0022] Provides a method to identify fir trees and spruce trees that include

[0023] In addition, to achieve the above objectives, the present invention provides a method for identifying a Korean fir and a Korean fir, comprising the step of evaluating the SNP site at position 530904 of nad5 intron 1 of the mitochondrial DNA of a Korean fir or a Korean fir, determining that it is a Korean fir if it is T, and determining that it is a Korean fir if it is G.

[0024] The objective of certain embodiments of the present invention is to solve, mitigate, or eliminate at least one of the problems and / or disadvantages associated with the prior art, at least partially. Certain embodiments are intended to provide at least one of the advantages described below. Effects of the invention

[0026] The present invention relates to a marker composition for identifying Korean fir and Abies koreana and a method for identification using the same. In the present invention, despite limited genomic resources, Korean fir ( Abies koreana ) and fir tree( Abies nephrolepisWe have developed a rapid and reliable SNP-based diagnostic method to distinguish between ). By utilizing the stability of mitochondrial DNA and maternal inheritance, it enables accurate species identification using allele-specific primers and real-time PCR. Compared to existing methods, this method is simpler, faster, and more accessible, making it highly suitable for forest management, conservation, and commercial applications. Although limited to a small sample size, this invention demonstrates the potential of molecular markers to resolve taxonomic ambiguity even in species with insufficient genomic data. Further validation and expansion of SNP markers will enhance the practical utility of this method and secure a wider range of applications. Brief explanation of the drawing

[0028] The accompanying drawings, included as part of the detailed description to aid in understanding the embodiments, provide various embodiments and explain the technical features of the various embodiments together with the detailed description. FIG. 1 is an embodiment of the present invention, wherein a fir tree ( Abies koreana ) and fir tree( Abies nephrolepis This is a diagram showing the PCR amplification results of the samples. Lane M: 100 bp DNA Ladder (Enzynomics, Daejeon, Korea); Lanes 1-2: Korean fir (A. koreana) samples collected from the National Institute of Ecology; Lanes 3-4: Korean fir (A. koreana) samples collected from Hallasan Mountain; Lanes 5-6: Abies nephrolepis samples collected from the National Institute of Ecology; Lane 7: Abies nephrolepis samples collected from Seoraksan Mountain. The PCR products were separated on a 1.5% agarose gel at 150 V for 40 minutes. Panel: (a) nad5 intron 1 (~1259bp), (b) nad5 intron 4 (302bp), (c) AkAnGCR2 (556bp), (d) AkAnMYB123 (532bp), (e) AkAnEFP (320bp), (f) AkAnATL78 (220bp) FIG. 2 is an embodiment of the present invention, wherein a fir tree ( Abies koreana ) and fir tree( Abies nephrolepis This is a diagram showing the verification results of single nucleotide polymorphisms (SNPs) specific to a particular gene in the nad5 intron 1 region of mitochondrial DNA. Korean fir ( Abies koreana ) and fir tree( Abies nephrolepis Species-specific SNPs were identified by comparing the nad5 intron 1 region sequences of ). Conserved and variable nucleotide positions were indicated in the alignment. Variant positions are indicated by arrows, demonstrating that Korean fir (NC_071216.1 and related sequences) and Japanese pagoda tree (KC578740.1 and related sequences) can be clearly distinguished. SNPs unique to each species are indicated at positions 530869 and 530938. An asterisk (*) indicates a conserved nucleotide position in all genes. The results were verified through resequencing, confirming the presence of species-specific SNPs important for the genetic identification and differentiation of the two species. FIG. 3 is an embodiment of the present invention, wherein the fir tree ( Abies koreana ) and fir tree( Abies nephrolepis This is a plot of allele differentiation for species-specific nad5 intron 1 SNP markers in ). (a) Results obtained using the ABI QuantStudio 3 system, utilizing pre- and post-amplification fluorescence readouts normalized with the ROX passive reference dye. SNP differentiation is based on the relative fluorescence signal intensity of FAM (T allele) and HEX (G allele). Each sample was analyzed in duplicate. (b) Results obtained using the Bio-Rad CFX Opus system, without the use of a passive reference dye. SNP differentiation was performed by lowering the temperature to 40°C after amplification to monitor FRET-based fluorescence generation or quenching, and CT values ​​for allele assignment were obtained. Both methods were used for Korean fir ( Abies koreana ) (FAM signal) and fir tree( Abies nephrolepis) (HEX signal) was effectively distinguished. Specific details for implementing the invention

[0029] Hereinafter, the present invention will be described in detail with reference to the attached drawings and embodiments thereof. However, the following embodiments are presented as examples of the present invention, and if it is determined that a detailed description of a technology or configuration well known to those skilled in the art may unnecessarily obscure the essence of the present invention, such detailed description may be omitted, and the present invention is not limited thereby. The present invention is capable of various modifications and applications within the scope of the claims set forth below and the equivalent scope interpreted therefrom.

[0030] Furthermore, the terminology used in this specification is used to appropriately describe preferred embodiments of the present invention, and may vary depending on the intent of the user or operator, or the conventions of the field to which the present invention belongs. Accordingly, the definitions of these terms should be based on the content throughout this specification. Throughout the specification, when a part is described as "comprising" a certain component, unless specifically stated otherwise, this means that it may include additional components rather than excluding other components.

[0032] In the present invention, fir tree ( Abies koreana , Korean fir) and fir tree ( Abies nephrolepis Korean fir (*, Trautv. Ex Maxim.) is an ecologically and economically important coniferous species in East Asia. However, morphological similarities and hybridization make species identification difficult, affecting conservation, forestry management, and commercial activities. In this invention, using single nucleotide polymorphisms (SNPs) in the mitochondrial nad5 intron 1 region, Korean fir ( Abies koreana ) and fir tree( Abies nephrolepisWe developed species-specific DNA markers to distinguish [specific genes]. In particular, PCR amplification and sequencing analysis of candidate drought and heat stress response genes, as well as mitochondrial nad5 intron 1 and nad5 intron 4, confirmed species-specific TG substitutions in nad5 intron 1. Allele-specific primers were designed, and SNP detection was performed using competitive allele-specific labeling luminescence technology. The primers were validated via real-time PCR, achieving high specificity and reliability. Overall, this molecular diagnostic tool provides a practical solution for accurate species identification, support for conservation activities, and sustainable resource management.

[0034] Throughout this specification, '%' used to indicate the concentration of a particular substance is (w / w) % for solid / solid, (w / v) % for solid / liquid, and (v / v) % for liquid / liquid, unless otherwise noted.

[0036] <Experimental Method>

[0037] 1. Collection of Plant Materials and Samples

[0038] The plant material of the present invention is fir tree ( Abies koreana ) and fir tree( Abies nephrolepis Leaves of ) were selected. These species were selected considering their ecological importance and unique geographical distribution within Korea. Korean fir samples were collected from Mt. Halla and the outdoor exhibition area of ​​the National Institute of Ecology. Abies koreana samples were collected from Mt. Seorak and the outdoor exhibition area of ​​the National Institute of Ecology. Plants were collected from two locations in each region. Detailed information on the collection sites, including geographical coordinates, is presented in Table 1 below. All collected samples were handled carefully and preserved in a refrigerator at 4°C until further experimental analysis.

[0040]

[0042] 2. DNA extraction

[0043] Using the Beniprep® Super Plant Total Nucleic Acid Extraction Kit (Cat# IVT7006, Invirustech, Gwangju, South Korea) according to the manufacturer's protocol, Korean fir ( Abies koreana ) and fir tree( Abies nephrolepis Genomic DNA was extracted from fresh leaves (100 mg) of ) The quality and quantity of extracted DNA were evaluated using a microplate spectrophotometer system (Biotek-Epoch, Winooski, VT, USA).

[0045] 3. Selection of Candidate Genes and Sequence Analysis

[0046] Candidate genes were identified based on de novo RNA-seq assembly and comparative analysis (Hwang et al. 2018; Park and Hwang 2024). Korean fir (after high-temperature treatment) Abies koreana Three genes showing differential expression in ) and three genes showing differential expression after drought treatment were selected. The candidate genes are fir trees ( Abies nephrolepis ) and Korean fir ( Abies koreanaSequence differences between them were evaluated. In addition, primers targeting the nad5 intron 1 and intron 4 regions of mitochondrial DNA were used (Table 2). PCR products for the selected target genes were purified, and Sanger sequencing was performed (Bionics Co., Seoul, Korea). The acquired sequences were analyzed using MAFFT (Multiple Alignment using Fast Fourier Transform) software (Katoh and Standley 2013). In particular, multiple sequence alignments were generated to identify species-specific variants. The sequence alignment files were visualized and analyzed using BioEdit software (version 7.2) to identify diagnostic SNPs.

[0048] 4. Primer Design and PCR Amplification

[0049] Primers were designed in various sizes to amplify variable regions of the gene, as shown in Table 2 below. PCR amplification was performed using BioFACT® A-Star Taq DNA Polymerase (AT116-500, Biofact Co., Daejeon, Korea) under the following thermal cycling conditions: initial denaturation at 95°C for 5 minutes, followed by 35 cycles of denaturation at 95°C for 30 seconds, annealing at -5°C for 30 seconds, and extension at 72°C for 30 seconds (Table 2). PCR products were analyzed by electrophoresis on a 1.5% agarose gel in 0.5X TBE buffer at 150V for 30 minutes. Three microliters of each PCR product were loaded onto the gel, and DNA bands were visualized under UV light after staining with ethidium bromide.

[0051]

[0053] 5. Establishment of a pipeline for the development of species-specific markers

[0054] Allele-specific primers were designed using a pipeline for the development of species-specific markers. SNP locations and allele variants were identified in the DNA sequence, and primers were designed using Primer3. Forward primers were optimized for Tm (55-60°C) for allele specificity. Reverse primers were designed downstream of the SNP (Tm: 61-68°C), and the amplicon size was limited to 300 bp. Precision was ensured through Python-based automation, and specificity and efficiency were confirmed through experimental verification via real-time PCR, enabling rapid SNP genotyping analysis (https: / / github.com / Key-man-fromArchive / SNP_primer_design).

[0056] 6. SNP Genotyping Analysis Using Species-Specific Markers

[0057] Using species-specific markers, Korean fir ( Abies koreana ) and fir tree( Abies nephrolepis It was used for rapid SNP-based differentiation of ). PCR (10 μL) was prepared using 2X Master Mix, Primer Mix, Q-FRET Mix_V1, and 2 μL of DNA template (>10 ng / μL). qRT-PCR was performed under the following conditions: initial denaturation at 95°C for 2 minutes, followed by 10 cycles of 94°C for 10 seconds and 56°C for 30 seconds, and then 26 cycles of 94°C for 10 seconds, 61°C for 30 seconds, and 40°C for 15 seconds. For allele differentiation, FAM(Korean fir ( Abies koreana )) and HEX(Fir tree( Abies nephrolepis Fluorescence signals were read at 40°C using dyes. The results were analyzed using the QuantStudio 3 (Applied Biosystems) and CFX Opus (Bio-Rad) real-time PCR platforms.

[0059] <Experimental Results>

[0060] 1. Korean fir ( Abies koreana ) and fir tree( Abies nephrolepis ) Sample collection site

[0061] Korean fir ( Abies koreana ) and fir tree( Abies nephrolepis Abies koreana is a coniferous tree that grows in temperate and subalpine regions of the Northern Hemisphere, including Korea. In this invention, samples were collected from Mt. Halla, Mt. Seorak, and the Alpine Vulnerable Ecosystem Exhibition Area within the National Institute of Ecology in Korea. Mt. Halla, located at the southernmost tip of the Korean Peninsula, is the highest mountain in South Korea with an elevation of 1,950 m. It is also the region with the highest habitat density of Korean fir. Mt. Seorak, located in the northeastern region of South Korea, is one of the most iconic mountains in the country and houses the largest Korean fir community in the South. Plants from each region were sampled, and their geographical coordinates were recorded (Table 1).

[0063] 2. Korean fir ( Abies koreana ) and fir tree( Abies nephrolepis Amplification of species-specific marker candidate genes distinguishing )

[0064] We previously exposed fir trees to heat or drought stress ( Abies koreana Transcriptome analyses for ) were performed at different periods. RNA-seq data were obtained from the fir tree ( Abies koreana This study provided insights into genes associated with responses to heat and drought stress. In this study, we focused on genes whose expression increased by more than twofold under heat or drought stress. We isolated candidate genes from Abies koreana using primers for Abies koreana. Six candidate genes showed sequence differences between Abies koreana and Abies koreana. Additionally, mitochondrial DNA of nad5 intron 1 and nad5 intron 4 was included as candidate genes to compare nucleotide sequences between Abies koreana and Abies koreana; a total of eight genes were included in the analysis (Table 2).

[0065] As a result of performing electrophoresis, fir tree ( Abies koreana ) and fir tree( Abies nephrolepisIt was confirmed that there was no difference in amplification patterns between the samples (Fig. 1). The observed differences in band intensity may be attributed to differences in DNA concentration between samples. In the case of nad5 intron 4, the product exhibited multiple bands, including a faint band in lane 4, and bands were successfully generated in all samples (Fig. 1b). The AkAnGCR2 gene was not amplified in any sample, and AkAnMYB123 exhibited multiple non-specific bands (Figs. 1c and d). AkAnEFP and AkAnATL78 clearly showed a single amplification product (Figs. 1e and f). Finally, three genes—nad5 intron 1, AkAnEFP, and AkAnATL78—were selected for DNA sequencing analysis.

[0067] 3. Korean fir ( Abies koreana ) and fir tree( Abies nephrolepis SNP in nad5 intron 1 of )

[0068] SNPs are one of the most common genetic variations, providing valuable information for species identification, phylogenetic studies, and evolutionary analysis. To evaluate SNPs, Korean fir ( Abies koreana ) and fir tree( Abies nephrolepis Nucleotide sequence alignment of nad5 intron 1, AkAnEFP, and AkAnATL78 was performed for ). Neither AkAnEFP nor AkAnATL78 showed enough sequence variation to distinguish between the two species, but distinct SNPs were observed between Korean fir and Abies koreana in nad5 intron 1.

[0069] The mitochondrial nad5 gene encodes a subunit of NADH dehydrogenase subunit 5, a critical part of Complex I, the first and largest enzyme in the electron transport chain, and plays an essential role in plant respiration and electron transport. Additionally, intron regions often contain conserved sequences and SNPs that are non-coding but can be useful for genetic differentiation. Therefore, using DNA samples collected from Mt. Halla, Mt. Seorak, and the exhibition area of ​​the National Institute of Ecology in Korea, we evaluated SNP sites at positions 530869 and 530938 of nad5 intron 1 in each species (Fig. 2). Specifically, mutations from T to G were observed, in Korean fir ( Abies koreana ) is T at mutation location 530904, fir tree( Abies nephrolepis ) represented G. These results suggest that nad5 intron 1 can serve as a candidate gene for species-specific markers.

[0071] 4. Korean fir ( Abies koreana ) and fir tree( Abies nephrolepis Development of NAD5 Intron 1 as a Marker for Species Identification

[0072] Korean fir ( Abies koreana ) and fir tree( Abies nephrolepisTo develop species-specific markers using the ad5 intron 1 for ), two allele-specific primers were designed to detect single nucleotide variants (SNVs). These primers selectively amplified T and G alleles, enabling effective differentiation between the two species (Table 3). The FAM_AkAnnad5 intron 1_T primer was designed to detect T allele-specific sequences in Abies koreana. To enhance specificity, an intentional mismatch (T → C) was introduced at the 3' end of the forward primer. This primer was labeled with the FAM fluorescence for T allele detection. The HEX_AkAnnad 5 intron 1_G primer was designed to detect G allele-specific sequences in Abies koreana. Similarly, to enhance marker specificity, an intentional mismatch (T → C) was introduced at the 3' end. This primer was labeled with the HEX fluorescence for G allele detection. In addition, the Rev_AkAnnad 5 intron 1 primer acted as a universal reverse primer to amplify the nad 5 intron 1 region in both species. These primers were able to accurately detect species-specific single nucleotide variants (SNVs) and improved specificity by introducing an intentional mismatch at the 3' end of the primer.

[0073] Finally, these primers were validated using real-time PCR systems including the ABI QuantStudio 3 and Bio-Rad CFX Opus platforms (Fig. 3). For ABI QuantStudio 3, seven samples (four Korean fir and three Korean spruce) were tested in duplicate. Fluorescence data normalized with the ROX passive reference dye confirmed the clear separation of species-specific alleles. The FAM signal (Allele 1) corresponded to Korean fir, and the HEX signal (Allele 2) corresponded to Korean spruce (Fig. 3a). Additionally, the Bio-Rad CFX Opus system confirmed that species differentiation was possible for four samples (two Korean fir and two Korean spruce) without duplicates using fluorescence analysis after amplification at 40°C without the passive reference dye (Fig. 3b). Both platforms showed clear separation of the T(FAM) and G(HEX) alleles, which is consistent with maternal inheritance and the absence of heterogeneity in mitochondrial DNA. Therefore, these results indicate that Korean fir ( Abies koreana ) and fir tree( Abies nephrolepis This strongly suggests the establishment of a rapid and powerful diagnostic method to distinguish ).

[0075] Sequence number primer Sequence 5'→3' Label Length (bp) Temperature (°C) function 1 FAM_AkAnnad5 intron 1_T ATCGATCCCCCTCTTTTTATTC*TA FAM 24 55.5 2 HEX_AkAnnad5 intron 1_G TCGATCCCCCTCTTTTTATTC*TC HEX 23 56.2 3 Rev_AkAnnad5 intron 1 CTTCCTTCCCGCTGATCCGC 20 64.5

[0077] The asterisk (*) in the forward primer sequence indicates a mismatch intentionally introduced to enhance specificity. This mismatch is located at the third position (T → C) from the 3' end. This table provides details on allele-specific primers designed to detect single nucleotide variants (SNVs) in the nad5 intron 1 region of Korean fir and Japanese spruce. The FAM_AkAnnad5 intron 1_T primer identifies the T allele specific to Korean fir, while HEX_AkAnnad5 intron 1_G detects the G allele specific to Japanese spruce. The Rev_AkAnnad5 intron 1 primer serves as a universal reverse primer.

[0079] The experimental results of the present invention are summarized as follows.

[0080] Since the late 1990s, significant rates of forest decline and tree mortality have occurred globally due to the increased frequency of high temperatures and drought conditions caused by global climate change (Allen et al. 2010). Since the 1970s, widespread conifer mortality due to recurring droughts has been observed, affecting up to 20% of coniferous forests in Switzerland, France, Poland, and Greece in Europe. In North America, reports of widespread drought-induced conifer mortality are increasing, particularly in the western United States, with pine, fir, and spruce forests being affected across vast areas. Additionally, widespread drought-induced conifer mortality has been observed in China, Russia, and other regions. Due to extreme drought, Korean fir (Abies koreana) in Korea Abies koreana ) (20-50%) decreased. In particular, alpine coniferous forests have suffered a severe decline, necessitating comprehensive research on the causes and conservation trends worldwide. Understanding these patterns is crucial for establishing the direction of conservation research focused on vulnerable alpine ecosystems in Korea.

[0081] Abies The genus includes various coniferous species distributed in the Northern Hemisphere. Among them, Korean fir ( Abies koreana ) and fir tree( Abies nephrolepisAbies koreana is an important species in East Asia. Understanding their unique characteristics and conservation requirements is essential to maintaining biodiversity and ecosystem stability (Park et al. 2022; Lee et al. 2023). While Abies koreana has a relatively wide distribution range, Abies koreana is endangered and requires immediate intervention. Protecting this valuable species for future generations requires a collective effort that includes habitat protection, research, and public engagement. Both Abies koreana and Abies koreana are subalpine conifers found in Korea, but their distribution and climate adaptability differ significantly (Table 1). Abies koreana is endemic to Korea and primarily inhabits subalpine regions such as Mt. Halla. It is distributed at elevations of 1,000–1,900 m on Mt. Halla, Mt. Jirisan, and Mt. Deogyusan. Although this species thrives in the cool temperate to subalpine zones, it is highly vulnerable to climate change, leading to severe population decline and habitat loss. In contrast, Abies koreana has a wider distribution across the northern and central Korean Peninsula, Russia, China, and Japan. It grows from the subalpine to the subarctic at elevations of 1,200 to 2,000 meters and is more resistant to low temperatures. Although this species is less affected by climate change compared to Korean fir, habitat destruction and warming trends can still pose a risk.

[0082] It is essential to distinguish between Korean fir and Abies koreana using molecular ecological methods. Traditional identification based on physical characteristics is unreliable, particularly in hybrid regions or areas where environmental variation affects phenotypic traits. Therefore, molecular markers such as chloroplast DNA (cpDNA) sequences, microsatellites (SSRs), and single nucleotide polymorphisms (SNPs) can provide accurate and reproducible identification methods. These genetic tools enable accurate species identification, aid in understanding evolutionary relationships, and support conservation efforts by identifying genetic diversity and potential threats such as habitat loss or climate change. To develop species-specific markers for Korean fir and Abies koreana, six candidate genes associated with responses to heat or drought stress were evaluated, in addition to mitochondrial nad5 introns 1 and 4 (Table 2). Finally, nad5 intron 1 was identified as a marker distinguishing between Korean fir and Abies koreana (Fig. 2).

[0083] The mitochondrial nad5 gene (NADH dehydrogenase subunit 5) encodes the NADH:ubiquinone oxidoreductase subunit, known as Complex I of the mitochondrial respiratory chain, and is involved in ATP production and energy metabolism as a component of the electron transport chain. Given its role in the electron transport chain, mutations or damage to the nad5 gene can affect metabolic processes and lead to various mitochondrial diseases. Variations in the intron regions of the nad5 gene can be species-specific, and several characteristics of the nad5 gene make it an ideal marker for distinguishing between Korean fir and Abies koreana. For example, mitochondrial DNA is maternally inherited, resulting in less genetic variation due to hybridization. Furthermore, because mitochondrial DNA is haploid and lacks a heterozygous phenotype, the nad5 intron 1 region provides a stable and consistent marker (Fig. 2). Low heterogeneity rates and predictable allelic inheritance also make this region a suitable choice for molecular identification.

[0084] Finally, markers distinguishing Korean fir and Abies koreana were developed using allele-specific primers for nad5 intron 1 (Table 3). Real-time PCR technology enables rapid and accurate quantitative analysis and clear allele differentiation. These primers were validated using real-time PCR platforms (e.g., ABI QuantStudio 3 and Bio-Rad CFX Opus systems) (Figure 3), demonstrating the usefulness of the developed primers for rapid species identification. Fluorescent signals corresponding to species-specific alleles facilitate clear differentiation without complex procedures or large-scale equipment, providing an efficient and practical method. By providing a fast and user-friendly method to distinguish between Korean fir and Abies koreana, these markers can play a crucial role in enhancing seedling authenticity and preventing misidentification in conservation and commercial environments.

[0085] Therefore, the nad5 intron 1 region represents a powerful genetic marker for distinguishing Korean Abies koreana and Abies nephrolepis. This marker provides a practical and efficient tool that meets critical demands in the fields of conservation, forestry management, and commercial utilization. By enabling accurate and rapid identification, this marker supports the integrity of breeding programs, promotes sustainable use, and contributes to the conservation of these economically and ecologically important species. Furthermore, integrating additional single nucleotide polymorphism (SNP) markers into the diagnostic pipeline can enhance the reliability of the method and expand its scope of application. These expanded markers can be used to generate detailed distribution maps of Korean Abies koreana and Abies nephrolepis, serving as a valuable tool for establishing conservation plans and monitoring the impact of environmental changes on species distribution. Additionally, they can aid in understanding the effects of climate change, land-use changes, and other ecological factors on the distribution and population dynamics of these species.

[0087] As described above, specific embodiments of the present invention have been described in detail; however, those skilled in the art who understand the spirit of the present invention will be able to easily propose other inventions that are inferior or other embodiments included within the scope of the spirit of the present invention by adding, changing, or deleting other components within the same spirit. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of the present invention is defined by the claims set forth below rather than by the detailed description above, and all modifications or variations derived from the meaning and scope of the claims and equivalent concepts should be interpreted as being included within the scope of the present invention.

Claims

Claim 1 A primer set for identifying Korean fir and Korean fir, characterized by simultaneously including a primer pair represented by SEQ ID NOs 1 and 3 and a primer pair represented by SEQ ID NOs 2 and 3, wherein the primer represented by SEQ ID NO 1 is a forward primer labeled with a FAM fluorescence for detecting the T allele of Korean fir, the primer represented by SEQ ID NO 2 is a forward primer labeled with a HEX fluorescence for detecting the G allele of Korean fir, and the primer represented by SEQ ID NO 3 is a common reverse primer that amplifies the nad5 intron 1 region of mitochondrial DNA in both Korean fir and Korean fir. Claim 2 A primer set for distinguishing Korean fir and Abies koreana, wherein, in claim 1, the primer represented by SEQ ID NO. 1 and the primer represented by SEQ ID NO. 2 each have an intentional mismatch introduced at the third position from the 3′ end to enhance allelic specificity. Claim 3 A primer set for distinguishing Korean fir and spruce, characterized in that, in paragraph 2, the intentional mismatch is a substitution from T to C. Claim 4 A primer set for identifying Korean fir and Korean fir, characterized in that, in claim 1, the primer pair represented by SEQ ID NOs 1 and 3 is capable of identifying Korean fir, and the primer pair represented by SEQ ID NOs 2 and 3 is capable of identifying Korean fir. Claim 5 A primer set for identifying Korean fir and Abies koreana, wherein the primer set is intended to allele-specifically amplify a single nucleotide polymorphism (SNP) within the nad5 intron 1 region of mitochondrial DNA. Claim 6 A primer set for distinguishing Korean fir and Korean fir, characterized in that, in claim 5, the above SNP is detected as a T allele in Korean fir and as a G allele in Korean fir. Claim 7 A kit for identifying Korean fir and Abies koreana, comprising: a primer pair represented by SEQ ID NOs. 1 and 3; a primer pair represented by SEQ ID NOs. 2 and 3; one or more amplification reagents selected from the group consisting of a dNTP mixture, DNA polymerase, and a buffer solution; and a Q-FRET mix for competitive allele-specific labeled light emission, wherein the primer represented by SEQ ID NO. 1 is labeled with a FAM fluorescence and the primer represented by SEQ ID NO. 2 is labeled with a HEX fluorescence. Claim 8 A kit for identifying Korean fir and Abies koreana, characterized in that, in claim 7, the kit further comprises a ROX passive reference dye for fluorescence signal normalization in an ABI QuantStudio 3 system. Claim 9 In claim 7, the kit is for identifying Korean fir and Korean fir by reading a FAM fluorescence signal corresponding to Korean fir and a HEX fluorescence signal corresponding to Korean fir. Claim 10 (a) a step of isolating DNA from a sample of Korean fir or Japanese fir to obtain sample DNA; (b) a step of performing a polymerase chain reaction (PCR) using the obtained sample DNA and a primer set comprising a primer pair represented by SEQ ID NOs 1 and 3 and a primer pair represented by SEQ ID NOs 2 and 3 to obtain a PCR product; and (c) a step of analyzing the PCR product to determine whether it is a Korean fir or Japanese fir; wherein the primer represented by SEQ ID NO. 1 is a forward primer labeled with a FAM fluorescent dye for detecting the T allele of Korean fir, and the primer represented by SEQ ID NO. 2 is a forward primer labeled with a HEX fluorescent dye for detecting the G allele of Japanese fir. Claim 11 A method for distinguishing between a Korean fir and a fir tree, characterized in that, in claim 10, the sample of the Korean fir or fir tree is a leaf sample of a Korean fir or a fir tree. Claim 12 A method for identifying Korean fir and Abies koreana, characterized in that, in claim 10, the polymerase chain reaction is performed by repeating the cycle 35 times, which includes initial denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at a temperature 5°C lower than the Tm value of the primer set for 30 seconds, and extension at 72°C for 30 seconds. Claim 13 A method for identifying Korean fir and Korean fir, comprising the step of evaluating an SNP site at position 530904 within the nad5 intron 1 region of the mitochondrial DNA of Korean fir or Korean fir, determining that it is a Korean fir if the base of the SNP site is T, and determining that it is a Korean fir if the base of the SNP site is G. Claim 14 A method for distinguishing Korean fir and Abies koreana, characterized in that, in claim 13, the evaluation of the SNP site is performed simultaneously using a primer pair represented by SEQ ID NOs 1 and 3 and a primer pair represented by SEQ ID NOs 2 and 3. Claim 15 A method for identifying Korean fir and Japanese saury, characterized in that, in claim 13, the evaluation of the SNP site is performed by reading FAM fluorescence signals and HEX fluorescence signals. Claim 16 (a) a step of extracting genomic DNA from a sample of Korean fir or Japanese fir; (b) a step of preparing a gene amplification reaction solution comprising the extracted genomic DNA, a primer pair represented by SEQ ID NO. 1 and 3, a primer pair represented by SEQ ID NO. 2 and 3, and a Q-FRET mix; (c) a step of injecting the gene amplification reaction solution into a real-time PCR platform to perform allele-specific amplification; and (d) a step of identifying Korean fir or Japanese fir by reading the relative fluorescence signal intensity emitted from FAM and HEX dyes after the amplification reaction; wherein the primer represented by SEQ ID NO. 1 is a FAM-labeled primer for detecting the T allele of Korean fir, the primer represented by SEQ ID NO. 2 is a HEX-labeled primer for detecting the G allele of Japanese fir, and the primer represented by SEQ ID NO. 3 is a common reverse primer. Claim 17 A method for real-time identification of Korean fir and Abies koreana, characterized in that, in claim 16, the real-time PCR is performed under conditions of initial denaturation at 95°C for 2 minutes, followed by 10 cycles consisting of 10 seconds at 94°C and 30 seconds at 56°C, and then 26 cycles consisting of 10 seconds at 94°C, 30 seconds at 61°C, and 15 seconds at 40°C. Claim 18 A real-time identification method for Korean fir and Abies koreana, characterized in that, in claim 16, the reading of the relative fluorescence signal intensity is performed under 40°C conditions after amplification. Claim 19 A gene amplification reaction composition for identifying Korean fir and Korean fir, comprising: a primer pair represented by SEQ ID NOs. 1 and 3; a primer pair represented by SEQ ID NOs. 2 and 3; a Q-FRET mix; and a 2× master mix, wherein the primer represented by SEQ ID NO. 1 is a primer for detecting the T allele of Korean fir labeled with a FAM fluorescence, the primer represented by SEQ ID NO. 2 is a primer for detecting the G allele of Korean fir labeled with a HEX fluorescence, and the primer represented by SEQ ID NO. 3 is a common reverse primer that amplifies the nad5 intron 1 region of mitochondrial DNA in both Korean fir and Korean fir. Claim 20 A gene amplification reaction composition for identifying Korean fir and fir trees, characterized in that, in claim 19, the gene amplification reaction composition further comprises a DNA template derived from Korean fir or fir tree.

Images