COMPOSITION INCLUDING sICAM-1 INHIBITOR FOR PREVENTING SPONTANEOUS ACTIVATION OF DENDRITIC CELLS

Abstract

The present invention relates to a composition for inhibiting the self-activation of primary dendritic cells, comprising as an active ingredient an inhibitor involved in the action of sICAM-1, a factor that induces self-activation after contact between dendritic cells cultured in vitro and stimulates surrounding cells. The composition can be usefully utilized for purposes such as the development of therapeutic agents for cancer, autoimmune diseases, and inflammatory diseases through dendritic cell culture, induction of dendritic cell activation, and immunomodulation by co-culture with other immune cells.

Description

Technology Field

[0001] The present invention relates to a composition and culture method capable of inhibiting the self-activation of isolated immature primary dendritic cells, and can be utilized in the field of culturing immature dendritic cells or developing immunotherapy agents. Background Technology

[0002] Dendritic cells (DCs) are antigen-presenting cells that provide a link between innate and adaptive immune responses. Dendritic cells are widely distributed throughout the body and are classified into various subtypes in the spleen, lymph nodes, mucosa, intestines, and epidermal tissues.

[0003] Inactive dendritic cells express major histocompatibility class-II (MHC-II) surface molecules and co-stimulatory molecules at low levels and produce almost no inflammation-inducing cytokines. Dendritic cells can directly detect pathogens via pattern recognition receptors such as scavenger receptors, tollgate-like receptors, and mannose receptors, and phagocytize antigens in their vicinity and harmful signals derived from pathogens or damaged cells through phagocytic mechanisms. Dendritic cells activated by these receptors transform into a cell type characterized by reduced antigen uptake capacity, increased MHC-II expression, increased expression of co-stimulatory molecules such as CD80, CD86, and CD40, and the chemoreceptor CCR7; this type is characterized by the secretion of various types of cytokines and increased migration to lymph nodes. These activated dendritic cells potently induce T-cell responses to specific antigens.

[0004] The process of phagocytosis and processing antigens is carried out by inactive dendritic cells. The biggest challenge in measuring the immunological function of these stable dendritic cells and utilizing them as cell therapy agents lies in the isolation and culture of tissue-derived primary dendritic cells (primary DCs). Primary dendritic cells isolated for cell culture undergo spontaneous activation from an inactive form to an active form within 12 hours of culture. Since the survival period of self-activated dendritic cells is very short, long-term culture is impossible. Although it has been observed that self-activation decreases somewhat when the number of dendritic cells is reduced under culture conditions or when cultured in a semi-solid gel, suggesting that it occurs through binding or contact between dendritic cells, no specific factors involved or techniques to maintain them in an inactive form during culture have yet been reported.

[0005] The three-dimensional structure and extracellular matrix of the spleen and lymph nodes regulate cell interactions and play an important role in the aggregation of cells within the tissue. Only a minute amount of collagen is present in the paracortical region of lymph nodes, and in lymphoid tissues such as the spleen, fibronectin is expressed as the major extracellular matrix, while laminin expression is extremely low. It has been reported that when dendritic cells differentiated from monocytes using cytokines are cultured on plates coated with fibronectin or laminin, the morphology of the dendritic cells changes and they remain in an inactive form.

[0006] Due to these various technical limitations, rather than culturing primary dendritic cells isolated from lymphoid tissue, techniques utilizing genetically modified dendritic cell lines or dendritic cells differentiated from progenitor cells are being applied. The dendritic cells currently used for culture as the most common method are those differentiated from bone marrow cells or monocytes, which are cells differentiated from these progenitor cells in the presence of inflammatory factors such as GM-CSF (granulocyte macrophage-colony stimulating factor) and tumor necrosis factor (TNF-α).

[0007] Therefore, although dendritic cells differentiated from these progenitor cells can be induced by cell culture of bone marrow cells or monocytes, they belong to the category of inflammatory dendritic cells that appear in vivo when single cells escape from the blood into tissues during an inflammatory state. Furthermore, a culture method and an analysis method for inactive dendritic cells have been reported, which allow for the stable culture of dendritic cells isolated from the spleen while maintaining them in an inactive state using a cell culture structure based on nano-micro hybrid fibers.

[0008] The present invention provides a technology that enables primary dendritic cells isolated from immune tissue to exist in a functionally inactive state while maintaining viability to phagocytize antigens, and to transform into an active form upon receiving immune or inflammatory stimuli, thereby enabling the implementation of immunological responses of dendritic cells that may occur in vivo in a culture state. These isolated primary dendritic cells have high potential for development as immunotherapy agents for diseases such as cancer, viral infections, autoimmune diseases, organ transplants, allergies, and rheumatoid arthritis by inducing T cell proliferation or inducing cytokine secretion through co-culture with T cells. Prior art literature

[0010] Garcia-Nieto S, Johal RK, Shakesheff KM, Emara M, Royer PJ, Chau DYS, et al. (2010) Laminin and Fibronectin Treatment Leads to Generation of Dendritic Cells with Superior Endocytic Capacity. PLoS ONE 5(4): e10123. The problem to be solved

[0011] The present invention aims to provide a composition for inhibiting the self-activation of dendritic cells that can maintain primary dendritic cells isolated from lymph tissue in an inactive form.

[0012] In addition, the present invention aims to provide a culture method for maintaining dendritic cells in an inactive state by treating them with the above composition.

[0013] In addition, the present invention aims to provide a method for manufacturing an immunotherapy agent using the above composition. means of solving the problem

[0014] 1. A composition for inhibiting the autoactivation of dendritic cells comprising an sICAM-1 (soluble Intercellular Adhesion Molecule 1) inhibitor.

[0015] 2. In the above 1, the inhibitor is a neutralizing antibody against sICAM-1, or a composition for inhibiting the self-activation of dendritic cells, which is a binding inhibitor between sICAM-1 and integrin.

[0016] 3. In the above 2, the integrin is αLβ2, a composition for inhibiting the self-activation of dendritic cells.

[0017] 4. A composition for inhibiting the self-activation of dendritic cells, wherein the inhibitor in 1 above is selected from the group consisting of compounds represented by the following chemical formulas 1 to 5:

[0018] [Chemical Formula 1]

[0019]

[0020] [Chemical Formula 2]

[0021]

[0022] [Chemical Formula 3]

[0023]

[0024] [Chemical Formula 4]

[0025]

[0026] [Chemical Formula 5]

[0027] .

[0028] 5. A composition for inhibiting the self-activation of dendritic cells, wherein, in 1 above, an integrin inhibitor that binds to integrin α4β1 or α5β1.

[0029] 6. A composition for inhibiting the self-activation of dendritic cells, wherein, in the above 1, a peptide comprising an amino acid sequence of any one of RGD, LDV, and SEQ ID NO. 1.

[0030] 7. A composition for inhibiting the self-activation of dendritic cells, wherein, in the above 5, the integrin inhibitor is selected from the group consisting of compounds represented by the following chemical formulas 6 to 10:

[0031] [Chemical Formula 6]

[0032]

[0033] [Chemical Formula 7]

[0034]

[0035] [Chemical Formula 8]

[0036]

[0037] [Chemical Formula 9]

[0038]

[0039] [Chemical Formula 10]

[0040] .

[0041] 8. A composition for inhibiting the self-activation of dendritic cells, wherein, in any one of claims 1 to 7 above, the dendritic cells are derived from the spleen or lymph nodes.

[0042] 9. In any one of paragraphs 1 to 7 above, in a test tube ( in vitro A composition for inhibiting the self-activation of dendritic cells for use.

[0043] 10. A method for culturing dendritic cells in an inactive state, comprising the step of culturing dendritic cells under a composition of any one of claims 1 to 7 above.

[0044] 11. A method for manufacturing an immunotherapy agent comprising the steps of: culturing dendritic cells under a composition according to any one of claims 1 to 7 above; activating the dendritic cells by treating the cultured dendritic cells with an immunostimulator; and co-culturing the activated dendritic cells with immune cells.

[0045] 12. A method for manufacturing an immunotherapy agent according to 11 above, wherein the immunostimulator is selected from the group consisting of CD40 (Cluster of differentiation 40) ligand, TNF-α (Tumor necrosis factor-α), IL-1β (Interleukin 1β), LPS (lipopolysaccharide), and poly (I:C) (Polyinosinic:polycytidylic acid).

[0046] 13. A method for manufacturing an immunotherapy agent according to 11 above, wherein the immunotherapy agent is for the treatment of cancer, infectious diseases, chronic inflammatory diseases or autoimmune diseases.

[0047] 14. An inactive dendritic cell composition comprising an inhibitor of any one of claims 1 to 4 above and dendritic cells mixed therewith. Effects of the invention

[0048] Using the composition or method of the present invention in vitro Dendritic cells can be maintained in an inactive form during culture.

[0049] Using the composition or method of the present invention, the inactive state of dendritic cells can be maintained for more than 24 hours.

[0050] Immunotherapy agents using inactive dendritic cells can be manufactured using the method of the present invention. Brief explanation of the drawing

[0052] Fig. 1 is Suzy's face This is the result of q-PCR measuring the amount of integrin receptor RNA expressed in dendritic cells immediately after isolation from the spleen and after culturing these cells for 2 hours. Figure 2 shows the DIC imaging results measuring the cell aggregation of splenite dendritic cells cultured with added BIO5192 and the flow cytometry results measuring CD86 expressed on the surface of splenite dendritic cells. Figure 3 shows the CD4 of mouse spleen dendritic cells cultured for 6 hours with the addition of BIO5192 and the combination of ATN-16, fibronectin, and peptide P1+P2+P3. + CD8 - , CD4 - CD8 + , CD4 - CD8 - , and CD4 + CD8 + This is the result of analyzing the UMAP plot measuring CD86 expression in subtypes. Figure 4 shows CD4 in splenic dendritic cells after adding BIO5192, fibronectin, and the peptide combination P1+P2+P3 and incubating for 6 hours. + CD8 - , CD4 - CD8 + , CD4 - CD8 - , and CD4 + CD8 +This is the result of analyzing the cell ratio by subtype from UMAP plot measurements that measured the number of subtypes. Figure 5 is the result of flow cytometry analysis measuring the expression level of CD86 in splenic dendritic cells after adding BIO5192, ATN-161, fibronectin, and the peptide combination P1+P2+P3 and culturing for 6 hours. Figure 6 shows the CD4 of splenic dendritic cells after adding BIO5192, ATN-16, fibronectin, and the peptide combination P1+P2+P3 and incubating for 6 hours. + CD8 - , CD4 - CD8 + , CD4 - CD8 - and CD4 + CD8 + This is the result of analyzing the CD86 expression ratio by subtype from the UMAP plot measuring the level of CD86 expression in subtypes. Figure 7 is the result of flow cytometry analysis measuring the extent to which CD86 expression is affected by adding BIO5192 and ATN-161 at various concentrations while culturing splenic dendritic cells for 6 and 24 hours. Figure 8 is the result of a Cytokine Array measuring the amount of cytokines secreted into the culture medium after culturing splenic dendritic cells at each time point. Figure 9 shows the results of measuring the culture medium obtained after culturing the spleen dendritic cells in Figure 8 for 3 and 24 hours using a Cytokine Array. Figure 10 shows the ELISA results of measuring the concentrations of sICAM-1 and TNF-α secreted in the culture medium after culturing primary dendritic spleen cells for 24 hours. Figure 11 is the ELISA result measured by comparing the concentration of sICAM-1 secreted into the culture medium from splenic dendritic cells cultured for 24 hours with the addition of fibronectin and the peptide combination P1+P2+P3. Figure 12 shows the results of flow cytometry measuring the expression of CD86 and MHC-II and ELISA measuring the amount of secreted TNF-α after co-administration of fibronectin, the peptide combination P1+P2+P3, and BIO5192 and ATN-161, along with conditions in which recombinant protein sICAM-1 was added and splenic dendritic cells were cultured for 24 hours. Figure 13 shows the results of DIC imaging measuring cell aggregation and flow cytometry measuring CD86 expression after adding a neutralizing antibody against sICAM-1 and culturing splenic dendritic cells for 6 and 24 hours. Figure 14 is the result of a protein immunoblot measuring the phosphorylation levels of PI3K, AKT, and IKK after inoculating primary splenic dendritic cells into a culture medium and leaving them at 37°C for 30 minutes. Figure 15 shows the results of flow cytometry analysis measuring CD86 expression after adding A286982 at different concentrations and culturing splenic dendritic cells for 6 and 24 hours. Specific details for implementing the invention

[0053] The present invention provides a composition for inhibiting the self-activation of dendritic cells comprising an inhibitor of the secretion factor sICAM-1 (soluble Intercellular Adhesion Molecule 1) of dendritic cells.

[0054] Dendritic cells are immune cells that function as antigen-presenting cells by processing pathogenic material and displaying antigens on their surface for other cells in the immune system; therefore, they serve as a mediator between innate and adaptive immune responses.

[0055] The above dendritic cells may originate from lymphoid tissues such as the spleen and lymph nodes, or from bone marrow, monocytes, etc., but are not limited thereto.

[0056] The above dendritic cells may have subtypes that vary by species but are not limited thereto. The above subtypes may be CD4+CD8-, CD4-CD8+, CD4-CD8-, or CD4+CD8+.

[0057] sICAM-1 (soluble Intercellular Adhesion Molecule 1) is a substance secreted when ICAM-1 (CD54), bound to the cell membrane, is degraded by protease. In other words, sICAM-1 is the secreted (soluble) form of ICAM-1, has a molecular weight of approximately 80-114 kDa, and acts as a major cell adhesion factor in inflammation and immune responses.

[0058] In the present invention, it was identified that sICAM-1 is also a secretory factor that induces self-activation in isolated dendritic cells (Examples 4-9), and a composition that inhibits the self-activation of dendritic cells using a sICAM-1 inhibitor is provided.

[0059] Specifically, the sICAM-1 inhibitor may be a substance capable of interfering with, inhibiting, or interfering with the secretion, activity, and / or mechanism of action of sICAM-1 in dendritic cells, and includes forms such as compounds, antibodies, polypeptides, proteins, nucleic acid molecules including RNA or DNA.

[0060] The above mechanism of action may refer to binding with dendritic cells, and specifically, may be the interaction between sICAM-1 and integrin.

[0061] For example, the inhibitor may be a neutralizing antibody against sICAM-1 or one that inhibits the binding between sICAM-1 and integrin.

[0062] The binding inhibitor between sICAM-1 and integrin may be one that binds to sICAM-1 or integrin, for example, a competitive inhibitor that binds to the binding site between sICAM-1 and integrin, or a non-competitive inhibitor that binds to a different binding site.

[0063] The above inhibitor may selectively bind to sICAM-1 or an integrin interacting with it.

[0064] The integrin that binds to the above sICAM-1 may be, for example, αLβ2(CD11a) (LFA-1), αMβ2(CD11b) (MAC-1), αXβ2(CD11c), or αDβ2(CD11D), and specifically may be αLβ2.

[0065] The above inhibitor may be a substance known as a neutralizing antibody or inhibitor of sICAM-1 without special restrictions, for example, a substance known as an inhibitor of the interaction between ICAM-1 and integrin αLβ2. (A-286982), (SAR 1118), (BIRT 377), (RWJ 50271) or (BMS-688521) and others may be used, but are not limited thereto.

[0066] The above composition may be used in combination with other substances that inhibit the self-activation of dendritic cells.

[0067] For example, the above composition may include an integrin inhibitor that binds to integrin α4β1 or α5β1, or a peptide consisting of any one of the amino acid sequences of RGD, LDV and PHSRN (Sequence No. 1).

[0068] The above integrin inhibitor may selectively bind to the above integrin.

[0069] For example, a substance known as an integrin inhibitor that binds to the above-mentioned integrin α4β1 or α5β1 (BIO5192), (BIO-1211), (TCS 2314), (ATN-161) or (K34c) may be used, but is not limited thereto.

[0070] The above peptide is a cell adhesion domain among the domains constituting fibronectin, and can inhibit self-activation by binding to the integrin binding site between dendritic cells in fibronectin.

[0071] The peptide composed of the above sequence may include one or more types. In addition, the peptide may be one or more types of peptides connected by a linker.

[0072] The composition of the present invention can regulate dendritic cell-mediated immune responses, specifically, inhibit the self-activation of dendritic cells or regulate the self-antigen presentation ability of dendritic cells, but is not limited thereto.

[0073] The self-activation of the above dendritic cells refers to a natural activation phenomenon in which isolated dendritic cells are converted from an inactive form to an active form within 12 hours in a culture state.

[0074] Since the above-mentioned activated dendritic cells have the disadvantage of being unable to be cultured for a long period due to their very short lifespan, the composition of the present invention inhibits this, thereby enabling the culture of dendritic cells separated into an inactive form capable of phagocytizing and processing antigens.

[0075] The above dendritic cells may be isolated from lymphatic tissue and may be from the spleen, lymph nodes, thymus, tonsils, etc.

[0076] The activation inhibitory composition of the present invention is in vivo ( in vivo ) or in a test tube ( in vitro ) can be used, but preferably in a test tube ( in vitro It may be intended for use.

[0078] In addition, the present invention provides a method for culturing dendritic cells in an inactive state, comprising the step of culturing dendritic cells under the above composition.

[0079] A detailed description of the above composition and its inhibitory effect on dendritic cell inactivation is as previously described.

[0080] The above composition may be added to the culture medium of dendritic cells.

[0081] The culture conditions of the above dendritic cells can be appropriately selected by those skilled in the art and are not particularly limited.

[0082] The concentration and treatment time of the above composition are not limited to specific concentrations and times, as long as they can inhibit the self-activation of dendritic cells. The treatment concentration is, for example, 2 × 10⁶ cells. 5 The amount may be 50 to 500 μg / mL, 100 to 400 μg / mL, or 0 to 300 μg / mL per cm, and the treatment time may be, for example, 2 to 48 hours, 6 to 48 hours, 4 to 24 hours, 6 to 18 hours, 4 to 12 hours, 6 to 8 hours, or 6 to 24 hours, but is not limited thereto.

[0083] The culture of the above dendritic cells may be carried out in three dimensions on a structure made of polycaprolactone (PCL) nanofibers, but is not limited thereto.

[0085] In addition, the present invention provides a method for manufacturing an immunotherapy agent.

[0086] The above method may include the step of culturing dendritic cells under the aforementioned composition; the step of inducing activation of dendritic cells by treating with an immune stimulant; and the step of co-culturing the activated dendritic cells and immune cells.

[0087] The above-mentioned immune cell therapy is a treatment method in which immune cells are extracted from a patient's blood, enhanced and modified, cultured, and then injected back into the body; the immune cells are cells involved in the immune response within the immune system and refer to cells utilized as a cell therapy.

[0088] The above immune cells may be, for example, T cells, B cells, dendritic cells, natural killer cells (NK cells), natural killer T cells (NKT cells), mast cells, or bone marrow-derived phagocytes, but are not limited thereto.

[0089] The above-mentioned immune stimulant is not particularly limited to any substance that causes dendritic cells to be converted into cells that display antigens on their surface by exposing them to antigens.

[0090] The above-mentioned immunostimulator may induce increased expression of MHC-II, CD86, CD80, or CD40 on the surface of dendritic cells. For example, the above-mentioned immunostimulator may be a bacterial agent, a CD40 agonist, TNF-α, IL-1β, LPS, or poly(I:C). The above-mentioned CD40 agonist may be a CD40 ligand.

[0091] The step of co-culturing the above-mentioned activated dendritic cells and immune cells induces the proliferation of immune cells and the secretion of cytokines.

[0092] For example, the ratio of the number of immune cells co-cultured based on activated dendritic cells may be 1 to 50, 4 to 30, 5 to 25, 10 to 30, or 15 to 25. The co-culture time may be 2 to 144 hours, 4 to 120 hours, 12 to 96 hours, or 24 to 96 hours, 48 ​​to 96 hours, or 48 to 72 hours, but is not limited thereto.

[0093] The above-mentioned immunotherapy agent may be used for the treatment or prevention of cancer, bacterial and viral infectious diseases, chronic inflammatory diseases, or autoimmune diseases.

[0094] The above cancers may be, for example, lung cancer, laryngeal cancer, stomach cancer, colorectal cancer, liver cancer, gallbladder cancer, pancreatic cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, prostate cancer, kidney cancer, carcinoma derived from epithelial cells, bone cancer, muscle cancer, adipose cancer, sarcoma derived from connective tissue cells, leukemia, lymphoma, blood cancer derived from hematopoietic cells of multiple myeloma, tumors occurring in nervous tissue, thyroid cancer, colon cancer, testicular cancer, brain tumor, head and neck cancer, bladder cancer, epithelial carcinoma, adenocarcinoma, esophageal cancer, mesothelioma, skin cancer, or melanoma, but are not limited thereto.

[0095] The above infectious disease may be a disease caused by infection with pathogens such as bacteria, spirochetes, rickettsia, viruses, fungi, or parasites, but is not limited thereto.

[0096] The aforementioned chronic inflammatory disease is a condition caused by the long-term accumulation of inflammation. It is known to cause cellular aging and deformation, and to disrupt the immune system by excessively activating immune responses; consequently, it has been reported to induce metabolic diseases such as obesity and diabetes, or even autoimmune diseases.

[0097] The above-mentioned autoimmune disease is a disease in which the immune system within the human body attacks normal cells rather than external antigens, and may include, for example, rheumatoid arthritis, atopy, lupus, Crohn's disease, type 1 diabetes, ulcerative colitis, or multiple sclerosis, but is not limited thereto.

[0098] In addition to the aforementioned cancer, infectious disease, or immune disease, an immunotherapy agent can be manufactured using the composition of the present invention regardless of the type of disease where immune cells can be used as a therapeutic agent.

[0100] In addition, the present invention provides a dendritic cell composition in an inactive state comprising the sICAM-1 inhibitor and dendritic cells mixed therewith.

[0101] A detailed explanation regarding the above inhibitor and its effect of inhibiting dendritic cell inactivation is as described above.

[0102] The above composition may include an integrin inhibitor that binds to integrin α4β1 or α5β1, or a peptide consisting of an amino acid sequence of any one of RGD, LDV, and PHSRN (Sequence No. 1).

[0103] The dendritic cells of the above composition may be maintained in an inactive state for, for example, 6 hours or more, 12 hours or more, 24 hours or more, or 48 hours or more, preferably 6 to 24 hours, 6 to 48 hours, 12 to 48 hours, or 12 hours to 24 hours, but are not limited thereto.

[0104] The above cell composition comprises dendritic cells maintained in an inactive state by the aforementioned composition for inhibiting the activation of dendritic cells, wherein the dendritic cells may specifically be dendritic cells in which the increase in expression of MHC-II, CD86, CD80, or CD40 factors is inhibited.

[0105] The aforementioned dendritic cells can functionally phagocytize antigens while maintaining viability until they are stimulated and activated. Unlike activated dendritic cells, they can be cultured for a long period, which enables the development of immunotherapies for various diseases by inducing T cell proliferation in vitro or by promoting cytokine secretion through co-culture with T cells.

[0107] The present invention will be explained in detail below by way of examples. The following examples are illustrative of the present invention, and the content of the present invention is not limited to the following examples.

[0109] Example 1. Measurement of RNA expression of integrin receptor in dendritic cells by Quantitative real-time PCR (q-PCR) reaction

[0110] In Table 1, the binding sites of fibronectin to cellular integrins and the major constituent amino acids of the binding domains were prepared as peptides, and the types of integrins bound to each peptide were indicated. The peptides RGD (P1), LDV (P2), and PHSRN (P3) were commissioned to Peptron (Daejeon, Korea) and purchased, and were prepared using SHIMADZU LCMS-2020.

[0111] Amino acid sequence of integrin-binding peptide in fibronectin Peptide sequence Fibronectin Binding Domain Integrin Receptor P1(RGD) III 10 α3β1,α5β1, α8β1, αVβ1, αVβ3, αVβ6 P2(LDV) III 14 -V α4β1, α4β7 P3(PHSRN) III9 αIIbβ3, α5β1

[0112] In Fig. 1, The amount of RNA of integrin receptors expressed in spleen dendritic cells was measured by q-PCR. CD11c in the spleen + Isolate primary dendritic cells and transfer cells to a 48-well culture plate at a rate of 2 × 10⁶ 7 Dispensed at cells / mL and 37 oThe cells were cultured for 2 hours under conditions of 5% CO2 at C. RNA was isolated from cells directly isolated from tissue without culture and from cells cultured for 2 hours using the Qiagen RNeasy Mini Kit (Qiagen, Germany), and RNA concentration was measured using a NanoDrop ND spectrophotometer (Nanodrop Technologies, USA). RNA was reverse transcribed using the PrimeScript RT reagent Kit (Takara, Japan), and Quantitative real-time PCR (q-PCR) was performed using the synthesized cDNA. The q-PCR reaction was measured using the QuantStudio™3 Real-Time PCR System (Thermo Fisher Scientific, USA) with SYBR Premix EX Taq (Tli RNase H Plus) mix (Takara, Japan). The primers listed in Table 2 below were used in the experiment. To measure expression levels in the q-PCR analysis, the Livak method (ΔΔC t ) was used.

[0113] List of Primers Used in Q-PCR Integrin Receptors Forward sequence (5'-3') Reverse sequence (5'-3') αE GGGTCCTACTTTGGCTCTGT (Sequence No. 2) GTGTGTGTGCCAAGGAGAAG (Sequence No. 3) α4 AATTGGACCAAGTGAGGGACAA (Sequence No. 4) TCGCTAGATCCATACACAAATGA (Sequence No. 5) α5 GAAGGGACGGAGTCAGTGTG (Sequence No. 6) TGAATGGTGCTGCACTGGAT (Sequence No. 7) αL AGATCGAGTCCGGACCCACAG (Sequence No. 8) GGCAGTGAAGAGGCCTCCCG (Sequence No. 9) αM AAACCACAGTCCCGCAGAGA (Sequence No. 10) CGTGTTCA CCAGCTGGCTTA (Sequence No. 11) αV AATCTCCAGTGGCCTTACAA (Sequence No. 12) AGGAAGCAGATGACTTCAGG (Sequence No. 13) β1 AATGCCAAATCTTGCGGAGAA (Sequence No. 14) TCTAAATCATCACATCGTGCAGAA (Sequence No. 15) β2 GATAACATGTACAAGAGGAGCAATG (Sequence No. 16) CGCAAAGATGGGCTGGAT (Sequence No. 17) β3 GGGGACTGCCTGTGTGACTC (Sequence No. 18) CTTTTCGGTCGTGGATGGTG (Sequence No. 19) β6 TCTGAGGATGGAGTGCTGTG (Sequence No. 20) GGCACCAATGGCTTTACACT (Sequence No. 21) β7 TGCAGCTCATCATGGATGCTTA (Sequence No. 22) CCGTCTTCTCAGGACCCTTACA (Sequence No. 23)

[0114] The mRNA expression levels in dendritic cells immediately after isolation from tissue (freshly isolated sDCs) and in cells cultured for 2 hours were compared by calculating the ratio of mRNA expression of each integrin receptor to β-actin mRNA expression and using the relative values ​​relative to the ratio of αE. In uncultured dendritic cells, very low expression levels of α5, αM, and αV were measured, while the expression level of α4 was measured to be relatively high. In comparison, the expression levels of β1 and β2 were similar. In dendritic cells after 2 hours of culture, the expression level of α5 did not increase significantly, but the expression levels of α4, β1, and β2 showed a pattern of significant increase.

[0116] Example 2. Culture of spleen dendritic cells in a medium supplemented with an integrin receptor inhibitor

[0117] In Figure 2, the inhibition of autoactivation in splenic dendritic cells was measured upon the addition of BIO5192, an inhibitor of integrin receptors expressed in splenic dendritic cells. BIO5192 is a compound that specifically binds to and inhibits α4β1 (VLA-4), thereby inhibiting the binding of α4β1 integrin to the LDV of fibronectin. BIO5192 was purchased from R&D Systems. Primary dendritic cells isolated from the spleen (2 × 10⁶ 5 BIO5192 ( / mL) was dispensed into a 48-well plate and various concentrations were added in a cell chamber maintained at 37°C and 5% CO2. After incubation for 6 and 24 hours, the degree to which the cells were distributed as single cells or aggregated was observed using Differential Interference Contrast (DIC) imaging with a confocal microscope (Olympus confocal microscope FV1000, Olympus Corporation, n = 5).

[0118] Results measured after 6 hours of culture showed that cell aggregation was significantly reduced by BIO5192 at concentrations of 5 μM or higher. The inhibitory effect of BIO5192 on cell aggregation was also observed in dendritic cells cultured for 24 hours. When CD86 expression in primary dendritic cells cultured with BIO5192 was measured using a flow cytometer (MACSQuant VYB flow cytometer, Miltenyi Biotec) and analyzed using FlowJo v10 (Tree Star, Ashland), CD86 expression was measured to be significantly lower compared to self-activated cells cultured without the addition of BIO5192.

[0120] Example 3. Measurement of the effect of integrin receptor inhibitors on the autoactivation of splenic dendritic cell subtypes after culture

[0121] In Fig. 3, CD4 of dendritic cells after treatment with fibronectin, the peptide combination P1+P2+P3, and the integrin receptor inhibitors BIO5192 (100 μM) and ATN-161 (100 μM) while culturing splenic dendritic cells + CD8 - , CD4 - CD8 + , CD4 - CD8 - , and CD4 + CD8 + The degree of CD86 expression in subtypes was measured. Splenic dendritic cells were stained with the following fluorescence-conjugated antibodies for 1 hour after 6 hours of culture: CD11-PE, CD86-FITC, CD4-PE.CY.7, CD8-APC (Thermo Fisher). Dendritic cells stained with fluorescence-conjugated antibodies were measured using a flow cytometer (Cytek Aurora Flow Cytometry) (Cytek Biosciences, Fremont, CA, USA) and analyzed using the T-distributed stochastic neighbor embedding algorithm (T-SNE) (FlowJo) program. The analysis results were displayed as a Uniform Manifold Approximation and Projection (UMAP) plot, and the number of cells expressing and not expressing CD86 in each subtype was indicated.

[0122] In Figure 4, the proportion of each subtype, measured by cell number, was compared as a percentage of the total cells in the results presented by the UMAP plot for each subtype of dendritic cells. Dendritic cells immediately after isolation from the spleen and before culture were CD4 + CD8 - Cells accounted for about 75%, but cells cultured for 6 hours were CD4 + CD8 - The subtype decreased to 45% and CD4 - CD8 + and CD4 - CD8 - Subtypes increased by approximately 25% each. CD4 + CD8 + The subtypes did not show proportionally significant changes among the total dendritic cells. Cells treated with fibronectin or the peptide combination P1+P2+P3 showed no significant change in the proportion of subtypes compared to untreated cells, but in the case of BIO5192 treatment, CD4 - CD8 + It showed a slight increase in the proportion of cells. * is compared to Fresh P It is <0.05 and is statistically significant, and # is compared to none P It is statistically significant as <0.05.

[0123] In Figure 5, when comparing the number of CD86-expressing cells as a percentage of the total cell count in the UMAP plots for each dendritic cell subtype, BIO5129 inhibited the increase in CD86 expression similarly to the fibronectin and peptide combination P1+P2+P3. ATN-161 (Ac-PHSCN-NH2, Selleckchem, Texas, USA), a peptide that binds to and inhibits α5β1, also showed an inhibitory effect on autoactivation similar to that of BIO5192. Even when BIO5192, which binds to α4β1, and ATN-161, which binds to α5β1, were added simultaneously, CD86 expression did not show a significant difference compared to single treatments. * indicates comparison with none P It is statistically significant as <0.05.

[0124] In Figure 6, CD86 expression was measured 6 hours after culturing each subtype of splenic dendritic cells with the addition of fibronectin, a peptide combination, and the integrin receptor inhibitors BIO5192 and ATN-161. The number of cells by subtype expressing CD86, as shown in the UMAP plot, was compared as a percentage. When only primary dendritic cells were cultured, CD86 expression increased in all subtypes. When fibronectin was added to the culture medium, the increase in CD86 expression was inhibited in all subtypes of dendritic cells, whereas in cultures supplemented with the peptide combination P1+P2+P3, CD4 + CD8 - and CD4 - CD8 - CD86 expression in cells was significantly inhibited, and CD4 - CD8 + The expression of CD86 in cells was not affected. BIO5192 and ATN-161 are CD4 similar to fibronectin + CD8 - , CD4 - CD8 + , and CD4 - CD8 -CD86 expression was inhibited in cells. * is compared to none P It is statistically significant as <0.05.

[0125] In Figure 7, to measure the extent to which activation is inhibited by BIO5192 and ATN-161, BIO5192 and ATN-161 were added at various concentrations and incubated for 6 or 24 hours, and the expression level of CD86 was measured using a flow cytometer; the IC of BIO5192 50 was 20 μM, and the IC of ATN-161 50 silver It was 70 μM.

[0127] Example 4. Measurement of factors secreted into the culture medium from cultured spleen dendritic cells

[0128] In FIG. 8, in order to determine whether a factor inducing autoactivation is secreted from dendritic cells after culturing spleen dendritic cells, dendritic cells (2 × 10⁻⁶ 5 After culturing cells (500 μl) for 3, 6, 12, and 24 hours, the amount of cytokines secreted into the culture medium was measured using the Proteome Profiler Mouse Cytokine Array Kit, Panel A (R&D Systems). Major cytokines or chemokines that increased over time after cell culture were measured from the A3 spot to the D2 spot, and the secreted amounts of TNF-α, sICAM-1 (soluble intercellular adhesion molecule-1), and CCL5 among the increased cytokines were indicated.

[0129] In Figure 9, the relative mean pixel intensity of major spots was shown by measuring the culture medium obtained after culturing splenic dendritic cells for 3 and 24 hours using a Cytokine Array. Each measured spot density was analyzed using ImageJ software (NIH, Bethesda) and expressed as mean pixel intensity. The secretion of sICAM-1 increased by approximately twofold after 24 hours compared to after 3 hours of culture, and TNF-α increased by approximately eightfold.

[0131] Example 5. Measurement of sICAM-1 secretion from cultured spleen dendritic cells and the effects of fibronectin and peptides thereon

[0132] In Fig. 10, primary dendritic cells of the spleen (2 × 10⁶ 5 After incubating (500 μl) for 24 hours, the concentrations of secreted sICAM-1 and TNF-α in the culture medium increased in a time-dependent manner. The concentration of sICAM-1 was reacted using an ELISA kit (R&D Systems) and measured at a wavelength of 450 nm using a microplate analyzer.

[0133] In Fig. 11, fibronectin (200 μg / mL) and the peptide combination P1+P2+P3 (200 μg / mL each) were added, and splenic dendritic cells (1 × 10⁶) 6 / mL) measured the concentration of sICAM-1 secreted into the culture medium after a certain period during 24-hour incubation. The amount of sICAM-1 secreted into the culture medium was significantly reduced by treatment with fibronectin or the peptide combination P1+P2+P3. * indicates comparison with none P It is statistically significant as <0.05.

[0135] Example 6. Measurement of sICAM-1 secretion from cultured spleen dendritic cells and the effects of fibronectin and peptides thereon

[0136] In Fig. 12, the recombinant protein sICAM-1 (10 ng / mL) was added to splenic dendritic cells (1 × 10⁶ 6The effect on the activity of splenic dendritic cells was measured by culturing them in sICAM-1 (200 μg / mL) for 24 hours. The results showed a significant increase in the expression levels of CD86 and MHC-II, as well as increased TNF-α secretion, in cells treated with sICAM-1, suggesting that sICAM-1 enhances cellular activity. This increase in sICAM-1-induced autoactivation was inhibited by the administration of fibronectin (200 μg / mL), the peptide combination P1+P2+P3 (200 μg / mL each), and the combination of BIO5192 (50 μM) and ATN-161 (50 μM). * indicates comparison to none P It is statistically significant as <0.05.

[0138] Example 7. Measurement of the effect of sICAM-1 neutralizing antibody on autoactivation in cultured primary dendritic cells

[0139] In Fig. 13, primary dendritic cells (2 × 10⁶ 5 10 μg / mL) was dispensed into a 24-well plate, and a neutralizing antibody against ICAM-1 (10 μg / mL) (AF796, Polyclonal Goat IgG, R&D Systems, Inc. Minneapolis, MN, USA) and a control isotype IgG (10 μg / mL) were added. After incubation for 6 or 24 hours, the aggregation of cells and the expression of CD86 were measured. When treated with the antibody against sICAM-1 compared to the control antibody, the aggregation of dendritic cells was significantly inhibited, and the expression of CD86 did not increase.

[0141] Example 8. Measurement of the activation of signaling factors involved in autoactivation in cultured primary dendritic cells and the effect of activation inhibitors thereon

[0142] In Fig. 14, primary splenic dendritic cells (2 × 10⁶ 6When a solution ( / mL) was dispensed into the culture medium and incubated at 37°C for 30 minutes, the phosphorylation level of signaling factors was measured using the Western blot method to determine which factors among various signaling factors were activated. Primary dendritic splenic cells were incubated for 30 minutes with the addition of fibronectin (200 μg / mL), the peptide combination P1+P2+P3 (200 μg / mL each), and sICAM-1 neutralizing antibody (10 μg / mL). The cultured cells were harvested, suspended in cell lysis buffer containing phosphatase and protease inhibitors (Cell Signaling Technology, MA, USA), and treated at 4°C for 20 minutes. The protein content of each sample was measured using the Bradford assay kit (Bio-Rad, Hercules, California, USA). Each sample was treated with 5× sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) buffer (250 mM Tris-HCl pH 6.8, 0.25% bromophenol blue, 50% glycerol, 10% SDS, 0.5 M dithiothreitol) and incubated at 95°C for 10 minutes, then stored at -20°C until electrophoresis was performed. 10 μg of protein per sample was electrophoresed on an 8% (v / v) SDS-PAGE gel and then transferred to a nitrocellulose membrane using a wet transfer Mini-Trans Blot system (Bio-Rad). Each membrane was immersed in PBS blocking buffer containing 0.05% tween and 5% bovine serum albumin and incubated at room temperature for 1 hour.

[0143] The following antibodies were used and treated at 4°C for 12 hours: anti-phospho-PI3-kinase p85(Tyr458) / p55(Tyr199) antibody (Cat. # 4228, Cell Signaling Technology), anti-phospho-AKT antibody (Ser473, 1:1000) (Cat. # 9271S, Cell Signaling Technology), anti-phospho-IKK-α / β antibody (Ser176 / 180, 1:5000) (Cat. # 2697T, Cell Signaling Technology), and anti-Beta Actin antibody (1:10,000) (Cat. # 60008-1-Ig, Protein Tech, Illinois, USA). The membranes treated with the primary antibody were washed three times with PBS blocking buffer and incubated with the anti-rabbit horseradish peroxidase-linked secondary antibody (Cat. #ab6721, Abcam, UK) at room temperature for 1 hour. Chemiluminescence was performed using Clarity™ western ECL substrate (Bio-Rad) and exposed to medical X-ray film (AGFA, Berlin, Germany). Imaging was analyzed using Image J software (NIH, MD, USA). Phosphorylation of PI3K (phosphoinositide 3-kinase), AKT, and IKK-α / β significantly increased after 30 minutes of incubation, and the phosphorylation of these proteins was significantly inhibited by the addition of the fibronectin and peptide combination as well as by the neutralizing antibody against sICAM-1.

[0145] Example 9. Inhibiting the binding of LFA-1 and ICAM-1 to the autoactivation of splenic dendritic cells after culture Measurement of the effects of inhibitors

[0146] In Fig. 15, CD11c+ splenic dendritic cells (2 × 10⁶ 5The degree of CD86 expression in dendritic cells was measured after treatment with A286982 (Selleckchem, Texas, USA), which inhibits binding to LFA-1 known to bind to ICAM-1, while culturing the cells in a dendritic cell culture (in 6 ml / mL) for 6 or 24 hours. When A286982 was added at increasing concentrations, it inhibited CD86 expression starting from a concentration of 0.1 nM and inhibited about 50% of autoactivation at a concentration of 5 nM.

Claims

Claim 1 In vitro (containing a sICAM-1 (soluble Intercellular Adhesion Molecule 1) inhibitor as an active ingredient) in vitro A composition for inhibiting the self-activation of dendritic cells for use, wherein the sICAM-1 inhibitor is selected from i) a neutralizing antibody against sICAM-1 and ii) an inhibitor of binding between sICAM-1 and an integrin, and the inhibitor of binding between sICAM-1 and an integrin is a compound represented by the following Chemical Formula 6, a compound represented by the following Chemical Formula 9, or a combination thereof. [Chemical Formula 9] . Claim 2 A composition for inhibiting the self-activation of dendritic cells according to claim 1, wherein the dendritic cells are primary dendritic cells. Claim 3 delete Claim 4 A composition for inhibiting the self-activation of dendritic cells according to claim 1, wherein the composition further comprises a compound selected from the group consisting of compounds represented by the following chemical formulas 2 to 5: [Chemical Formula 2] [Chemical Formula 3] [Chemical Formula 4] [Chemical Formula 5] . Claim 5 delete Claim 6 A composition for inhibiting the self-activation of dendritic cells according to claim 1, wherein the composition further comprises a peptide consisting of the amino acid sequence of RGD, a peptide consisting of the amino acid sequence of LDV, a peptide consisting of the amino acid sequence of SEQ ID NO. 1, or a combination thereof. Claim 7 A composition for inhibiting the self-activation of dendritic cells according to claim 1, wherein the composition further comprises a compound selected from the group consisting of compounds represented by the following formulas 7, 8, and 10: [Formula 7] [Chemical Formula 8] [Chemical Formula 10] . Claim 8 A composition for inhibiting the self-activation of dendritic cells according to any one of claims 1, 2, 4, 6, and 7, wherein the dendritic cells are derived from the spleen or lymph nodes. Claim 9 delete Claim 10 A method for culturing dendritic cells in an inactive state, comprising the step of culturing dendritic cells under a composition of any one of claims 1, 2, 4, 6, and 7. Claim 11 A method for manufacturing an immune cell therapy agent comprising: a step of culturing dendritic cells under a composition of any one of claims 1, 2, 4, 6, and 7; a step of activating dendritic cells by treating the cultured dendritic cells with an immunostimulant; and a step of co-culturing the activated dendritic cells with immune cells. Claim 12 A method for manufacturing an immunotherapy agent according to claim 11, wherein the immunostimulator is selected from the group consisting of CD40 (Cluster of differentiation 40) ligand, TNF-α (Tumor necrosis factor-α), IL-1β (Interleukin 1β), LPS (lipopolysaccharide), and poly (I:C) (Polyinosinic:polycytidylic acid). Claim 13 A method for manufacturing an immunotherapy agent according to claim 11, wherein the immunotherapy agent is used to treat cancer, infectious diseases, chronic inflammatory diseases or autoimmune diseases. Claim 14 A composition for culturing dendritic cells comprising a composition of any one of claims 1, 2, 4, 6, and 7 and dendritic cells mixed therewith, wherein the dendritic cells are maintained in an inactive state.

Images