Bacteroid thetaiotaomicron strain producing butyrate and method for producing butyrate using the same

KR103023235B1Active Publication Date: 2026-09-23KOREA ADVANCED INST OF SCI & TECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
KR1020220071565
Authority / Receiving Office
KR · KR
Patent Type
Patents
Current Assignee / Owner
Filing Date
2022-06-13
Publication Date
2026-09-23
Estimated Expiration
2042-06-13

Smart Images

  • Figure 112022061459766-PAT00001_ABST
    Figure 112022061459766-PAT00001_ABST
Patent Text Reader

Abstract

The present invention relates to a Bacteroides thetaiotaomicron strain that produces butyrate and a method for producing butyrate using the same. The strain according to the present invention exhibits a significant butyrate production capacity compared to the B. thetaiotaomicron strain, into which an exogenous butyrate biosynthetic pathway that does not produce butyrate under glucose-limiting conditions has been introduced, so it can be applied not only for butyrate production but also as a microbial therapeutic agent.
Need to check novelty before this filing date? Find Prior Art

Description

Technology Field

[0001] The present invention relates to Bacteroides tetaiothaomicron (which produces butyrate) Bacteroides thetaiotaomicron This relates to a strain and a method for producing butyrate using the same. Background Technology

[0003] Therapeutic microbes refer to genetically modified bacteria that have been repurposed to prevent or alleviate the symptoms of human diseases. In 1917, E. coli ( Escherichia coli Since the efficacy of Nissle in alleviating intestinal inflammation was confirmed, and with the increasing availability of new synthetic biology tools and genomic information, there have been numerous studies aimed at creating microorganisms with functions beneficial to human health through genetic engineering, including the delivery of therapeutic payloads, the reduction of inflammation, and the correction of inherent defects in metabolism.

[0004] To manipulate microorganisms to express targeted therapeutic functions, it is necessary to select potent microorganisms capable of self-survival, proliferation, and the production of functional therapeutic agents; human gut symbionts that have evolved to effectively inhabit the human gut are promising candidates that meet these criteria. Bacteroides thetaeothaomicron, known as a major human gut symbiont ( Bacteroides thetaiotaomicron It is known to be widespread across various human populations and to have an excellent ability to colonize the gut (Human Microbiome Project, Nature 486, 207-214., 2012).

[0005] Meanwhile, butyrate is a short-chain fatty acid (SCFA) that plays a multifunctional role in the human intestine, such as serving as an energy source for colon epithelial cells in the regulation of immune function. Butyrate is Firmicutes ( FirmicutesIt can be synthesized from acetyl-CoA through a 5-6 step biosynthetic reaction identified in ) species (Baek et al., Biotechnol. Bioeng. 110, 2790-2794., 2013). However, B. thetaiotaomicron It is known that butyrate is not produced in [location] (Adamberg et al., Front. Nutr. 1, 21., 2014).

[0006] Accordingly, the exogenous butyrate biosynthetic pathway is wild-type B. thetaiotaomicron There have been attempts to produce butyrate by direct integration, but the wild-type in which the exogenous butyrate biosynthetic pathway was introduced B. thetaiotaomicron It had a problem in that it did not produce butyrate under glucose-restricted conditions.

[0007] Against this background, the inventors have introduced an exogenous butyrate biosynthetic pathway that produces butyrate even under glucose-limiting conditions. B. thetaiotaomicron The present invention was completed by developing a strain and confirming that it can be applied not only to butyrate production but also as a microbial therapeutic agent. The problem to be solved

[0009] One objective of the present invention is for a genus of Bacteroides that produces butyrate ( Bacteroides It is to provide the sp.) strain.

[0010] Another object of the present invention is to provide a method for producing butyrate, comprising: a) culturing the strain in a medium; and b) recovering butyrate from the cultured medium and strain. means of solving the problem

[0012] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in the present invention may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in the present invention fall within the scope of the present invention. Furthermore, the scope of the present invention should not be considered limited by the specific descriptions provided below.

[0014] One aspect of the present invention for achieving the above objective is a genus of Bacteroides that produces butyrate ( Bacteroides Provides the sp.) strain.

[0015] Specifically, the strain comprises i) any one or more polypeptides selected from acetyl-CoA acetyltransferase, 3-hydroxybutyryl-CoA dehydratase, butyryl-CoA dehydrogenase, electron transfer flavoprotein subunit beta, electron transfer flavoprotein subunit alpha, 3-hydroxybutyryl-CoA dehydrogenase, phosphate butyryltransferase, butyrate kinase, and combinations thereof, or a polynucleotide encoding the same,

[0016] ii) One or more polypeptides selected from phosphotransacetylase, lactate dehydrogenase, and combinations thereof, or polynucleotides encoding the same, may be weakened or deleted.

[0018] In the present invention, the genus Bacteroides ( Bacteroides sp.) strains are, for example, Bacteroides tetaiothaomicron ( Bacteroides thetaiotaomicron ), Bacteroides obatus( Bacteroides ovatus It could be ) etc., and specifically B. thetaiotaomicron It may be, but is not limited to.

[0019] In the present invention, the term "Bacteroides tetaiothaomicron ( Bacteroides thetaiotaomicron )" is a strain known as a major human intestinal symbiont, and is known to have gastrointestinal alleviating effects such as anti-inflammatory properties, strengthening of the mucosal barrier, and stimulation of host immune function.

[0021] In the present invention, i) any one or more polypeptides selected from acetyl-CoA acetyltransferase, 3-hydroxybutyryl-CoA dehydrogenase, butyryl-CoA dehydrogenase, electron transfer flavoid protein subunit beta, electron transfer flavoid protein subunit alpha, 3-hydroxybutyryl-CoA dehydrogenase, phosphate butyryltransferase, and butyrate kinase may be polypeptides of microbial origin, and for example, of the genus Clostridium ( Clostridium It may be a polypeptide derived from the sp.) strain, specifically Clostridium acetobutylicum ( Clostridium acetobutylicum It may be a polypeptide derived from ).

[0022] The strain of the present invention may comprise one or more, two or more, three or more, four or more, five or more, six or more, seven or more, or eight polypeptides selected from the polypeptides, or may comprise one or more, two or more, three or more, four or more, five or more, six or more, seven or more, or eight polynucleotides encoding them. For the purposes of the present invention, the strain of the present invention may comprise all eight polypeptides or all polynucleotides encoding them.

[0024] The acetyl-CoA acetyltransferase, 3-hydroxybutyryl-CoA dehydrogenase, butyryl-CoA dehydrogenase, electron transfer flavoid subunit beta, electron transfer flavoid subunit alpha, 3-hydroxybutyryl-CoA dehydrogenase, phosphate butyryltransferase and butyrate kinase of the present invention may be polypeptides of an exogenous butyrate biosynthetic pathway using acetyl-CoA derived from Clostridium acetobutylicum as a precursor.

[0025] Specifically, the acetyl-CoA acetyltransferase of the present invention thl Wow, 3-hydroxybutyryl-CoA dehydrogenase is crt Wow, butyryl-CoA dehydrogenase is bcd Wow, electron transfer flavoid subunit beta is etfB Wow, electron transporter flavoid subunit alpha is etfA Wow, 3-hydroxybutyryl-CoA dehydrogenase is hbd Wow, phosphate butyryltransferase ptb Wow, butyrate kinase book It can be used interchangeably with.

[0026] The amino acid sequences of the above-mentioned acetyl-CoA acetyltransferase, 3-hydroxybutyryl-CoA dehydrogenase, butyryl-CoA dehydrogenase, electron transfer flavoid protein subunit beta, electron transfer flavoid protein subunit alpha, 3-hydroxybutyryl-CoA dehydrogenase, phosphate butyryltransferase, and butyrate kinase polypeptide can be obtained from known databases such as NCBI’s GenBank and UniProtKB. Specifically, the sequences of acetyl-CoA acetyltransferase can be obtained at P45359 (UniProtKB), 3-hydroxybutyryl-CoA dehydrogenase at P52046 (UniProtKB), butyryl-CoA dehydrogenase at P52042 (UniProtKB), electron transfer flavoid subunit beta at P52040 (UniProtKB), electron transfer flavoid subunit alpha at P52039 (UniProtKB), 3-hydroxybutyryl-CoA dehydrogenase at P52041 (UniProtKB), phosphate butyryltransferase at P58255 (UniProtKB), and butyrate kinase at Q45829 (UniProtKB).

[0027] More specifically, the acetyl-CoA acetyltransferase, 3-hydroxybutyryl-CoA dehydrogenase, butyryl-CoA dehydrogenase, electron transfer flavoid protein subunit beta, electron transfer flavoid protein subunit alpha, 3-hydroxybutyryl-CoA dehydrogenase, phosphate butyryltransferase, or butyrate kinase may each include the amino acid sequence of SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9, SEQ ID NO. 11, SEQ ID NO. 13, or SEQ ID NO. 15. Specifically, the acetyl-CoA acetyltransferase of the present invention may have the amino acid sequence of SEQ ID NO. 1, the 3-hydroxybutyryl-CoA dehydrogenase may have the amino acid sequence of SEQ ID NO. 3, the butyryl-CoA dehydrogenase may have the amino acid sequence of SEQ ID NO. 5, the electron transfer flavoid subunit beta may have the amino acid sequence of SEQ ID NO. 7, the electron transfer flavoid subunit alpha may have the amino acid sequence of SEQ ID NO. 9, the 3-hydroxybutyryl-CoA dehydrogenase may have the amino acid sequence of SEQ ID NO. 11, the phosphate butyryltransferase may have the amino acid sequence of SEQ ID NO. 13, and the butyrate kinase may have the amino acid sequence of SEQ ID NO. 15, respectively, or may be composed of the said amino acid sequences.

[0029] In the present invention, ii) phosphotransacetylase and lactate dehydrogenase may be polypeptides derived from microorganisms, and, for example, may be endogenous polypeptides of the genus Bacteroides strain of the present invention, and specifically B. thetaiotaomicron It may be an intrinsic polypeptide.

[0030] The strain of the present invention may include any one or two polypeptides selected from the polypeptides, or any one or two polynucleotides encoding them. For the purposes of the present invention, the strain of the present invention may have both phosphotransacetylase and lactate dehydrogenase activities weakened, or all polynucleotides encoding them deleted.

[0032] The phosphotransacetylase of the present invention may be a polypeptide of the acetate biosynthetic pathway. Additionally, the lactate dehydrogenase of the present invention may be a polypeptide of the lactate biosynthetic pathway.

[0033] Specifically, the phosphotransacetylase of the present invention is a phosphate acetyltransferase or pta (BT3692) and lactate dehydrogenase are ldhD It can be used interchangeably with (BT1575).

[0034] The amino acid sequences of the above-mentioned phosphotransacetylase and lactate dehydrogenase can be obtained from known databases such as NCBI’s GenBank and UniProtKB. Specifically, the sequences of phosphotransacetylase can be obtained from Q8A1G8 (UniProtKB) and the sequence of lactate dehydrogenase can be obtained from Q8A7E9 (UniProtKB).

[0035] More specifically, the phosphotransacetylase or lactate dehydrogenase may each include the amino acid sequence of SEQ ID NO. 17 or SEQ ID NO. 19. Specifically, the phosphotransacetylase of the present invention may have the amino acid sequence of SEQ ID NO. 17, and the lactate dehydrogenase may have the amino acid sequence of SEQ ID NO. 19, or may be composed of the amino acid sequences said therein.

[0037] In the present application, the amino acid sequence of SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9, SEQ ID NO. 11, SEQ ID NO. 13, SEQ ID NO. 15, SEQ ID NO. 17, or SEQ ID NO. 19 may include an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more of homology or identity with the amino acid sequence described as SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9, SEQ ID NO. 11, SEQ ID NO. 13, SEQ ID NO. 15, SEQ ID NO. 17, or SEQ ID NO. 19. In addition, it is obvious that if an amino acid sequence has such homology or identity and exhibits efficacy corresponding to a protein comprising the amino acid sequence of SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9, SEQ ID NO. 11, SEQ ID NO. 13, SEQ ID NO. 15, SEQ ID NO. 17, or SEQ ID NO. 19, a protein having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted, or added is also included within the scope of the present application.

[0038] For example, this includes cases where there are sequence additions or deletions, naturally occurring mutations, silent mutations, or conservative substitutions that do not alter the function of the protein of the present application at the N-terminus, C-terminus, and / or within the above amino acid sequence.

[0039] The aforementioned "conservative substitution" refers to the substitution of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions can generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions have little to no effect on the activity of a protein or polypeptide.

[0041] In this application, the terms 'homology' or 'identity' refer to the degree of similarity between two given amino acid sequences or base sequences and may be expressed as a percentage. The terms homology and identity may often be used interchangeably.

[0042] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard arrangement algorithms, and a default gap penalty established by the program used may be utilized. Practically, homologous or identical sequences can generally be hybridized with the entire sequence or a part thereof under moderate or high stringent conditions. It is evident that hybridization also includes hybridization with polynucleotides containing common codons or codons that account for codon degeneracy.

[0043] Whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity can be determined using a known computer algorithm, such as the “FASTA” program, using default parameters as in, for example, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, it can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] (Including Academic Press, San Diego, 1994, and [CARILLO ET AL / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST from the National Biotechnology Information Database Center or ClustalW.

[0044] The homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information using a GAP computer program, such as that described in, for example, Smith and Waterman, Adv. Appl. Math (1981) 2:482, or Needleman et al. (1970), J Mol Biol. 48:443. In summary, a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). The default parameters for a GAP program are (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), or Gribskov et al. (1986) Nucl. Acids Res. 14: A weighted comparison matrix of 6745 (or an EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0046] In the present invention, the term "polynucleotide" refers to a polymer of nucleotides in which nucleotide monomers are linked together in a long chain by covalent bonds, such as a DNA or RNA strand of a certain length or longer, and more specifically, a polynucleotide fragment encoding the protein.

[0048] The polynucleotide encoding acetyl-CoA acetyltransferase, 3-hydroxybutyryl-CoA dehydrogenase, butyryl-CoA dehydrogenase, electron transfer flavoid protein subunit beta, electron transfer flavoid protein subunit alpha, 3-hydroxybutyryl-CoA dehydrogenase, phosphate butyryltransferase and butyrate kinase of the present invention may include a nucleotide sequence encoding an amino acid sequence described as SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9, SEQ ID NO. 11, SEQ ID NO. 13, or SEQ ID NO. 15.

[0049] As an example of the present invention, each gene encoding the acetyl-CoA acetyltransferase, 3-hydroxybutyryl-CoA dehydrogenase, butyryl-CoA dehydrogenase, electron transfer flavoid protein subunit beta, electron transfer flavoid protein subunit alpha, 3-hydroxybutyryl-CoA dehydrogenase, phosphate butyryltransferase, and butyrate kinase, i.e., thl , crt , bcd , etfB , etfA , hbd , ptb and book Each gene may comprise the polynucleotide sequence of SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 10, SEQ ID NO. 12, SEQ ID NO. 14, or SEQ ID NO. 16. Specifically, the present invention thl The gene encoding is the polynucleotide sequence of SEQ ID NO. 2, crt The gene encoding is the polynucleotide sequence of SEQ ID No. 4, bcd The gene encoding is the polynucleotide sequence of SEQ ID No. 6, etfB The gene encoding is the polynucleotide sequence of SEQ ID No. 8, etfA The gene encoding is the polynucleotide sequence of SEQ ID NO. 10, hbd The gene encoding is the polynucleotide sequence of SEQ ID NO. 12, ptbThe gene encoding is the polynucleotide sequence of SEQ ID NO. 14, book The gene encoding for may each include, have, or be composed of the polynucleotide sequence of SEQ ID NO. 16, or may essentially be composed of the said polynucleotide sequence.

[0051] The polynucleotide encoding the phosphotransacetylase and lactate dehydrogenase of the present invention may include a base sequence encoding the amino acid sequence described in SEQ ID NO. 17 or SEQ ID NO. 19.

[0052] As an example of the present invention, each gene encoding the phosphotransacetylase and lactate dehydrogenase, i.e., pta and ldhD The gene may each include the polynucleotide sequence of SEQ ID NO. 18 or SEQ ID NO. 20. Specifically, the present invention pta The gene encoding is the polynucleotide sequence of SEQ ID NO. 18, ldhD The gene encoding for may include, have, or be composed of the polynucleotide sequence of SEQ ID NO. 20, or may essentially be composed of the said polynucleotide sequence.

[0054] The polynucleotide of the present invention may have various modifications made to its coding region within a range that does not alter the amino acid sequence of the protein of the present invention, taking into account the degeneracy of codons or codons preferred by the organism intended to express the protein of the present invention. Specifically, the polynucleotide of the present invention has or includes a nucleotide sequence having homology or identity of 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and 99% or more with respect to the sequence of SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 10, SEQ ID NO. 12, SEQ ID NO. 14, SEQ ID NO. 16, SEQ ID NO. 18 or SEQ ID NO. 20, or having homology or identity of 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, and 95% or more. It may consist of or essentially consist of nucleotide sequences that are 96% or more, 97% or more, 98% or more, and 99% or more, but is not limited thereto. For example, the polynucleotide of the present invention may be codon-optimized, but is not limited thereto. For example, the polynucleotide of the present invention may have, include, or be composed of the nucleotide sequences of SEQ ID NOs 21 to 24.

[0055] In addition, the polynucleotide of the present invention may include, without limitation, probes that can be prepared from known gene sequences, for example, sequences that can be hybridized under stringent conditions with a sequence complementary to all or part of the polynucleotide sequence of the present invention. The "stringent condition" means a condition that enables specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, conditions may be listed in which polynucleotides with high homology or identity are hybridized with each other, with homology or identity of 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more, and polynucleotides with lower homology or identity are not hybridized with each other, or conditions in which washing is performed once, specifically two to three times, at a salt concentration and temperature equivalent to the washing conditions of conventional southern hybridization, such as 60°C, 1 χSSC, 0.1% SDS, specifically 60°C, 0.1 χSSC, 0.1% SDS, more specifically 68°C, 0.1 χSSC, 0.1% SDS.

[0056] Hybridization requires that two nucleic acids have complementary sequences, even though a mismatch between bases may be possible depending on the degree of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, regarding DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Accordingly, the polynucleotides of the present invention may also include isolated nucleic acid fragments that are complementary to the entire sequence, as well as substantially similar nucleic acid sequences.

[0057] Specifically, a polynucleotide having homology or identity with the polynucleotide of the present invention can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. Additionally, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and can be appropriately adjusted by a person skilled in the art according to the purpose.

[0058] The appropriate strictness for hybridizing the above polynucleotides depends on the length and degree of complementarity of the polynucleotides, and the variables are well known in the art (e.g., J. Sambrook et al., i.e.).

[0060] Any one or more polypeptides selected from the group consisting of acetyl-CoA acetyltransferase, 3-hydroxybutyryl-CoA dehydrogenase, butyryl-CoA dehydrogenase, electron transfer flavoid protein subunit beta, electron transfer flavoid protein subunit alpha, 3-hydroxybutyryl-CoA dehydrogenase, phosphate butyryltransferase, butyrate kinase, and combinations thereof, comprising a polynucleotide encoding acetyl-CoA acetyltransferase, 3-hydroxybutyryl-CoA dehydrogenase, butyryl-CoA dehydrogenase, electron transfer flavoid protein subunit beta, electron transfer flavoid protein subunit alpha, 3-hydroxybutyryl-CoA dehydrogenase, phosphate butyryltransferase, and / or butyrate kinase. in other words, thl , crt , bcd , etfB , etfA , hbd , ptb and / or book It may have been introduced through a vector containing a gene.

[0061] The vector of the present invention may comprise a DNA product comprising a base sequence of a polynucleotide encoding said target polypeptide, which is operably linked to a suitable expression control region (or expression control sequence) so as to enable the expression of said target polypeptide within a suitable host. The expression control region may comprise a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence coding for a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After being transformed into a suitable host cell, the vector may replicate or function independently of the host genome and may be integrated into the genome itself.

[0062] The vector used in the present invention is not particularly limited, and any vector known in the art may be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and RSF-based, P15A-based, pDZ-based, pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors may be used as plasmid vectors. Specifically, vectors such as pMM710, pFD340, pNBU2, pLGB13, pDZ, pDC, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, and pCC1BAC can be used.

[0063] For example, a polynucleotide encoding a target polypeptide can be inserted into a chromosome using a vector for intracellular chromosome insertion. The insertion of said polynucleotide into the chromosome may be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker may be additionally included to confirm whether the chromosome insertion has occurred. The selection marker is intended to select cells transformed by the vector, that is, to confirm whether the target nucleic acid molecule has been inserted, and markers conferring selectable phenotypes such as drug resistance, nutritional requirements, resistance to cytotoxic agents, or expression of surface polypeptides may be used. Since only cells expressing the selection marker survive or exhibit other phenotypes in an environment treated with a selective agent, the transformed cells can be selected.

[0064] In the present invention, the term "transformation" means introducing a vector containing a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoded by said polynucleotide can be expressed within the host cell. The transformed polynucleotide may include both inserted into and located within the chromosomes of the host cell and extrachromosomally, as long as it can be expressed within the host cell. Additionally, said polynucleotide includes DNA and / or RNA encoding the target polypeptide. said polynucleotide may be introduced in any form as long as it can be introduced into and expressed within the host cell. For example, said polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a gene structure containing all the elements necessary for self-expression. said expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal operably linked to said polynucleotide. said expression cassette may be in the form of a self-replicating expression vector. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.

[0065] In addition, the term "operably connected" above means that a promoter sequence and a polynucleotide sequence are functionally connected to initiate and mediate the transcription of a polynucleotide encoding the target protein of the present invention.

[0066] In the present invention, the target protein may be one or more polypeptides selected from acetyl-CoA acetyltransferase, 3-hydroxybutyryl-CoA dehydrogenase, butyryl-CoA dehydrogenase, electron transfer flavoid protein subunit beta, electron transfer flavoid protein subunit alpha, 3-hydroxybutyryl-CoA dehydrogenase, phosphate butyryltransferase, and butyrate kinase.

[0068] In the present invention, the term “strain (or microorganism)” includes both wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification, and may be a microorganism in which a specific mechanism is weakened or strengthened due to causes such as the insertion of external genes or the enhancement or inactivation of the activity of endogenous genes, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein, or product.

[0069] The strain of the present invention comprises i) one or more polypeptides selected from acetyl-CoA acetyltransferase, 3-hydroxybutyryl-CoA dehydrogenase, butyryl-CoA dehydrogenase, electron transfer flavoprotein subunit beta, electron transfer flavoprotein subunit alpha, 3-hydroxybutyryl-CoA dehydrogenase, phosphate butyryltransferase, butyrate kinase, and combinations thereof, a polynucleotide encoding the same, and a vector containing the same, and ii) a strain in which one or more polypeptides selected from phosphotransacetylase, lactate dehydrogenase, and combinations thereof, or a polynucleotide encoding the same, are weakened or deleted, wherein i) acetyl-CoA acetyltransferase, 3-hydroxybutyryl-CoA dehydrogenase, butyryl-CoA dehydrogenase, electron transfer ii) a strain that expresses one or more polypeptides selected from flavoprotein subunit beta, electron transfer flavoprotein subunit alpha, 3-hydroxybutyryl-CoA dehydrogenase, phosphate butyryltransferase, butyrate kinase and combinations thereof, or a polynucleotide encoding the same, or has said polypeptide activity, and ii) a strain modified such that one or more polypeptides selected from phosphotransacetylase, lactate dehydrogenase and combinations thereof, or a polynucleotide encoding the same is weakened or deleted (e.g., a recombinant strain), but is not limited thereto.

[0071] The strain of the present invention may be a strain having the ability to produce butyrate.

[0072] For example, the strain of the present invention is a natural wild-type microorganism, a microorganism that naturally possesses acetyl-CoA acetyltransferase, 3-hydroxybutyryl-CoA dehydrogenase, butyryl-CoA dehydrogenase, electron transfer flavoid protein subunit beta, electron transfer flavoid protein subunit alpha, 3-hydroxybutyryl-CoA dehydrogenase, phosphate butyryltransferase, or butyrate kinase, or does not possess phosphotransacetylase or lactate dehydrogenase, or has butyrate-producing ability, or acetyl-CoA acetyltransferase, 3-hydroxybutyryl-CoA dehydrogenase, butyryl-CoA dehydrogenase, electron transfer flavoid protein subunit beta, electron transfer flavoid protein subunit alpha, 3-hydroxybutyryl-CoA A protein of the present invention or a polynucleotide encoding the same (or a vector containing said polynucleotide) is introduced into a parent strain that does not have a dehydrogenase, phosphate butyryltransferase, or butyrate kinase, or has phosphotransacetylase or lactate dehydrogenase, or has no butyrate production ability, and one or more polypeptides selected from phosphotransacetylase, lactate dehydrogenase, and combinations thereof, or a polynucleotide encoding the same, are weakened or deleted, and the microorganism may be endowed with butyrate production ability, but is not limited thereto.

[0073] The recombinant strain endowed with butyrate production capability may be a strain with enhanced butyrate production capability compared to a natural wild-type microorganism or an unmodified microorganism (i.e., i) not containing any one or more polypeptides selected from acetyl-CoA acetyltransferase, 3-hydroxybutyryl-CoA dehydrogenase, butyryl-CoA dehydrogenase, electron transfer flavoid protein subunit beta, electron transfer flavoid protein subunit alpha, 3-hydroxybutyryl-CoA dehydrogenase, phosphate butyryltransferase, butyrate kinase and combinations thereof, polynucleotides encoding the same, and vectors containing the same, and / or ii) a microorganism in which any one or more polypeptides selected from phosphotransacetylase, lactate dehydrogenase and combinations thereof, or polynucleotides encoding the same are not weakened or deleted).

[0074] In the present invention, the term "non-mutated microorganism" does not exclude strains including variant strains that may naturally occur in microorganisms, and may refer to wild-type strains or natural-type strains themselves, or strains prior to genetic mutations caused by natural or artificial factors. For example, the non-mutated microorganism may refer to a strain in which the protein described herein has not been introduced or is prior to being introduced. The term "non-mutated microorganism" may be used interchangeably with "pre-mutation strain," "pre-mutation microorganism," "non-mutated strain," "non-mutated strain," "non-mutated microorganism," or "reference microorganism."

[0076] Modification of part or all of the polynucleotides in the strain of the present invention may be induced by (a) homologous recombination using a vector for chromosome insertion into the microorganism or genome editing using engineered nucleases (e.g., CRISPR-Cas9) and / or (b) treatment by light and / or chemicals such as ultraviolet rays and radiation, but is not limited thereto. The method of modifying part or all of the gene may include methods using DNA recombination technology. For example, deletion of part or all of the gene may be achieved by injecting a nucleotide sequence or vector containing a nucleotide sequence homologous to the target gene into the microorganism to induce homologous recombination. The injected nucleotide sequence or vector may include a dominant selection marker, but is not limited thereto.

[0078] In the present invention, the strain of the present invention may be a strain that produces butyrate with a butyrate titer of 28 mg / L or higher under glucose-limiting conditions (e.g., conditions of culturing in a glucose minimum medium (MM-glc) with glucose added at a final concentration of 0.5%). Additionally, the strain of the present invention may be a strain that produces butyrate with a butyrate titer of 41 mg / L or higher under conditions where glucose is not limited (e.g., conditions of culturing in a BHIS (brain heart infusion-supplemented broth) medium).

[0079] In one embodiment of the present invention, a butyrate biosynthetic pathway is introduced and pta and ldhD Gene deleted The present invention B. thetaiotaomicrion Strain (△ pta △ ldhD The _but strain) exhibited a maximum butyrate titer of approximately 28 ± 1 mg / L in MM-glc medium ( 도 4c , 표 3 ), in BHIS medium mimicking a nutrient-rich gut, the maximum potency and productivity of butyrate increased by 3.4-fold and 4.9-fold, respectively ( 도 4d , 표 3 ), showed a maximum butyrate potency of 41 ± 1 mg / L.

[0080] On the other hand, the wild type in which only the butyrate biosynthetic pathway was introduced B. thetaiotaomicrion The strain failed to produce butyrate under MM-glc conditions, so the wild type B. thetaiotaomicrion It was confirmed that even if the butyrate biosynthetic pathway is introduced, butyrate is not produced under glucose-limiting conditions.

[0081] Therefore, the present invention relates to the conventional wild type B. thetaiotaomicrion To address the problem where butyrate is not produced under glucose-limiting conditions when only the butyrate biosynthetic pathway is introduced, wild-type B. thetaiotaomicrion Introduce the butyrate biosynthetic pathway and additionally pta and ldhD It is significant that this is the first time it has been confirmed that deleting a gene can significantly increase butyrate production capacity under glucose-limiting conditions.

[0083] Another aspect of the present invention provides a method for producing butyrate, comprising: i) culturing a strain of the present invention in a medium; and ii) recovering butyrate from the cultured medium and strain.

[0084] The terms used herein are as described above.

[0086] In the present invention, the term "culture" means growing the strain of the present invention under appropriately controlled environmental conditions. The culture process of the present invention may be carried out according to suitable media and culture conditions known in the art. Such a culture process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culture may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0087] In the present invention, the term "medium" refers to a substance mixed with nutrients as the main component required to culture the strain of the present invention, and supplies nutrients and growth factors, including water, which is indispensable for survival and growth. Specifically, the medium and other culture conditions used for culturing the strain of the present invention may be any medium used for culturing conventional microorganisms without special limitations; however, the strain of the present invention may be cultured under aerobic conditions while controlling the temperature, pH, etc., in a conventional medium containing a suitable carbon source, nitrogen source, phosphorus, inorganic compounds, amino acids, and / or vitamins.

[0088] In the present invention, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvate, lactic acid, citric acid, etc.; and amino acids such as glutamic acid, methionine, lysine, etc. Additionally, natural organic nutrient sources such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane residue, and corn steep liquid may be used. Specifically, carbohydrates such as glucose and sterilized pre-treated molasses (i.e., molasses converted into reducing sugars) may be used, and other carbon sources in appropriate amounts may be used in various ways without limitation. These carbon sources may be used individually or in combination of two or more types, but are not limited thereto.

[0089] The above nitrogen sources may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; and organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc., peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquid, casein hydrolysate, fish or its decomposition products, defatted soybean cake or its decomposition products, etc. These nitrogen sources may be used alone or in combination of two or more types, but are not limited thereto.

[0090] The above ingredients may include monopotassium phosphate, dipotassium phosphate, or corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc., and may also include amino acids, vitamins, and / or suitable precursors. These components or precursors may be added to the culture medium in a batch or continuous manner. However, they are not limited thereto.

[0091] During the cultivation of the strain of the present invention, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc., may be added to the medium in an appropriate manner to adjust the pH of the medium. Additionally, during cultivation, an antifoaming agent such as a fatty acid polyglycol ester may be used to suppress the formation of bubbles. Furthermore, to maintain an aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection to maintain an anaerobic and microaerobic state, but is not limited thereto.

[0092] In the culture of the present invention, the culture temperature can be maintained at 20 to 40°C, specifically 25 to 37°C, and culture can be performed for about 10 to 160 hours, but is not limited thereto.

[0093] The butyrate produced by the culture of the present invention may be secreted into the culture medium or remain within the cell.

[0095] The butyrate production method of the present invention may additionally include, for example, the step of preparing a strain of the present invention, the step of preparing a medium for culturing said strain, or a combination thereof (in any order), prior to the culturing step.

[0096] The above method can recover butyrate from the cultured medium or strain.

[0097] The above recovery may involve collecting the desired IMP using a suitable method known in the art according to the culture method of the microorganism of the present invention, such as a batch, continuous, or fed-batch culture method. For example, various chromatographs such as centrifugation, filtration, treatment with a crystallizing protein precipitating agent (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC, or a combination thereof may be used, and the desired butyrate may be recovered from the culture medium or microorganism using a suitable method known in the art.

[0098] In addition, the butyrate production method of the present invention may additionally include a purification step. The purification may be performed using a suitable method known in the art. In one example, where the butyrate production method of the present invention includes both a recovery step and a purification step, the recovery step and the purification step may be performed continuously or discontinuously regardless of the order, or simultaneously or integrated into a single step, but are not limited thereto.

[0100] Another aspect of the present invention provides a composition for producing butyrate comprising the strain of the present invention and a culture medium thereof.

[0101] The terms used herein are as described above.

[0103] The above composition may include the strain of the present invention and a culture medium thereof, and may additionally include, without limitation, a composition capable of increasing the butyrate production of the strain. Effects of the invention

[0105] The strain according to the present invention is introduced with an exogenous butyrate biosynthetic pathway that does not produce butyrate under glucose-restricted conditions. B. thetaiotaomicron Exhibiting a significant butyrate production capacity compared to strains, it can be applied not only for butyrate production but also as a microbial therapeutic agent. Brief explanation of the drawing

[0107] Fig. 1 shows (a) Bacteroides tetaiothaomicron ( Bacteroides thetaiotaomicron This is a diagram showing the butyrate biosynthetic pathway introduced into ). Abbreviations Ac-AcoA: Acetyl-CoA, AAc-CoA: Acetoacetyl-CoA, 3-HB_CoA: 3-hydroxybutanoyl-CoA, Crt-CoA: Crotonyl-CoA, But-CoA: Butyryl-CoA, butyryl-P: Butyryl phosphate, But: Butyrate. (b) Wild type B. thetaiotaomicron Schematic diagram of a vector comprising a gene and a promoter for expressing the butyrate biosynthetic pathway and comprising the same B. thetaiotaomicrionThis is a schematic diagram of the genome of (WT_but). A synthetic promoter (p_BfP1E6) was used for the expression of the butyrate biosynthetic pathway. (cd) This is a figure showing the butyrate production profile in BHIS (brain heart infusion-supplemented broth) medium (c) and minimal medium (MM-glc medium) supplemented with 0.5% (w / v) glucose (d). Figure 2 shows through subsequent PCR screening B. thetaiotaomicron In the genome pta This is the result of confirming the outcome within the frame. Figure 3 shows the wild type under MM-glc culture conditions. B. thetaiotaomicrion , △ ldhD , △ pta and △ pta △ ldhD This figure shows the growth profile and specific growth rate of the strain. Error bars represent the standard deviation. **** : P ≤ 0.0001, *** : P ≤ 0.001, ns: not significant. Figure 4 shows (a) wild type under MMglc culture conditions. B. thetaiotaomicrion , △ ldhD , △ pta and △ pta △ ldhD This is a figure showing the metabolite profile of the strain. Error bars represent the standard deviation. (b) △ pta △ ldhD to the strain Schematic diagram of a vector comprising a gene and a promoter for expressing the butyrate biosynthetic pathway and the same B. thetaiotaomicrion (△ pta △ ldhD This is a schematic diagram of the genome of _but). (c) Figures showing the growth and butyrate production profiles of WT_but and △pta△ldhD_but in (c) MM-glc medium and (d) BHIS medium. Error bars represent the standard deviation. Specific details for implementing the invention

[0108] Hereinafter, the present invention will be described in detail with reference to examples to aid in understanding. However, the following examples are merely illustrative of the content of the present invention and the scope of the present invention is not limited to the following examples. The examples of the present invention are provided to more completely explain the present invention to those with average knowledge in the art.

[0110] 실시예 1. slightly less than 100 sq. m

[0111] Bacteroides tetaiothaomicron, a human intestinal symbiont ( Bacteroides thetaiotaomicron In order to confer butyrate production ability to ) a foreign butyrate biosynthetic pathway using acetyl-CoA as a precursor was introduced to induce heterogeneous expression.

[0112] First, the wild type B. thetaiotaomicron Clostridium acetobutylicum ( Clostridium acetobutylicum ) of ATCC 824 thl (acetyl-CoA acetyltransferase), crt (3-hydroxybutyryl-coA dehydratase), bcd (butyryl-CoA dehydrogenase), etfB (electron transfer flavoprotein subunit beta), etfA (electron transfer flavoprotein subunit alpha), hbd (3-hydroxybutyryl-CoA dehydrogenase), ptb (phosphate butyryltransferase) and bookA six-step butyrate biosynthetic pathway using acetyl-CoA as a precursor composed of (butyrate kinase) 도 1a To introduce ), a vector was created.

[0113] Specifically, each gene fragment was cloned into the pMM710 and pFD340 backbones after codon optimization (SEQ NOs. 21 to 24) and positioned under the control of the wild-type promoter pBT1311 (Mimee et al., Cell Syst. 1, 62-71., 2015) and the synthetic promoter P_BfP1E6 (Whitaker et al., Cell 169, 538-546., 2017). Schematic diagrams of the vectors containing each gene and promoter and the vectors containing them B. thetaiotaomicrion The genome schematic is 도 1b As illustrated in [figure].

[0114] The primer sequences used here are as shown in Table 1 below.

[0115] 서열번호 서열명 서열 25 From 1 Fwd Primer GCAtctagatgatctggaagaagcaatgaaag 26 From 1 Primary Rev ataGCGGCCGCttaGGGCCCagtcCTCGAGtgaGTCGACACCTACCGATTCTTAAAACCTTCT 27 From 2 Fwd Primary GAATCGGTAGGTCGACGAAATAAAGAC 28 From 2 Primary Dreams ataGCGGCCGCTTCTCGAGTTAAAATAATGC 29 From 3 Fwd Primer TTAACTCGAGAAAAGGATCTATTA 30 From 3 Primary Dreams ttacgatcagtcGGGCCcTTATTTGGAATAATC 31 From 4 Fwd Primary TATTCCAAATAAgGGCCCgactgatcgtaatc 32 From 4 Primary Dreams tGCGGCCGCggaccaaaacgaaaaaggcc 33 CAB1_BB_Infu_F tctttattcGtgaGTCGACACCTACCGATTCT 34 CAB1_BB_Infu_R TTATATTTAAaCTCGAGgactGGGCCCtaa 35 CAB2_Infu_frag_F gtcgactcacGAAATAAAAGACATATAAAAGAAAA 36 CAB2_Infu_frag_R gtcCTCGAGtTTAAATAATGCTCCTCCTTCAG 37 NBU2_Backbone_F GCAtctagatacttgtgcctgttctatttccg 38 NBU2_Backbone_R ataGCGGCCGCggtggaggggaattcccat

[0117] The generated vector is wild type B. thetaiotaomicrionButyrate production capacity was analyzed by transforming VPI-5482 (ATCC 29148) and culturing it. The transformed strain was sterilized by filtering using a Minisart® 0.2μm syringe filter (Sartorius, Gottingen, Germany) and autoclaving immediately before inoculation in BHIS (brain heart infusion-supplemented broth) medium supplemented with 5% fibrinolytic sheep blood (MB cells) containing 37g BHI powder (BD Bacto, Detroit, MI), 5g yeast extract (BD Bacto), 0.5g / L L-cysteine ​​hydrochloride monohydrate dissolved in dH2O (TCI, Tokyo, Japan), 0.2mM L-histidine, 1.9μM hemin solution dissolved in 1N NaOH (pH 8), and 1μg / mL menadione dissolved in anhydrous ethanol, L-cysteine ​​hydrochloride monohydrate, L-histidine-hemin solution, and menadione. Cultures were performed in a minimum medium (MM-glc) prepared by adding glucose to the medium or with glucose added to a final concentration of 0.5% (containing 100 mM KH2PO4, 15 mM NaCl, 8.5 mM (NH4)2SO4, 0.5 g / L L-cysteine ​​hydrochloride monohydrate, 0.2 mM L-histidine, 1.9 μM hemin, 50 μM CaCl2, 100 μM MgCl2, 1.4 μL FeSO4·7H2O, 1 μg / mL menadione, and 5 ng / mL vitamin B12 per liter, with glucose added to a final concentration of 0.5%) (Martens et al., Cell Host Microbe 4, 447-457., 2008), specifically in an N2 / CO2 (90:10) medium at a gauge pressure of 80 kPa. It was performed in a 150 mL serum bottle containing 100 mL of gas-purged culture medium.

[0118] Strain growth profiling was performed on a 48-well plate at 37°C with shaking (206 rpm double orbit) for 24 hours using a plate reader (BioTek, Winooski, VT), and absorbance at OD600 nm was measured at 10-minute intervals.

[0119] To quantify butyrate produced by the strain, cultured strains were sampled at 1-2 hour intervals, and up to 1 mL of the sample was filtered through a Minisart® 0.2 μm syringe filter (Sartorius) to obtain a cell-free supernatant. Each metabolite of the culture supernatant was analyzed using high-pressure liquid chromatography equipped with an RI detector (Waters, Milford, MA) and a MetaCarb 87H Organic Acids Column (Agilent, Waldbronn, Germany). The column was eluted with 6.57 mM H2SO4 at a flow rate of 0.6 mL / min at 37°C.

[0121] As a result, the wild-type strain with the butyrate biosynthetic pathway introduced produced butyrate at a final concentration of 12 mg / L in BHIS medium, but did not produce butyrate under glucose-limiting conditions (MM-glc medium). 도 1c-d ).

[0122] Accordingly, wild type B. thetaiotaomicrion It was confirmed that even if the butyrate biosynthetic pathway is introduced, butyrate is not produced under glucose-limiting conditions.

[0124] 실시예 2. 내재 유전자 결실 및 외래 부티레이트 생합성 경로 도입 균주 작 작

[0125] Inactivating certain non-essential innate pathways to maximize the production of target products in strains is one of the most common approaches. Accordingly, B. thetaiotaomicron We sought to enhance the production of heterogeneous butyrate through the knockout of cell precursors or organic acid (acetate, lactate, succinate, etc.) fermentation pathways that share redox cofactors required for butyrate synthesis.

[0126] First, catalyzing the first conversion of acetyl-CoA to acetate as a deletion target to maximize the production of a target product while minimizing inhibition of cell growth. pta Catalyzing the production of (phosphotransacetylase, BT3692) and D-lactate ldhD Two genes of (lactate dehydrogenase, BT1575) were selected, and the said genes were knocked out using site-specific double crossing mediated by NBU2 integrase with pNBU2 containing the erythromycin selection marker ermG (Garcia-Bayona and Comstock, 2019), △ ldhD , △ pta and △ pta △ ldhD Each strain was prepared.

[0127] Specifically, pta and ldhD 1.1 and 1.2kbp adjacent to the top and bottom of B. thetaiotaomicrion Genomic regions were PCR amplified and individually cloned into pLGB13. For gene knockout, homologous arms adjacent to both ends of the target gene were introduced into the pLGB13 backbone. In addition, Bacteroides ovatus of pLGB30 ( Bacteroides ovatus ) derived tetracycline resistance tetQ gene (Garcia-Bayona and Comstock, mBio 10., 2019) pta It was placed between homologous arms and used for screening tetracycline resistance.

[0128] The primer sequences used here are as shown in Table 2 below.

[0129] 서열번호 서열명 서열 39 Lac_1_HA_F tcccgggcagcagcatccggaaat 40 Lac_1_HA_R agtcaggtaaaggttacgtaaaaacagggtggttttgttt 41 Lac_2_HA_F accctgtttttacgtaacctttacctgacttcccttgt 42 Lac_2_HA_R GTCGACAACTTTCGCGGCAGTACCTT 43 Lac_con_F CCAGCCAGGTATTCGTGTGT 44 Lac_con_R AGGAAGCGATCGTGTAACCG 45 Ace_1_HA_F ACCCGGGTGTCCATGGCAGTGGAAGTG 46 Ace_1_HA_R gccattcggcaaagtatttgtaatttgcgctgcaaaagta 47 Ace_2_HA_F gcgcaaattacaaatactttgccgaatggcgaaaa 48 Ace_2_HA_R AGTCGACcgacttcatgataagccgcc 49 pAceKO_F agcaaaaatgtgccgaatggcgaaaagaaag 50 pAceKO_R ggagcggtcatttggctgtttggctttggg 51 pLGB30_tetQ_F2 aacagccaaatgaccgctccattattttg 52 pLGB30_tetQ_R2 ccattcggcacatttttgctcaacaattgct 53 Ace_con_F tcggcggtcacttttcatgg 54 Ace_con_R CCGATCTGCCACTTCCTTACA

[0131] The generated vector is wild type B. thetaiotaomicrionSelected on TYG (Tryptone Yeast Extract Agar) agar plates after transformation into VPI-5482 (ATCC 29148) B. thetaiotaomicron Colonies were transferred to liquid BHIS medium containing 25 μg / mL erythromycin and anaerobically incubated at 37°C. Erythromycin-positive cultures were serially diluted to 100 cfu / mL in non-selective liquid BHIS medium and statically incubated at 37°C for 12 hours. The strains were cultured on TYG agar and 100 ng / mL aTC inducer to screen for double-crossover resolvents. Through subsequent PCR screening B. thetaiotaomicron In the genome pta The results within the frame were confirmed ( Fig. 2 ).

[0132] To evaluate the effect of each gene knockout on strain growth, the growth of wild-type and each knockout variant strain was checked in MM-glc medium using the same strain growth profiling method as in Example 1 above.

[0134] As a result, strain △ ldhD While the change in the growth rate of was found to be negligible compared to the wild type, △ pta and △ pta △ ldhD strain growth was significantly reduced ( Fig. 3 ).

[0136] Next, to verify whether the fermentation pathway was functionally inactivated by analyzing the metabolite profile in the culture medium of the knockout mutant strain grown under MM-glc conditions, acetate, succinate, and D-lactate produced by the strain were quantified using the same method as in Example 1, but by eluting at a column temperature of 50°C.

[0138] in result, ldhD The final result of the fruition D-lactate titer decreased twofold compared to the wild type (0.04 ± 0.00 g / L and △ in the wild type ldhD (at 0.02 ± 0.00 g / L) Fig. 4a ).

[0139] pta The final acetate titer resulting from the deletion of [the substance] decreased by nearly three times compared to the wild type (1.30 ± 0.05 g / L in the wild type and △ pta (0.45 ± 0.02 g / L), decreased slightly more in double knockout strains (△ pta △l dhD (at 0.39 ± 0.01 g / L).

[0140] In addition, the final concentration of succinate is strain △ pta and △ pta △ ldhD It increased significantly in, but △ ldhD In this case, it was maintained at a level similar to the wild type.

[0141] Accordingly, the above strains pta and ldhD The fermentation pathway is functionally inactivated, so △ ldhD , △ pta and △ pta △ ldhD It was confirmed that the strain was produced.

[0143] Example 3. Analysis of butyrate production capacity of strains with endogenous gene deletion and introduced exogenous butyrate biosynthetic pathway

[0144] The vector containing the butyrate biosynthetic pathway prepared in Example 1 above is used with the double knockout mutant strain △ prepared in Example 2 above. pta △ ldhD Introduced to △ pta △ ldhD A _but strain was constructed. A schematic diagram of a vector containing each gene and promoter and containing the same B. thetaiotaomicrion The genome schematic is Fig. 4b As illustrated in [figure].

[0145] Strain growth profiling and butyrate quantification produced by the strain were analyzed using the same method as in Example 1 above.

[0147] As a result, the wild-type strain with the introduced butyrate biosynthetic pathway failed to produce butyrate under MM-glc conditions, whereas △ pta △ ldhD The _but strain exhibited a maximum butyrate titer of approximately 28 ± 1 mg / L ( Fig. 4c , Table 3 ).

[0148] In BHIS medium mimicking a nutrient-rich gut, the maximum potency and productivity of butyrate increased by 3.4-fold and 4.9-fold, respectively ( Fig. 4d , Table 3 ), showed a maximum butyrate potency of 41 ± 1 mg / L.

[0149] Media Strain Titer (mg / L) Productivity (mg / L / h) Calculated Flux (mmol / gDW / hr) MM_Glc WT 0 0 0 Double KO(△ pta △ ldhD _but) 28 ± 1 2.8 ± 1.0 0.03 ± 0.01 BHIS WT 12 ± 0 1.4 ± 0 0.02 ± 0.00 Double KO(△ pta △ ldhD _but) 41 ± 1 6.8 ± 0.2 0.11 ± 0.02

[0151] From the results of the above examples, a double knockout mutant strain (△) into which the exogenous butyrate biosynthetic pathway according to the present invention has been introduced pta △ ldhD ) B. thetaiotaomicron The strain is an introduced exogenous butyrate biosynthetic pathway that does not produce butyrate under glucose-limiting conditions. B. thetaiotaomicron It showed a significant butyrate production ability compared to strains, and produced butyrate with a maximum butyrate potency of 41 ± 1 mg / L in nutrient-rich media, so it can be applied not only for butyrate production but also as a microbial therapeutic agent.

[0153] From the foregoing description, those skilled in the art to which the present invention pertains will understand that the present invention may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.

Claims

Claim 1 i) Acetyl-CoA acetyltransferase, 3-hydroxybutyryl-CoA dehydratase, butyryl-CoA dehydrogenase, electron transfer flavoprotein subunit beta, electron transfer flavoprotein subunit alpha, 3-hydroxybutyryl-CoA dehydrogenase, phosphate butyryltransferase, and butyrate kinase; or comprising a polynucleotide encoding the same, ii) phosphotransacetylase, and lactate dehydrogenase; or Bacteroides thetaiothaomicron producing butyrate, in which the polynucleotide encoding the same is weakened or deleted ( Bacteroides thetaiotaomicron ) strain, wherein the above phosphotransacetylase and lactate dehydrogenase are endogenous polypeptides of the Bacteroides thetaiothaomicron strain, and the polynucleotide of i) is a Clostridium genus ( Clostridium A strain derived from sp.) and said strain that produces butyrate when cultured in a medium containing glucose. Claim 2 delete Claim 3 In claim 1, the Clostridium genus strain is Clostridium acetobutylicum ( Clostridium acetobutylicum A strain that is ) Claim 4 delete Claim 5 delete Claim 6 delete Claim 7 a) a step of culturing the strain of claim 1 or 3 in a medium containing glucose; and b) a step of recovering butyrate from the cultured medium and strain; a method for producing butyrate.

Citation Information

Patent Citations

  • Microorganism producing 4-hydroxybutyrate and method for producing 4-hydroxybutyrate in anaerobic condition using same

    KR1020150022530A

  • Engineered microorganisms for producing n-butanol and related methods

    US20090155869A1