Recombinant Escherichia coli strain for production of P(3HP-co-3HB) with high yield and method for producing biodegradable P(3HP-co-3HB) using the same
Patent Information
- Application Number
- KR1020230098722
- Authority / Receiving Office
- KR · KR
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2023-07-28
- Publication Date
- 2026-09-29
- Estimated Expiration
- 2043-07-28
Smart Images

Figure 112023083454205-PAT00010_ABST
Abstract
Description
Technology Field
[0001] The present invention relates to a recombinant Escherichia coli strain that produces poly(3-hydroxypropionate-co-3-hydroxybutyrate) [P(3HP-co-3HB)] with high efficiency and a method for producing biodegradable P(3HP-co-3HB) using the same. Background Technology
[0002] Globally, synthetic polymers are mass-produced and consumed as indispensable necessities. They are primarily derived from fossil fuels and pose serious environmental and human health problems due to carbon emissions and recalcitrant nature. As an alternative, bio-based polymers with biological origin, low toxicity, and high biodegradability have been proposed. However, the global bioplastics market is only 0.2% of the petroleum-based plastics market. Major obstacles to commercialization are expensive carbon raw materials, low production efficiency, and high manufacturing costs. To address this issue, metabolic engineering approaches using various host microorganisms and inexpensive carbon raw materials have been explored.
[0003] Among bio-based polymers, polyhydroxyalkanoates (PHAs) have garnered significant attention due to their structural diversity and excellent biodegradability. Of these, poly(3-hydroxybutyrate) [poly(3HB)], synthesized by numerous bacteria, is the easiest to produce and the subject of the most research. Unfortunately, poly(3HB) is a highly crystalline and brittle polymer with a low elongation-to-break factor, making it unsuitable for various applications. Consequently, research has been conducted to develop copolymers with improved physical and mechanical properties. Poly(3-hydroxybutyrate-co-3-hydroxyvalerate) [poly(3HB-co-3HV)], poly(3-hydroxybutyrate-co-4-hydroxyvalerate) [poly(3HB-co-4HV)], poly(3-hydroxybutyrate-co-4-hydroxybutyrate) [poly(3HB-co-4HB)], and poly(3-hydroxybutyrate-co-3-hydroxypropionate) [poly(3HB-co-3HP)] are important copolymer polymers.
[0004] In terms of price, bio-PHAs are generally inferior to petrochemical-derived polymers, but some polymers, such as poly(3HB-co-3HV), poly(3HB-co-4HB), and poly(3HB-co-3HH), have been commercialized with significant competitiveness. Poly(3HB-co-3HV) was the first to be commercialized by ICI in 1983 under the trade name Biopol. This copolymer accumulates when glucose and propionic acid are supplied in batch cultures where phosphate is depleted by Cupriavidus necator. The physical properties of poly(3HB-co-3HV) are similar to those of polyethylene and polypropylene. Recently, poly(3HB-co-4HB) was commercialized by CJ CheilJedang under the name PHAT, and it is known that it is possible to achieve various melting points, crystallinities, and glass transition temperatures (Tg) by controlling the 4HB and 3HB content.
[0005] Poly(3HB-co-3HP), a copolymer of 3-HP and 3-HB, has also attracted much attention due to its excellent properties. It is known that as the 3HP fraction increases from 0 to 100 mol%, the glass transition temperature decreases from -4°C to -19°C. This effect is similarly observed in Poly(3HB-co-3HH) and poly(3HB-co-4HB), in which 3HB is partially replaced by other hydroxyalkanoic acids. The change in melting point exhibits a parabolic shape. The melting point of Poly(3HB) is 177°C. It is known that as the 3HP content increases, the melting point decreases to 44°C up to 67 mol%, and then begins to increase again as the 3HP content is further increased, rising to 77°C at 100 mol% 3HP. Poly(3HB-co-3HH) and poly(3HB-co-4HB) also exhibit similar trends. The enthalpy of melting also shows similar behavior. It first decreases from 97 J / g (0 mol% 3HP) to 2 J / g (43 mol% 3HP), and then increases to 74 J / g (100 mol% 3HP). The degree of thermal decomposition of poly(3HB-co-3HP) increases with fraction. Furthermore, according to previous reports, poly(3HB-co-3HP) with a 3HP content of less than 42 mol% forms only the poly(3HB) type crystal structure, whereas copolymers with a 3HP content of 56 mol% or more form only the poly(3HP) type. At a 3HP content of 48.8 mol%, both types of crystals occur.
[0006] Despite its diverse and excellent properties, poly(3HB-co-3HP) has never been produced in large quantities or at high concentrations. This is because its production efficiency is significantly lower compared to 3-HB monopolymers such as P-3HB or 3-HB mixed polymers such as poly(3HB-co-3HH) and poly(3HB-co-4HB). Most research has been conducted at the flask level, and despite significant efforts, the production concentration has not exceeded 10 g / L. Furthermore, there is a problem in that it is very difficult to freely control the content of 3-HB and 3-HP. Prior art literature
[0007] Korean Registered Patent No. 10-2311152 (Registered on Oct. 05, 2021) The problem to be solved
[0008] The objective of the present invention is to provide a genetically modified E. coli strain in which the gene of the pathway required for the biosynthesis of P(3HP-co-3HB) is cloned, and additionally, the phasin protein required to improve the biosynthesization efficiency of P(3HP-co-3HB) is overexpressed.
[0009] In addition, another objective of the present invention is to provide a method for enhancing the production of P(3HP-co-3HB), comprising the step of culturing the recombinant E. coli strain. means of solving the problem
[0010] To achieve the above objective, the present invention relates to a polyhydroxyalkanoates synthase; phaC ) gene, acetyl-CoA-acetyltransferase; phaA ) gene, NADPH-dependent acetoacetyl-CoA reductase; phaB), acyl-CoA synthetase domain of trifunctional propionyl-CoA synthase; acs ) Genes and phasin; phaP1 Provides a recombinant expression vector containing genes in sequence.
[0011] In addition, the present invention provides a recombinant E. coli strain with enhanced P(3HP-co-3HB) production, transformed with the recombinant expression vector.
[0012] In addition, the present invention provides a method for enhancing P(3HP-co-3HB) production, comprising the step of culturing the recombinant E. coli strain. Effects of the invention
[0013] The present invention relates to a recombinant E. coli strain that produces poly(3-hydroxypropionate-co-3-hydroxybutyrate) [P(3HP-co-3HB)] with high efficiency and a method for producing biodegradable P(3HP-co-3HB) using the same. In the present invention, 3-HP was used as a raw material for the first time, and as a result, a P(3HP-co-3HB) composite polymer could be produced with a maximum intracellular content of over 85%. In addition, the 3-HP content in the P(3HP-co-3HB) composite polymer could be easily controlled within the range of 0-90 mol%. Furthermore, it was possible to produce a P(3HP-co-3HB) composite polymer with a content of >100 g / L through the operation of a fed-batch bioreactor. This is the world's best known level to date, and the genetically modified Escherichia coli strain of the present invention can produce P(3HP-co-3HB) composite polymers with various mole fractions at high concentrations, yields, and rates using glucose and 3-HP as substrates. Brief explanation of the drawing
[0014] Figure 1 shows the metabolic pathway for producing the P(3HP-co-3HB) complex polymer. Ca_acs is derived from the Chloroflexus aurantiacus strain and encodes the acyl-CoA synthetase domain of the trifunctional propionyl-CoA synthase enzyme, while Cn_PhaA, Cn_PhaB, and Cn_phaC are derived from the Cupriavidus necator strain and encode acetyl-CoA acetyltransferase, NADPH-dependent acetoacetyl-CoA reductase, and PHA synthase, respectively. Figure 2 shows the recombinant plasmids constructed for the production of P(3HP-co-3HB) copolymer. The basic pathway gene was cloned into C5, and in addition to the basic pathway gene, the phaP1 gene encoding the production of phasin protein was additionally cloned into C6. The C7-C10 plasmids are plasmids in which the UTR was modified to control the expression level of the acs gene. Figure 3 shows the results of P(3HP-co-3HB) copolymer production from a basic strain with a C5 plasmid. The recombinant E. coli strain with a C5 plasmid expressed Cn_PhaC, Cn_PhaA, Cn_PhaB, and Ca_Acs in the pQE-80L plasmid and was cultured at 30°C in modified M9 medium. Figure 4 shows the selection results of various E. coli strains for the production of P(3HP-co-3HB) copolymer. Recombinant E. coli strains carrying the C5 plasmid expressed Cn_PhaC, Cn_PhaA, Cn_PhaB, and Ca_Acs in the pQE-80L plasmid and were cultured at 30°C in modified M9 medium. Error bars represent the standard deviation (<10%). Figure 5 shows the effect of the induction time of the biosynthetic pathway expression on the production of P(3HP-co-3HB) copolymer. Recombinant E. coli K12 with a C5 plasmid were cultured at 30°C using modified M9 medium, but the induction time was varied to two levels: 0 h and 9 h. Figure 6 shows the effect of Cn_PhaP1 expression on the production of P(3HP-co-3HB) copolymer. Recombinant E. coli K12 with C5 or C6 plasmids were cultured at 30°C using modified M9 medium. Figure 7 shows the results of sequential removal of byproduct generation pathways to enhance carbon flow in the direction of 3HB-CoA production. The developed mutant strains K2CP / C6 to K8CP / C6 genetically modified strains were cultured in M9 medium at 30°C. Figure 8 shows the byproducts generated by carbon metabolism mutants during the production of P(3HP-co-3HB) copolymer. Various microorganisms with byproduct generation pathways removed to enhance carbon flow in the direction of 3HB-CoA production were cultured in M9 medium at 30°C. Figure 9 shows the results of UTR engineering of Ca_Acs to adjust the monomer composition in the production of P(3HP-co-3HB) copolymer. Four UTRs were synthesized, and a newly developed C7–C10 plasmid was introduced into E. coli K8CP using them. Figure 10 shows the results of fed-batch high-concentration fermentation of the K8CP / C6 strain in a bioreactor. Cell concentration, net cell biomass, and P(3HP-co-3HB) copolymer concentration and content are shown as a function of time. Glucose (700 g / L) was supplied via a pH stat, and air and pure oxygen were supplied in appropriate proportions to maintain the DO concentration above 30%. Specific details for implementing the invention
[0015] The objective of the present invention is to develop an efficient microbial cell factory and process for producing P(3HP-co-3HB) copolymer from glucose and 3-HP at a commercially meaningful level, and to this end C. aurantiacus The acs domain of propionyl-CoA synthase and C. necator of phaABC genes E. coli It was introduced into K12 MG1655. In addition, the effect of PhaP1(phasin) on the production of P(3HP-co-3HB) copolymer was evaluated, and the competitive pathway of the acetyl-CoA node and the thiesterase converting 3-HB-CoA to 3-HB were examined. yciA The aim was to increase the yield of copolymer production for substrate use by increasing the supply of 3HB-CoA through the removal of the above. The strain developed in this invention was able to produce P(3HP-co-3HB) copolymer with various compositions, achieved a high intracellular content of 93.5% and a productivity of 3.70 g / L / h, and was able to produce up to 100 g / L of P(3HP-co-3HB) copolymer.
[0017] The present invention relates to a polyhydroxyalkanoates synthase; phaC ) gene, acetyl-CoA-acetyltransferase; phaA ) gene, NADPH-dependent acetoacetyl-CoA reductase; phaB ), acyl-CoA synthetase domain of trifunctional propionyl-CoA synthase; acs ) Genes and phasin; phaP1Provides a recombinant expression vector containing genes in sequence.
[0018] Preferably, the above phaC The gene consists of a nucleotide sequence represented by SEQ ID NO. 1, and the above phaA The gene consists of a nucleotide sequence represented by SEQ ID NO. 2, and the above phaB The gene consists of a nucleotide sequence represented by SEQ ID NO. 3, and the above acs The gene consists of a nucleotide sequence represented by SEQ ID NO. 4, and the above phaP1 The gene may consist of the nucleotide sequence indicated by sequence number 5, but is not limited thereto.
[0019] Preferably, the above acs The 5' untranslated region (UTR) of the gene may consist of any one of the nucleotide sequences represented by SEQ ID NOs 6 to 10, but is not limited thereto.
[0020] In the present invention, "vector" refers to a self-replicating DNA molecule used to carry a clonal gene (or another piece of clonal DNA).
[0021] In the present invention, "expression vector" refers to a recombinant DNA molecule comprising a desired coding sequence and an appropriate nucleic acid sequence essential for expressing the coding sequence operably linked in a specific host organism. The expression vector may preferably include one or more selectivity markers. The marker is a nucleic acid sequence having characteristics that can typically be selected by chemical methods, and includes any gene capable of distinguishing transformed cells from non-transformed cells. Examples include, but are not limited to, antibiotic resistance genes such as ampicillin, kanamycin, geneticin (G418), bleomycin, hygromycin, and chloramphenicol, and can be appropriately selected by a person skilled in the art.
[0023] In addition, the present invention provides a recombinant E. coli strain with enhanced P(3HP-co-3HB) production, transformed with the recombinant expression vector.
[0024] The basic E. coli strain used in the present invention is K12 MG1655, which is a representative strain of the K-group among various E. coli strains and is a GRAS (Generally Regarded As Safe) strain whose safety has been recognized.
[0025] Preferably, the recombinant E. coli strain is pyruvate oxidase; poxB ) gene, alcohol dehydrogenase; adhE ) gene, lactate dehydrogenase (D-lactate dehydrogenase; ldhA ) gene, phosphate acetyltransferase-acetate kinase; pta-ackA ) gene, acyl-CoA thioesterase; yciA) gene and DNA-binding transcriptional dual regulator; pdhR It may be an E. coli strain in which one or more genes selected from a group consisting of ) genes are deleted, transformed with the recombinant expression vector, but is not limited thereto.
[0026] More preferably, the recombinant E. coli strain may be the strain deposited under accession number KCTC 15337BP, and the strain deposited under accession number KCTC 15337BP is the strain described in this specification as the K8CP / C6 strain.
[0028] To date, the highest potency among the results of producing P(3HP-co-3HB) composite polymers using glycerol was 9.8 g / L. Additionally, among the results of producing P(3HP-co-3HB) using 1,3-PDO as a raw material, the best results were an intracellular content of 60% and a reactor production concentration of 4.2 g / L. Meanwhile, there was a recent study attempting to supply 3-HP monomer via the beta-alanine pathway; in this case, 0-80 mol% of 3-HP could be incorporated into the composite polymer, but the reactor production concentration was very low, below 3 g / L. Such low performance is still far from sufficient for commercialization.
[0029] When producing P(3HP-co-3HB) complex polymers biologically, 3HB is typically produced using monosaccharides such as glucose, while glycerol or 1,3-propanediol (1,3-PDO) is used as a raw material for 3-HP. In this process, 3-HB monomers are produced well, but 3-HP monomers are not produced efficiently. In other words, the reason P(3HP-co-3HB) complex polymers have not been produced at high concentrations and with high efficiency until now is that 3-HP monomers are not produced effectively. Although there are several reasons, one important one is that 3-HPA (3-hydroxypropionaldehyde), which is generated during the process of producing 3HP monomers using glycerol or 1,3-propanediol (1,3-PDO) as raw materials, is highly toxic. 3-HPA is highly reactive and has been reported to inactivate various proteins and enzymes and cause cell death even at low concentrations of 5 mM. In particular, it inactivates ribonucleotide reductase, which is essential for the production of deoxynucleotides for DNA synthesis. In other words, if 3-HP monomer is produced under conditions where 3-HPA is produced, it means that it is very difficult to control the composition ratio of P(3HP-co-3HB) or to produce the polymer at high concentrations because 3-HP monomer biosynthesis is not easy.
[0030] Another biological method for producing 3-HP involves using sugars such as glucose. A representative example is the method of producing malonyl-CoA from acetyl-CoA and then converting it into 3-HP using the malonyl-CoA reductase (MCR) enzyme. Another method involves producing aspartic acid, an amino acid, and then converting it into 3-HP via beta-alanine. It has been proven that both methods can produce 3-HP at a level of approximately 40 g / L. However, despite significant efforts, producing it at a higher level has been difficult. This is because malonyl-CoA (in the case of the MCR pathway) or malonate semialdehyde (in the case of the beta-alanine pathway), which are intermediate metabolites produced in the 3-HP biosynthetic pathway, are not only toxic but also do not exhibit high activity in the key enzymes, MCR or malonate semialdehyde dehydrogenase. Furthermore, this is because it is very difficult to synthesize two monomers, 3-HP and 3-HB, from a single, identical raw material, sugar, at the desired rate and ratio. In other words, with current technology, it is not possible to produce P(3HP-co-3HB) with the desired composition ratio at high efficiency using only sugar as a raw material.
[0031] At the current level of technology, it is estimated that the only way to produce P(3HP-co-3HB) with the desired composition ratio with high efficiency using biological methods is to supply 3-HP as a monomer from an external source. However, until now, this monomer has not existed in a pure form or at high concentrations, and commercially available monomers were in the form of 37% aqueous solutions, which had low concentrations and were very expensive. Furthermore, these aqueous solutions contained large amounts of various impurities, posing a problem for use in fermentation. For this reason, no attempts were made to produce P(3HP-co-3HB) mixed polymers on a large scale using 3-HP as a raw material. However, a process for producing 3-HP on a large scale using glycerol as a raw material has recently been established biologically, making it possible to use relatively pure 3-HP salts or high-concentration, high-purity 3-HP aqueous solutions of over 80% as raw materials.
[0033] In this invention, 3-HP was used as a raw material for the first time, and as a result, P(3HP-co-3HB) composite polymers could be produced with a maximum intracellular content of over 85%. Furthermore, the 3-HP content in the P(3HP-co-3HB) composite polymer could be easily controlled within the range of 0-90 mol%. Moreover, P(3HP-co-3HB) composite polymers with a content of >100 g / L could be produced through the operation of a fed-batch bioreactor. This is the highest level known in the world to date.
[0034] In the present invention, the phaCAB gene of C. necator was introduced into E. coli as a host cell to establish a pathway for biosynthesizing 3-HB monomer and PHB polymer from glucose. Additionally, the acs domain of propionyl-CoA synthase from Chloroflexus aurantiacus was introduced to convert 3-HP into 3-HP-CoA and to biosynthesize the P(3HP-co-3HB) complex polymer together with 3-HB-CoA generated from phaAB. Therefore, the recombinant E. coli of the present invention basically has four genes introduced, including phaCAB and acs.
[0035] In addition, the present invention provides a strain in which one or more of seven genes, including adhE, poxB, ldhA, pta-ackA, yciA, and pdhR, have been removed to promote 3HB-CoA production and increase 3HB content. Lactate dehydrogenase (ldhA), alcohol dehydrogenase (adhE), and pyruvate oxidase (poxB) help prevent the loss of precursors pyruvate and acetyl-CoA. Furthermore, the removal of thioesterases such as acetate phosphatase and kinase (pta-ackA) and yciA also helps prevent the loss of acetyl-CoA. Moreover, the removal of pdhR promotes the expression of the pyruvate dehydrogenation complex, thereby reducing pyruvate accumulation and promoting the production of acetyl-CoA.
[0036] In addition, the present invention provides a recombinant expression vector that co-overexpresses phasin (phaP1) which reduces polymer toxicity. P(3HP-co-3HB) has a severe effect on cell morphology when produced as an intracellular product and exhibits toxic effects by interacting with cell proteins. Proteins such as PhaR, PhaP, and PhaM, referred to as phasins, are known to reduce the intracellular toxicity of the produced polymer through the regulation of polymer biosynthesis, coating of the produced polymer (determining the surface-to-volume ratio), intracellular localization, and regulation of polymer detachment during cell division.
[0038] In addition, the present invention provides a method for enhancing P(3HP-co-3HB) production, comprising the step of culturing the recombinant E. coli strain.
[0039] Preferably, the above-mentioned culturing step may use glucose and 3-hydroxypropionic acid (3-HP) as substrates, but is not limited thereto.
[0040] Preferably, the method may have a 3HP content of 5 mol% to 82 mol% in the produced P(3HP-co-3HB), but is not limited thereto.
[0041] Preferably, the method may be a two-step fed-batch fermentation process comprising: 1) a step of growing cells to a concentration of 30 g / L or higher using glucose; and 2) a step of continuously adding 3-HP and glucose to accumulate high concentrations of P(3HP-co-3HB) within the cells, but is not limited thereto.
[0043] The present invention will be described in more detail below through examples. These examples are intended solely to illustrate the invention more specifically, and it will be obvious to those skilled in the art that the scope of the invention is not limited by these examples according to the gist of the invention.
[0045] < 실험예 >
[0046] The following experimental examples are intended to provide experimental examples that are commonly applied to each embodiment according to the present invention.
[0048] 1. 재료
[0049] Reagents were purchased from Sigma-Aldrich (USA). Tryptone, yeast extract, and agar, which are components of the bacterial culture medium, were purchased from Difco (USA). Kits for chromosomal DNA isolation, DNA purification, and plasmid isolation were purchased from Promega (USA), Qiagen (Germany), and Cosmo-Genetech (Korea), respectively. High-performance DNA polymerase (pfuX), T4 ligase, and restriction enzymes were purchased from New England Biolabs (USA). The gene-removal plasmid pKOV was provided by Professor Church (Harvard University). Primer synthesis and Sanger sequencing were performed by Macrogen Co. Ltd (Korea).
[0051] 2. 균주 및 배양조건
[0052] Details regarding various E. coli strains, including K-12 MG1655, W3110 (ATCC 27325), XL1-Blue, BW25113, BL21 (DE), and DH5α, are shown in Table 1. 3-HP solution was purchased from Noroo Holdings Ltd (Korea). The modified M9 minimal medium, generally used for culture (pH 7.0), consisted of 0.25 g / L MgSO4·7H2O, 2 g / L NH4SO4, 0.5 g / L yeast extract, and 100 mM potassium phosphate. Glucose (3% w / v) was used as a carbon source for cell growth and energy production. Cell growth and macromolecule production were performed at 30°C and 250 rpm unless otherwise specified. 0.25 mM isopropyl β-D-1-cygalactopyranoside (IPTG) was used for gene induction. During fed-batch culture, pH was maintained by adding 6 N NH4OH and 5 N HCl.
[0054] Strains Details Source / Remarks E. coli DH5 alpha Takara, Korea (Cloning host) K12 E. coli MG1655 KCTC1116 BL21(DE3) E. coli BL21(DE3) Novagen W3110 E. coli W3110 ATCC 27325 XL -1 Blue E. coli XL -1 Blue KCCM, Korea BW25113 E. coli BW25113 CGSC K2CP E. coli MG1655 ΔpoxB ΔadhE Δldh This study K3CP E. coli MG1655 ΔpoxB ΔadhE Δldh Δpta - acca This study K4CP E. coli MG1655 ΔpoxB ΔadhE Δldh Δpta - acca ΔyciA This study K8CP E. coli MG1655 ΔpoxB ΔadhE Δldh Δpta - acca ΔyciA ΔpdhR This study Plasmid C5 pQE80L_T5_phaC_phaA_phaB_acs UTR1 P(3HP-co-3HB) production C6 pQE80L_T5_phaC_phaA_phaB_acs UTR1 _phaP1 Introduction of phase C7 pQE80L_T5_phaC_phaA_phaB_acs UTR2 _phaP1 Varying ratio of monomers in P(3HP-co-3HB) C8 pQE80L_T5_phaC_phaA_phaB_acs UTR3 _phaP1 C9 pQE80L_T5_phaC_phaA_phaB_acs UTR4 _phaP1 C10 pQE80L_T5_phaC_phaA_phaB_acs UTR5 _phaP1
[0056] 3. 플라스미드 및 변이 균주의 제작
[0057] All strains and plasmids used in the present invention are shown in Table 1. To construct the C5 plasmid Cupriavidus necator and Chloroflexus aurantiacus Acetyl-CoA-acetyltransferase from chromosomal DNA ( PhaA ), acetoacetyl-CoA reductase ( PhaB ), polyhydroxyalkano acid synthase( phaC ), triple-active propionyl synthase ( acsThe gene encoding the ACS domain of ) was PCR amplified. From this, a single fragment was prepared by overlapping PCR, treated with restriction enzymes, and cloned in pQE-80L. Additionally, pha1 was further cloned to construct a C6 plasmid, and C7–C10 plasmids were constructed by modifying the UTR of acs within the C6 plasmid (Fig. 2).
[0058] The E. coli K12 MG1655 mutant strain was constructed using the scarless homologous recombination method developed by Link et al. in 1997. In this method, the upstream and downstream regions (each approximately 500 bp) of the target gene were amplified and ligated into the pKOV vector. For example, ldhA The plasmid for removal was constructed as follows: namely, US- ldhA -F and US- ldhA - Using the R primer E. coli In K12 chromosomal DNA IdhA The upstream region fragment was amplified, and DS- ldhA -F and DS- ldhA - Using the R primer E. coli In the genomic DNA of K12 ldhA The downstream region fragment was amplified. Subsequently, US- ldhA -F and DS- ldhA 1000 bp using -R primer- ldhA Two fragments were used as templates to amplify the fragments. The corresponding fragments were treated with NotI and XbaI and ligated into pKOV cut with the same restriction enzymes. Plasmids for other gene deletions were constructed following a similar method, and these plasmids were then subjected to electrophoresis. E. coli It was introduced into K12 or the corresponding variant. The gene to be removed was replaced with the truncated gene through homologous recombination (double crossing over).
[0060] 4. 재조합 균주 제작
[0061] The host strain was cultured in LB medium at 37°C and 250 rpm for 8 hours. The obtained cells were centrifuged at 6,000 × g for 5 minutes and washed twice with 10% glycerol. The cells were redispersed in the same solution, and the plasmid was introduced into the cells by electroporation. Subsequently, the cells were recovered using LB medium and plated on LB solid medium containing antibiotics.
[0063] 5. 분석 방법
[0064] (1) Analysis of substrates and metabolites
[0065] The concentrations of 3-HP, glucose, and other metabolites in the culture medium were measured using high-performance liquid chromatography (HPLC, Agilent 1260 Infinity II, Santa Clara, CA, USA). In summary, the culture medium was centrifuged at 10,000 × g for 10 minutes to obtain a cell-free supernatant. The supernatant was then filtered through a 0.4 μm membrane and separated at 65°C using an Aminex HPX-87H column (300 mm × 7.8 mm; BioRad, Hercules, CA, USA) with 2.5 mM H2SO4 as the mobile phase.
[0067] (2) Analysis of PHA concentration
[0068] To measure the amount of polymers, gas chromatography-mass spectrometry (GC-MS) using a BD-5MS UI capillary column (60 m × 250 μm × 0.25 μm) and helium as the carrier gas was used. Briefly, freeze-dried bacterial cell pellets were reacted with methanol at 100°C for 2 hours and 30 minutes in the presence of 15% (v / v) H2SO4. The resulting 3-HP methyl ester and 3-HB methyl ester were analyzed by GC-MS. Methyl benzoic acid was used as an internal standard, and the analysis was performed under conditions of an injection temperature of 250°C, an injection volume of 5 μL, a flow rate of 0.7 mL / min, a ramping of 10°C, and a total run time of 25 minutes.
[0070] 6. 고분자 추출 및 열적 성질 측정
[0071] Extraction and purification of the polymer produced were performed according to the methods described in previous literature. The harvested microorganisms were centrifuged at 10,000 g for 10 minutes, washed with ethanol and distilled water, and freeze-dried. Subsequently, approximately 100 ml of chloroform was added to 10 g of the dried cells and treated at 100°C for 4 hours. The resulting PHA polymer-chloroform solution was filtered through Whatman filter paper and precipitated in a large amount of cold ethanol. The precipitated polymer was then washed with ethanol and vacuum-dried. To investigate the thermal properties of the polymer, Simultaneous thermogravity (TGA) and Differential scanning calorimetry (DSC) (Q600, TA Instrument, USA) were used in a nitrogen atmosphere in the temperature range of -80 to 200°C, and the melting temperature (Tm), enthalpy of fusion (Δ), and dielectric transition temperature (Tg) were determined. Molecular weight was measured using Agilent 1200 (Agilent, USA) Gel permeation chromatography equipped with a MINIDAWN Multi-Angle static Light Scattering (MALS) detector (Wyatt Technol., USA) and an Agilent PL column.
[0073] < 실시예 1> The snow-white snow-white snow-white snowflakes
[0074] first E . coli The potential for P(3HP-co-3HB) production in the K12 strain was investigated. The gene that catalyzes the reaction converting acetyl-CoA to 3HB-CoA is Cn _ PhaA (Acetyl-CoA-acetyltransferase), Cn _ PhaB (acetoacetyl-CoA reductase) and the gene that converts 3-hydroxypropionic acid (3HP) into 3-hydroxypropionic acid-coenzyme A (3HP-CoA). Ca_acs (acyl-CoA synthase domain of triactivated propionyl-CoA synthase), and a class I polyhydroxyalkano acid synthase that polymerizes 3HB-CoA and 3HP-CoA monomers Cn _ phaC was cloned into the pQE-80L plasmid (Fig. 2), and this recombinant plasmid C5 E. coli It was introduced into the K12 MG1655. Recombination E. coli K12 was cultured in a shaking flask at 30°C and 250 rpm for 48 hours (Fig. 3). M9 medium was used, and 100 mM 3HP sodium salt and 200 mM glucose were added. The PHA pathway gene was expressed at 0 hours. The recombinant K12 / C5 strain consumed 142 mM glucose and produced 4.8 g / L DCW [P(3HP-co-3HB) content 30%] and 1.38 g / L P(3HP-co-3HB) polymer (Fig. 3). From these results, the PhaC enzyme E. coli It was confirmed that the biosynthesis of copolymers can be effectively catalyzed within K12 from two monomers, namely 3HP and 3-HB, or more precisely from HP-CoA and 3HB-CoA. Each monomer is derived from externally added 3-HP and glucose. While many studies have reported that P(3HP-co-3HB) production is possible using various substrates including glucose, glycerol, gluconate, and 1,3-PDO, this is the first result demonstrating that copolymer production is possible from glucose and externally added 3-HP as in the present invention. Full-scale metabolic engineering research was conducted to enhance P(3HP-co-3HB) accumulation using the current production system.
[0076] < Examples 2> Selection of Host Strain for Polymer Production
[0077] The selection of an appropriate host is very important in PHA biosynthesis. Five types E. coli A C5 plasmid was introduced into the strains, and the production of P(3HP-co-3HB) copolymer was evaluated on a flask scale (Fig. 4). For the experiment, activation of the copolymer biosynthetic pathway was induced at 0 hours using IPTG 0.25 mM, and the strains were cultured in M9 medium for 48 hours. Among the strains evaluated E. coli K12 MG1655 showed the highest P(3HP-co-3HB) production at 1.46 g / L. E. coli BL21(DE3) produced 1.0 g / L, second only to K12, while W3110 produced the lowest amount of P(3HP-co-3HB) among the evaluated strains at 0.21 g / L (Fig. 4). The polymer composition produced by the K12 strain was 27 mol% 3HP and 4 mol% 3HB. To date, recombinant E. coli There are only 2-3 studies reporting P(3HP-co-3HB) production, and no host strain screening has been conducted at all. The reason why various hosts exhibit different performance in P(3HP-co-3HB) production is unclear. Factors affecting performance include differences in gene expression on the same promoter and plasmid, variations in proteins involved in cell division (which can be affected by PHA accumulation), and differences in the degree of filamentation caused by the intracellular accumulation of PHA. Furthermore, the toxic effects of 3HP used as a substrate are E. coli There may also be differences between strains.
[0079] < Examples 3> P( 3HP -co- 3HB ) Optimization of induction time for improved production
[0080] The recombination that showed the best performance E. coli The effect of induction time was investigated using K12 MG1655 (K12 / C5) (Fig. 5). To optimize induction time, 0.25 mM IPTG was added at two time points (0 hours and 9 hours) while maintaining a constant stirring speed of 250 rpm. Induction time had a significant impact on P(3HP-co-3HB) production. At an induction time of 9 hours, 3.8 g / L of P(3HP-co-3HB) was produced, which was significantly higher than the 1.42 g / L produced at 0-hour induction. Changes in P(3HP-co-3HB) content showed a similar trend, increasing from 28% at 0-hour induction to 51% at 9-hour induction. However, there was no significant difference in the actual cell biomass (T_DCW; actual cell biomass calculated by subtracting the weight of the P(3HP-co-3HB) polymer from the dry weight of the cells) at 48 hours, the completion point of fermentation, between the two experimental conditions. Specifically, it was 3.2 g / L under the 9-hour induction condition and 3.5 g / L under the 0-hour induction condition. However, when the polymerization pathway was not induced—that is, in the absence of copolymer production—strain K12 / C5 exhibited better growth. When polymerization was present, the net cell concentration was only 1 g / L under the 0-hour induction condition, whereas when polymerization was not induced, a cell biomass of approximately 3.6 g / L was obtained after 9 hours of fermentation. This implies that P(3HP-co-3HB) production reduces cell growth, and the reduction becomes more severe as production increases. It has been reported that the PHA production pathway and the induction of PHA production can induce a heat shock response in cells and alter cellular metabolism. The accumulation of P(3HP-co-3HB) in the cytoplasm induces stress that promotes endogenous respiration in the cell, resulting in a decrease in cell mass. Furthermore, it is known that many cytoplasmic proteins and surrounding proteins are damaged by interacting with high concentrations of hydrophobic PHA molecules.
[0082] < Examples 4> P( 3HP -co- 3HB ) for production improvement Phasin Introduction
[0083] PHA is a hydrophobic intracellular granule that affects cellular homeostasis by interacting with other important hydrophobic proteins. To maintain stability, many natural PHA-producing bacteria express phasin, a PHA-binding protein. Phasin coats the hydrophobic surface of PHA and, due to its amphiphilic structure, reduces interactions with other cytoplasmic proteins, decreases intracellular toxicity, and further inhibits the degradation of PHA, thereby providing stability to the intracellular PHA. In the present invention C. necator of phaP1 The gene was cloned and introduced into the C5 plasmid to create the C6 plasmid (Fig. 2). Fig. 6 shows a comparison of the fermentation results of the K12 / C5 and K12 / C6 strains. While there was no significant change in T_DCW, which was 3.67 g / L (K12 / C5) and 3.36 g / L (K12 / C6), respectively, the production and intracellular content of P(3HP-co-3HB) improved from 3.8 g / L and 51% to 5.6 g / L and 62%, respectively. However, the composition of 3HP and 3HB in the produced copolymer remained almost unchanged. The K12 / C5 strain produced a polymer with a molar ratio of 82% 3HP and 18% 3HB, respectively, while the K12 / C6 strain showed a molar ratio of 81% and 19%, respectively.
[0085] < Examples 5> Acetyl- CoA Remove competition paths from the node
[0086] According to experimental results to date, the ratio of 3HB to 3HP was very low in most strains, and acetic acid and pyruvate were obtained as byproducts. To promote 3HB-CoA production and increase 3HB content adhE, poxB, ldhA, pta-ackA, yciA and pdhRSeven genes were sequentially removed (Fig. 7). Lactate dehydrogenase ( ldhA ), alcohol dehydrogenase ( adhE ) and pyruvate oxidase ( poxB ) helps prevent the loss of the precursors pyruvate and acetyl-CoA. K2CP / C6 strain( ΔadhE ΔpoxB ΔldhA In ), lactic acid production was eliminated, but acetic acid was not eliminated (Fig. 7). Acetic acid is produced by acetylphosphorase and phosphokinase ( pta- ackA ), yciA Thioesterases such as, and mhpF , aldB, adhP It can be produced via alcohol / aldehyde dehydrogenation reactions by enzymes encoded by . To reduce acetic acid production, in the K3CP / C6 strain pta- ackA ...was removed, and showed an improved result of 12.6 g / L for P(3HP-co-3HB) production compared to K2CP / C6, which had 10 g / L. However, pta- ackA Acetic acid formation did not decrease even after removal. CoA intermediates can be separated by thioesterase, and E. coli There are several enzymes of this type. These enzymes can act on acetyl-CoA, acetoacetyl-CoA, and 3-HB-CoA to limit the metabolic flow to 1,3-BDO. yciA Removal (K4CP / C6) reduced acetate and significantly increased the P(3HP-co-3HB) concentration to 19 g / L, which has 61 mol% 3-HB, compared to K3CP / C6 with 50 mol% 3-HB. Since the K3CP / C6 strain produced 22 mM of pyruvate (Fig. 8), to prevent pyruvate accumulation, the pyruvate dehydrogenase complex regulatory gene ( pdhR) was removed. As a result, the generated K8CP / C6 strain had no pyruvate accumulation, the P(3HP-co-3HB) concentration improved to 22.1 g / L, and the 3HB ratio increased to 65 mol% (Fig. 8).
[0088] < Examples 6> P( 3HP -co- 3HB 3-HP in ): 3- HB To arbitrarily adjust the ratio UTR Engineering
[0089] The 3-HP:3-HB ratio in P(3HP-co-3HB) can be adjusted according to Acs activity. Cloned in a C6 plasmid for Acs activity control Ca_acs The untranslated region (UTR) containing the gene's ribosome binding site was modified in four stages (C7 ~ C10), and through this, acsThe expression of was increased or decreased to influence the proportion of 3HP included in P(3HP-co-3HB) (Fig. 2; Table 2). Based on an in silico UTR Designer, four new UTR sequences were synthesized with expected expression differences ranging from approximately 0.2 to 6.5-fold. P(3HP-co-3HB) production was evaluated using these recombinant strains in flask experiments. The K8CP / C7 and K8CP / C8 strains exhibited 3HP mol% of 68% and 59%, respectively, which were increased compared to 38% of K8CP / C6 (Fig. 9). Additionally, for the K8CP / C9 strain, the 3HP:3HB ratio was 27 mol%:72 mol%, and for the K8 / C10 strain, it was 5 mol%:95 mol% (Fig. 9, Table 3). Through changes in carbon metabolism and modification of acs UTR, the 3HP content could be varied from 5 mol% to 82.6 mol%, and the 3HB content could also be varied from 17.4 mol% to 95.0 mol%. These changes in the 3HP and 3HB ratios affect not only the thermal properties of the copolymer but also the production concentration. The intracellular copolymer content was found to be as high as 93% in K8CP / C7. The various 3HP and 3HB ratios obtained in this invention and their thermal properties are shown in Table 3.
[0090] Ca_ acs UTR design for controlling expression and copolymer composition Plasmids Purpose UTR Sequence In silico expression level Fold change by prediction* acs C7Native UTR of Ca_acs Increased expression TTAACTTTAAGAAGGA GA TATACAA (Sequence No. 6) 2,183,619 6.51 C8 Increased expression TTA T CTTTAAGAAGGAGATATACAA(Sequence No. 7) 943682 2.81 C6 Original TTAACTTTAAGAAGGAATTATACAA(Sequence No. 8) 335320 0.15 C9 Reduced expression TTA T CTTTAAGA T GGA GA TATACAA (Sequence No. 9) 156075 0.46 C10 Reduced expression TT TT CTTTAAGAAGG T ATTATACAA (Sequence No. 10) 98515 0.29
[0091] The change in relative strength is the value obtained by dividing the strength of the newly designed UTR by the strength of the initial UTR (UTR3) as an estimate.
[0093] different centuries Ca_acs Fermentation results according to the expression of Experimental scale Strain Cell density (g CDW / L) PHA (g / L) PHA content (%) Monomer composition ( mol% ) Thermal properties* 3HP 3HB T g (℃) T m (℃) Flask K12 / C5 7.5 3.9 51.2 82.6 17.4 -20.0 74.0 K12 / C6 9.0 5.6 62.6 81.1 19.0 -20.0 74.0 K8CP / C7 30.3 28.2 93.2 68.0 32.0 -20.0 72.0 K2CP / C6 14.4 10.6 73.5 60.0 40.0 -20.0 72.0 K8CP / C8 28.8 26.5 92.2 59.0 41.0 -19.0 68.0 K3CP / C6 14.7 12.6 86.2 49.2 50.8 -18.0 70.0 K4CP / C6 22.2 19.6 88.2 38.9 61.1 -16.0 72.0 K8CP / C6 24.2 22.1 91.4 38.0 62.0 -16.0 72.0 K8CP / C6 24.2 22.1 91.4 34.8 65.2 -15.0 73.0 K8CP / C9 23.2 20.6 88.6 27.4 72.6 -4.0 163.0 K8CP / C10 22.8 20.2 88.5 5.0 95.0 4.0 170.0 Bioreactor K8CP / C6 143.7 112.0 78.0 56.7 43.3 -19.0 68.0
[0095] < Examples 7> High concentration Yu Ga-sik High concentration P through bioreactor culture 3HP -co- 3HB ) production
[0096] Since PHA is an intracellular product, high-concentration cell culture is important to increase PHA production. High-concentration fed-batch culture was conducted in bioreactor experiments using the K8CP / C6 strain. Dissolved oxygen (DO) was maintained above 30% by supplying pure oxygen (O2) simultaneously with air. Glucose concentration was maintained between 50 and 250 mM through intermittent glucose supply (700 g / L stock solution), and 1 gram each of trace element solution (1X SL6), ammonium phosphate, yeast extract, and tryptone was periodically added. Additionally, 5 M 3-HP was supplied periodically to maintain its concentration at approximately 100 mM. The polymer synthesis pathway was induced during the late logarithmic growth phase, when DCW reached approximately 20 g / L (10th hour). At this point, since there was no accumulation of P(3HP-co-3HB), DCW and T_DCW were identical. T_DCW increased to 22.58 g / L by 12 hours after induction, but a decrease in biomass was observed thereafter (Fig. 10). After 12 hours, the cessation of actual cell growth or a decrease in T_DCW was observed, which is presumed to be due to the high PHA content (~90%), which can have a severe effect on cell division. There are reports that cell growth is severely inhibited when the PHA content is approximately 50%. The concentration of P(3HP-co-3HB) was 7 g / L by 12 hours, significantly increased to 67 g / L by 18 hours, and reached >100 g / L at the end of fermentation. The ratio of 3-HP and 3-HB in the polymer was 59.5 mol% and 40.5 mol%, respectively. Since P(3HP-co-3HB) is a product that accumulates within cells, production of P(3HP-co-3HB) was achieved at high reactor concentrations by achieving high cell biomass (T_DCW) and high content.
[0098] The production of P(3HP-co-3HB) copolymer at >100 g / L, an in vivo polymer content of 93.5%, and a productivity of 3.7 g / L / h achieved in this invention are the highest values reported to date and represent a commercially significant level. As shown in Table 4, a comparison of P(3HP-co-3HB) production from different strains and carbon sources yields superior results that are incomparable to previous research findings. The achievement of the highest content and productivity in this invention is attributed to the development of efficient strains, the use of 3HP substrates, and effective fermenter operation. In particular, acs UTR engineering enabled the monomer ratio within the copolymer to be varied at will, and yciA and pdhR The removal of facilitated the polymerization of glucose and energy production.
[0099] Name of strain (Reference) Titer (g / L) Cellular content ( % ) Yield Productivity ( g PHA / L / h) Composition ( mol% of 3HP in 3HP-co-3HB) Substrate Alcaligenes eutrophus (Nakamura et al., 1991) 0.51 12 -- -- 7.0 3HP Alcaligenes side (Wang et al., 1999) 4.2 45.2 -- -- 23.0 Sucrose,3HP XL1-Blue (Valentin et al., 2000) -- 14 -- -- 25.0 3HP,Mannitol Copper-loving murderer H16(Fukui et al., 2009) 1.02 57 -- -- 1.0 Fructose Copper-loving murderer JMP134 (Fukui et al., 2009) 0.77 31 -- -- 2.1 Fructose E. to be cultivated JM109(DE3)(Wang et al., 2013) 9.8 -- -- 48.2 Glycerol Shimwellia cockroaches (Sato et al., 2015) 7.12 30.7 0.093 0.148 2.1 Glycerol Shimwellia cockroaches (Sato et al., 2015) 0.32 17.2 0.0033 0.006 18.1 Glycerol Escherichia to be cultivated Trans 1-T1(Meng et al., 2015) 5 42 -- -- 84 Glucose Copper-loving murderer H16(McGregor et al., 2021) 0.35 17.74 -- -- 1.27 Gluconate, β-alanine Copper-loving murderer H16(McGregor et al., 2021) 1.49 29.91 -- -- 36.72 Gluconate, β-alanine Copper-loving murderer H16(McGregor et al., 2021) 2.59 50.76 -- -- 7.11 Gluconate, β-alanine Halomonas blue phagegenesis TD27(Jiang et al., 2021) 4.20 60 -- -- 45.0 Glucose,1,3 PDO E. to be cultivated K12 (This study) 100 93.5 -- 3.7 59.5 Glucose, 3HP
[0101] Foregoing, specific parts of the present invention have been described in detail. It is evident to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. Accordingly, the actual scope of the invention is defined by the appended claims and their equivalents.
[0102] The scope of the present invention is defined by the claims set forth below, and all modifications or variations derived from the meaning and scope of the claims and equivalent concepts thereof should be interpreted as being included within the scope of the present invention.
[0104] Depository Name: Korea Research Institute of Biotechnology and Bioengineering Biological Resource Center (KCTC) Trustee Number: KCTC15337BP Date of Deposit: 2023-03-07
Claims
Claim 1 Escherichia coli strains deleted from the pyruvate oxidase (poxB) gene, alcohol dehydrogenase (adhE) gene, D-lactate dehydrogenase (ldhA) gene, phosphate acetyltransferase-acetate kinase (pta-ackA) gene, acyl-CoA thioesterase (yciA) gene, and DNA-binding transcriptional dual regulator (pdhR) gene, polyhydroxyalkanoates synthase; phaC ) gene, acetyl-CoA-acetyltransferase; phaA ) gene, NADPH-dependent acetoacetyl-CoA reductase; phaB ), acyl-CoA synthetase domain of trifunctional propionyl-CoA synthase; acs ) Genes and phasin; phaP1 A recombinant E. coli strain with enhanced poly(3-hydroxypropionate-co-3-hydroxybutyrate)[poly(3-hydroxypropionate-co-3-hydroxybutyrate; P(3HP-co-3HB)] production, transformed with a recombinant expression vector containing the ) gene in sequence. Claim 2 In paragraph 1, the above phaC The gene consists of a nucleotide sequence represented by SEQ ID NO. 1, and the above phaA The gene consists of a nucleotide sequence represented by SEQ ID NO. 2, and the above phaB The gene consists of a nucleotide sequence represented by SEQ ID NO. 3, and the above acs The gene consists of a nucleotide sequence represented by SEQ ID NO. 4, and the above phaP1 A recombinant E. coli strain with enhanced P(3HP-co-3HB) production, characterized in that the gene consists of the nucleotide sequence indicated by SEQ ID NO.
5. Claim 3 In paragraph 1, the above acs A recombinant E. coli strain with enhanced P(3HP-co-3HB) production, characterized in that the 5' untranslated region (UTR) of the gene consists of any one of the nucleotide sequences represented by SEQ ID NOs 6 to 10. Claim 4 delete Claim 5 delete Claim 6 A recombinant E. coli strain with enhanced P(3HP-co-3HB) production, characterized in that, in claim 1, the recombinant E. coli strain is the strain deposited under accession number KCTC 15337BP. Claim 7 A method for enhancing P(3HP-co-3HB) production, comprising the step of culturing a recombinant E. coli strain according to any one of claims 1 to 3 and 6. Claim 8 A method for promoting P(3HP-co-3HB) production according to claim 7, wherein the culturing step is characterized by using glucose and 3-hydroxypropionic acid (3-HP) as substrates. Claim 9 A method for promoting the production of P(3HP-co-3HB) according to claim 7, characterized in that the 3HP content in the produced P(3HP-co-3HB) is 5 mol% to 82 mol%. Claim 10 A method for enhancing the production of P(3HP-co-3HB) according to claim 8, characterized in that the method is a two-stage fed-batch fermentation process comprising: 1) a step of growing cells to a concentration of 30 g / L or higher using glucose; and 2) a step of continuously adding 3-HP and glucose to cause high concentrations of P(3HP-co-3HB) to accumulate within the cells.