Peptide promoting hair hair growth or inhibiting hair loss and uses thereof
Patent Information
- Application Number
- KR1020230044927
- Authority / Receiving Office
- KR · KR
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2023-04-05
- Publication Date
- 2026-09-21
- Estimated Expiration
- 2043-04-05
Smart Images

Figure 112023038513515-PAT00001_ABST
Abstract
Description
Technology Field
[0001] This description relates to a peptide having the ability to promote hair growth or inhibit hair loss and the use thereof. Background Technology
[0002] As society ages, the number of people struggling with hair loss is increasing. While this was previously a primary issue for middle-aged men, interest in hair loss prevention and hair growth has recently been growing among younger generations and women as well. Meanwhile, although hair loss has traditionally been perceived as a natural part of the aging process, recent findings reveal that it is caused by a variety of factors, including genetic predisposition, stress, Westernized dietary habits, nutritional imbalances, and changes in social activities.
[0003] Currently, drugs approved by the U.S. FDA for hair growth include minoxidil (6-Amino-1,2-dihydro-1-hydroxy-2-imino-4-phenoxypyrimidine) (U.S. Patent No. 3,382,247) and finasteride (U.S. Patent No. 5,215,894). Minoxidil was developed in the early 1970s as a vasodilator for the treatment of hypertension; however, due to reports of hypertrichosis as a side effect, it is now used as a hair growth stimulant, exhibiting the effect of thickening hair by widening hair follicles and increasing hair diameter. Additionally, finasteride was developed as a treatment for benign prostatic hyperplasia but is currently used as a hair loss treatment, slowing the progression of hair loss and promoting hair growth.
[0004] However, side effects such as weight gain, edema, dermatitis, and increased heart rate have been reported with minoxidil, and finasteride requires continuous use and carries side effects such as sexual dysfunction in men and birth defects in pregnant women; therefore, the development of a hair loss treatment without side effects remains a necessity.
[0005] Against this technological backdrop, multifaceted research is being conducted to improve hair loss through mechanisms such as hormone regulation and metabolic regulation (Korean Published Patent No. 2002-0005332), but the current situation is still insufficient. The problem to be solved
[0006] One aspect of the present disclosure is to provide a peptide consisting of the amino acid sequence of SEQ ID NO. 1.
[0007] Another aspect of the present disclosure is to provide a cosmetic composition for promoting hair growth or inhibiting hair loss comprising the above peptide.
[0008] Other problems and advantages of the present disclosure will become more apparent from the following detailed description, together with the appended claims and drawings. Content not described in this application is omitted, as it can be sufficiently recognized and inferred by those skilled in the art of this application or a similar art field. means of solving the problem
[0009] A peptide according to one aspect consists of the amino acid sequence of SEQ ID NO. 1.
[0010] A cosmetic composition for promoting hair growth or inhibiting hair loss according to another aspect comprises, as an active ingredient, a peptide composed of the amino acid sequence of SEQ ID NO. 1 that exhibits the ability to promote the proliferation or activity of hair follicle cells or the ability to inhibit hair loss. Effects of the invention
[0011] According to a peptide according to one aspect, it can be applied to promote hair growth, etc. by promoting the proliferation or activity of hair follicle cells or promoting the expression of hair follicle stem cells by (a) promoting the proliferation of human hair follicle dermal papilla cells (HHFDPC), (b) promoting the proliferation of human hair follicle outer root sheath cells (HHFORSC), (c) promoting the proliferation of human hair follicle germinal matrix cells (HHFGMC), (d) activating beta-catenin, (e) increasing the expression of Lef-1, Cyclin D1, or c-Myc, or (f) promoting the differentiation of human hair follicle stem cells (HHFSC).
[0012] According to the peptide according to another aspect, it exhibits the ability to inhibit the expression of hair loss factors and can be applied to inhibit hair loss, etc. Brief explanation of the drawing
[0013] Figure 1 shows the results of measuring the proliferation-promoting effect of a peptide composed of the amino acid sequence of SEQ ID NO. 1 on human dermal papilla cells. Figure 2 shows the results of measuring the proliferation-promoting effect of a peptide composed of the amino acid sequence of SEQ ID NO. 1 on human hair follicle lateral sarcoma cells. Figure 3 shows the results of measuring the proliferation-promoting effect of a peptide composed of the amino acid sequence of SEQ ID NO. 1 on human hair follicle matrix cells. Figure 4 shows the results of measuring the effect of a peptide composed of the amino acid sequence of SEQ ID NO. 1 on the proliferation mechanism of hair follicle cells. Figure 5 is the result of confirming that the peptide composed of the amino acid sequence of SEQ ID NO. 1 increases the expression of Lef-1, Cyclin D1, and c-Myc, which are factors related to the activity and growth of hair follicle cells. Figure 6 is the result of confirming that the expression of stem cell markers decreases due to differentiation induction by a peptide composed of the amino acid sequence of SEQ ID NO. 1. Figure 7 is the result of confirming that the expression of differentiation markers increases due to differentiation induction by a peptide composed of the amino acid sequence of SEQ ID NO. 1. Figure 8 shows the results of measuring the inhibitory effect of a peptide composed of the amino acid sequence of SEQ ID NO. 1 on the expression of hair loss-related factors in hair follicle cells. Figure 9 is the result of comparing and measuring the effect of a peptide composed of the amino acid sequence of SEQ ID NO. 1 and a peptide composed of the amino acid sequence of SEQ ID NO. 26 on the mechanism of hair follicle cell proliferation. Figure 10 shows the results of measuring the expression of stem cell markers after treatment with a peptide consisting of the amino acid sequence of SEQ ID NO. 1 and a peptide consisting of the amino acid sequence of SEQ ID NO. 26. Figure 11 shows the results of measuring the expression of differentiation markers after treatment with a peptide consisting of the amino acid sequence of SEQ ID NO. 1 and a peptide consisting of the amino acid sequence of SEQ ID NO. 26. Figure 12 shows the results of measuring the inhibitory effect on the expression of hair loss-related factors after treatment with a peptide consisting of the amino acid sequence of SEQ ID NO. 1 and a peptide consisting of the amino acid sequence of SEQ ID NO. 26. Specific details for implementing the invention
[0014] Hereinafter, embodiments of the present invention are described in detail so that those skilled in the art can easily implement them. However, the present invention may be implemented in various different forms and is not limited to the embodiments described herein.
[0015] As used herein, the term "peptide" may mean a linear molecule formed by amino acid residues being joined together by peptide bonds. The peptide may be prepared according to chemical synthesis methods known in the art, in particular solid-phase synthesis techniques (Merrifield, J. Amer. Chem. Soc. 85:2149-54(1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd ed., Pierce Chem. Co.: Rockford, 111(1984)) or liquid-phase synthesis techniques (US Patent No. 5,516,891).
[0016] As a result of diligent efforts to develop a peptide having biologically effective activity, the inventors identified a peptide composed of the amino acid sequence of SEQ ID NO. 1. Herein, the biologically effective activity may be the ability to promote hair growth or inhibit hair loss. The promotion of hair growth may include the promotion of proliferation of hair follicle cells, the promotion of activity of hair follicle cells, or the promotion of expression of hair follicle stem cells. The ability to promote proliferation or activity of hair follicle cells may be (a) promoting the proliferation of human hair follicle dermal papilla cells (HHFDPC), (b) promoting the proliferation of human hair follicle outer root sheath cells (HHFORSC), (c) promoting the proliferation of human hair follicle germinal matrix cells (HHFGMC), (d) activating beta-catenin, or (e) increasing the expression of Lef-1, Cyclin D1, or c-Myc. The promotion of hair follicle stem cell expression can be confirmed by promoting the differentiation of human hair follicle stem cells (HHFSC), which decreases stem cell markers and increases differentiation markers. The inhibition of hair loss may be the ability to inhibit the expression of DKK-1 (Dickkopf-related protein 1). Therefore, the peptide according to one embodiment can be utilized for promoting hair growth or inhibiting hair loss.
[0017] The above peptide may have a protecting group attached to the N- or C-terminus of the peptide to obtain chemical stability, enhanced pharmacological properties (half-life, absorption, potency, efficacy, etc.), modified specificity (e.g., broad spectrum of biological activity), and reduced antigenicity. In one embodiment, the N-terminus of the peptide may be attached to any one protecting group selected from the group consisting of an acetyl group, a fluoreonylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, a butoxycarbonyl group (Boc), an allyloxycarbonyl group (Alloc), and polyethylene glycol (PEG); and / or the C-terminus of the peptide may be bonded to any one of the protecting groups selected from the group consisting of an amino group (-NH2), a tertiary alkyl group, and an azide (-NHNH2). Additionally, the peptide may optionally further include a targeting sequence, a tag, a labeled residue, an amino acid sequence prepared for a specific purpose to increase half-life or peptide stability.
[0018] Another embodiment provides a cosmetic composition for promoting hair growth or inhibiting hair loss comprising a peptide consisting of the amino acid sequence of SEQ ID NO. 1.
[0019] Hair growth promotion can refer to any action that increases hair growth from hair follicles, and can refer to any action that increases the total amount of hair, such as the proliferation of hair follicle cells, activation of hair follicle cells, promotion of hair follicle cell growth, or the effect of promoting the expression of hair follicle stem cells.
[0020] Hair loss inhibition can comprehensively refer to the process or effects of treating, alleviating, or mitigating the condition of hair loss, and may include, for example, all actions that inhibit the progression of hair loss, such as the regeneration of hair follicle cells, the restoration of hair follicle cell activity, the inhibition of hair follicle cell death, and the inhibition of the expression of hair loss-inducing factors such as DKK-1.
[0021] Conventional functional peptides, despite their effective biological activity, have shown disadvantages such as not being effectively absorbed into target tissues or cells due to the size of the peptide itself, or being eliminated from the body in a short period of time due to a short half-life. On the other hand, the cosmetic composition according to the present embodiment includes a peptide composed of 10 or fewer amino acids as an active ingredient, and accordingly, the skin penetration rate of the active ingredient is excellent, and, for example, when applied topically to the skin, it can promote hair growth and effectively suppress hair loss.
[0022] The cosmetic composition may comprise a cosmetically effective amount of peptide; and / or a cosmetically acceptable carrier, but is not limited thereto.
[0023] "Cosmetic effective amount" may mean an amount sufficient to achieve the efficacy of improving hair loss or promoting hair growth of the above cosmetic composition.
[0024] The cosmetic composition may be prepared in any formulation conventionally manufactured in the art, for example, as a solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation, and spray, but is not limited thereto. For example, it may be prepared in the form of a softening lotion, a nourishing lotion, a nourishing cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray, or a powder.
[0025] In the case where the formulation of the cosmetic composition is a paste, cream, or gel, animal oil, vegetable oil, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, or zinc oxide may be used as a carrier component.
[0026] When the formulation of the cosmetic composition is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, or polyamide powder may be used as a carrier component, and, for example, in the case of a spray, may additionally include a propellant such as chlorofluorohydrocarbon, propane / butane, or dimethyl ether.
[0027] When the formulation of the cosmetic composition is a solution or an emulsion, a solvent, a solubilizing agent, or an emulsifying agent is used as a carrier component, and may include, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol, or fatty acid ester of sorbitan.
[0028] In the case where the formulation of the cosmetic composition is a suspension, liquid diluents such as water, ethanol, or propylene glycol, suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, or tracanth may be used as carrier components.
[0029] In the case where the formulation of the cosmetic composition is a cleansing product containing a surfactant, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide ether sulfate, alkylamidobetaine, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, or ethoxylated glycerol fatty acid ester, etc. may be used as a carrier component.
[0030] In addition to the peptide and carrier components as active ingredients, the components included in the cosmetic composition may include ingredients commonly used in cosmetic compositions, such as, for example, antioxidants, stabilizers, solubilizers, vitamins, pigments, and fragrances.
[0031] Another embodiment provides a method for improving hair loss or promoting hair growth, comprising the step of applying a cosmetic composition containing a peptide having the amino acid sequence of SEQ ID NO. 1 as an active ingredient to the skin of an individual.
[0032] "Applying," "administering," and "applying" are used interchangeably and may mean causing at least partial localization of the composition according to one embodiment to a desired site, or dispensing the composition according to one embodiment into an individual by a route of administration.
[0033] Another embodiment provides a pharmaceutical composition for the prevention or treatment of hair growth promotion or hair loss inhibition comprising a peptide consisting of the amino acid sequence of SEQ ID NO. 1 as an active ingredient.
[0034] "Prevention" refers to any act of suppressing or delaying the onset of disease through the administration of the above-mentioned composition.
[0035] "Treatment" means any form of treatment that provides effects to an individual suffering from a disease or at risk of developing a disease, including improvement of the individual's condition (e.g., one or more symptoms), delay of disease progression, delay of symptom onset, or slowing of symptom progression. Accordingly, "treatment" and "prevention" are not intended to mean the cure or complete elimination of symptoms.
[0036] "Individual" refers to a subject requiring treatment for a disease, and more specifically, to mammals such as human or non-human primates, mice, dogs, cats, horses, and cattle.
[0037] "Hair loss," a disease targeted for prevention or treatment by pharmaceutical compositions, refers to a condition in which hair is absent in areas where it should normally be present; specifically, it may refer to the shedding of terminal hairs (thick, dark hair) from the scalp. The causes of hair loss are not limited, but can be triggered by various dietary and environmental influences, such as genetic factors, hormonal imbalances, mental stress, exposure to air pollution, and the consumption of processed foods. For example, hair loss includes hereditary androgenetic alopecia (baldness), alopecia areata, tinea capitis caused by fungal infection, telogen effluvium, trichotillomania, and hair growth disorders. Scarring alopecia, in which scars form, may refer to hair loss caused by lupus, folliculitis, lichen planus follicles, and burns or trauma.
[0038] According to one embodiment, a peptide having the amino acid sequence of SEQ ID NO. 1 exhibits functions such as promoting the proliferation of hair follicle cells, promoting the activity of hair follicle cells, or promoting the expression of hair follicle stem cells. Additionally, it exhibits the ability to inhibit the expression of hair loss factors. Therefore, the peptide can be utilized as an active ingredient in a pharmaceutical composition for the prevention or treatment of hair loss promotion or inhibition.
[0039] The pharmaceutical composition may comprise a pharmaceutically effective amount of the peptide; and / or a pharmaceutically acceptable carrier, but is not limited thereto.
[0040] "Pharmaceutical effective amount" means an amount sufficient to achieve the efficacy of preventing or treating hair loss of the above pharmaceutical composition.
[0041] Pharmaceutically acceptable carriers are those commonly used in formulations and include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).
[0042] In addition to the above components, the pharmaceutical composition may additionally include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc., but is not limited thereto.
[0043] The pharmaceutical composition may be administered orally or parenterally, preferably parenterally, and in the case of parenteral administration, may be administered by intramuscular injection, intravenous injection, subcutaneous injection, intraperitoneal injection, local administration, transdermal administration, etc., but is not limited thereto.
[0044] The dosage of the pharmaceutical composition may be 0.0001 to 1000 µg (micrograms, 0.001 to 1000 µg, 0.01 to 1000 µg, 0.1 to 1000 µg, or 1.0 to 1000 µg per day, but is not limited thereto, and may be prescribed in various ways depending on factors such as the method of formulation, mode of administration, age, body weight, sex, pathological condition, food, time of administration, route of administration, excretion rate and response responsiveness.
[0045] The pharmaceutical composition may be prepared in a unit volume form or contained in a multi-volume container by formulation using a pharmaceutically acceptable carrier and / or excipient, according to a method that can be easily carried out by a person skilled in the art to which the invention belongs.
[0046] Another embodiment provides a method for preventing or treating hair loss by promoting hair growth or inhibiting hair loss, comprising the step of administering to an individual a pharmaceutical composition containing, as an active ingredient, a therapeutically effective amount of a peptide consisting of the amino acid sequence of SEQ ID NO. 1.
[0048] The embodiments described above will be explained in more detail through the following examples. However, the following examples are for illustrative purposes only and do not limit the scope of the invention.
[0049] Example 1: Synthesis of Peptides
[0050] Peptides having the amino acid sequence of SEQ ID NO. 1 listed in Table 1 below were synthesized using an automated peptide synthesizer (Milligen 9050, Millipore, USA), and these synthesized peptides were purified using C18 reverse-phase high-performance liquid chromatography (HPLC) (Waters Associates, USA). An ACQUITY UPLC BEH300 C18 column (2.1 mm x 100 mm, 1.7 µm, Waters Co, USA) was used.
[0051] Sequence number Sequence (N-terminus → C-terminus) 1 RQTRVERSHS
[0052] Example 2: Confirmation of Hair Follicle Cell Proliferation Effect The proliferation-promoting effect of a peptide composed of the amino acid sequence of SEQ ID NO. 1 was intended to be confirmed on hair follicle cells. Specifically, human hair follicle dermal papilla cells (HHFDPC), human hair follicle outer root sheath cells (HHFORSC), and human hair follicle matrix cells (HHFGMC) were each 4 x 10⁶ 3 Cells were seeded into 96-well plates at a cell / well density and cultured for 24 hours. The medium was then replaced with serum-free mesenchymal stem cell medium and cultured for another 24 hours. The aforementioned peptides were treated at concentrations of 10 µM, 50 µM, or 100 µM, respectively, and cultured at 37°C for 72 hours. As positive controls, 1 µM of Minoxidil (used as a hair loss treatment), 100 ng / ml of human recombinant Wnt-3a protein, and 100 ng / ml of human recombinant EGF protein were applied. After incubation was complete, the culture supernatant was removed, and the cells were immobilized using ethanol. After washing with PBS, staining was performed using SRB solution. Cells were observed under a microscope after washing with 1% acetic acid, and destaining was performed using 20 mM tris solution. The viability of cells was measured by measuring the absorbance at a wavelength of 560 nm using a spectrophotometer (SpectraMax iD3, Molecular Devices (USA, CA)).
[0053] The results are illustrated in Figures 1 to 3. Figure 1 shows the proliferation results of human hair follicle dermal papilla cells (HHFDPC), Figure 2 shows the proliferation results of human hair follicle outer root sheath cells (HHFORSC), and Figure 3 shows the proliferation results of human hair follicle matrix cells (HHFGMC), confirming that proliferation was induced and increased in a concentration-dependent manner in the peptide-treated groups. An increase of up to approximately 46% was observed for HHFDPC (Figure 1), up to approximately 49% for HHFORSC (Figure 2), and up to approximately 33% for HHFGMC (Figure 3).
[0054] Example 3: Confirmation of the effect of promoting the proliferation mechanism of hair follicle cells
[0055] We aimed to confirm the effect of the peptide composed of the amino acid sequence of SEQ ID NO. 1 on the proliferation mechanism of hair follicle cells. Specifically, HHFDPC 4x10 5Cells were seeded into 6-well plates at a cell / well density and cultured for 24 hours. The medium was then replaced with serum-free mesenchymal stem cell medium, followed by 24 hours of culture. Peptides were added at concentrations of 10 µM, 50 µM, or 100 µM, respectively, and cultured at 37°C for 24 hours. Recombinant human Wnt-3a protein was added at 10 ng / mL as a positive control. After PBS washing, nuclear proteins were isolated using a nuclear protein extraction kit (Thermo Scientific, USA), and equal amounts of protein samples were prepared by BCA quantification. The isolated proteins were transferred to a PVDF membrane by performing electrophoresis on a 10% SDS-PAGE gel. The samples were blocked with 5% skim milk at room temperature for 30 minutes. Beta-catenin (cell signaling, USA) and HDAC1 (santa Cruz, USA) antibodies were diluted 1:1000 in 3% BSA and incubated with the membrane at 4°C for 16 hours. The membrane was washed three times for 15 minutes with 0.1% PBS-T (0.1% Tween-20 in PBS). The secondary antibody was diluted 1:2000 in 5% skim milk and incubated at room temperature for 1 hour. The membrane was washed three times for 15 minutes with 0.1% PBS-T (0.1% Tween-20 in PBS). Detection was performed on the membrane after treatment with ECL solution (GE Healthcare, USA).
[0056] The results are shown in Fig. 4. From the results in Fig. 4, it can be seen that the expression of beta-catenin increases upon peptide treatment, and that the nuclear translocation of beta-catenin from the cytoplasm to the nucleus increases by up to 5.34 times due to peptide treatment.
[0057] Example 4: Confirmation of the effect of promoting hair follicle cell activity
[0058] We aimed to confirm the effect of the peptide composed of the amino acid sequence of SEQ ID NO. 1 on promoting the activity of hair follicle cells. HHFDPC was 4x105 Cells were seeded into 6-well plates at a cell / well density and cultured for 24 hours. After replacing the medium with serum-free mesenchymal stem cell medium, the cells were cultured for another 24 hours. Peptides were added at concentrations of 10 µM, 50 µM, or 100 µM, respectively, and cultured at 37°C for 24 hours. Recombinant human Wnt-3a protein was added at 10 ng / mL as a positive control. After washing with PBS, RNA was isolated by adding 300 μL of easy blue (Intron, Korea). Following RNA quantification, cDNA synthesis was performed using a cDNA synthesis kit (enzynomics, Korea). PCR was conducted using a PCR pre-mix (enzynomics, Korea) with the Lef-1, Cyclin D1, and c-Myc primers shown in Table 2. Electrophoresis was performed on a 1.5% agarose gel, and band detection was performed using a Bio-Rad gel imaging system.
[0059] The results are shown in Fig. 5. From the results in Fig. 5, it was confirmed that the expression of Lef-1, c-Myc, and Cyclin D1, which are factors related to the activity and growth of HHFDPC cells, was increased by peptide treatment. It was confirmed that Lef-1 showed an increase in expression of up to 1.53 times compared to the control group, Cyclin D1 showed an increase of up to 6.13 times, and c-Myc showed an increase of up to 4.86 times.
[0060] primer order Sequence number LEF-1 Forward Direction (5')CCAGCTATTGTAACACCTCA (3') 2 LEF-1 reverse direction (5') TTCAGATGTAGGCAGCTGTC (3') 3 c-Myc forward direction (5') ACCAGCAGCGACTCTGAGGAGGAAC (3') 4 c-Myc reverse direction (5') TGACCCTCTTGGCAGCAGGATAGTCC (3') 5 Cyclin D1 Forward Direction (5') ACCTTCGTTGCCCTCTGTGCCACAGATG (3') 6 Cyclin D1 reverse direction (5') AGGCCCGGAGGGCAGTCCGGGT (3') 7 GAPDH Forward Direction (5') GGAGCCAAAAGGGTCATCAT (3') 8 GAPDH reverse (5') GTGATGGCATGGACTGTGGT (3') 9
[0061] Example 5: Confirmation of Stem Cell Differentiation-Inducing Effect We intended to confirm the stem cell differentiation-inducing effect of the peptide composed of the amino acid sequence of SEQ ID No. 1. HHFSC was 1 x 10⁻⁶ 5Cells were seeded into 6-well plates at a cell / well density and cultured for 24 hours. After replacing the medium with serum-free mesenchymal stem cell medium, the cells were cultured for another 24 hours. Peptides were added at concentrations of 10 µM, 50 µM, and 100 µM, respectively, and the cells were incubated at 37°C for 72 hours. As positive controls, recombinant human Wnt-3a protein was added at concentrations of 10 ng / mL and 100 ng / mL, respectively. After washing with PBS, RNA was isolated by adding 300 μL of easy blue (Intron, Korea). Following RNA quantification, cDNA synthesis was performed using a cDNA synthesis kit (Enzynomics, Korea). PCR was conducted using a PCR pre-mix (Enzynomics, Korea) with the primers listed in Table 3. Electrophoresis was performed on a 1.5% agarose gel, and band detection was performed using a Bio-Rad gel imaging system.
[0062] primer order Sequence number CD34 forward direction (5') CTGCATGCAAGAGTGACACC (3') 10 CD34 reverse (5') GACATTGCCCCTTCCCTTTG (3') 11 Lhx-2 forward direction (5') AAGCTGCAACGAAAACGACG (3') 12 Lhx-2 reverse direction (5')GGTGGGGCTAGTCAAGTTCTG (3') 13 Keratin 15-Forward (5') CCAGCAAGACGGAGATCACA (3') 14 Keratin 15-Reverse (5') GAAGAGGCTTCCCTGATGGC (3') 15 Alpha-SMA Forward (5') CCTATCCCCGGGACTAAGAC (3') 16 Alpha-SMA inverse (5') ATGCTCTTCAGGGGCAACAC (3') 17 Corin forward direction (5')CAGTGGAATCTGCATCCCCG (3') 18 Corin reverse direction (5') CAGCGATGCTCTGTTGTGG (3') 19 Versican forward direction (5') CCGTTCTCCCCAGGAAAACTT (3') 20 Versican reverse (5') TGCAGCGATCAGGTCGTTTA (3') 21 Vimentin forward direction (5') TGGACCAGCTAACCAACGAC (3') 22 Vimentin reverse direction (5') GTCATTGTTCCGGTTGGCAG (3') 23 Nexin-1 forward direction (5') CCCAGCCAACCTATGAGGAG (3') 24 Nexin-1 reverse direction (5') CTTGAGGAGACCAGCACCAC (3') 25
[0063] Figure 6 shows the results of measuring stem cell markers, and Figure 7 shows the results of measuring differentiation markers. From the results in Figure 6, it can be confirmed that the expression of the stem cell markers CD34, Lhx-2, and Keratin15 all decreased significantly. On the other hand, from the results in Figure 7, it can be confirmed that the expression of the differentiation markers Alpha-SMA, Corin, Versican, Vimentin, and Nexin-1 all increased significantly. From this, it was confirmed that the peptide having the amino acid sequence of SEQ ID NO. 1 induces the proliferation of stem cells and induces differentiation to migrate to hair roots, thereby enabling the generation of new hair follicles. Example 6: Confirmation of the inhibitory effect of hair loss-related factors on expression in hair follicle cells
[0064] The purpose was to determine whether the expression of DKK-1, a hair loss-related factor, is inhibited in hair follicle cells by a peptide composed of the amino acid sequence of SEQ ID NO. 1. HHFDPC was 4x10 5Cells were seeded into 6-well plates at a cell / well density and cultured for 24 hours. The medium was then replaced with serum-free mesenchymal stem cell medium and cultured for another 24 hours. Peptides were treated at concentrations of 10 μM, 50 μM, or 100 μM, respectively, while DHT, a substance that induces the hair loss protein DKK-1, was simultaneously treated at a concentration of 100 nM. As a positive control, 5 μM of finasteride, a drug that inhibits male hormones, was administered. DHT is known as a hair loss hormone that increases the expression of DKK-1 (Dickkopf-related protein 1), a hair loss inducing factor, by activating androgen receptors. After incubating at 37°C for 24 hours, cell lysates were prepared by washing with PBS and treating with lysis buffer. Equal amounts of protein samples were prepared by quantifying BCA. Electrophoresis was performed using a 10% SDS-PAGE gel. Proteins isolated via SDS-PAGE were transferred to a PVDF membrane. Blocking was performed using 5% skim milk at room temperature for 30 minutes. The DKK-1 (Cell Signaling, USA) antibody was diluted 1:1000 in 3% BSA and incubated with the membrane at 4°C for 16 hours. The membrane was washed three times for 15 minutes each with 0.1% PBS-T (0.1% Tween-20 in PBS). The secondary antibody was diluted 1:2000 in 5% skim milk and incubated at room temperature for 1 hour. The membrane was washed three times for 15 minutes each with 0.1% PBS-T (0.1% Tween-20 in PBS). After treatment with ECL solution (GE Healthcare, USA), protein band detection and densitometry were performed using an ImageQuant 800 (Amersham, USA) instrument.
[0065] The results are shown in Fig. 8. From the results in Fig. 8, it was possible to confirm the inhibitory effect on DHT-induced DKK-1 expression after peptide treatment. It was confirmed that in the group treated with a high concentration of peptide, the DKK-1 expression level decreased by approximately 50% compared to the negative control group (DHT treatment group).
[0066] Example 7: Comparison of Effects Promoting the Proliferation Mechanism of Hair Follicle Cells
[0067] The effects of a novel peptide consisting of the amino acid sequence of SEQ ID NO. 1 and a peptide consisting of the amino acid sequence of SEQ ID NO. 26 disclosed in KR10-1209117 (Table 4) on the proliferation mechanism of hair follicle cells were compared. The experiment was conducted in the same manner as described in Example 3, by treating HHFDPC with the peptides at different concentrations and measuring the cell proliferation effect.
[0068] Sequence number Sequence (5'→3') 26 RQTRVQRSHS
[0069] The results are illustrated in Fig. 9. From the results in Fig. 9, it can be confirmed that both the peptide with the amino acid sequence of SEQ ID NO. 26 and the novel peptide with the amino acid sequence of SEQ ID NO. 1 promote the translocation of β-catenin from the cytoplasm to the nucleus in a concentration-dependent manner. Furthermore, when comparing the activities of the two peptides, it can be confirmed that the novel peptide exhibits significantly higher activity in promoting the proliferation mechanism than the known peptide when treated at the same concentration.
[0070] Example 8: Comparison of Stem Cell Differentiation Induction Effects
[0071] The differentiation-inducing effects of a novel peptide consisting of the amino acid sequence of SEQ ID NO. 1 and a peptide consisting of the amino acid sequence of SEQ ID NO. 26 on stem cells were compared. The experiment was conducted in the same manner as described in Example 5, by treating HHFSCs with the peptides at different concentrations and confirming the differentiation-inducing effects.
[0072] The results are illustrated in Figures 10 and 11. Figure 10 shows the results of measuring stem cell markers, and Figure 11 shows the results of measuring differentiation markers. From the results in Figure 10, it can be seen that the expression of the stem cell markers CD34, Lhx-2, and Keratin15 all decreased significantly upon treatment with the two peptides. Furthermore, when comparing the activities of the two peptides, it can be seen that the novel peptide showed a more significant decrease in the expression of stem cell markers than the known peptide when treated at the same concentration. Additionally, from the results in Figure 11, it can be seen that the expression of the differentiation markers Alpha-SMA, Corin, Versican, Vimentin, and Nexin-1 all increased significantly upon treatment with the two peptides. Furthermore, when comparing the activities of the two peptides, it can be seen that the novel peptide showed a significantly greater increase in the expression of differentiation markers than the known peptide when treated at the same concentration. Therefore, it can be confirmed that the novel peptide induces the proliferation of stem cells and differentiation to reach the hair root, thereby enabling the creation of new hair follicles, compared to known peptides.
[0073] Example 9: Comparison of the inhibitory effect of hair loss-related factors on expression in hair follicle cells
[0074] The inhibitory effect of a novel peptide composed of the amino acid sequence of SEQ ID NO. 1 and a peptide composed of the amino acid sequence of SEQ ID NO. 26 on the expression of hair loss-related factors was compared. The experiment was conducted in the same manner as described in Example 6, by treating HHFDPC with the peptides at different concentrations and confirming whether the expression of DKK-1, a hair loss-related factor, was inhibited.
[0075] The results are illustrated in FIG. 12. From the results in FIG. 12, it can be confirmed that both the peptide composed of the amino acid sequence of SEQ ID NO. 26 and the novel peptide composed of the amino acid sequence of SEQ ID NO. 1 exhibit a concentration-dependent inhibitory effect on DKK-1 expression. Furthermore, when comparing the inhibitory effects of the two peptides, it can be confirmed that the novel peptide has a significantly higher ability to inhibit DKK-1 expression than the known peptide when treated at the same concentration. Although preferred embodiments of the present invention have been described in detail above, the scope of the present invention is not limited thereto, and various modifications and improvements by those skilled in the art using the basic concept of the present invention as defined in the following claims also fall within the scope of the present invention.
Claims
Claim 1 delete Claim 2 delete Claim 3 delete Claim 4 delete Claim 5 delete Claim 6 delete Claim 7 delete Claim 8 A peptide composed of the amino acid sequence of SEQ ID NO. 1 that inhibits the expression of DKK-1 (Dickkopf-related protein 1), a hair loss-inducing factor. Claim 9 In claim 8, the peptide is a peptide that reduces the expression of DKK-1 in a concentration-dependent manner by 2 to 35% compared to a sequence in which the 6th amino acid in the amino acid sequence of SEQ NO. 1 is Q (glutamine). Claim 10 In claim 8, the peptide is a peptide that induces stem cell differentiation. Claim 11 A peptide comprising the amino acid sequence of SEQ ID NO. 1, which increases the expression of stem cell differentiation markers alpha-SMA, Corin, Versican, Vimentin, and Nexin-1 by at least 1.2 times compared to a sequence in which the 6th amino acid of the amino acid sequence of SEQ ID NO. 1 is Q (glutamine). Claim 12 A peptide composed of the amino acid sequence of SEQ ID NO. 1 that promotes the activity of hair follicle cells and increases the expression of Lef-1, Cyclin D1, and c-Myc Claim 13 A peptide composed of the amino acid sequence of SEQ ID NO. 1, which increases the translocation of beta-catenin from the cytoplasm to the nucleus by more than 1.2 times compared to a sequence in which the 6th amino acid in the amino acid sequence of SEQ ID NO. 1 is Q (glutamine). Claim 14 A cosmetic composition comprising a peptide of any one of claims 8 to 13 as an active ingredient
Citation Information
Patent Citations
Modified WNT10―Derived Peptides and Uses Thereof
KR101209117B1