Oligonucleotides for treating neurological diseases and methods of use

Abstract

Antisense oligonucleotide sequences and methods of use for treating neurological diseases are disclosed herein. Oligonucleotide inhibitors are described herein. In various embodiments, oligonucleotides target transcripts for the treatment of neurological diseases and / or neuropathy, including motor neuron diseases. For example, transcript inhibitors may be used to treat PD, ALS, FTD, and ALS accompanied by FTD.

Description

Technology Field

[0001] Cross-reference

[0002] This application claims the benefit and priority of U.S. Provisional Application No. 62 / 856,264 filed June 3, 2019; U.S. Provisional Application No. 62 / 914,252 filed October 11, 2019; and U.S. Provisional Application No. 62 / 949,817 filed December 18, 2019, the full disclosure of each of these is incorporated herein by reference in its entirety for all purposes.

[0003] Sequence list

[0004] The present application contains a list of sequences submitted electronically in ASCII format, the full text of which is incorporated herein by reference. The said ASCII copy, created on May 29, 2020, is named QRL-002WO_SL.txt and is 378,978 bytes in size.

[0005] Field of invention

[0006] The present application relates to an inhibitor of an STMN2 transcript comprising a potential exon, comprising an STMN2 antisense oligonucleotide sequence, and a method for treating neurological diseases. Background Technology

[0007] Motor neuron diseases are a class of neurological disorders that cause degeneration and death of motor neurons—neurons that coordinate voluntary muscle movements by the brain. Motor neuron diseases can be sporadic or hereditary and can affect upper motor neurons and / or lower motor neurons. Motor neuron diseases include amyotrophic lateral sclerosis, progressive medullary palsy, pseudobulbar palsy, primary lateral sclerosis, progressive muscular atrophy, spinal muscular atrophy, and post-poliomyelitis syndrome.

[0008] Amyotrophic Lateral Sclerosis (ALS) is a group of motor neuron diseases affecting approximately 15,000 individuals in the United States. ALS is characterized by the degeneration and death of upper and lower motor neurons, resulting in a loss of voluntary muscle control. The death of motor neurons is accompanied by muscle fasciculations and atrophy. Early symptoms of ALS include muscle spasms, muscle rigidity, muscle weakness (e.g., affecting the arms, legs, neck, or diaphragm), slurred speech, and difficulty chewing or swallowing. Eventually, a loss of control over force and movement occurs, including that required for speech, eating, and breathing. Disease progression may be accompanied by weight loss, malnutrition, anxiety, depression, an increased risk of pneumonia, muscle spasms, neuropathy, and possibly dementia. Most individuals diagnosed with ALS die of respiratory failure within five years of the first onset of symptoms. Currently, there is no effective treatment for ALS.

[0009] ALS occurs in individuals of all ages, but is most common in individuals aged 55 to 75 years and has a slightly higher incidence in men. ALS can be characterized as sporadic or familial. Sporadic ALS appears to occur randomly and accounts for more than 90% of all ALS cases. Familial ALS accounts for 5-10% of all ALS cases.

[0010] FTD refers to a widespread progressive neurodegenerative disease caused by neuronal loss in the frontal and temporal lobes of the brain. FTD is characterized by changes in behavior and personality, as well as language dysfunction. Forms of FTD include behavioral variant FTD (bvFTD), semantic variant primary progressive aphasia (svPPA), and non-fluent variant primary progressive aphasia (nfvPPA). ALS with FTD is characterized by symptoms associated with FTD, along with symptoms of ALS such as muscle weakness, atrophy, fasciculations, rigidity, speech disorders (dysarthria), and dysphagia (dysphagia). Individuals typically die from FTD within 5 to 10 years, and ALS with FTD often results in death within 2 to 3 years of the onset of initial disease symptoms.

[0011] As with ALS, there is no known cure for FTD or ALS with FTD, nor is there any known treatment to prevent or delay the progression of the disease.

[0012] Therefore, there is an urgent need to identify compounds capable of preventing, alleviating, and treating neurological diseases, such as amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), and / or neuropathy, such as chemotherapy-induced neuropathy.

[0013] RNA-binding protein transcriptional activation response: DNA-binding protein 43 (TDP-43) is involved in fundamental RNA processing activities, including RNA transcription, splicing, and transport. TDP-43 binds with high affinity to GU-rich sequences, including the self-regulation of its own mRNA through binding to the 3' untranslated region. Alternatively, a reduction in TDP-43 from the normal adult nervous system alters the splicing or expression levels of over 1,500 RNAs, including long intron-containing transcripts. See [Melamed et al., Nat Neurosci. (2019), 22(2):180-190].

[0014] Cytoplasmic accumulation and nuclear loss of TDP-43 have been reported in most cases of ALS and in approximately 45% of affected neurons in patients with FTD. See [Melamed et al., Nat Neurosci. (2019), 22(2):180-190]. Additionally, TDP-43 has been found to regulate the expression of the neuronal growth-associated factor statmin-2. See [Melamed (2019)]; also see [Klim et al., Nat Neurosci. (2019), 22(2):167-179]. Disruption of TDP-43 has been found to drive premature polyadenylation and abnormal splicing in intron 1 of statmin-2 free-mRNA, resulting in the loss of distalized mRNA and functional STMN2 protein. See [Melamed (2019)]. STMN2 codes for a protein necessary for normal motor neuron growth and repair. See [Melamed (2019)]; also see [Klim (2019)].

[0015] The statmin-2 gene is annotated as containing five constitutive exons (Refseq ID: NM_001199214.1) plus a proposed alternative exon between exons 4 and 5. See [Melamed (2019)]; also see [Klim (2019)]. A reduction or mutation in TDP-43 induces a new spliced ​​exon mapped within intron 1. See [Melamed (2019)]; also see [Klim (2019)]. This new exon (indicated as "exon 2a" or "latent exon") emerges from STMN2 free-mRNA when TDP-43 is depleted or when endogenous TDP-43 has the N352 mutation. See [Melamed (2019)]; See also [Klim (2019)]. The latent exon in STMN2 free-mRNA contains a latent polyadenylation sequence that causes early polyadenylation of the free-mRNA. See [Melamed (2019)]; see also [Klim (2019)]. This immature polyadenylated RNA contains 227 nucleotides originating from the latent exon, having its predicted 16-amino acid translation product that starts at the normal AUG codon in exon 1 and ends at the latent exon at the 11th codon. See [Melamed (2019)]; see also [Klim (2019)].

[0016] The present invention provides an inhibitor of the STMN2 transcript containing a potential exon for the treatment of neurological diseases or disorders.

[0017] Oligonucleotide inhibitors are described herein. In various embodiments, the oligonucleotide targets a transcript for the treatment of neurological diseases and / or neuropathy, including motor neuron disease. For example, inhibitors of the transcript may be used to treat PD, ALS, FTD, and ALS accompanied by FTD. In various embodiments, the oligonucleotide inhibitor is an antisense oligonucleotide. In various embodiments, the oligonucleotide inhibitor targets the statmin-2 (STMN2) transcript. In some embodiments, the STMN2 transcript comprises a latent exon, e.g., a latent exon having the sequence identified in SEQ ID NO: 447 below.

[0018] Additionally, the present invention discloses a compound comprising an oligonucleotide comprising a linked nucleoside having at least 19 adjacent nucleoside sequences that are at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) complementary to at least 19 to 50 adjacent nucleoside portions of sequence identification number: 944 or to sequence identification number: 944, for at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) complementary to an equal length portion of a transcript having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with respect to sequence identification number: 944 or to adjacent nucleoside portions of sequence identification number: 944, wherein at least one nucleoside link of the linked nucleoside is a non-natural link. Additionally, an oligonucleotide comprising a linked nucleoside having at least 19 adjacent nucleoside sequences that are at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) complementary to an equal length portion of a transcript having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with respect to sequence identification number: 944 or to adjacent 19 to 50 nucleoside portions of sequence identification number: 944, wherein at least one nucleoside link of the linked nucleoside is a non-natural link.

[0019] In various embodiments, the nucleobase sequence comprises at least 10 adjacent nucleobase portions that share at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with any one of sequence identification number: 1-446, sequence identification number: 894-918, sequence identification number: 945-1390, or sequence identification number: 1392-1432. In various embodiments, the nucleobase sequence comprises at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 adjacent nucleobase portions that share at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with any one of sequence identification number: 1-446, sequence identification number: 894-918, sequence identification number: 945-1390, or sequence identification number: 1392-1432.

[0020] In various embodiments, the nucleobase sequence is sequence identification number: 31, 36, 41, 46, 55, 144, 146, 150, 169, 170, 171, 172, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 390, 395, 400, 975, 980, 985, 999, 1088, 1090, 1094, 1113, 1114, 1115, 1116, 1117, 1121, 1125, 1129, 1141, It comprises at least 10 adjacent nucleobase portions that share at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with any one of the same length portions of 1147, 1153, 1159, 1181, 1188, 1193, 1196, 1324, 1329, 1334, 1339, or 1344, wherein at least one nucleoside link of the linked nucleosides is a non-natural link.In various embodiments, the nucleobase sequence is sequence identification number: 31, 36, 41, 46, 55, 144, 146, 150, 169, 170, 171, 172, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 390, 395, 400, 975, 980, 985, 999, 1088, 1090, 1094, 1113, 1114, 1115, 1116, 1117, 1121, 1125, 1129, 1141, It includes at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 adjacent nucleobase portions that share at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with any one of 1147, 1153, 1159, 1181, 1188, 1193, 1324, 1329, 1334, 1339, or 1344 equal length portions.

[0021] Additionally, a compound comprising an oligonucleotide comprising a linked nucleoside having at least 19 adjacent nucleobase sequences is disclosed herein, wherein the nucleobase sequence comprises at least 10 adjacent nucleobase portions sharing at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity for an equal length portion of either Sequence Identification No.: 894-918 or Sequence Identification No.: 1392-1432. Additionally, an oligonucleotide comprising linked nucleosides having at least 19 adjacent nucleobase sequences is disclosed herein, wherein the nucleobase sequence comprises at least 10 adjacent nucleobase portions that share at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity for an equal length portion of either Sequence Identification No.: 894-918 or Sequence Identification No.: 1392-1432. In various embodiments, the nucleobase sequence comprises at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 adjacent nucleobase portions that share at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with respect to either Sequence Identification Number: 894-918 or Sequence Identification Number: 1392-1432.

[0022] Additionally, a compound comprising an oligonucleotide comprising a linked nucleoside having at least 19 adjacent nucleobase sequences is disclosed herein, wherein the nucleobase sequences are positions 121-144, 144-168, 146-170, 150-170, 150-172, 150-170, 150-172, 150-174, 169-193, 169-189, 169-191, 170-190, 170-192, 171-191, 171-193, 172-192, 172-194, 170-194, 171-195, 172-196, 173-197 of sequence identification number: 944. It includes at least 10 adjacent nucleobase portions that are at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) complementary to the same length portion of nucleobases in any one of 185-209, 197-221, 237-261, 249-273, 252-276, or 276-300. Additionally, an oligonucleotide comprising a linked nucleoside having a nucleoside sequence having at least 19 adjacent nucleoside sequences is disclosed herein, wherein the nucleoside sequences are positions 121-144, 144-168, 146-170, 150-170, 150-172, 150-174, 169-193, 169-189, 169-191, 170-190, 170-192, 171-191, 171-193, 172-192, 172-194, 170-194, 171-195, 172-196, 173-197, 185-209, 197-221 of sequence identification number: 944. It includes at least 10 adjacent nucleobase portions that are at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) complementary to the same length portion of the nucleobases in any one of 237-261, 249-273, 252-276, or 276-300.

[0023] In various embodiments, a portion of the nucleobase sequence is among positions 121-144, 144-168, 146-170, 150-170, 150-172, 150-174, 169-193, 169-189, 169-191, 170-190, 170-192, 171-191, 171-193, 172-192, 172-194, 170-194, 171-195, 172-196, 173-197, 185-209, 197-221, 237-261, 249-273, 252-276, or 276-300 of sequence identification number: 944 It is 100% complementary to the same length portion of the nucleus within any one. In various embodiments, a portion of the nucleus sequence is 100% complementary to the same length portion of the nucleus within any one of positions 144-164, 144-166, 145-167, 146-166, 146-168, 147-165, or 148-168 of sequence identification number: 944. In various embodiments, a portion of the nucleus sequence is 100% complementary to the same length portion of the nucleus within any one of positions 173-191, 173-193, 173-195, 173-197, 175-195, 175-197, 177-197, or 179-197 of sequence identification number: 944.

[0024] In various embodiments, a portion of the nucleobase sequence is 100% complementary to the same length portion of the nucleobase within any one of positions 185-205, 187-209, 189-209, 185-207, 197-217, 197-219, or 191-209 of sequence identification number: 944. In various embodiments, a portion of the nucleobase sequence is 100% complementary to the same length portion of the nucleobase within any one of positions 237-255, 237-257, 237-259, 239-259, 239-261, 241-261, 237-257, 249-269, 249-271, 252-272, 252-274, or 243-261 of sequence identification number: 944. In various embodiments, the nucleobase sequence is any of positions 121-144, 144-168, 146-170, 150-170, 150-172, 150-174, 169-193, 169-189, 169-191, 170-190, 170-192, 171-191, 171-193, 172-192, 172-194, 170-194, 171-195, 172-196, 173-197, 185-209, 197-221, 237-261, 249-273, 252-276, or 276-300 of sequence identification number: 944 It includes at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 adjacent nucleobase portions that are complementary to equal length portions of nucleobases within one.In various embodiments, the nucleobase sequences are at positions 144-164, 144-166, 145-167, 146-166, 146-168, 147-165, 148-168, 173-191, 173-193, 173-195, 173-197, 175-195, 175-197, 177-197, 179-197, 185-205, 185-207, 197-217, 197-219, 187-209, 189-209, 191-209, 237-255, 237-257, 237-259 of sequence identification number: 944, It includes at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 adjacent nucleobase portions that are complementary to the equal length portion of the nucleobases within any one of 239-259, 239-261, 241-261, 237-257, 249-269, 249-271, 252-272, 252-274, or 243-261.

[0025] In various embodiments, the oligonucleotides are 19 and 40 nucleosides long. In various embodiments, the oligonucleotide comprises a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a phosphodithioate linkage, a phosphotriester linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidotyamate linkage, a phosphorodiamidate linkage (e.g., comprising phosphorodiamidate morpholino (PMO), 3'-aminoribose, or 5'-aminoribose), an aminoalkylphosphoamidate linkage, a thiophosphoamidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage, or any combination thereof. It includes at least one nucleoside linkage selected from the group. In various embodiments, at least two, three, or four nucleoside linkages of the oligonucleotide are phosphodiester nucleoside linkages. In various embodiments, the oligonucleotide includes at least two, three, or four modified nucleoside linkages.

[0026] In various embodiments, each modified nucleoside link of the oligonucleotide is independently selected from phosphorothioate linkage, phosphoramidate linkage, phosphoramidothoate linkage, and phosphorodiamidate. In various embodiments, all nucleoside linkages of the oligonucleotide are phosphorothioate linkages. In various embodiments, the phosphorothioate nucleoside linkages exist as either Rp coordination or Sp coordination. In various embodiments, the oligonucleotide comprises at least one modified nucleobase. In various embodiments, at least one modified nucleobase is 5-methylcytosine, pseudouridine, or 5-methoxyuridine.

[0027] In various embodiments, the oligonucleotide comprises at least one modified sugar moiety. In various embodiments, the modified sugar moiety is one of a 2'-OMe (2'-OCH3 or 2'-O-methyl) modified sugar moiety, a non-cyclic sugar moiety, a 2'-O-(2-methoxyethyl) (2'-O(CH2)2OCH3(2'MOE)), a 2'-deoxy-2'-fluoronucleoside, a 2'-fluoro-β-D-arabinonucleoside, a locking nucleic acid (LNA), a binding ethyl 2'-4'-crosslinked nucleic acid (cEt), a S-cEt, a hexitol nucleic acid (HNA), and a tricyclic analog (e.g., tcDNA).

[0028] In various embodiments, the oligonucleotide comprises three linked nucleosides linked by phosphodiester nucleoside linkages at the 5' end and three linked nucleosides linked by phosphodiester nucleoside linkages at the 3' end. In various embodiments, the oligonucleotide comprises one or more 2'-O-(2-methoxyethyl) nucleosides linked by phosphorothioate nucleoside linkages. In some embodiments, all cytosine nucleosides of the STMN2 antisense oligonucleotide of the present invention comprise a 2'-MOE containing a modified sugar moiety, all nucleosides comprise a modified nucleobase 5-methylcytosine, and all nucleoside linkages are phosphorothioate linkages. In various embodiments, the oligonucleotide comprises three linked nucleosides linked via phosphothioate nucleoside linkages at the 5' end and three linked nucleosides linked via phosphothioate nucleoside linkages at the 3' end. In various embodiments, the oligonucleotide comprises five linked nucleosides linked via phosphodiester nucleoside linkages. In various embodiments, each of the five linked nucleosides is a 2'-O-(2-methoxyethyl) (2'MOE) nucleoside. In various embodiments, each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'MOE) nucleoside.

[0029] In various embodiments, the oligonucleotide represents an increase of at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the full-length STMN2 transcript or STMN2 protein. In various embodiments, the oligonucleotide represents an increase of at least 100% of the full-length STMN2 transcript or STMN2 protein. In various embodiments, the oligonucleotide represents an increase of at least 200% of the full-length STMN2 transcript or STMN2 protein. In various embodiments, the oligonucleotide represents an increase of at least 300% of the full-length STMN2 transcript or STMN2 protein. In various embodiments, the oligonucleotide represents an increase of at least 400% of the full-length STMN2 transcript or STMN2 protein. In various embodiments, the increase in full-length STMN2 protein is measured in comparison to a reduced level of full-length STMN2 protein achieved using TDP43 antisense oligonucleotide. In various embodiments, the oligonucleotide represents at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% relief of the full-length STMN2 transcript or STMN2 protein. In various embodiments, the oligonucleotide represents at least 50%, 60%, 70%, 80%, or 90% reduction of the STMN2 transcript having latent exons.

[0030] Additionally, a pharmaceutical composition comprising one or more of the oligonucleotides described above, a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient is disclosed herein. Additionally, a method for treating a neurological disease and / or neuropathy in a patient requiring treatment for said neurological disease and / or neuropathy is disclosed herein, comprising administering any of the oligonucleotides described above, a pharmaceutically acceptable salt thereof, or the pharmaceutical composition described above.

[0031] In various embodiments, neurological diseases are selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, and corticobasal degeneration (CBD). In various embodiments, the neuropathy is chemotherapy-induced neuropathy.

[0032] Additionally, a method for restoring axonal growth and / or regeneration of a neuron is disclosed herein, comprising exposing a motor neuron to any of the oligonucleotides described above, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition described above. Additionally, a method for increasing, promoting, stabilizing, or maintaining STMN2 expression and / or function in a neuron is disclosed herein, comprising exposing a cell to any of the oligonucleotides described above, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition described above. In various embodiments, the neuron is a neuron of a patient requiring treatment for a neurological disease and / or neuropathy. In various embodiments, the neurological disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, and corticobasal degeneration (CBD). In various embodiments, the neuropathy is chemotherapy-induced neuropathy.

[0033] In various embodiments, exposure is performed in vivo or in vitro. In various embodiments, exposure comprises administering the STMN2 oligonucleotide (STMN2 AON) disclosed herein or its pharmaceutical composition to a patient in need thereof. In various embodiments, the STMN2 oligonucleotide or its pharmaceutical composition is administered topically, parenterally (e.g., subcutaneously, intramuscularly, intradermally, duodenally, or intravenously), into a lesion, into the spinal canal, into a cistern, orally, rectally, buccally, sublingually, vaginally, transagroscopically, tracheally, nasally, transdermally, or into the duodenum. In various embodiments, the STMN2 oligonucleotide or its pharmaceutical composition is administered orally. In various embodiments, a therapeutically effective amount of the STMN2 oligonucleotide or its pharmaceutical composition is administered into the spinal canal or cistern.

[0034] In various embodiments, the patient is a human. In various embodiments, the pharmaceutical composition is suitable for topical, intrathecal, intravesical, parenteral (e.g., subcutaneous, intramuscular, intradermal, duodenal, or intravenous), intralesional, oral, pulmonary, tracheal, nasal, transdermal, rectal, buccal, sublingual, vaginal, or duodenal administration.

[0035] Additionally, the use of the STMN2 oligonucleotide described above, or a pharmaceutically acceptable salt or pharmaceutical composition thereof, in the manufacture of medicines for the treatment of neurological diseases or neuropathy is disclosed herein. In various embodiments, neurological diseases are selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, and corticobasal degeneration (CBD). In various embodiments, neuropathy is chemotherapy-induced neuropathy.

[0036] Additionally, a method for treating a neurological disease or neuropathy in a patient requiring treatment for a neurological disease or neuropathy is disclosed herein, comprising administering a therapeutically effective amount of the STMN2 oligonucleotide described above or a pharmaceutically acceptable salt or pharmaceutical composition thereof to a patient requiring treatment for a neurological disease or neuropathy. In various embodiments, the neurological disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, and corticobasal degeneration (CBD). In various embodiments, the neuropathy is chemotherapy-induced neuropathy. In various embodiments, the pharmaceutical composition is administered topically, parenterally (e.g., subcutaneously, intramuscularly, intradermally, duodenally, or intravenously), into the lesion, orally, transpulmonaryly, rectally, buccally, sublingually, vaginally, tracheally, nasally, into the cistern, intrathecally, transdermally, or into the duodenum. In various embodiments, the pharmaceutical composition is administered intrathecally or into the cistern. In various embodiments, a therapeutically effective amount of STMN2 oligonucleotide or its pharmaceutical composition is administered intrathecally or into the cistern. In various embodiments, the patient is a human.

[0037] Additionally, STMN2 oligonucleotides or pharmaceutically acceptable salts thereof are disclosed herein for use as medicine in the treatment of neurological diseases or neuropathy. In certain embodiments, the present disclosure provides STMN2 oligonucleotides or pharmaceutically acceptable salts thereof for use in the treatment of neurological diseases or neuropathy. In various embodiments, neurological diseases are selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, and corticobasal degeneration (CBD). In various embodiments, neuropathy is chemotherapy-induced neuropathy.

[0038] Additionally, an STMN2 oligonucleotide or a pharmaceutically acceptable salt thereof comprising a linked nucleoside having the nucleobase sequence of any one of SEQ ID NO: 1-446, SEQ ID NO: 894-918, SEQ ID NO: 945-1390, or SEQ ID NO: 1392-1432 is disclosed herein, wherein the oligonucleotide is a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a phosphorodithioate linkage, a phosphotriester linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoradiamidate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, It comprises at least one nucleoside linkage selected from the group consisting of thionoalkylphosphonate linkage, thionoalkylphosphotriester linkage, thiophosphate linkage, selenophosphate linkage, and boranophosphate linkage, and / or, wherein at least one of the linked nucleosides is substituted with a component selected from the group consisting of 2'-O-(2-methoxyethyl) nucleoside (2'-O-methoxyethylribonucleoside (2'-MOE)), 2'-O-methyl nucleoside, 2'-deoxy-2'-fluoronucleoside, 2'-fluoro-β-D-arabinonucleoside, locking nucleoside (LNA), binding methoxyethyl (cMOE), binding ethyl (cET), and peptide nucleoside (PNA).

[0039] In various embodiments, at least one nucleoside linkage of the oligonucleotide is a phosphothioate linkage. In various embodiments, the oligonucleotide comprises three linked nucleosides linked via phosphodiester nucleoside linkages at the 5' end and three linked nucleosides linked via phosphodiester nucleoside linkages at the 3' end. In various embodiments, the oligonucleotide comprises one or more 2'-O-(2-methoxyethyl) nucleosides linked via phosphothioate nucleoside linkages. In various embodiments, the oligonucleotide comprises five linked nucleosides linked via phosphodiester nucleoside linkages. In various embodiments, each of the five linked nucleosides is a 2'-O-(2-methoxyethyl) (2'MOE) nucleoside. In various embodiments, each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl) (2'MOE) nucleoside. In various embodiments, all nucleoside linkages of the oligonucleotide are phosphorothioate linkages, and optionally each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0040] Additionally, pharmaceutical compositions comprising any of the oligonucleotides described above, or pharmaceutically acceptable salts thereof, and pharmaceutically acceptable excipients are disclosed herein. Additionally, STMN2 oligonucleotides or pharmaceutically acceptable salts thereof are disclosed herein capable of increasing, restoring, or stabilizing the expression of STMN2 mRNA and / or the activity and / or function of STMN2 protein, which enables the translation of functional STMN2 in cells or human patients with neurological diseases or disorders, wherein the level of increase, restoration, or stabilization of expression and / or activity and / or function is sufficient for the use of the oligonucleotides as medicine for the treatment of neurological diseases or disorders. In various embodiments, the oligonucleotides comprise one or more chiral centers and / or double bonds. In various embodiments, the oligonucleotides exist as stereoisomers selected from geometric isomers, enantiomers, and diastereomers.

[0041] Additionally, for patients requiring treatment of neurological diseases and / or neuropathy, a therapeutically effective amount of the above-described STMN2 oligonucleotide or its pharmaceutically acceptable salt or pharmaceutical composition, riluzole (Rilutek), edaravone (Radicava), rivastigmine, donepezil, galantamine, selective serotonin reuptake inhibitors, antipsychotics, cholinesterase inhibitors, memantine, benzodiazepine anxiolytics, AMX0035 (Elibrio), zilucoplan (RA101495), dual AON intrathecal administration (e.g., BIIB067, BIIB078), BIIB100, levodopa / carbidopa, dopaminergic agonists (e.g., ropinirol, pramipexole, rotigotine), medroxyprogesterone, KCNQ2 / KCNQ3 openers, anticonvulsants, and A method for treating a neurological disorder and / or neuropathy in a patient requiring treatment for a neurological disorder and / or neuropathy is disclosed herein, comprising administering in combination with a second therapeutic agent and / or therapy selected from psychostimulant agents (e.g., selected from respiratory management, physical therapy, occupational therapy, speech therapy, and nutritional support).

[0042] In various embodiments, neurological diseases are selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, and corticobasal degeneration (CBD). In various embodiments, the neuropathy is chemotherapy-induced neuropathy. Brief explanation of the drawing

[0043] Figure 1a is a schematic illustration of a portion of the STMN2 transcript and an STMN2 antisense oligonucleotide designed to target a specific portion of the STMN2 transcript. Figure 1b is another schematic illustration of a portion of the STMN2 transcript and an STMN2 antisense oligonucleotide designed to target a specific portion of the STMN2 transcript in SY5Y cells. Figure 1c is another schematic illustration of a portion of the STMN2 transcript and an STMN2 antisense oligonucleotide designed to target a specific portion of the STMN2 transcript in human motor neurons. In Figures 1a, 1b, and 1c, respectively, the solid line represents the tested STMN2 AON that increased STMN2-FL mRNA expression by more than 50% compared to TDP43 AON treated alone. The dotted line represents the tested STMN2 AON that increased STMN2-FL (full length) mRNA by less than 50% compared to TDP43 AON treated alone. Figure 2 is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 antisense, and the recovery of full-length STMN2 transcripts in the presence of six different STMN2 antisense oligonucleotides (QSN-36, QSN-55, QSN-177, QSN-203, QSN-244, and QSN-395). Figure 3 is a bar graph showing the results of RT-qPCR analysis of the decrease in STMN2 transcript mRNA levels with latent exons in the presence of TDP43 antisense and in the presence of six different STMN2 antisense oligonucleotides (QSN-173, QSN-181, QSN-197, QSN-215, QSN-385, and QSN-400). Figure 4 is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense and the recovery of full-length STMN2 transcripts in the presence of six different STMN2 antisense oligonucleotides (QSN-173, QSN-181, QSN-197, QSN-215, QSN-385, and QSN-400). Figure 5a is a bar graph showing the results of RT-qPCR analysis of STMN2 transcript mRNA levels with latent exons in the presence of TDP43 antisense, and the decrease in STMN2 transcript mRNA levels with latent exons in the presence of six different STMN2 antisense oligonucleotides (QSN-185, QSN-209, QSN-237, QSN-252, QSN-380, and QSN-390). Figure 5b is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense and the recovery of full-length STMN2 transcripts in the presence of six different STMN2 antisense oligonucleotides (QSN-185, QSN-209, QSN-237, QSN-252, QSN-380, and QSN-390). Figure 6a is a bar graph showing the results of RT-qPCR analysis of the decrease in STMN2 transcript mRNA levels with latent exons in the presence of TDP43 antisense and in the presence of two different STMN2 antisense oligonucleotides (QSN-144 and QSN-237) over two double experiments. Figure 6b is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense and the recovery of full-length STMN2 transcripts in the presence of two different STMN2 antisense oligonucleotides (QSN-144 and QSN-237) over two double experiments. Figure 7a is a bar graph showing the results of RT-qPCR analysis of the decrease in STMN2 transcript mRNA levels with latent exons in the presence of TDP43 antisense and in the presence of five different STMN2 antisense oligonucleotides (QSN-36, QSN-173, QSN-177, QSN-181, and QSN-185). Figure 7b is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense and the recovery of full-length STMN2 transcripts in the presence of five different STMN2 antisense oligonucleotides (QSN-36, QSN-173, QSN-177, QSN-181, and QSN-185). Figure 8a is a bar graph showing the results of RT-qPCR analysis of STMN2 transcript mRNA levels with latent exons in the presence of TDP43 antisense, and the reduction of STMN2 transcript mRNA levels with latent exons in the presence of five different STMN2 antisense oligonucleotides (QSN-197, QSN-203, QSN-237, QSN-380, and QSN-395). Figure 8b is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense and the recovery of full-length STMN2 transcripts in the presence of five different STMN2 antisense oligonucleotides (QSN-197, QSN-203, QSN-237, QSN-380, and QSN-395). Figure 9a is a bar graph showing the results of RT-qPCR analysis of the decrease in STMN2 transcript mRNA levels with latent exons in the presence of TDP43 siRNA and TDP43 antisense, and STMN2 transcript mRNA levels with latent exons in the presence of three different STMN2 antisense oligonucleotides (QSN-144, QSN-173, and QSN-237). Figure 9b is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts in the presence of three different STMN2 antisense oligonucleotides (QSN-144, QSN-173, and QSN-237). Figure 10a is a bar graph showing the results of RT-qPCR analysis of STMN2 transcript mRNA levels with latent exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of STMN2 transcript mRNA levels with latent exons across different doses of QSN-181 STMN2 antisense oligonucleotide. Figure 10b is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts across different doses of QSN-181 STMN2 antisense oligonucleotide. Figure 11a is a bar graph showing the results of RT-qPCR analysis of STMN2 transcript mRNA levels with latent exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of STMN2 transcript mRNA levels with latent exons across different doses of QSN-185 STMN2 antisense oligonucleotide. Figure 11b is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts across different doses of QSN-185 STMN2 antisense oligonucleotide. Figure 12a is a bar graph showing the results of RT-qPCR analysis of STMN2 transcript mRNA levels with latent exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of STMN2 transcript mRNA levels with latent exons across different doses of QSN-197 STMN2 antisense oligonucleotide. Figure 12b is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts across different doses of QSN-197 STMN2 antisense oligonucleotide. Figure 13a is a bar graph showing the results of RT-qPCR analysis of STMN2 transcript mRNA levels with latent exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of STMN2 transcript mRNA levels with latent exons across different doses of QSN-144 STMN2 antisense oligonucleotide. Figure 13b is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts across different doses of QSN-144 STMN2 antisense oligonucleotide. Figure 14a is a bar graph showing the results of RT-qPCR analysis of STMN2 transcript mRNA levels with latent exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of STMN2 transcript mRNA levels with latent exons across different doses of QSN-173 STMN2 antisense oligonucleotide. Figure 14b is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts across different doses of QSN-173 STMN2 antisense oligonucleotide. Figure 15a is a bar graph showing the results of RT-qPCR analysis of STMN2 transcript mRNA levels with latent exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of STMN2 transcript mRNA levels with latent exons across different doses of QSN-237 STMN2 antisense oligonucleotide. Figure 15b is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts across different doses of QSN-237 STMN2 antisense oligonucleotide. Figure 16 is a protein blot and quantified bar graph showing the normalized amount of STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts in the case of two different STMN2 antisense oligonucleotides (QSN-173 and QSN237). Figure 17a is a bar graph showing the results of RT-qPCR analysis of STMN2 transcript mRNA levels with latent exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of STMN2 transcript mRNA levels with latent exons using different variants of QSN-237 STMN2 antisense oligonucleotide. Figure 17b is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and recovery of full-length STMN2 transcripts using different variants of QSN-237 STMN2 antisense oligonucleotides. Figure 18a is a bar graph showing the results of RT-qPCR analysis of STMN2 transcript mRNA levels with latent exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of STMN2 transcript mRNA levels with latent exons using different variants of QSN-185 STMN2 antisense oligonucleotide. Figure 18b is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and recovery of full-length STMN2 transcripts using different variants of QSN-185 STMN2 antisense oligonucleotides. Figure 19a is a bar graph showing the results of RT-qPCR analysis of the decrease in STMN2 transcript mRNA levels with latent exons in the presence of TDP43 siRNA and TDP43 antisense, and the decrease in STMN2 transcript mRNA levels with latent exons using different variants of QSN-173 STMN2 antisense oligonucleotide. Figure 19b is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and recovery of full-length STMN2 transcripts using different variants of QSN-173 STMN2 antisense oligonucleotides. Figure 20a is a bar graph showing the results of RT-qPCR analysis of STMN2 transcript mRNA levels with latent exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of STMN2 transcript mRNA levels with latent exons using different variants of QSN-237 STMN2 antisense oligonucleotide. Figure 20b is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and recovery of full-length STMN2 transcripts using different variants of QSN-237 STMN2 antisense oligonucleotides. Figure 21a is a bar graph showing the results of RT-qPCR analysis of STMN2 transcript mRNA levels with latent exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of STMN2 transcript mRNA levels with latent exons using different variants of QSN-173 STMN2 antisense oligonucleotide. Figure 21b is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and recovery of full-length STMN2 transcripts using different variants of QSN-173 STMN2 antisense oligonucleotides. Figure 22a is a bar graph showing the results of RT-qPCR analysis of STMN2 transcript mRNA levels with latent exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of STMN2 transcript mRNA levels with latent exons using different variants of QSN-144 STMN2 antisense oligonucleotide. Figure 22b is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and recovery of full-length STMN2 transcripts using different variants of QSN-144 STMN2 antisense oligonucleotides. Figure 23 shows a dose-response curve illustrating the increasing recovery of full-length STMN2 transcripts by increasing concentrations of STMN2 AON. Figure 24a shows a Western blot assay demonstrating a qualitative increase in full-length STMN2 protein in response to higher concentrations of STMN2 AON. Figure 24b shows the quantified levels of full-length STMN2 protein normalized to GAPDH in response to different concentrations of STMN2 AON. Figure 25a is a bar graph showing the results of RT-qPCR analysis of STMN2 transcript mRNA levels with latent exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of STMN2 transcript mRNA levels with latent exons using different QSN-144 STMN2 AON and AON variants. Figure 25b is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts using different QSN-144 STMN2 AON and AON variants. Figure 26a is a bar graph showing the results of RT-qPCR analysis of STMN2 transcript mRNA levels with latent exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of STMN2 transcript mRNA levels with latent exons using different QSN-173 STMN2 AON and AON variants. Figure 26b is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts using different QSN-173 STMN2 AON and AON variants. Figure 27a is a bar graph showing the results of RT-qPCR analysis of STMN2 transcript mRNA levels with latent exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of STMN2 transcript mRNA levels with latent exons using different QSN-185 STMN2 AON and AON variants. Figure 27b is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts using different QSN-185 STMN2 AON and AON variants. Figure 28a is a bar graph showing the results of RT-qPCR analysis of STMN2 transcript mRNA levels with latent exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of STMN2 transcript mRNA levels with latent exons using different QSN-237 STMN2 AON and AON variants. Figure 28b is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts using different QSN-237 STMN2 AON and AON variants. Figure 29a is a bar graph showing the results of RT-qPCR analysis of STMN2 transcript mRNA levels with latent exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of STMN2 transcript mRNA levels with latent exons using different STMN2 AONs (QSN-31, QSN-41, and QSN-46). Figure 29b is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts using different STMN2 AONs (QSN-31, QSN-41, and QSN-46). Figure 30 is a bar graph showing the reversal of potential exon induction in human motor neurons using QSN-237 STMN2 antisense oligonucleotide in terms of even increasing proteasome inhibition. Figures 31a and 31b show bar graphs showing the results of RT-qPCR analysis of STMN2 transcript mRNA levels with latent exons and STMN2 full-length mRNA levels, demonstrating a decrease in STMN2 transcript mRNA levels with latent exons and a recovery of full-length STMN2 transcripts using different STMN2 AON and AON variants. Figure 32 is a bar graph showing the results of a Western blot analysis of STMN2 protein levels, demonstrating the recovery of full-length STMN2 protein using different STMN2 AON and AON variants. Figure 33a is a bar graph showing the results of RT-qPCR analysis of STMN2 transcript mRNA expression with latent exons in human motor neurons, demonstrating a decrease in STMN2 transcript mRNA levels with latent exons using different STMN2 AONs (QSN-31, QSN-41, and QSN-46). Figure 33b is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels, demonstrating the recovery of full-length STMN2 transcripts using different STMN2 AONs (QSN-31, QSN-41, and QSN-46). Figure 34a is a bar graph showing the results of RT-qPCR analysis of STMN2 transcript mRNA expression with latent exons in human motor neurons, demonstrating a decrease in STMN2 transcript mRNA levels with latent exons using different STMN2 AONs (QSN-146, QSN-150, and QSN-169). Figure 34b is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels, demonstrating the recovery of full-length STMN2 transcripts using different STMN2 AONs (QSN-146, QSN-150, and QSN-169). Figure 34c is a bar graph showing the results of RT-qPCR analysis of STMN2 transcript mRNA expression with latent exons in human motor neurons, demonstrating a decrease in STMN2 transcript mRNA levels with latent exons using different STMN2 AONs (QSN-170, QSN-171, and QSN-172). Figure 34d is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels, demonstrating the recovery of full-length STMN2 transcripts using different STMN2 AONs (QSN-170, QSN-171, and QSN-172). Figure 34e is a bar graph showing the results of RT-qPCR analysis of STMN2 transcript mRNA expression with latent exons in human motor neurons, demonstrating a decrease in STMN2 transcript mRNA levels with latent exons using different STMN2 AON (QSN-249). Figure 34f is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels, demonstrating the recovery of full-length STMN2 transcripts using different STMN2 AON (QSN-249). Specific details for implementing the invention

[0044] Features and other details of the present disclosure will now be described in greater detail. Specific terms used in the specification, embodiments, and appended claims are gathered herein. These definitions should be read in light of the remainder of the present disclosure and understood by a person skilled in the art. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by a person skilled in the art.

[0045] The terms “treat,” “therapy,” “therapeutic,” and “therapeutic” are used herein to mean obtaining a desired pharmacological and / or physiological effect. The effect may be therapeutic in terms of partially or completely curing the disease and / or adverse effects attributable to the disease. As used herein, the term “therapy” encompasses any treatment of a disease in mammals, particularly humans, and includes (a) suppressing the disease, i.e., preventing an increase in the severity or category of the disease; (b) alleviating the disease, i.e., causing partial or complete remission of the disease; or (c) preventing the recurrence of the disease, i.e., preventing a return to an active state of the disease after a previous successful treatment of disease symptoms or treatment of the disease.

[0046] “Prevention” includes delaying the onset of clinical symptoms, complications, or biochemical signs of a condition, disorder, disease, or pathology occurring in a subject who suffers from or may be susceptible to the condition, disorder, disease, or pathology but has not yet experienced or exhibited clinical or subclinical symptoms of the condition, disorder, disease, or pathology. “Prevention” includes prophylactic treatment of clinical symptoms, complications, or biochemical signs of a condition, disorder, disease, or pathology occurring in or in the subject, as well as prophylactic treatment of a condition, disorder, disease, or pathology occurring in or in the subject.

[0047] The terms “pharmaceutical acceptable carrier” or “pharmaceutical acceptable excipient” as used interchangeably herein refer to any and all solvents, dispersion media, coatings, isotonic agents, absorption retardants, etc. that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutical active substances is widely known in the art. The composition may also contain other active compounds that provide supplementary, additional, or enhanced therapeutic functions.

[0048] As used herein, the term “pharmaceutical composition” refers to a composition comprising at least one biologically active compound as disclosed herein, e.g., STMN2 antisense oligonucleotide (AON), formulated with one or more pharmaceutically acceptable excipients.

[0049] The terms “individual,” “patient,” or “subject” are used interchangeably and include any animal, including mammals, preferably mice, rats, other rodents, rabbits, dogs, cats, pigs, cattle, sheep, horses, or non-human primates, most preferably humans. The compounds of the present invention may be administered to mammals, e.g., humans, but may also be administered to other mammals, e.g., animals requiring veterinary treatment, e.g., livestock (e.g., dogs, cats, etc.), farm animals (e.g., cattle, sheep, pigs, horses, etc.), and laboratory animals (e.g., rats, mice, guinea pigs, non-human primates, etc.). In some embodiments, the mammals treated in the method of the present invention are preferably mammals requiring adjustment of STMN2 expression and / or activity.

[0050] The terms "STMN2 oligonucleotide," "STMN2 antisense oligonucleotide," or "STMN2 AON" refer to oligonucleotides capable of increasing, restoring, or stabilizing full-length STMN2 activity, e.g., full-length STMN2 expression, e.g., full-length STMN2 mRNA and / or full-length STMN2 protein expression. Generally, STMN2 oligonucleotides reduce the levels of mature STMN2 transcripts containing latent exons by targeting STMN2 transcripts containing latent exons. A patient with ALS, FTD, ALS with FTD, or another neurological or motor neuron disease may be a patient diagnosed with the disease or exhibiting symptoms of the disease. A patient with ALS, FTD, ALS with FTD, or another neurological or motor neuron disease may be a patient who has previously suffered from the disease and, after experiencing recovery or complete or partial remission of the disease and / or disease symptoms, has experienced a complete or partial recurrence of the disease or disease symptoms. Patients suffering from ALS, FTD, ALS with FTD, or another neurological or motor neuron disease or condition may have gene mutations associated with signs of the disease or condition.For example, patients with ALS have SOD1, C9orf72, Ataxin 2 (ATXN2), Charged Polyendoplasmic Reticulum Protein 2B (CHMP2B), Dinactin 1 (DCTN1), Human Epidermal Growth Factor Receptor 4 (ERBB4), FIG4 Phosphoinositide 5-Phosphatase (FIG4), NIMA-Associated Kinase 1 (NEK1), Heteronucleoprotein A1 (HNRNPA1), Neurofilament Heavy Chain (NEFH), Peripherin (PRPH), TAR DNA Binding Protein 43 (TDP43 or TARDBP), Sarcoma Fusion (FUS), Ubiquilin-2 (UBQLN2), Kinesin Family Member 5A (KIF5A), Valosin-Containing Protein (VCP), ALS2, Senataxin (SETX), Sigma Non-Opioid Intracellular Receptor 1 (SIGMAR1), Motor Neuron Survival 1, Patients may have a gene mutation in any of the following: telomer (SMN1), spastic paraplegia 11, autosomal recessive (SPG11), transient receptor translocation cation channel subfamily M member 7 (TRPM7), vesicle-associated membrane protein-associated protein B / C (VAPB), angiogenin (ANG), prophylline-1 (PFN1), matrin-3 (MATR3), coiled-coil-helix-coil-helix domain-containing 10 (CHCHD10), tubulin, alpha 4A (TUBA4A), TBK1, C21orf2, sequestosome-1 (SQSTM1, also known as ubiquitin-binding protein p62), and / or optineurin (OPTN), in particular, the mutations here are associated with a high risk of developing ALS or ALS.

[0051] Patients at risk of ALS, FTD, ALS with FTD, or other neurological or motor neuron diseases may include patients with a family history of the disease or a genetic predisposition to the disease (e.g., patients with gene mutations associated with a high risk of the disease), or patients exposed to environmental factors that increase the risk of the disease. For example, if a patient has a mutation in any of the genes encoding SOD1, C9orf72, ATXN2, CHMP2B, DCTN1, ERBB4, FIG4, HNRNPA1, NEFH, PRPH, NEK1, TDP43, FUS, UBQLN2, KIF5A, VCP, ALS2, SETX, SIGMAR1, SMN1, SPG11, TRPM7, VAPB, ANG, PFN1, MATR3, CHCHD10, TUBA4A, TBK1, SQSTM1, C21orf2 and / or OPTN, the patient may be at risk of ALS, particularly if the mutation is associated with a high risk of developing ALS or ALS. Patients at risk may also include patients diagnosed with a disease or condition having a high comorbidity with ALS, FTD, ALS with FTD, or another neurological or motor neuron disease (e.g., patients with dementia significantly associated with a higher odds of a family history of ALS, FTD, and medullary-onset ALS (see [Trojsi, F., et al. (2017) "Comorbidity of dementia with amyotrophic lateral sclerosis (ALS): insights from a large multicenter Italian cohort" J Neurol 264: 2224-31]).

[0052] As used herein, "STMN2" (also known as superior ganglion-10 protein, statmin-like 2, SCGN10, SCG10, neuron growth-associated protein, neuron-specific growth-associated protein, or protein SCG10 (superior ganglion NEAR neuron-specific 10)) refers to the gene or gene product (e.g., protein or mRNA transcript (including free-mRNA) encoded by the gene) and its allelic variants identified by Entrez Gene ID number 11075, as well as orthologs found in non-human species (e.g., non-human primates or mice).

[0053] In this specification, the term “therapeutic effective dose” means an amount of a targeted inhibitor of an STMN2 transcript containing a latent exon that elicits a biological or medical response in a tissue, system, animal, or human being sought by a researcher, veterinarian, physician, or other clinician. The inhibitor of the STMN2 transcript containing a latent exon according to the present invention is administered at a therapeutic effective dose to treat and / or prevent a disease, pathology, disorder, or condition, e.g., ALS, FTD, ALS accompanied by FTD, or another motor neuron disease or neurological disease or pathology. Alternatively, the therapeutic effective dose of the inhibitor of the STMN2 transcript containing a latent exon is an amount required to achieve the desired therapeutic and / or preventive effect, e.g., an amount that results in the prevention or reduction of symptoms associated with a disease associated with reduced STMN2 activity in motor neurons.

[0054] The phrase "oligonucleotide targeting STMN2 transcript" refers to an oligonucleotide that binds to the STMN2 transcript. In various embodiments, the oligonucleotide binds to a region of the STMN2 transcript. Exemplary regions of the STMN2 transcript are presented in Table 1, which represent sequences corresponding to regions of branching points (e.g., branching points 1, 2, and 3), 3' splice acceptor region, ESE binding region, TDP43 binding site, potential exon, and poly-A region. In various embodiments, the oligonucleotide binds to a region of the STMN2 transcript having a potential exon, said region being located less than 75 nucleotides upstream or downstream of any of the branching points (e.g., branching points 1, 2, and 3), 3' splice acceptor region, ESE binding region, TDP43 binding site, potential exon, and poly-A region.

[0055] As used herein, the term “pharmaceutical acceptable salt(s)” refers to salts of acidic or basic groups that may be present in the STMN2 transcript inhibitor containing a potential exon used in the composition of the present invention. The STMN2 transcript inhibitor containing a potential exon included in the composition of the present invention, which is inherently basic, may form a wide variety of salts with various inorganic and organic acids. Acids that can be used to prepare pharmaceutically acceptable acid addition salts of these basic compounds are non-toxic acid addition salts, i.e., salts containing pharmacologically acceptable anions, e.g., non-limitingly maleates, oxalates, chlorides, bromides, iodides, nitrates, sulfates, bisulfates, phosphates, acid phosphates, isonicotinates, acetates, lactates, salicylates, citrates, tartrates, oleates, tannates, pantothenates, bitartrates, ascorbates, succinates, maleates, gentisinates, fumarates, gluconates, glucuronates, saccharates, formates, benzoates, glutamates, methanesulfonates, ethanesulfonates, benzenesulfonates, p-toluenesulfonates, and pamoates (i.e., It forms a 1,1'-methylene-bis-(2-hydroxy-3-naphthoate)) salt. Inhibitors of STMN2 transcripts containing potential exons included in the composition of the present invention containing amino moiety may form pharmaceutically acceptable salts with various amino acids in addition to the acid mentioned above. Compounds included in the composition of the present invention that are acidic by nature may form various pharmacologically acceptable cations and base salts. Examples of such salts include alkali metal or alkaline earth metal salts, in particular calcium, magnesium, sodium, and lithium salts. Pharmaceutically acceptable salts of the present disclosure include, for example, pharmaceutically acceptable salts of STMN2 AON comprising the nucleobase sequence of any of SEQ ID NO: 1-446, SEQ ID NO: 894-918, SEQ ID NO: 945-1390, or SEQ ID NO: 1392-1432.

[0056] Inhibitors of STMN2 transcripts containing potential exons of the present disclosure may contain one or more chiral centers, groups, linkages, and / or double bonds and thus may exist as stereoisomers, e.g., geometric isomers, enantiomers, or diastereomers. As used herein, the term "stereoisomer" consists of all geometric isomers, enantiomers, or diastereomers. These compounds may be designated by the symbol "R" or "S" (or "Rp" or "Sp") depending on the coordination of substituents around the stereogenic atom, e.g., the stereogenic carbon, phosphorus, or sulfur atom. In some embodiments, one or more linkages of the compound may have Rp or Sp coordination (e.g., one or more phosphorothioate linkages have Rp or Sp coordination). The coordination of each phosphorothioate linkage may be independent of another phosphorothioate linkage (e.g., one phosphorothioate linkage has Rp coordination, and a second phosphorothioate linkage has Sp coordination). The present invention encompasses various stereoisomers of these compounds and mixtures thereof. Stereoisomers include enantiomers and diastereomers. Mixtures of enantiomers or diastereomers may be designated as “(±”) in nomenclature, but a person skilled in the art will recognize that the structure may implicitly represent a chiral center. Individual stereoisomers of STMN2 transcript inhibitors containing the potential exons of the present invention may be synthesized from commercially available starting materials containing an asymmetric or stereogenic center, or may be prepared by a decomposition method widely known to a person skilled in the art following the preparation of a racemic mixture.These decomposition methods are exemplified by (1) attachment of a mixture of enantiomers to a chiral auxiliary, recrystallization or separation by chromatography of the resulting mixture of diastereomers and liberation of an optically pure product from the auxiliary, (2) salt formation using an optically active decomposition agent, or (3) direct separation of a mixture of optical enantiomers on a chiral chromatography column. A mixture of stereoisomers may also be decomposed into its constituent stereoisomers by widely known methods, such as chiral-phase gas chromatography, chiral-phase supercritical fluid chromatography, chiral-phase mock moving-bed chromatography, chiral-phase high-performance liquid chromatography, crystallization of the compound as a chiral salt complex, or crystallization of the compound in a chiral solvent. Stereoisomers may also be obtained from stereoisomerically pure intermediates, reagents, and catalysts by widely known asymmetric synthesis methods.

[0057] Inhibitors of STMN2 transcripts containing potential exons disclosed herein may exist in a solvated form with pharmaceutically acceptable solvents, such as water, ethanol, etc., as well as in a nonsolvated form, and the present invention is intended to encompass both solvated and nonsolvated forms.

[0058] The present disclosure also covers the isotope-labeled compounds of the present invention identical to those described herein (i.e., isotope-labeled inhibitors of STMN2 transcripts containing potential exons), except that one or more atoms are replaced by atoms having an atomic mass or mass number different from that which is abundant in nature. Examples of isotopes that may be incorporated into the compounds of the present invention are isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine, and chlorine, e.g., respectively 2 H, 3 H, 11 C, 13 C, 14 C, 15 N, 18 O, 17O, 31 P, 32 P, 33 P, 35 S, 18 F and 36 It contains Cl.

[0059] Initiated compounds labeled with specific isotopes (e.g., 3 H and 14 C-labeled) is useful for testing the distribution of compounds and / or substrate tissues. Tritium (i.e., 3 H) and carbon-14 (i.e., 14 C) Isotopes are particularly desirable due to their ease of manufacture and detection sensitivity. Additionally, heavier isotopes, such as deuterium (i.e., 2 Substitution with H) can provide specific therapeutic benefits derived from greater metabolic stability (e.g., increased in vivo half-life or reduced dosage requirements), and thus may be desirable in some situations.

[0060] As used herein, “2’-O-(2-methoxyethyl” (also 2’-MOE and 2’-O(CH2)2OCH3 and MOE) refers to an O-methoxyethyl modification of the 2’ position of a furanose ring. 2’-O-(2-methoxyethyl) is used interchangeably as “2’-O-methoxyethyl” in this disclosure. The sugar moiety within the nucleoside modified by 2’-MOE is the modified sugar.

[0061] As used herein, "2'-MOE nucleoside" (also 2'-O-(2-methoxyethyl) nucleoside) means a nucleoside containing a 2'-MOE modified sugar moiety.

[0062] As used herein, “2’-substituted nucleoside” means a nucleoside comprising a substituent other than H or OH at the 2’-position of a furanose ring. In certain embodiments, the 2’-substituted nucleoside comprises a nucleoside having a noncyclic sugar modification.

[0063] "5-methylcytosine" (5-MeC) as used herein refers to cytosine modified by a methyl group attached to the 5 position. 5-methylcytosine (5-MeC) is a modified nucleobase.

[0064] As used herein, "bicyclic sugar" refers to a furanose ring modified by the cross-linking of two atoms. A bicyclic sugar is a modified sugar.

[0065] As used herein, “bicyclic nucleoside” (also BNA) refers to a nucleoside that forms a bicyclic ring system by having a sugar moiety comprising a crosslink connecting two carbon atoms of a sugar ring. In certain embodiments, the crosslink connects the 4’-carbon and the 2’-carbon of the sugar ring.

[0066] As used herein, "cap structure" or "terminal cap moiety" refers to a chemical modification incorporated into one of the ends of an antisense compound.

[0067] "cEt" or "binding ethyl" as used herein refers to a non-cyclic nucleoside having a sugar moiety containing a crosslink connecting the 4'-carbon and the 2'-carbon, wherein the crosslink has the chemical formula: 4'-CH(CH3)-O-2'.

[0068] As used herein, "binding ethyl nucleoside" (also cEt nucleoside) means a nucleoside containing a non-cyclic sugar moiety containing a 4'-CH(CH3)-O-2' crosslink.

[0069] As used herein, “internucleoside linkage” refers to a covalent linkage between adjacent nucleosides in an oligonucleotide. In some embodiments, as used herein, “non-natural linkage” refers to a “modified internucleoside linkage.”

[0070] As used herein with respect to oligonucleotides, "adjacent" refers to immediately adjacent nucleosides, nucleobases, sugar moietyes, or linkages between nucleosides. For example, "adjacent nucleobases" means immediately adjacent nucleobases in a sequence.

[0071] As used herein, “locked nucleic acid,” “LNA,” or “LNA nucleoside” refers to a nucleic acid monomer having a crosslink (e.g., methylene, ethylene, aminooxy, or oxyimino crosslink) that connects two carbon atoms at the 4’ and 2’ positions of a nucleoside sugar unit to form a cyclic sugar. Examples of such cyclic sugars include, but are not limited to, (A) α-L-methyleneoxy (4’-CH2-O-2’) LNA, (B) β-D-methyleneoxy (4’-CH2-O-2’) LNA, (C) ethyleneoxy (4’-(CH2)2-O-2’) LNA, (D) aminooxy (4’-CH2-ON(R)-2’) LNA, and (E) oxyamino (4’-CH2-N(R)-O-2’) LNA.

[0072] The LNA compounds used herein have at least one crosslink between the 4' and 2' positions of the sugar, wherein each crosslink is independently -[C(R1)(R2)] n -, -C(R1)=C(R2)-, -C(R1)=N-, -C(=NR1)-, -C(=O)-, -C(=S)-, -O-, -Si(R1)2-, -S(=O) x - and -N(R1)- include 1 or 2 to 4 linkers independently selected from; where x is 0, 1 or 2; n is 1, 2, 3 or 4; and each R1 and R2 is independently H, a protecting group, a hydroxyl, a C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 alkynyl, substituted C2-C 12 Alkynyl, C5-C 20Aryl, substituted C5-C 20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1) or sulfoxyl (S(=O)-J1); and each J1 and J2 are independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 It includes, but is not limited to, aminoalkyl or protecting group compounds.

[0073] Examples of 4'-2' crosslinking groups included within the definition of LNA include, but are not limited to, one of the following chemical formulas: -[C(R1)(R2)] n -, -[C(R1)(R2)] n -O-, -C(R1R2)-N(R1)-O-, or -C(R1R2)-ON(R1)-. Additionally, other crosslinking groups included in the definition of LNA are 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2-ON(R1)-2', and 4'-CH2-N(R1)-O-2'- crosslinking groups, where each R1 and R2 is independently H, a protecting group, or a C1-C 12 It is an alkyl.

[0074] Additionally, the definition of LNA according to the present invention includes an LNA that forms a cyclic sugar moiety by forming a crosslink through the connection of a 2'-hydroxyl group of a ribosyl sugar ring to a 4' carbon atom of the sugar ring. The crosslink may also be a methylene (-CH2-) group connecting the 2' oxygen atom and the 4' carbon atom, in which case the term methyleneoxy(4'-CH2-O-2') LNA is used. Furthermore, in the case of a cyclic sugar moiety having an ethylene crosslink group at this position, the term ethyleneoxy(4'-CH2CH2-O-2') LNA is used. α-L-methyleneoxy(4'-CH2-O-2') LNA, which is an isomer of methyleneoxy(4'-CH2-O-2'), is also encompassed within the definition of LNA used herein.

[0075] The "hotspot region" as used herein is a specific range of nucleobases on a target nucleic acid applicable to oligomer compound-mediated coordination of target nucleic acid splicing.

[0076] As used herein, "hybridization" means the pairing or annealing of complementary oligonucleotides and / or nucleic acids. Although not limited to a specific mechanism, the most common hybridization mechanism involves hydrogen bonding, which may be Watson-Crick, Whistine, or reverse Whistine hydrogen bonds between complementary nucleobases.

[0077] As used herein, "increasing the amount of activity" refers to inducing full-length mature mRNA and / or protein expression and / or greater activity through more transcriptional expression and more accurate splicing compared to transcriptional expression or activity in untreated or control samples.

[0078] As used herein, "mismatch" or "non-complementary nucleobase" refers to a case where the nucleobase of the first nucleic acid cannot pair with the corresponding nucleobase of the second or target nucleic acid.

[0079] As used herein, "linked nucleosides" are nucleosides linked through linkages between nucleosides in adjacent sequences (i.e., no additional nucleosides exist between the linked nucleosides).

[0080] As used herein, “modified internucleoside linkage” refers to a substitution or any change from a naturally occurring internucleoside linkage (e.g., a phosphodiester internucleoside linkage). “Phosphorothioate linkage” is a modified internucleoside linkage in which one of the non-crosslinked oxygen atoms of a phosphodiester internucleoside linkage is replaced by a sulfur atom.

[0081] As used herein, “modified nucleobase” means any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. Examples of modified nucleobases include 5-methylcytosine, pseudouridine, or 5-methoxyuridine. “Non-modified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0082] As used herein, "modified nucleoside" means a nucleoside having an independently modified sugar moiety and / or a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of five non-modified nucleosides. Modified nucleosides include abasic nucleosides lacking a nucleobase.

[0083] As used herein, "modified oligonucleotide" means an oligonucleotide comprising at least one modified nucleoside linkage, a modified sugar, and / or a modified nucleobase.

[0084] As used herein, “modified sugar” or “modified sugar moiety” means a modified furanosyl sugar moiety, or a modified sugar moiety having something other than a furanosyl moiety that can connect a nucleobase to another group, such as an internucleoside linkage, a conjugate group, or a terminal group of an oligonucleotide.

[0085] As used herein, "monomer" means a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.

[0086] The term "motif" as used herein refers to patterns of unmodified and modified nucleosides in antisense compounds.

[0087] As used herein, "natural sugar moiety" refers to a sugar moiety found in DNA (2'-H) or RNA (2'-OH).

[0088] As used herein, "naturally occurring internucleoside linkage" refers to a phosphodiester linkage from 3' to 5'.

[0089] As used herein, "non-complementary nucleobases" refers to a pair of nucleobases that do not form hydrogen bonds with each other or otherwise do not support hybridization.

[0090] As used herein, "nucleic acid" refers to a molecule composed of monomeric nucleotides. Nucleic acids include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acid, double-stranded nucleic acid, small interfering ribonucleic acid (siRNA), short-hairpin RNA (shRNA), and microRNA (miRNA).

[0091] As used herein, "nucleobase" refers to a heterocyclic moiety capable of forming a pair with a base of another nucleic acid.

[0092] As used herein, "nucleobase complementarity" refers to a nucleobase capable of forming a base pair with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, a complementary nucleobase refers to a nucleobase of an antisense compound capable of forming a base pair with a nucleobase of its target nucleic acid. For example, if a nucleobase at a specific position of an antisense compound can hydrogen bond with a nucleobase at a specific position of a target nucleic acid, the hydrogen bonding position between the oligonucleotide and the target nucleic acid is considered complementary to that nucleobase pair.

[0093] As used herein, "nuclear base sequence" means a sequence of adjacent nuclei independent of any sugar, linkage, and / or nucleobase modification.

[0094] As used herein, "nucleoside" means a nucleobase connected to a sugar. The term "nucleoside" also includes "modified nucleosides" having independently modified sugar moiety and / or modified nucleobase.

[0095] As used herein, “nucleoside mimic” includes structures used to replace a sugar or a sugar and a base and a linkage, but not necessarily, at one or more positions of an oligomer compound, e.g., morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo, or tricyclo sugar mimics, e.g., nucleoside mimics having a non-furanose sugar unit. Nucleoside mimics include structures used to replace a nucleoside and a linkage at one or more positions of an oligomer compound, e.g., peptide nucleoside or morpholino (-N(H)-C(=O)-O- or other morpholino linked by non-phosphodiester linkages). Sugar substitutes overlap with the slightly broader term nucleoside mimics but are intended to indicate the replacement of only the sugar unit (furanose ring). The tetrahydropyranyl ring provided herein is an example of a sugar substitute in which a furanose sugar group is replaced by a tetrahydropyranyl ring system. "Mimic" refers to a substituted group instead of a sugar, nucleobase, and / or nucleoside link. Generally, a mimic is used instead of a sugar or a sugar-nucleoside link combination, and the nucleobase is retained for hybridization to a selected target.

[0096] As used herein, "nucleotide" means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

[0097] As used herein, "oligomer compound" or "oligomer" means a polymer of linked monomer subunits capable of hybridizing to at least one region of a nucleic acid molecule.

[0098] As used herein, "oligonucleotide" means a polymer of linked nucleosides that can be modified or unmodified independently of each other.

[0099] strain

[0100] A nucleoside is a base-sugar combination. The nucleobase portion of a nucleoside (also known as a base) is typically a heterocyclic base moiety. A nucleotide is a nucleoside that additionally contains a phosphate group covalently linked to the sugar portion of the nucleoside. In the case of nucleosides containing a pentopranosyl sugar, the phosphate group may be linked to the 2', 3', or 5' hydroxyl moiety of the sugar. Oligonucleotides are formed through covalent linkages between adjacent nucleosides to form linear polymer oligonucleotides. Within the oligonucleotide structure, the phosphate group is typically referred to as forming the internucleoside linkages of the oligonucleotide.

[0101] Modifications to antisense compounds involve internucleoside linkages, sugar moiety, or substitution or change in nucleobases. Modified antisense compounds are often preferred over their natural forms due to desirable properties, such as enhanced cellular uptake, enhanced affinity for nucleic acid targets, increased stability in the presence of nucleases, or increased inhibitory activity.

[0102] Chemically modified nucleosides can also be used to increase the binding affinity of shortened or truncated antisense oligonucleotides to their target nucleic acids. Consequently, equivalent results can often be obtained using shorter antisense compounds containing these chemically modified nucleosides.

[0103] Modified nucleoside linkage

[0104] The naturally occurring nucleoside linkages of RNA and DNA are phosphodiester linkages from 3' to 5'. Antisense compounds having one or more modified, i.e., non-naturally occurring nucleoside linkages are often selected over antisense compounds having naturally occurring nucleoside linkages because of desirable properties, such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

[0105] Oligonucleotides having modified internucleoside linkages include internucleoside linkages containing a phosphorus atom as well as internucleoside linkages that do not contain a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates. Methods for preparing phosphorus-containing and non-phosphorus-containing linkages are widely known.

[0106] In certain embodiments, the antisense compound targeting STMN2 nucleic acid comprises one or more modified nucleoside linkages. In certain embodiments, the modified nucleoside linkages are interspersed throughout the antisense compound. In certain embodiments, the modified nucleoside linkages are phosphothioate linkages. In certain embodiments, each nucleoside linkage of the antisense compound is a phosphothioate nucleoside linkage. In certain embodiments, the antisense compound targeting STMN2 nucleic acid comprises at least one phosphodiester linkage and at least one phosphothioate linkage.

[0107] Modified sugar moiety

[0108] Antisense compounds may optionally contain one or more nucleosides in which the sugar group is modified. Such sugar-modified nucleosides may confer enhanced nuclease stability, increased binding affinity, or some other beneficial biological properties to the antisense compound. In certain embodiments, the nucleoside comprises a chemically modified ribofuranose ring moiety. Examples of chemically modified ribofuranose rings are, but not limited to, the addition of substituents (including 5' and 2' substituents), the cross-linking of non-identical ring atoms to form cyclic nucleic acids (BNA), and the substitution of ribosyl ring oxygen atoms with S, N(R), or C(R1)(R2) (R, R1, and R2 are each independently H, C1-C 12 It includes alkyl or protecting groups) and combinations thereof. Examples of chemically modified sugars include 2'-F-5'-methyl-substituted nucleosides (for other disclosed 5',2'-bis-substituted nucleosides, see PCT International Application WO 2008 / 101157 published August 21, 2008) or substitution of a ribosyl ring oxygen atom with S or CF2 and further substitution at the 2'-position (see U.S. Patent Application Publication US2005-0130923 published June 16, 2005) or alternatively, 5'-substitution of BNA (see PCT International Application WO 2007 / 134181 published November 22, 2007, where LNA is substituted, for example, with a 5'-methyl or 5'-vinyl group).

[0109] Examples of nucleosides having a modified sugar moiety include, but are not limited to, nucleosides comprising 5'-vinyl, 5'-methyl (R or 5), 4'-S, 2'-F, 2'-OCH3, 2'-OCH2CH3, 2'-OCH2CH2F, and 2'-O(CH2)2OCH3 substituents. Substituents at the 2' position are also allyl, amino, azido, thio, O-allyl, O-C1-C 10 Alkyl, OCF3, OCH2F, O(CH2)2S CH3, O(CH2)2-ON(Rm )(R n ), O-CH2-C(=O)-N(R m )(R n ) and O-CH2-C(=O)-N(R1)-(CH2)2-N(R m )(R n It can be selected from ), where each R l , R m and R n is independently H or substituted or unsubstituted C1-C 10 It is an alkyl.

[0110] Further examples of modified sugar moiety include 2'-OMe modified sugar moiety, non-cyclic sugar moiety, 2'-O-(2-methoxyethyl) (2'MOE), 2'-deoxy-2'-fluoronucleoside, 2'-fluoro-β-D-arabinonucleoside, locking nucleic acid (LNA), binding ethyl 2'-4'-crosslinked nucleic acid (cEt) (4'-CH(CH3)-O-2'), S-binding ethyl (S-cEt) 2'-4'-crosslinked nucleic acid, 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CH2OCH3)-O-2' ("binding MOE" or "cMOE"), hexitol nucleic acid (HNA), and tricyclic analogs (e.g., tcDNA).

[0111] As used herein, "bicyclic nucleoside" refers to a modified nucleoside comprising a bicyclic sugar moiety. Examples of bicyclic nucleosides include, but are not limited to, nucleosides comprising a crosslink between 4' and 2' ribosyl ring atoms. In certain embodiments, the antisense compound provided herein comprises one or more bicyclic nucleosides comprising a 4' and 2' crosslink. Examples of such 4' and 2' crosslinked bicyclic nucleosides include, but are not limited to, one of the following formulas: 4'-(CH2)-O-2' (LNA); 4'-(CH2)-S-2'; 4'-(CH2)2-O-2' (ENA); 4'-CH(CH3)-O-2' and 4'-CH(CH2OCH3)-O-2' (and their analogs, see U.S. Patent No. 7,399,845 granted July 15, 2008); 4'-C(CH3)(CH3)-O-2' (and their analogs, see International Application Publication WO / 2009 / 006478 published January 8, 2009); 4'-CH2-N(OCH3)-2' (and their analogs, see International Application Publication WO / 2008 / 150729 published December 11, 2008); 4'-CH2-ON(CH3)-2' (published September 2, 2004, see Published U.S. Patent Application Publication US2004-0171570); 4'-CH2-N(R)-O-2' (where R is H, C1-C 12 alkyl or protecting group) (see U.S. Patent No. 7,427,672 granted September 23, 2008); 4'-CH2-C(H)(CH3)-2' (see reference [Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134]); and 4'-CH2-C-(=CH2)-2' (and its analogs, see International Application Publication WO 2008 / 154401 published December 8, 2008).

[0112] Further reports on non-cyclic nucleosides can also be found in the published literature (e.g., Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. USA, 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129(26) 8362-8379; Elayadi et al., Curr. Opinion Invest. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; and Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243]; U.S. Patent Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 7,034,133; 7,053,207; 7,399,845; 7,547,684; and 7,696,345; U.S. Patent Publication No. US2008-0039618; See US2009-0012281; U.S. Patent Serial Nos. 60 / 989,574; 61 / 026,995; 61 / 026,998; 61 / 056,564; 61 / 086,231; 61 / 097,787; and 61 / 099,844; published PCT international applications WO 1994 / 014226; WO 2004 / 106356; WO 2005 / 021570; WO 2007 / 134181; WO 2008 / 150729; WO 2008 / 154401; and WO 2009 / 006478).For example, each of the above-mentioned noncyclic nucleosides having one or more stereochemical sugar coordinations, including α-L-ribofuranose and β-D-ribofuranose, can be prepared (see PCT international application PCT / DK98 / 00393 disclosed as WO 99 / 14226 on March 25, 1999).

[0113] In certain embodiments, the cyclic sugar moiety of the BNA nucleoside comprises, but is not limited to, a compound having at least one crosslink between the 4' and 2' positions of the pentopranosyl sugar moiety, wherein such crosslink is independently -[C(R a )(R b )] n -, -C(R a )=C(R b )-, -C(R a )=N-, -C(=O)-, -C(=NR a )-, -C(=S) -, -O-, -Si(R a )2-, -S(=O) x - and -N(R a Includes 1 or 2 to 4 connectors independently selected from )-;

[0114] Here

[0115] x is 0, 1, or 2, and;

[0116] n is 1, 2, 3, or 4, and;

[0117] Each R a and R b is independently H, protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1) or sulfoxyl (S(=O)-J1);

[0118] Each J1 and J2 independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 It is an aminoalkyl or protecting group.

[0119] In certain embodiments, the crosslinking of the non-cyclic sugar moiety is -[C(R a )(R b )] n -, -[-[C(R a )(R b )] n -O-, -C(R a R b )-N(R)-O- or -C(R a R b )-ON(R)-. In certain embodiments, the crosslinks are 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2'-, where each R is independently H, a protecting group, or a C1-C 12 It is alkyl, and each R a and R bis independently H, protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1) or sulfoxyl (S(=O)-J1).

[0120] In certain embodiments, non-cyclic nucleosides are further defined by isomer coordination. For example, nucleosides containing a 4'-2' methylene-oxy crosslink may be α-L coordination or β-D coordination. Previously, α-L-methyleneoxy(4'-CH2-O-2') BNA was incorporated into antisense oligonucleotides exhibiting antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).

[0121] In certain embodiments, the noncyclic nucleoside comprises, but is not limited to, α-L-methyleneoxy (4'-CH2-O-2') BNA, β-D-methyleneoxy (4'-CH2-O-2') BNA, ethyleneoxy (4'-(CH2)2-O-2) BNA, aminooxy (4'-CH2-ON(R)-2') BNA, oxyamino (4'-CH2-N(R)-O-2') BNA, methyl(methyleneoxy) (4'-CH(CH3)-O-2') BNA, methylene-thio (4'-CH2-S-2') BNA, methylene-amino (4'-CH2-N(R)-2') BNA, methyl carbocyclic (4'-CH2-CH(CH3)-2') BNA and propylene carbocyclic (4'-(CH2)3-2') BNA.

[0122] The present disclosure provides, in some embodiments, a method for treating, resolving, or preventing a neurological disease, e.g., ALS, FTD, or ALS accompanied by FTD, or a method for treating, resolving, or preventing a neurological disease, condition, or disorder characterized by symptoms associated with a neurological disease, e.g., ALS, FTD, or ALS accompanied by FTD, comprising, in some embodiments, a method of administering to a patient a pharmaceutically acceptable composition, e.g., a pharmaceutically acceptable agent, comprising one or more inhibitors of STMN2 transcripts containing latent exons. Inhibitors of STMN2 transcripts containing latent exons may increase, restore, or stabilize STMN2 activity, e.g., STMN2 activity and / or STMN2 expression levels, e.g., STMN2 mRNA and / or protein expression.

[0123] The present disclosure also provides pharmaceutical compositions comprising an inhibitor of an STMN2 transcript containing a latent exon as disclosed herein, formulated with one or more excipients accepted for pharmaceutical or cosmetic use. These formulations are suitable for oral, sublingual, intratracheal, intranasal, transdermal, pulmonary, intrathecal, intravesical, parenteral (e.g., subcutaneous, intramuscular, intradermal, duodenal, or intravenous) or intralesional administration, suitable for transmucosal (e.g., buccal, vaginal, and rectal) use, or suitable for topical use, such as as part of a composition suitable for topical application to the skin and / or mucous membranes, e.g., in the form of a gel, paste, wax, cream, spray, liquid, foam, lotion, ointment, topical solution, transdermal patch, powder, vapor, or tincture. In any given case, the most suitable form of administration will depend on the degree and severity of the condition to be treated and the properties of the specific inhibitor of the STMN2 transcript containing the latent exon to be used.

[0124] The present disclosure also provides a pharmaceutical composition comprising an inhibitor of an STMN2 transcript comprising a potential exon (e.g., an STMN2 AON comprising the nucleobase sequence of any of SEQ ID NO: 1-446, SEQ ID NO: 894-918, SEQ ID NO: 945-1390, or SEQ ID NO: 1392-1432) or a pharmaceutically acceptable salt thereof.

[0125] The present disclosure also provides a method comprising the use of a pharmaceutical composition comprising an inhibitor of an STMN2 transcript containing a latent exon as disclosed herein (e.g., any one of STMN2 AONs SEQ ID NO: 1-446, SEQ ID NO: 894-918, SEQ ID NO: 945-1390, or SEQ ID NO: 1392-1432), formulated with one or more pharmaceutically acceptable excipients. An exemplary composition provided herein comprises a composition comprising an inhibitor of an STMN2 transcript containing a latent exon as described above and one or more pharmaceutically acceptable excipients. The formulation comprises one suitable for oral, sublingual, intratracheal, intranasal, transdermal, pulmonary, intrathecal, intravesical, parenteral (e.g., subcutaneous, intramuscular, intradermal, duodenal, or intravenous) or intralesional administration, transmucosal (e.g., buccal, vaginal, and rectal), or topical use. In any given case, the most appropriate form of administration will depend on the clinical symptoms, complications, or biochemical signs of the condition, disorder, disease, or pathological condition to be prevented in the subject; the condition, disorder, disease, or pathological condition to be prevented in the subject; and / or the nature of the specific compound and / or composition to be used.

[0126] Inhibitors of STMN2 transcripts containing latent exons

[0127] In certain embodiments, STMN2 levels (e.g., STMN2 mRNA or full-length STMN2 protein levels) and / or activity (e.g., biological activity, e.g., STMN2 activity) may be increased, restored, or stabilized using a compound or composition that targets an STMN2 gene product (e.g., STMN2 free-mRNA) containing a potential exon.

[0128] In some embodiments, inhibitors of STMN2 transcripts containing potential exons may be nucleotide-based inhibitors of STMN2 (e.g., STMN2 shRNA, STMN2 siRNA, STMN2 PNA, STMN2 LNA, 2'-O-methyl (2'OMe) STMN2 antisense oligonucleotide (AON), 2'-O-(2-methoxyethyl) (2'MOE) STMN2 AON, or STMN2 morpholino oligomers (e.g., phosphorodiamidate morpholino (PMO))) or compositions comprising such compounds, but are not limited thereto.In some embodiments, the inhibitor of STMN2 is an antisense oligonucleotide (AON) comprising: 2'OMe (e.g., an STMN2 AON comprising one or more 2'OMe modified sugars), MOE (e.g., an STMN2 AON comprising one or more MOE modified sugars (e.g., 2'-MOE)), PNA (e.g., an STMN2 AON comprising one or more N-(2-aminoethyl)-glycine units connected by amide bonds or carbonylmethylene linkages as repeating units instead of a sugar-phosphate backbone), LNA (e.g., an STMN2 AON comprising one or more lock riboses and may be a mixture of 2'-deoxynucleotides or 2'OMe nucleotides), c-ET (e.g., an STMN2 AON comprising one or more cET sugars), cMOE (e.g., an STMN2 AON comprising one or more cMOE sugars), or a morpholino oligomer (e.g., comprising one or more PMOs). STMN2 AON containing a backbone), deoxy-2'-fluoronucleosides (e.g., STMN2 AON containing one or more 2'-fluoro-β-D-arabinonucleosides), ENA (e.g., STMN2 AON containing one or more ENA-modified sugars), HNA (e.g., STMN2 AON containing one or more HNA-modified sugars), or tcDNA (e.g., STMN2 AON containing one or more tcDNA-modified sugars).In some embodiments, the STMN2 AON comprises one or more phosphothioate linkages, phosphodiester linkages, phosphotriester linkages, methylphosphonate linkages, phosphoramidate linkages, phosphodiamidate morpholino (PMO) linkages (“morpholino linkages”), peptide nucleic acid (PNA) linkages, or any combination of phosphothioate linkages, phosphodiester linkages, phosphotriester linkages, methylphosphonate linkages, phosphoramidate linkages, phosphodiamidate morpholino (PMO) (morpholino) linkages, and PNA linkages. In some embodiments, the STMN2 AON comprises one or more phosphothioate linkages, phosphodiester linkages, or a combination of phosphothioate and phosphodiester linkages.

[0129] STMN2 antisense treatment

[0130] Antisense therapeutics are a class of nucleic acid-based compounds that can be used to modify STMN2 mRNA or STMN2 transcripts (e.g., STMN2 free-mRNA containing latent exons). Antisense therapeutics may be single- or double-stranded deoxyribonucleic acid (DNA)-based, ribonucleic acid (RNA)-based, or DNA / RNA chemical analog compounds. Generally, antisense therapeutics are designed to include a nucleobase sequence that is complementary or nearly complementary to the mRNA or free-mRNA sequence to facilitate binding between the antisense therapeutic and the free-mRNA or mRNA transcribed from a given gene. In certain embodiments, antisense therapeutics act by binding to mRNA or free-mRNA, thereby inhibiting protein translation and / or altering free-mRNA splicing into mature mRNA and / or (e.g., by preventing the binding of appropriate proteins such as splicing activator proteins), or by causing the destruction of mRNA. In certain embodiments, the antisense therapeutic nucleobase sequence is complementary to a portion of the sense sequence of the targeted gene or mRNA. In certain embodiments, the STMN2 antisense therapeutic described herein is an oligonucleotide-based compound comprising an oligonucleotide sequence complementary to the pre-mRNA sense or a portion thereof. In certain embodiments, the STMN2 antisense therapeutic described herein may also be a nucleotide chemical analog-based compound. Synthetic oligonucleotides as therapeutic agents have evolved for a wide range of applications involving numerous modes. These applications include ribozymes, small interfering RNA (siRNA), microRNA, aptamers, non-coding RNA, splicing modulation, targeted toxic repeats, gene editing, and immunomodulation. The STMN2 oligonucleotide (STMN2 AON) of this disclosure prevents anomalous or mis-splicing by targeting the STMN2 transcript (e.g., STMN2 pre-mRNA (e.g., Sequence ID No. 944)).

[0131] An antisense oligonucleotide (AON) is a short oligonucleotide-based sequence comprising an oligonucleotide sequence complementary to a target RNA sequence. In certain embodiments, the AON is 8 to 50 nucleotide long, e.g., 8, 10, 15, 20, 25, 30, 35, 40, 45, or 45 nucleotide long. In certain embodiments, the AON is 25 nucleotide long. In certain embodiments, the AON may comprise chemically modified nucleosides (e.g., 2'-O-methylated nucleosides or 2'-O-(2-methoxyethyl) nucleosides (2'-O-methoxyethylribonucleosides (2'-MOE))), as well as linkages between modified nucleosides (e.g., phosphorothioate linkages). In certain embodiments, the STMN2 AON described herein comprises an oligonucleotide sequence complementary to the STMN2 RNA sequence. In certain embodiments, the STMN2 AON described herein may include a chemically modified nucleoside and a link between the modified nucleosides (e.g., a phosphorothioate link).

[0132] Peptide nucleic acid (PNA) is a short artificial synthetic polymer having a structure that mimics DNA or RNA. PNA comprises a backbone composed of repeating N-(2-aminoethyl)-glycine units linked by peptide bonds. In certain embodiments, the STMN2 PNA described herein may be used as an antisense therapeutic agent that binds to the STMN2 RNA sequence with high specificity and increases, restores, and / or stabilizes STMN2 levels (e.g., STMN2 mRNA or protein levels) and / or activity (e.g., biological activity, e.g., STMN2 activity).

[0133] Locked nucleic acid (LNA) is an oligonucleotide sequence comprising one or more modified RNA nucleotides in which the ribose moiety is modified by an additional crosslink connecting the 2' oxygen and the 4' carbon. LNA is believed to have a higher Tm than similar oligonucleotide sequences. In certain embodiments, the STMN2 LNA described herein may be used as an antisense therapeutic agent that binds to the STMN2 RNA sequence with high specificity, inhibits the early polyadenylation of STMN2 free-mRNA, and increases, restores, and / or stabilizes STMN2 levels (e.g., STMN2 mRNA or protein levels) and / or activity (e.g., biological activity, e.g., STMN2 activity).

[0134] Morpolino oligomers are oligonucleotide compounds comprising DNA bases attached to the backbone of a methylenemorpholine ring connected via a phosphorodiamidate group. In certain embodiments, the morphpolino oligomers of the present invention may be designed to bind to a specific STMN2 free-mRNA sequence of interest to inhibit the premature polyadenylation of the free-mRNA and to increase, restore, and / or stabilize STMN2 levels (e.g., STMN2 mRNA or protein levels) and / or activity (e.g., biological activity, e.g., STMN2 activity). In certain embodiments, the STMN2 morphpolino oligomers described herein may be used as antisense therapeutic agents that bind to the STMN2 free-mRNA sequence with high specificity, inhibit the premature polyadenylation of the STMN2 free-mRNA, and increase, restore, and / or stabilize STMN2 levels (e.g., STMN2 mRNA or protein levels) and / or activity (e.g., biological activity, e.g., STMN2 activity). In certain embodiments, the STMN2 morpholino oligomers described herein may also be used to bind to STMN2 free-mRNA sequences to alter STMN2 free-mRNA splicing and STMN2 gene expression, and to increase, restore, and / or stabilize STMN2 levels (e.g., STMN2 mRNA or protein levels) and / or activity (e.g., biological activity, e.g., STMN2 activity).

[0135] In some embodiments, the STMN2 antisense therapeutic comprises an STMN2 AON comprising: 2'OMe (e.g., an STMN2 AON comprising one or more 2'OMe modified sugars), MOE (e.g., an STMN2 AON comprising one or more MOE modified sugars (e.g., 2'-MOE)), PNA (e.g., an STMN2 AON comprising one or more N-(2-aminoethyl)-glycine units connected by amide bonds or carbonylmethylene linkages as repeating units instead of a sugar-phosphate backbone), LNA (e.g., an STMN2 AON comprising one or more lock riboses and may be a mixture of 2'-deoxynucleotides or 2'OMe nucleotides), c-ET (e.g., an STMN2 AON comprising one or more cET sugars), cMOE (e.g., an STMN2 AON comprising one or more cMOE sugars), or a morpholino oligomer (e.g., comprising one or more PMOs). STMN2 AON containing a backbone), deoxy-2'-fluoronucleosides (e.g., STMN2 AON containing one or more 2'-fluoro-β-D-arabinonucleosides), ENA (e.g., STMN2 AON containing one or more ENA-modified sugars), HNA (e.g., STMN2 AON containing one or more HNA-modified sugars), or tcDNA (e.g., STMN2 AON containing one or more tcDNA-modified sugars). In some embodiments, STMN2 AON comprises one or more phosphorothioate linkages, phosphodiester linkages, phosphotriester linkages, methylphosphonate linkages, phosphoramidate linkages, morpholino linkages, PNA linkages, or any combination of phosphorothioate linkages, phosphodiester linkages, phosphotriester linkages, methylphosphonate linkages, phosphoramidate linkages, morpholino linkages, and PNA linkages.In some embodiments, STMN2 AON comprises one or more phosphorothioate linkages, phosphodiester linkages, or a combination of phosphorothioate and phosphodiester linkages.

[0136] STMN2 antisense oligonucleotide

[0137] In certain embodiments, for example, the STMN2 antisense oligonucleotide disclosed herein may be an oligonucleotide sequence of length 5 to 100 nucleotides, for example, length 10 to 40 nucleotides, for example, length 14 to 40 nucleotides, length 10 to 30 nucleotides, for example, length 14 to 30 nucleotides, for example, length 14 to 25 or length 15 to 22 nucleotides, or length 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. In certain embodiments, the AON is 25 nucleotides long. In certain embodiments, the STMN2 antisense oligonucleotide (AON) described herein is a short synthetic oligonucleotide sequence complementary to the STMN2 transcript (e.g., free-mRNA), a portion of the STMN2 transcript, or the STMN2 gene sequence.

[0138] In some embodiments, the STMN2 AON comprises a nucleobase sequence that is 80%, 85%, 90%, 95%, or 100% complementary to an STMN2 transcript (e.g., STMN2 free-mRNA) containing a potential exon. In some embodiments, the nucleobase sequence of the STMN2 antisense oligonucleotide is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 adjacent nucleosizes that are 80%, 85%, 90%, 95%, or 100% complementary to equal length portions of nucleosates within a portion of the STMN2 transcript containing the potential exon. AON binding specificity can be evaluated through the measurement of parameters, such as dissociation constants, melting temperature (Tm), or other criteria, such as changes in protein or RNA expression levels, or through other assays that measure STMN2 activity or expression.

[0139] In some embodiments, STMN2 AON may comprise a non-duplexed oligonucleotide. In some embodiments, STMN2 AON may comprise a duplex of two oligonucleotides, wherein the first oligonucleotide comprises a nucleobase sequence that is completely or nearly completely complementary to the STMN2 free-mRNA sequence, and the second oligonucleotide comprises a nucleobase sequence that is complementary to the nucleobase sequence of the first oligonucleotide.

[0140] In some embodiments, the STMN2 AON may target STMN2 free-mRNA containing latent exons produced from STMN2 genes of one or more species. For example, the STMN2 AON may target STMN2 free-mRNA containing latent exons of mammalian STMN2 genes, e.g., human (i.e., Homo sapiens) STMN2 genes. In certain embodiments, the STMN2 AON targets human STMN2 free-mRNA containing latent exons. In some embodiments, the STMN2 AON includes a nucleotide sequence complementary to the nucleotide sequence of the STMN2 gene or STMN2 free-mRNA containing latent exons or a portion thereof.

[0141] The STMN2 AON described herein comprises an antisense oligonucleotide comprising the oligonucleotide sequences listed in Table 1 below:

[0142] Table 1. STMN2 AON sequence

[0143]

[0144]

[0145]

[0146]

[0147]

[0148]

[0149]

[0150]

[0151]

[0152]

[0153]

[0154]

[0155]

[0156]

[0157]

[0158]

[0159]

[0160]

[0161]

[0162]

[0163]

[0164] * At least one nucleoside linkage of the nucleobase sequence is selected from phosphorothioate linkage, alkyl phosphate linkage, phosphorodithioate linkage, phosphotriester linkage, alkylphosphonate linkage, 3-methoxypropyl phosphonate linkage, methylphosphonate linkage, aminoalkylphosphotriester linkage, alkylene phosphonate linkage, phosphinate linkage, phosphoramidate linkage, phosphoramidothoate linkage, phosphorodiamidate linkage (e.g., phosphorodiamidate morpholino (PMO), 3'-amino ribose or 5'-amino ribose), aminoalkylphosphoramidate linkage, thiophosphoramidate linkage, thionoalkylphosphonate linkage, thionoalkylphosphotriester linkage, thiophosphate linkage, selenophosphate linkage, and boranophosphate linkage.

[0165] Additional STMN2 AON sequences are identified in Table 2 below:

[0166] Table 2. Additional STMN2 AON sequences

[0167]

[0168]

[0169]

[0170]

[0171]

[0172]

[0173]

[0174]

[0175]

[0176]

[0177]

[0178] * At least one nucleoside linkage of the nucleobase sequence is selected from phosphorothioate linkage, alkyl phosphate linkage, phosphorodithioate linkage, phosphotriester linkage, alkylphosphonate linkage, 3-methoxypropyl phosphonate linkage, methylphosphonate linkage, aminoalkylphosphotriester linkage, alkylene phosphonate linkage, phosphinate linkage, phosphoramidate linkage, phosphorodiamidate linkage, aminoalkylphosphoramidate linkage, thiophosphoramidate linkage, thionoalkylphosphonate linkage, thionoalkylphosphotriester linkage, thiophosphate linkage, selenophosphate linkage, and boranophosphate linkage.

[0179] An exemplary STMN2 AON sequence is identified in Table 3 below:

[0180] Table 3. Exemplary STMN2 AON sequence

[0181]

[0182]

[0183] * At least one nucleoside linkage of the nucleobase sequence is selected from phosphorothioate linkage, alkyl phosphate linkage, phosphorodithioate linkage, phosphotriester linkage, alkylphosphonate linkage, 3-methoxypropyl phosphonate linkage, methylphosphonate linkage, aminoalkylphosphotriester linkage, alkylene phosphonate linkage, phosphinate linkage, phosphoramidate linkage, phosphoramidothoate linkage, phosphorodiamidate linkage (e.g., phosphorodiamidate morpholino (PMO), 3'-amino ribose or 5'-amino ribose), aminoalkylphosphoramidate linkage, thiophosphoramidate linkage, thionoalkylphosphonate linkage, thionoalkylphosphotriester linkage, thiophosphate linkage, selenophosphate linkage, and boranophosphate linkage.

[0184] In some embodiments, all internucleoside linkages of the STMN2 AON oligonucleotides listed in Table 3 are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. For example, in some embodiments, all internucleoside linkages of the QSN-31 STMN2 AON (sequence identification number: 31) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-36 STMN2 AON (SEQ ID: 36) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-55 STMN2 AON (SEQ ID: 55) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-144 STMN2 AON (SEQ ID: 144) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-173 STMN2 AON (SEQ ID: 173) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.In some embodiments, all internucleoside linkages of the QSN-177 STMN2 AON (SEQ ID No.: 177) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-181 STMN2 AON (SEQ ID No.: 181) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-185 STMN2 AON (SEQ ID No.: 185) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-197 STMN2 AON (SEQ ID No.: 197) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-203 STMN2 AON (sequence identification number: 203) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.In some embodiments, all internucleoside linkages of the QSN-209 STMN2 AON (SEQ ID: 209) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-215 STMN2 AON (SEQ ID: 215) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-237 STMN2 AON (SEQ ID: 237) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-244 STMN2 AON (SEQ ID: 244) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-252 STMN2 AON (sequence identification number: 252) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.In some embodiments, all internucleoside linkages of the QSN-380 STMN2 AON (SEQ ID: 380) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-385 STMN2 AON (SEQ ID: 385) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-390 STMN2 AON (SEQ ID: 390) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-395 STMN2 AON (SEQ ID: 395) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-400 STMN2 AON (sequence identification number: 400) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.In some embodiments, all internucleoside linkages of the QSN-169 STMN2 AON (SEQ ID: 169) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-170 STMN2 AON (SEQ ID: 170) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-171 STMN2 AON (SEQ ID: 171) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-172 STMN2 AON (SEQ ID: 172) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-249 STMN2 AON (sequence identification number: 249) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0185] In some embodiments, all internucleoside linkages of the STMN2 AON oligonucleotides listed in Table 3 are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and none of the "C"s are replaced with 5-MeC. For example, in some embodiments, all internucleoside linkages of the QSN-31 STMN2 AON (SEQ ID: 31) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-36 STMN2 AON (SEQ ID: 36) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-55 STMN2 AON (SEQ ID: 55) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-144 STMN2 AON (sequence identification number: 144) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and none of the "C"s are replaced with 5-MeC.In some embodiments, all internucleoside linkages of the QSN-173 STMN2 AON (SEQ ID No.: 173) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-177 STMN2 AON (SEQ ID No.: 177) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-181 STMN2 AON (SEQ ID: 181) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-185 STMN2 AON (SEQ ID: 185) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-197 STMN2 AON (sequence identification number: 197) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and none of the "C"s are replaced with 5-MeC.In some embodiments, all internucleoside linkages of the QSN-203 STMN2 AON (SEQ ID No.: 203) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-209 STMN2 AON (SEQ ID No.: 209) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-215 STMN2 AON (SEQ ID No.: 215) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-237 STMN2 AON (SEQ ID No.: 237) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-244 STMN2 AON (sequence identification number: 244) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and none of the "C"s are replaced with 5-MeC.In some embodiments, all internucleoside linkages of the QSN-252 STMN2 AON (SEQ ID No.: 252) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-380 STMN2 AON (SEQ ID No.: 380) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-385 STMN2 AON (SEQ ID No.: 385) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-390 STMN2 AON (SEQ ID No.: 390) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-395 STMN2 AON (sequence identification number: 395) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and none of the "C"s are replaced with 5-MeC.In some embodiments, all internucleoside linkages of the QSN-400 STMN2 AON (SEQ ID No.: 400) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and none or any "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-169 STMN2 AON (SEQ ID No.: 169) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and none or any "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-170 STMN2 AON (SEQ ID: 170) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-171 STMN2 AON (SEQ ID: 171) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and none of the "C"s are replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-172 STMN2 AON (sequence identification number: 172) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and no "C" is replaced with 5-MeC.In some embodiments, all internucleoside linkages of the QSN-249 STMN2 AON (sequence identification number: 249) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and none of the "C"s are replaced with 5-MeC.

[0186] Additional exemplary STMN2 AON sequences are identified in Table 4 below:

[0187] Table 4. Additional exemplary STMN2 AON sequences

[0188]

[0189] * At least one nucleoside linkage of the nucleobase sequence is selected from phosphorothioate linkage, alkyl phosphate linkage, phosphorodithioate linkage, phosphotriester linkage, alkylphosphonate linkage, 3-methoxypropyl phosphonate linkage, methylphosphonate linkage, aminoalkylphosphotriester linkage, alkylene phosphonate linkage, phosphinate linkage, phosphoramidate linkage, phosphoramidothoate linkage, phosphorodiamidate linkage (e.g., phosphorodiamidate morpholino (PMO), 3'-amino ribose or 5'-amino ribose), aminoalkylphosphoramidate linkage, thiophosphoramidate linkage, thionoalkylphosphonate linkage, thionoalkylphosphotriester linkage, thiophosphate linkage, selenophosphate linkage, and boranophosphate linkage.

[0190] Battlefield STMN2 Warrior Body

[0191] As described herein, the present disclosure provides a method for restoring full-length STMN2 transcript expression in cells, comprising exposing cells to an inhibitor of STMN2 transcripts containing latent exons or contacting cells with an inhibitor of STMN2 transcripts containing latent exons. Such inhibitors may sterically block the splice mechanism and / or sterically mimic TDP43 binding and / or inhibit the early polyadenylation of STMN2 free-mRNA and / or increase, restore, and / or stabilize the level of full-length STMN2 transcripts.

[0192] In various embodiments, the full-length STMN2 transcript comprises the sequence of accession number NM_001199214.2 identified below as sequence identification number: 1433.

[0193]

[0194] In various embodiments, the full-length STMN2 protein comprises the amino acid sequence of accession number NP_001186143.1 identified by sequence identification number: 1434 below.

[0195]

[0196] In various embodiments, the full-length STMN2 transcript comprises the sequence of accession number NM_007029.4 identified below as sequence identification number: 1435.

[0197]

[0198] In various embodiments, the full-length STMN2 protein comprises the amino acid sequence of accession number NP_008960.2 identified by sequence identification number: 1436 below.

[0199]

[0200] In various embodiments, the full-length STMN2 transcript comprises the sequence of accession number XM_005251142.2 identified below as sequence identification number: 1437.

[0201]

[0202] In various embodiments, the full-length STMN2 protein comprises the amino acid sequence of accession number XP_005251199 identified below as sequence identification number: 1438.

[0203]

[0204] STMN2 transcript with latent exons

[0205] In one embodiment, an STMN2 transcript having a latent exon may include the sequence provided as sequence identification number: 944.

[0206]

[0207] In one embodiment, the STMN2 transcript having a latent exon may include a free-mRNA STMN2 transcript. In one embodiment, the STMN2 transcript having a latent exon may include the sequence provided as sequence identification number: 1391.

[0208]

[0209]

[0210]

[0211]

[0212]

[0213]

[0214]

[0215]

[0216]

[0217]

[0218]

[0219]

[0220]

[0221]

[0222]

[0223]

[0224]

[0225]

[0226]

[0227]

[0228] The STMN2 latent exon sequence within the STMN2 transcript is provided as sequence identification number: 447.

[0229]

[0230] In various embodiments, the STMN2 transcript having latent exons shares 90-100% identity with sequence identification number: 944. In various embodiments, the STMN2 transcript having latent exons shares 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, at least 99% or 100% identity with sequence identification number: 944.

[0231] STMN2 antisense oligonucleotide targeting a portion of the STMN2 transcript

[0232] In various embodiments, the STMN2 AON disclosed herein targets a specific portion of an STMN2 transcript containing a latent exon. The presented sequence identification number: 944 describes one example of an STMN2 transcript containing a latent exon. In some embodiments, the STMN2 transcript containing a latent exon may share at least 80%, 85%, 90%, 95%, or 100% identity with the nucleobase sequence of sequence identification number: 944.

[0233] In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript in which the specific portion of the STMN2 transcript has a length of 10 nucleotides. In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript in which the specific portion of the STMN2 transcript has a length of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides.

[0234] In some embodiments, STMN2 AON is a specific portion of the STMN2 transcript at positions 121-144, 144-168, 146-170, 150-170, 150-172, 150-174, 169-193, 169-189, 169-191, 170-190, 170-192, 171-191, 171-193, 172-192, 172-194, 170-194, 171-195, 172-196, 173-197, 185-209, 197-221, 237-261, 249-273, 252-276 of sequence identification number: 944 or Targets a specific portion of the STMN2 transcript that includes any one of 276-300. In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript that includes any one of positions 144-164, 144-166, 145-167, 146-166, 146-168, 147-165, or 148-168 of sequence identification number: 944. In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript in which the specific portion of the STMN2 transcript comprises any one of positions 173-191, 173-193, 173-195, 173-197, 175-195, 175-197, 177-197, or 179-197 of sequence identification number: 944. In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript in which the specific portion of the STMN2 transcript comprises any one of positions 185-205, 187-209, 189-209, 185-207, 197-217, 197-219, or 191-209 of sequence identification number: 944.In some embodiments, STMN2 AON targets a specific portion of the STMN2 transcript in which the specific portion of the STMN2 transcript comprises any one of positions 237-255, 237-257, 237-259, 239-259, 239-261, 241-261, 237-257, 249-269, 249-271, 252-272, 252-274, or 243-261 of sequence identification number: 944.

[0235] In some embodiments, STMN2 AON is a specific portion of the STMN2 transcript at positions 121-144, 144-168, 146-170, 150-170, 150-172, 150-174, 169-193, 169-189, 169-191, 170-190, 170-192, 171-191, 171-193, 172-192, 172-194, 170-194, 171-195, 172-196, 173-197, 185-209, 197-221, 237-261, 249-273, 252-276 of sequence identification number: 944 or Targets a specific portion of the STMN2 transcript that consists of any one of 276-300. In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript that consists of any one of positions 144-164, 144-166, 145-167, 146-166, 146-168, 147-165, or 148-168 of sequence identification number: 944. In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript in which the specific portion of the STMN2 transcript consists of any one of positions 173-191, 173-193, 173-195, 173-197, 175-195, 175-197, 177-197, or 179-197 of sequence identification number: 944. In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript in which the specific portion of the STMN2 transcript consists of any one of positions 185-205, 187-209, 189-209, 185-207, 197-217, 197-219, or 191-209 of sequence identification number: 944.In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript in which the specific portion of the STMN2 transcript consists of any one of positions 237-255, 237-257, 237-259, 239-259, 239-261, 241-261, 237-257, 249-269, 249-271, 252-272, 252-274, or 243-261 of sequence identification number: 944.

[0236] In various embodiments, STMN2 AON is at positions 144-164, 144-166, 145-167, 146-166, 146-168, 147-165, 148-168, 173-191, 173-193, 173-195, 173-197, 175-195, 175-197, 177-197, 179-197, 185-205, 185-207, 197-217, 197-219, 187-209, 189-209, 191-209, 237-255, 237-257, 237-259 of sequence identification number: 944, It includes a nucleus sequence comprising at least 10 adjacent nucleus portions that are complementary to the equal length portion of a nucleus within any one of 239-259, 239-261, 241-261, 237-257, 249-269, 249-271, 252-272, 252-274, or 243-261. In various embodiments, STMN2 AON is at positions 144-164, 144-166, 145-167, 146-166, 146-168, 147-165, 148-168, 173-191, 173-193, 173-195, 173-197, 175-195, 175-197, 177-197, 179-197, 185-205, 185-207, 197-217, 197-219, 187-209, 189-209, 191-209, 237-255, 237-257, 237-259 of sequence identification number: 944, It includes a nucleus sequence comprising at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 adjacent nucleus portions that are complementary to the equal length portion of a nucleus within any one of 239-259, 239-261, 241-261, 237-257, 249-269, 249-271, 252-272, 252-274, or 243-261.

[0237] In various embodiments, the oligonucleotide comprises a linked nucleoside having at least 19 adjacent nucleoside sequences that are at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) for an equal length portion of a transcript having at least 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) for sequence identification number: 944 or for an adjacent 19 to 50 nucleoside portion of sequence identification number: 944, where at least one nucleoside link of the linked nucleoside is a non-natural link. In various embodiments, the oligonucleotide comprises a linked nucleoside having at least 19, 20, 21, 22, 23, 24, or 25 adjacent nucleoside sequences that are at least 90% complementary (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) to an equal length portion of a transcript having at least 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to at least 19, 20, 21, 22, 23, 24, or 25 adjacent nucleoside sequences for at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to 19 to 50 adjacent nucleoside portions of 19 to 505 nucleoside portions of 19 to 55 nucleoside portions of 19 to 55 nucleoside portions of 19 to 55 nucleoside portions of 19 to 55 The connection is a non-natural connection.

[0238] In various embodiments, the oligonucleotide comprises a linked nucleoside having at least 19 adjacent nucleobase sequences that include a portion of at least 10 adjacent nucleobases that share at least 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) with an equal length portion of any one of sequence identification number: 1-446, sequence identification number: 894-918, sequence identification number: 945-1390, or sequence identification number: 1392-1432. In various embodiments, the oligonucleotide comprises a linked nucleoside having at least 19 adjacent nucleobase sequences comprising portions of at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 adjacent nucleobases that share at least 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) with an equal length portion of any one of sequence identification number: 1-446, sequence identification number: 894-918, sequence identification number: 945-1390, or sequence identification number: 1392-1432.

[0239] In various embodiments, the oligonucleotide is sequence identification number: 31, 36, 41, 46, 55, 144, 146, 150, 169, 170, 171, 172, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 390, 395, 400, 975, 980, 985, 999, 1088, 1090, 1094, 1113, 1114, 1115, 1116, 1117, 1121, 1125, 1129, 1141, It comprises a linked nucleoside having at least 19 adjacent nucleobase sequences that include at least 10 adjacent nucleobase portions that share at least 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) with an equal length portion of any one of 1147, 1153, 1159, 1181, 1188, 1193, 1196, 1324, 1329, 1334, 1339, or 1344, wherein at least one nucleoside link of the linked nucleoside is a non-natural link.In various embodiments, the oligonucleotide is sequence identification number: 31, 36, 41, 46, 55, 144, 146, 150, 169, 170, 171, 172, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 390, 395, 400, 975, 980, 985, 999, 1088, 1090, 1094, 1113, 1114, 1115, 1116, 1117, 1121, 1125, 1129, 1141, A linked nucleoside comprising at least 19 adjacent nucleobase sequences including portions of at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 adjacent nucleobases that share at least 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) with an equal length portion of any one of 1147, 1153, 1159, 1181, 1188, 1193, 1196, 1324, 1329, 1334, 1339, or 1344 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity), wherein at least one of the linked nucleosides Nucleoside linkages are non-natural linkages.

[0240] In various embodiments, the oligonucleotide comprises a linked nucleoside having at least 19 adjacent nucleobase sequences, wherein the nucleobase sequence comprises at least 10 adjacent nucleobase portions that share at least 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) for equal length portions of either Sequence Identification No.: 894-918 or Sequence Identification No.: 1392-1432. In various embodiments, the oligonucleotide comprises a linked nucleoside having at least 20, 21, 22, 23, 24, or 25 adjacent nucleobase sequences, wherein the nucleobase sequence comprises at least 10 adjacent nucleobase portions that share at least 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) for equal length portions of either Sequence Identification No.: 894-918 or Sequence Identification No.: 1392-1432.

[0241] In various embodiments, the oligonucleotide comprises a linked nucleoside having at least 19 adjacent nucleobase sequences, wherein the nucleobase sequence comprises at least 10 adjacent nucleobase portions that share at least 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) for equal length portions of either Sequence Identification No.: 894-918 or Sequence Identification No.: 1392-1432. In various embodiments, the oligonucleotide comprises a linked nucleoside having at least 20, 21, 22, 23, 24, or 25 adjacent nucleobase sequences, wherein the nucleobase sequence comprises at least 10 adjacent nucleobase portions that share at least 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) for equal length portions of either Sequence Identification No.: 894-918 or Sequence Identification No.: 1392-1432.

[0242] In various embodiments, the oligonucleotide comprises a linked nucleoside having at least 19 adjacent nucleobase sequences, wherein the nucleobase sequences comprise portions of at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 adjacent nucleosides that share at least 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) with respect to either Sequence Identification No.: 894-918 or Sequence Identification No.: 1392-1432.

[0243] In various embodiments, the nucleobase sequence is any one of positions 121-144, 144-168, 146-170, 150-170, 150-172, 150-174, 169-193, 169-189, 169-191, 170-190, 170-192, 171-191, 171-193, 172-192, 172-194, 170-194, 171-195, 172-196, 173-197, 185-209, 197-221, 237-261, 249-273, 252-276, or 276-300 of sequence identification number: 944 It includes at least 10 adjacent nucleobase portions that are at least 90% complementary (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to the same length portion of the nucleobase within. In various embodiments, the nucleobase sequence is any one of positions 121-144, 144-168, 146-170, 150-170, 150-172, 150-174, 169-193, 169-189, 169-191, 170-190, 170-192, 171-191, 171-193, 172-192, 172-194, 170-194, 171-195, 172-196, 173-197, 185-209, 197-221, 237-261, 249-273, 252-276, or 276-300 of sequence identification number: 944 It includes at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 adjacent nucleobase portions that are at least 90% complementary (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to the same length portion of the nucleobase within.

[0244] In various embodiments, the nucleobase sequence is any one of positions 121-144, 144-168, 146-170, 150-170, 150-172, 150-174, 169-193, 169-189, 169-191, 170-190, 170-192, 171-191, 171-193, 172-192, 172-194, 170-194, 171-195, 172-196, 173-197, 185-209, 197-221, 237-261, 249-273, 252-276, or 276-300 of sequence identification number: 944 It includes at least 10 adjacent nucleobase portions that are at least 90% complementary (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to the same length portion of the nucleobase within. In various embodiments, the nucleobase sequence is any one of positions 121-144, 144-168, 146-170, 150-170, 150-172, 150-174, 169-193, 169-189, 169-191, 170-190, 170-192, 171-191, 171-193, 172-192, 172-194, 170-194, 171-195, 172-196, 173-197, 185-209, 197-221, 237-261, 249-273, 252-276, or 276-300 of sequence identification number: 944 It includes at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 adjacent nucleobase portions that are at least 90% complementary (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) to the same length portion of the nucleobase within.

[0245] In various embodiments, a portion of the nucleobase sequence is any of the positions 121-144, 144-168, 146-170, 150-170, 150-172, 150-174, 169-193, 169-189, 169-191, 170-190, 170-192, 171-191, 171-193, 172-192, 172-194, 170-194, 171-195, 172-196, 173-197, 185-209, 197-221, 237-261, 249-273, 252-276, or 276-300 of sequence identification number: 944 It is 100% complementary to the same length portion of the nucleus within one. In various embodiments, a portion of the nucleus sequence is 100% complementary to the same length portion of the nucleus within any one of positions 144-164, 144-166, 145-167, 146-166, 146-168, 147-165, or 148-168 of sequence identification number: 944. In various embodiments, a portion of the nucleus sequence is 100% complementary to the same length portion of the nucleus within any one of positions 173-191, 173-193, 173-195, 173-197, 175-195, 175-197, 177-197, or 179-197 of sequence identification number: 944. In various embodiments, a portion of the nucleobase sequence is 100% complementary to the same length portion of the nucleobase within any one of positions 185-205, 187-209, 189-209, 185-207, 197-217, 197-219, or 191-209 of sequence identification number: 944. In various embodiments, a portion of the nucleobase sequence is 100% complementary to the same length portion of the nucleobase within any one of positions 237-255, 237-257, 237-259, 239-259, 239-261, 241-261, 237-257, 249-269, 249-271, 252-272, 252-274, or 243-261 of sequence identification number: 944.

[0246] STMN2 antisense oligonucleotide variant

[0247] In various embodiments, STMN2 AON comprises different variants referred to hereinafter as STMN2 AON variants. The STMN2 AON variant may be an oligonucleotide sequence of length 5 to 100 nucleotides, for example, length 10 to 40 nucleotides, for example, length 14 to 40 nucleotides, length 10 to 30 nucleotides, for example, length 14 to 30 nucleotides, for example, length 16 to 28 nucleotides, for example, length 19 to 23 nucleotides, for example, length 21 to 23 nucleotides, or for example, lengths of 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. The STMN2 AON variant may be an oligonucleotide sequence complementary to the STMN2 free-mRNA sequence or a portion of the STMN2 gene sequence.

[0248] In various embodiments, the STMN2 AON variant represents a modified version of the corresponding STMN2 AON comprising a nucleobase sequence selected from either Sequence Identification No.: 1-446 or Sequence Identification No.: 945-1390. In some embodiments, the STMN2 AON variant comprises a nucleobase sequence representing a shortened version of the nucleobase sequence of the STMN2 AON selected from either Sequence Identification No.: 1-446 or Sequence Identification No.: 945-1390. As an example, if STMN2 AON comprises a 25-mer (e.g., 25 nucleotide length), a variant (e.g., STMN2 variant) may comprise a shorter version of the 25-mer STMN2 AON (e.g., 15-mer, 16-mer, 17-mer, 18-mer, 19-mer, 20-mer, 21-mer, 22-mer, 23-mer, or 24-mer). In one embodiment, the nucleobase sequence of the STMN2 AON variant differs from the corresponding nucleobase sequence of STMN2 AON in that 1, 2, 3, 4, 5, or 6 nucleotides are removed from one or both of the 3' and 5' ends of the nucleobase sequence of STMN2 AON. In one embodiment, the corresponding STMN2 AON variant may comprise a 23-mer in which two nucleotides are removed from either the 3' or 5' end of the 25-mer included in STMN2 AON. In one embodiment, the corresponding STMN2 AON variant may comprise a 23-mer in which one nucleotide is removed from each of the 3' and 5' ends of the 25-mer included in STMN2 AON. In one embodiment, the corresponding STMN2 AON variant may comprise a 21-mer in which two nucleotides are removed from each of the 3' and 5' ends of the 25-mer included in STMN2 AON. In one embodiment, the corresponding STMN2 AON variant may comprise a 21-mer in which four nucleotides are removed from the 3' or 5' end of the 25-mer included in STMN2 AON.In one embodiment, the corresponding STMN2 AON variant may comprise a 19-mer in which three nucleotides are removed from each of the 3' and 5' ends of the 25-mer contained in STMN2 AON. In one embodiment, the corresponding STMN2 AON variant may comprise a 19-mer in which six nucleotides are removed from the 3' or 5' end of the 25-mer contained in STMN2 AON.

[0249] Exemplary sequences of STMN2 AON variants are presented in Table 5 below. Each exemplary STMN2 AON variant is associated with an identifier describing the difference between the STMN2 AON variant and the corresponding STMN2 AON. For example, the STMN2 AON variant contains sequence identification number: 894 and is identified using identifier: QSN-144-1 / 5-1 / 3. The first part of this identifier "QSN-144" indicates that the STMN2 AON variant is a modified version of the QSN-144 STMN2 AON containing sequence identification number: 144. Additionally, the second part of the identifier, containing the numerical notation "1 / 5-1 / 3," indicates that one nucleotide has been removed from the 5' and 3' ends, respectively, of the nucleobase sequence contained in QSN-144 STMN2 AON (e.g., one nucleotide has been removed from the 3' and 5' ends, respectively, of Sequence Identification No.: 144). To provide another example, the STMN2 AON variant contains Sequence Identification No.: 895 and is identified as QSN-144-2 / 3. This STMN2 AON variant is a modified version of QSN-144 STMN2 AON. The numerical notation "2 / 3" indicates that two nucleotides have been removed from the 3' end of the nucleobase sequence of QSN-144 STMN2 AON (e.g., two bases have been removed from the 3' end of Sequence Identification No.: 144).

[0250] In some embodiments, the STMN2 AON variant differs from the corresponding STMN2 AON in that one or more nucleoside linkages of the STMN2 AON variant are phosphodiester bonds. In these embodiments, the length of the STMN2 AON variant may be the same length as the corresponding STMN2 AON (e.g., 25 nucleotide length). In some embodiments, the phosphodiester nucleoside linkages connect 2, 3, 4, 5, 6, 7, 8, 9, or 10 adjacent nucleotides.

[0251] In some embodiments, phosphodiester nucleoside linkages connect nucleotides located at one or both of the 3' or 5' ends. For example, 2, 3, 4, 5, 6, 7, 8, 9, or 10 adjacent nucleotides at one or both of the 3' or 5' ends are connected through phosphodiester nucleoside linkages.

[0252] In some embodiments, phosphodiester nucleoside linkages link nucleotides located within the nucleobase sequence. For example, within the 25mer STMN2 AON variant, adjacent nucleotides between positions 6 and 15 may be linked via phosphodiester nucleoside linkages. In some embodiments, adjacent nucleotides between any one of positions 7 and 15, 8 and 14, or 9 and 13 are linked via phosphodiester nucleoside linkages.

[0253] Variants of the STMN2 AON sequence are identified in Table 5 below:

[0254] Table 5. STMN2 antisense oligonucleotide variant sequences

[0255]

[0256]

[0257] * Except where otherwise indicated (e.g., in sequence identification numbers 1417, 1418, 1419, 1420, 1421, 1422, 1423, and 1424 of Table 5), at least one nucleoside linkage of the nucleobase sequence is a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropylphosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothodate linkage, a phosphorodiamidate linkage (e.g., phosphorodiamidate morpholino (PMO), containing 3'-aminoribose or 5'-aminoribose), or an aminoalkylphosphoramidate linkage It is selected from ligation, thiophosphoramidate ligation, thionoalkylphosphonate ligation, thionoalkylphosphotriester ligation, thiophosphate ligation, selenophosphate ligation, and boranophosphate ligation. In some embodiments, all nucleoside ligations are phosphorothioate ligations, except where otherwise indicated (e.g., in sequence identification numbers 1417, 1418, 1419, 1420, 1421, 1422, 1423, and 1424 of Table 5).

[0258] 1 The notation "-" indicates the presence of phosphodiester linkages in sequence identification numbers 1417, 1418, 1419, 1420, 1421, 1422, 1423 and 1424 of Table 5.

[0259] Additional variants of the STMN2 AON sequence are identified in Table 6 below:

[0260] Table 6. Sequences of additional STMN2 antisense oligonucleotide variants

[0261]

[0262] * Except where otherwise indicated (e.g., in sequence identification numbers 1425, 1426, 1427, 1428, 1429, 1430, 1431, and 1432 of Table 6), at least one nucleoside linkage of the nucleobase sequence is a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropylphosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothodate linkage, a phosphorodiamidate linkage (e.g., phosphorodiamidate morpholino (PMO), including 3' amino ribose or 5' amino ribose), It is selected from aminoalkylphosphoramidate linkages, thiophosphoramidate linkages, thionoalkylphosphonate linkages, thionoalkylphosphotriester linkages, thiophosphate linkages, selenophosphate linkages, and boranophosphate linkages. In some embodiments, all nucleoside linkages are phosphorothioate linkages, except where otherwise indicated (e.g., in sequence identification numbers 1425, 1426, 1427, 1428, 1429, 1430, 1431, and 1432 of Table 6).

[0263] 1 The notation "-" indicates the presence of phosphodiester linkages in sequence identification numbers 1425, 1426, 1427, 1428, 1429, 1430, 1431 and 1432 of Table 6.

[0264] Performance of STMN2 antisense oligonucleotides and variants

[0265] Generally, STMN2 AON and STMN2 AON variants may target STMN2 transcripts containing latent exons to increase, restore, rescue, or stabilize the expression levels of STMN2 mRNA that can be translated to produce a functional STMN2 protein (e.g., full-length STMN2). In various embodiments, STMN2 AON and STMN2 AON variants may exhibit at least a 60%, 70%, 80%, or 90% increase in full-length STMN2 protein. In various embodiments, STMN2 AON and STMN2 AON variants may exhibit at least a 100%, 200%, 300%, or 400% increase in full-length STMN2 protein. In some embodiments, the percentage increase in full-length STMN2 protein is an increase compared to the reduced level of full-length STMN2 protein achieved using TDP43 antisense oligonucleotides. For example, after depleting full-length STMN2 protein using TDP43 antisense oligonucleotide, full-length STMN2 protein can be increased using STMN2 AON or STMN2 AON variants.

[0266] In some embodiments, STMN2 AON and STMN2 AON variants reduce the level of STMN2 transcripts containing latent exons. In various embodiments, STMN2 AON and STMN2 AON variants may exhibit at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% reduction of STMN2 transcripts containing latent exons. In some embodiments, the percentage reduction in latent exon levels is a reduction compared to the increased level of latent exons achieved using TDP43 antisense oligonucleotides. For example, after increasing latent exon levels using TDP43 antisense oligonucleotides, latent exon levels may be reduced using STMN2 AON or STMN2 AON variants.

[0267] In some embodiments, STMN2 AON and STMN2 AON variants may exhibit at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% rescue of full-length STMN2 protein. In some embodiments, the percentage rescue of full-length STMN2 refers to the percentage of full-length STMN2 after depletion with TDP43 antisense oligonucleotide and treatment with STMN2 AON or STMN2 AON variant compared to a negative control (e.g., cells that have not undergone depletion or treatment or cells treated with vehicle solution).

[0268] In some embodiments, STMN2 AON and AON variants represent 50% to 100% of the full-length STMN2 rescue. In some embodiments, STMN2 AON and AON variants represent 60% to 100% of the full-length STMN2 rescue. In some embodiments, STMN2 AON and AON variants represent 70% to 100% of the full-length STMN2 rescue. In some embodiments, STMN2 AON and AON variants represent 80% to 100% of the full-length STMN2 rescue. In some embodiments, STMN2 AON and AON variants represent 90% to 100% of the full-length STMN2 rescue. In some embodiments, STMN2 AON and AON variants represent 60% to 90% of the full-length STMN2 rescue. In some embodiments, STMN2 AON and AON variants represent 50% to 80% of the full-length STMN2 rescue. In some embodiments, STMN2 AON and AON variants exhibit 60% to 80% relief of the full-length STMN2.

[0269] In certain embodiments, QSN-31 STMN2 AON (Sequence ID No.: 31) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-31 STMN2 AON (Sequence ID No.: 31) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-31 STMN2 AON (Sequence ID No.: 31) represents 70 to 100% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-31 STMN2 AON (Sequence ID No.: 31) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0270] In certain embodiments, QSN-36 STMN2 AON (SEQ ID No.: 36) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-36 STMN2 AON (SEQ ID No.: 36) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-36 STMN2 AON (SEQ ID No.: 36) represents 70 to 100% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-36 STMN2 AON (SEQ ID No.: 36) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-36 STMN2 AON (sequence identification number: 36) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0271] In certain embodiments, QSN-41 STMN2 AON (Sequence ID No.: 41) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-41 STMN2 AON (Sequence ID No.: 41) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-41 STMN2 AON (Sequence ID No.: 41) represents 70 to 100% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-41 STMN2 AON (Sequence ID No.: 41) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0272] In certain embodiments, QSN-46 STMN2 AON (Sequence ID No.: 46) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-46 STMN2 AON (Sequence ID No.: 46) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-46 STMN2 AON (Sequence ID No.: 46) represents 70 to 100% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-46 STMN2 AON (Sequence ID No.: 46) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0273] In certain embodiments, QSN-55 STMN2 AON (Sequence ID No.: 55) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-55 STMN2 AON (Sequence ID No.: 55) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-55 STMN2 AON (Sequence ID No.: 55) represents 70 to 100% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-55 STMN2 AON (Sequence ID No.: 55) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-55 STMN2 AON (sequence identification number: 55) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0274] In certain embodiments, QSN-144 STMN2 AON (SEQ ID No.: 144) represents 50 to 80 percent of the full-length STMN2. In certain embodiments, QSN-144 STMN2 AON (SEQ ID No.: 144) represents 60 to 90 percent of the full-length STMN2. In certain embodiments, QSN-144 STMN2 AON (SEQ ID No.: 144) represents 70 to 100 percent of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-144 STMN2 AON (SEQ ID No.: 144) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-144 STMN2 AON (sequence identification number: 144) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0275] In certain embodiments, QSN-146 STMN2 AON (Sequence ID No.: 146) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-146 STMN2 AON (Sequence ID No.: 146) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-146 STMN2 AON (Sequence ID No.: 146) represents 70 to 100% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-146 STMN2 AON (Sequence ID No.: 146) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0276] In certain embodiments, QSN-150 STMN2 AON (Sequence ID No.: 150) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-150 STMN2 AON (Sequence ID No.: 150) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-150 STMN2 AON (Sequence ID No.: 150) represents 70 to 100% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-150 STMN2 AON (Sequence ID No.: 150) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0277] In certain embodiments, QSN-169 STMN2 AON (Sequence ID No.: 169) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-169 STMN2 AON (Sequence ID No.: 169) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-169 STMN2 AON (Sequence ID No.: 169) represents 70 to 100% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-169 STMN2 AON (Sequence ID No.: 169) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0278] In certain embodiments, QSN-170 STMN2 AON (Sequence ID No.: 170) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-170 STMN2 AON (Sequence ID No.: 170) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-170 STMN2 AON (Sequence ID No.: 170) represents 70 to 100% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-170 STMN2 AON (Sequence ID No.: 170) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0279] In certain embodiments, QSN-171 STMN2 AON (Sequence ID No.: 171) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-171 STMN2 AON (Sequence ID No.: 171) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-171 STMN2 AON (Sequence ID No.: 171) represents 70 to 100% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-171 STMN2 AON (Sequence ID No.: 171) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0280] In certain embodiments, QSN-172 STMN2 AON (Sequence Identification No.: 172) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-172 STMN2 AON (Sequence Identification No.: 172) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-172 STMN2 AON (Sequence Identification No.: 172) represents 70 to 100% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-172 STMN2 AON (Sequence Identification No.: 172) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0281] In certain embodiments, QSN-173 STMN2 AON (SEQ ID No.: 173) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-173 STMN2 AON (SEQ ID No.: 173) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-173 STMN2 AON (SEQ ID No.: 173) represents 70 to 100% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-173 STMN2 AON (SEQ ID No.: 173) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-173 STMN2 AON (sequence identification number: 173) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0282] In certain embodiments, QSN-177 STMN2 AON (SEQ ID No.: 177) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-177 STMN2 AON (SEQ ID No.: 177) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-177 STMN2 AON (SEQ ID No.: 177) represents 70 to 100% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-177 STMN2 AON (SEQ ID No.: 177) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-177 STMN2 AON (SEQ ID No.: 177) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In certain embodiments, QSN-181 STMN2 AON (SEQ ID No.: 181) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-181 STMN2 AON (SEQ ID No.: 181) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-181 STMN2 AON (SEQ ID No.: 181) represents 70 to 100% of the full-length STMN2. In some embodiments, all nucleoside linkages of the QSN-181 STMN2 AON (sequence identification number: 181) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.In some embodiments, all internucleoside linkages of the QSN-181 STMN2 AON (sequence identification number: 181) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0283] In certain embodiments, QSN-185 STMN2 AON (Sequence ID No.: 185) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-185 STMN2 AON (Sequence ID No.: 185) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-185 STMN2 AON (Sequence ID No.: 185) represents 70 to 100% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-185 STMN2 AON (Sequence ID No.: 185) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, all internucleoside linkages of the QSN-185 STMN2 AON (SEQ ID No.: 185) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside. In certain embodiments, QSN-197 STMN2 AON (SEQ ID No.: 197) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-197 STMN2 AON (SEQ ID No.: 197) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-197 STMN2 AON (SEQ ID No.: 197) represents 70 to 100% of the full-length STMN2. In some embodiments, all nucleoside linkages of the QSN-197 STMN2 AON (sequence identification number: 197) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.In some embodiments, all internucleoside linkages of the QSN-197 STMN2 AON (sequence identification number: 197) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0284] In certain embodiments, QSN-203 STMN2 AON (Sequence ID No.: 203) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-203 STMN2 AON (Sequence ID No.: 203) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-203 STMN2 AON (Sequence ID No.: 203) represents 70 to 100% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-203 STMN2 AON (Sequence ID No.: 203) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-203 STMN2 AON (SEQ ID No.: 203) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In certain embodiments, QSN-209 STMN2 AON (SEQ ID No.: 209) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-209 STMN2 AON (SEQ ID No.: 209) represents 60 to 90% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-209 STMN2 AON (SEQ ID No.: 209) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside. In certain embodiments, QSN-209 STMN2 AON (SEQ ID No.: 209) represents 70 to 100% of the full length STMN2.In some embodiments, all internucleoside linkages of the QSN-209 STMN2 AON (sequence identification number: 209) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0285] In certain embodiments, QSN-215 STMN2 AON (Sequence ID No.: 215) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-215 STMN2 AON (Sequence ID No.: 215) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-215 STMN2 AON (Sequence ID No.: 215) represents 70 to 100% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-215 STMN2 AON (Sequence ID No.: 215) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-215 STMN2 AON (SEQ ID No.: 215) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In certain embodiments, QSN-237 STMN2 AON (SEQ ID No.: 237) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-237 STMN2 AON (SEQ ID No.: 237) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-237 STMN2 AON (SEQ ID No.: 237) represents 70 to 100% of the full-length STMN2. In some embodiments, all nucleoside linkages of the QSN-237 STMN2 AON (sequence identification number: 237) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.In some embodiments, all internucleoside linkages of the QSN-237 STMN2 AON (sequence identification number: 237) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0286] In certain embodiments, QSN-244 STMN2 AON (Sequence Identification No.: 244) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-244 STMN2 AON (Sequence Identification No.: 244) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-244 STMN2 AON (Sequence Identification No.: 244) represents 70 to 100% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-244 STMN2 AON (Sequence Identification No.: 244) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-244 STMN2 AON (sequence identification number: 244) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0287] In certain embodiments, QSN-249 STMN2 AON (Sequence Identification No.: 249) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-249 STMN2 AON (Sequence Identification No.: 249) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-249 STMN2 AON (Sequence Identification No.: 249) represents 70 to 100% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-249 STMN2 AON (Sequence Identification No.: 249) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0288] In certain embodiments, QSN-252 STMN2 AON (Sequence ID No.: 252) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-252 STMN2 AON (Sequence ID No.: 252) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-252 STMN2 AON (Sequence ID No.: 252) represents 70 to 100% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-252 STMN2 AON (Sequence ID No.: 252) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-252 STMN2 AON (sequence identification number: 252) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0289] In certain embodiments, QSN-380 STMN2 AON (Sequence ID No.: 380) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-380 STMN2 AON (Sequence ID No.: 380) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-380 STMN2 AON (Sequence ID No.: 380) represents 70 to 100% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-380 STMN2 AON (Sequence ID No.: 380) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-380 STMN2 AON (SEQ ID No.: 380) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In certain embodiments, QSN-385 STMN2 AON (SEQ ID No.: 385) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-385 STMN2 AON (SEQ ID No.: 385) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-385 STMN2 AON (SEQ ID No.: 385) represents 70 to 100% of the full-length STMN2. In some embodiments, all nucleoside linkages of the QSN-385 STMN2 AON (sequence identification number: 385) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.In some embodiments, all internucleoside linkages of the QSN-385 STMN2 AON (sequence identification number: 385) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0290] In certain embodiments, QSN-390 STMN2 AON (Sequence ID No.: 390) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-390 STMN2 AON (Sequence ID No.: 390) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-390 STMN2 AON (Sequence ID No.: 390) represents 70 to 100% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-390 STMN2 AON (Sequence ID No.: 390) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside. In some embodiments, all internucleoside linkages of the QSN-390 STMN2 AON (SEQ ID No.: 390) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In certain embodiments, QSN-395 STMN2 AON (SEQ ID No.: 395) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-395 STMN2 AON (SEQ ID No.: 395) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-395 STMN2 AON (SEQ ID No.: 395) represents 70 to 100% of the full-length STMN2. In some embodiments, all nucleoside linkages of the QSN-395 STMN2 AON (sequence identification number: 395) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.In some embodiments, all internucleoside linkages of the QSN-395 STMN2 AON (SEQ ID No.: 395) oligonucleotide are phosphorothioate linkages, each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In certain embodiments, QSN-400 STMN2 AON (SEQ ID No.: 400) represents 50 to 80% of the full-length STMN2. In certain embodiments, QSN-400 STMN2 AON (SEQ ID No.: 400) represents 60 to 90% of the full-length STMN2. In certain embodiments, QSN-400 STMN2 AON (SEQ ID No.: 400) represents 70 to 100% of the full-length STMN2. In some embodiments, all nucleoside linkages of the QSN-400 STMN2 AON (Sequence ID: 400) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside. In some embodiments, all nucleoside linkages of the QSN-400 STMN2 AON (Sequence ID: 400) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0291] In a specific embodiment, QSN-144-1 / 5-1 / 3 (Sequence Identification No.: 894) represents 30 to 100% of the full-length STMN2. In a specific embodiment, QSN-144-1 / 5-1 / 3 (Sequence Identification No.: 894) represents 40 to 80% of the full-length STMN2. In a specific embodiment, QSN-144-1 / 5-1 / 3 (Sequence Identification No.: 894) represents 50 to 60% of the full-length STMN2. In a specific embodiment, QSN-144-2 / 3 (Sequence Identification No.: 895) represents 30 to 100% of the full-length STMN2. In a specific embodiment, QSN-144-2 / 3 (Sequence Identification No.: 895) represents 40 to 80% of the full-length STMN2. In certain embodiments, QSN-144-2 / 3 (SEQ ID: 895) represents 50 to 60 percent of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-144-2 / 3 STMN2 AON (SEQ ID: 895) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0292] In certain embodiments, QSN-144-2 / 5 (Sequence Identification No.: 896) represents 30 to 100% of the full-length STMN2. In certain embodiments, QSN-144-2 / 5 (Sequence Identification No.: 896) represents 40 to 80% of the full-length STMN2. In certain embodiments, QSN-144-2 / 5 (Sequence Identification No.: 896) represents 50 to 60% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-144-2 / 5 (Sequence Identification No.: 896) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0293] In certain embodiments, QSN-144-2 / 5-2 / 3 (Sequence Identification No.: 897) represents 30 to 100% of the full-length STMN2. In certain embodiments, QSN-144-2 / 5-2 / 3 (Sequence Identification No.: 897) represents 40 to 80% of the full-length STMN2. In certain embodiments, QSN-144-2 / 5-2 / 3 (Sequence Identification No.: 897) represents 50 to 60% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-144-2 / 5-2 / 3 STMN2 AON (Sequence Identification No.: 897) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0294] In certain embodiments, QSN-144-3 / 5-3 / 3 (Sequence Identification No.: 898) represents 30 to 100% of the full-length STMN2. In certain embodiments, QSN-144-3 / 5-3 / 3 (Sequence Identification No.: 898) represents 40 to 80% of the full-length STMN2. In certain embodiments, QSN-144-3 / 5-3 / 3 (Sequence Identification No.: 898) represents 50 to 60% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-144-3 / 5-3 / 3 (Sequence Identification No.: 898) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0295] In certain embodiments, QSN-144-4 / 3 (Sequence Identification No.: 899) represents 30 to 100% of the full-length STMN2. In certain embodiments, QSN-144-4 / 3 (Sequence Identification No.: 899) represents 40 to 80% of the full-length STMN2. In certain embodiments, QSN-144-4 / 3 (Sequence Identification No.: 899) represents 50 to 60% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-144-4 / 3 STMN2 AON (Sequence Identification No.: 899) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0296] In certain embodiments, QSN-144-4 / 5 (Sequence ID No.: 900) represents 30 to 100% of the full-length STMN2. In certain embodiments, QSN-144-4 / 5 (Sequence ID No.: 900) represents 40 to 80% of the full-length STMN2. In certain embodiments, QSN-144-4 / 5 (Sequence ID No.: 900) represents 50 to 60% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-144-4 / 5 (Sequence ID No.: 900) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0297] In certain embodiments, QSN-173-2 / 3 (Sequence Identification No.: 901) represents 30 to 100% of the full-length STMN2. In certain embodiments, QSN-173-2 / 3 (Sequence Identification No.: 901) represents 40 to 80% of the full-length STMN2. In certain embodiments, QSN-173-2 / 3 (Sequence Identification No.: 901) represents 50 to 60% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-173-2 / 3 STMN2 AON (Sequence Identification No.: 901) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0298] In certain embodiments, QSN-173-2 / 5 (Sequence Identification No.: 902) represents 30 to 100% of the full-length STMN2. In certain embodiments, QSN-173-2 / 5 (Sequence Identification No.: 902) represents 40 to 80% of the full-length STMN2. In certain embodiments, QSN-173-2 / 5 (Sequence Identification No.: 902) represents 50 to 60% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-173-2 / 5 (Sequence Identification No.: 902) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0299] In certain embodiments, QSN-173-2 / 5-2 / 3 (Sequence Identification No.: 903) represents 30 to 100% of the full-length STMN2. In certain embodiments, QSN-173-2 / 5-2 / 3 (Sequence Identification No.: 903) represents 40 to 80% of the full-length STMN2. In certain embodiments, QSN-173-2 / 5-2 / 3 (Sequence Identification No.: 903) represents 50 to 60% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-173-2 / 5-2 / 3 (Sequence Identification No.: 903) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0300] In certain embodiments, QSN-173-4 / 3 (Sequence Identification No.: 904) represents 30 to 100% of the full-length STMN2. In certain embodiments, QSN-173-4 / 3 (Sequence Identification No.: 904) represents 40 to 80% of the full-length STMN2. In certain embodiments, QSN-173-4 / 3 (Sequence Identification No.: 904) represents 50 to 60% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-173-4 / 3 (Sequence Identification No.: 904) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0301] In certain embodiments, QSN-173-4 / 5 (Sequence Identification No.: 905) represents 30 to 100% of the full-length STMN2. In certain embodiments, QSN-173-4 / 5 (Sequence Identification No.: 905) represents 40 to 80% of the full-length STMN2. In certain embodiments, QSN-173-4 / 5 (Sequence Identification No.: 905) represents 50 to 60% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-173-4 / 5 (Sequence Identification No.: 905) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0302] In certain embodiments, QSN-173-6 / 3 (Sequence Identification No.: 906) represents 30 to 100% of the full-length STMN2. In certain embodiments, QSN-173-6 / 3 (Sequence Identification No.: 906) represents 40 to 80% of the full-length STMN2. In certain embodiments, QSN-173-6 / 3 (Sequence Identification No.: 906) represents 50 to 60% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-173-6 / 3 (Sequence Identification No.: 906) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0303] In certain embodiments, QSN-173-6 / 5 (Sequence Identification No.: 907) represents 30 to 100% of the full-length STMN2. In certain embodiments, QSN-173-6 / 5 (Sequence Identification No.: 907) represents 40 to 80% of the full-length STMN2. In certain embodiments, QSN-173-6 / 5 (Sequence Identification No.: 907) represents 50 to 60% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-173-6 / 5 (Sequence Identification No.: 907) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0304] In certain embodiments, QSN-185-2 / 5 (Sequence Identification No.: 908) represents 30 to 100% of the full-length STMN2. In certain embodiments, QSN-185-2 / 5 (Sequence Identification No.: 908) represents 40 to 80% of the full-length STMN2. In certain embodiments, QSN-185-2 / 5 (Sequence Identification No.: 908) represents 50 to 60% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-185-2 / 5 (Sequence Identification No.: 908) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0305] In certain embodiments, QSN-185-4 / 3 (Sequence Identification No.: 909) represents 30 to 100% of the full-length STMN2. In certain embodiments, QSN-185-4 / 3 (Sequence Identification No.: 909) represents 40 to 80% of the full-length STMN2. In certain embodiments, QSN-185-4 / 3 (Sequence Identification No.: 909) represents 50 to 60% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-185-4 / 3 (Sequence Identification No.: 909) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0306] In certain embodiments, QSN-185-4 / 5 (Sequence Identification No.: 910) represents 30 to 100% of the full-length STMN2. In certain embodiments, QSN-185-4 / 5 (Sequence Identification No.: 910) represents 40 to 80% of the full-length STMN2. In certain embodiments, QSN-185-4 / 5 (Sequence Identification No.: 910) represents 50 to 60% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-185-4 / 5 (Sequence Identification No.: 910) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0307] In certain embodiments, QSN-185-6 / 5 (Sequence Identification No.: 911) represents 30 to 100% of the full-length STMN2. In certain embodiments, QSN-185-6 / 5 (Sequence Identification No.: 911) represents 40 to 80% of the full-length STMN2. In certain embodiments, QSN-185-6 / 5 (Sequence Identification No.: 911) represents 50 to 60% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-185-6 / 5 (Sequence Identification No.: 911) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0308] In certain embodiments, QSN-237-2 / 3 (Sequence Identification No.: 912) represents 30 to 100% of the full-length STMN2. In certain embodiments, QSN-237-2 / 3 (Sequence Identification No.: 912) represents 40 to 80% of the full-length STMN2. In certain embodiments, QSN-237-2 / 3 (Sequence Identification No.: 912) represents 50 to 60% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-237-2 / 3 (Sequence Identification No.: 912) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0309] In certain embodiments, QSN-237-2 / 5 (Sequence Identification No.: 913) represents 30 to 100% of the full-length STMN2. In certain embodiments, QSN-237-2 / 5 (Sequence Identification No.: 913) represents 40 to 80% of the full-length STMN2. In certain embodiments, QSN-237-2 / 5 (Sequence Identification No.: 913) represents 50 to 60% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-237-2 / 5 (Sequence Identification No.: 913) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0310] In certain embodiments, QSN-237-2 / 5-2 / 3 (Sequence Identification No.: 914) represents 30 to 100% of the full-length STMN2. In certain embodiments, QSN-237-2 / 5-2 / 3 (Sequence Identification No.: 914) represents 40 to 80% of the full-length STMN2. In certain embodiments, QSN-237-2 / 5-2 / 3 (Sequence Identification No.: 914) represents 50 to 60% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-237-2 / 5-2 / 3 (Sequence Identification No.: 914) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0311] In certain embodiments, QSN-237-4 / 3 (Sequence Identification No.: 915) represents 30 to 100% of the full-length STMN2. In certain embodiments, QSN-237-4 / 3 (Sequence Identification No.: 915) represents 40 to 80% of the full-length STMN2. In certain embodiments, QSN-237-4 / 3 (Sequence Identification No.: 915) represents 50 to 60% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-237-4 / 3 (Sequence Identification No.: 915) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0312] In certain embodiments, QSN-237-4 / 5 (Sequence Identification No.: 916) represents 30 to 100% of the full-length STMN2. In certain embodiments, QSN-237-4 / 5 (Sequence Identification No.: 916) represents 40 to 80% of the full-length STMN2. In certain embodiments, QSN-237-4 / 5 (Sequence Identification No.: 916) represents 50 to 60% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-237-4 / 5 (Sequence Identification No.: 916) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0313] In certain embodiments, QSN-237-6 / 3 (Sequence Identification No.: 917) represents 30 to 100% of the full-length STMN2. In certain embodiments, QSN-237-6 / 3 (Sequence Identification No.: 917) represents 40 to 80% of the full-length STMN2. In certain embodiments, QSN-237-6 / 3 (Sequence Identification No.: 917) represents 50 to 60% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-237-6 / 3 (Sequence Identification No.: 917) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0314] In certain embodiments, QSN-237-6 / 5 (Sequence Identification No.: 918) represents 30 to 100% of the full-length STMN2. In certain embodiments, QSN-237-6 / 5 (Sequence Identification No.: 918) represents 40 to 80% of the full-length STMN2. In certain embodiments, QSN-237-6 / 5 (Sequence Identification No.: 918) represents 50 to 60% of the full-length STMN2. In some embodiments, all internucleoside linkages of the QSN-237-6 / 5 (Sequence Identification No.: 918) oligonucleotide are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside.

[0315] In a specific embodiment, QSN-173-po3 (Sequence Identification No.: 1417) represents 30 to 100% of the full-length STMN2. In a specific embodiment, QSN-173-po3 (Sequence Identification No.: 1417) represents 40 to 80% of the full-length STMN2. In a specific embodiment, QSN-173-po3 (Sequence Identification No.: 1417) represents 50 to 60% of the full-length STMN2. In a specific embodiment, QSN-173-po5 (Sequence Identification No.: 1418) represents 30 to 100% of the full-length STMN2. In a specific embodiment, QSN-173-po5 (Sequence Identification No.: 1418) represents 40 to 80% of the full-length STMN2. In a specific embodiment, QSN-173-po5 (sequence identification number: 1418) represents 50 to 60% of the full length STMN2.

[0316] In a specific embodiment, QSN-144-po3 (Sequence Identification No.: 1419) represents 30 to 100% of the full-length STMN2. In a specific embodiment, QSN-144-po3 (Sequence Identification No.: 1419) represents 40 to 80% of the full-length STMN2. In a specific embodiment, QSN-144-po3 (Sequence Identification No.: 1419) represents 50 to 60% of the full-length STMN2. In a specific embodiment, QSN-144-po5 (Sequence Identification No.: 1420) represents 30 to 100% of the full-length STMN2. In a specific embodiment, QSN-144-po5 (Sequence Identification No.: 1420) represents 40 to 80% of the full-length STMN2. In a specific embodiment, QSN-144-po5 (sequence identification number: 1420) represents 50 to 60% of the full length STMN2.

[0317] In a specific embodiment, QSN-185-po3 (Sequence ID: 1421) represents 30 to 100% of the full-length STMN2. In a specific embodiment, QSN-185-po3 (Sequence ID: 1421) represents 40 to 80% of the full-length STMN2. In a specific embodiment, QSN-185-po3 (Sequence ID: 1421) represents 50 to 60% of the full-length STMN2. In a specific embodiment, QSN-185-po5 (Sequence ID: 1422) represents 30 to 100% of the full-length STMN2. In a specific embodiment, QSN-185-po5 (Sequence ID: 1422) represents 40 to 80% of the full-length STMN2. In a specific embodiment, QSN-185-po5 (sequence identification number: 1422) represents 50 to 60% of the full length STMN2.

[0318] In a specific embodiment, QSN-237-po3 (Sequence ID: 1423) represents 30 to 100% of the full-length STMN2. In a specific embodiment, QSN-237-po3 (Sequence ID: 1423) represents 40 to 80% of the full-length STMN2. In a specific embodiment, QSN-237-po3 (Sequence ID: 1423) represents 50 to 60% of the full-length STMN2. In a specific embodiment, QSN-237-po5 (Sequence ID: 1424) represents 30 to 100% of the full-length STMN2. In a specific embodiment, QSN-237-po5 (Sequence ID: 1424) represents 40 to 80% of the full-length STMN2. In a specific embodiment, QSN-237-po5 (sequence identification number: 1424) represents 50 to 60% of the full length STMN2.

[0319] Additional chemically modified STMN2 antisense oligonucleotides

[0320] The STMN2 AON described herein may include chemically modified nucleosides, including modified ribonucleosides and modified deoxyribonucleosides. Chemically modified nucleosides include, but are not limited to, uracil, uracin, uridine, 2'-O-(2-methoxyethyl) modifications, e.g., 2'-O-(2-methoxyethyl)guanosine, 2'-O-(2-methoxyethyl)adenosine, 2'-O-(2-methoxyethyl)cytosine, and 2'-O-(2-methoxyethyl)thymidine. In certain embodiments, mixed forms, e.g., a combination of STMN2 peptide nucleic acid (PNA) and STMN2 lock nucleic acid (LNA), are present. Chemically modified nucleosides also include, but are not limited to, lock nucleic acid (LNA), 2'-MOE, 2'-O-methyl, 2'-fluoro, and 2'-fluoro-β-D-arabinonucleotide (FANA), and fluorocyclohexenyl nucleic acid (F-CeNA) modifications. Chemically modified nucleosides that may be included in the STMN2 AON described herein are [Johannes and Lucchino, (2018) "Current Challenges in Delivery and Cytosolic Translocation of Therapeutic RNAs" Nucleic Acid Ther. 28(3): 178-93; Rettig and Behlke, (2012) "Progress toward in vivo use of siRNAs-II" Mol Ther 20:483-512; and Khvorova and Watts, (2017) “The chemical evolution of oligonucleotide therapies of clinical utility” Nat Biotechnol., 35(3):238-48], each of which is incorporated herein by reference.

[0321] The STMN2 AON described herein may include chemical modifications that promote the stabilization of the terminal 5'-phosphate of an oligonucleotide and are phosphatase-resistant analogs of 5'-phosphate. Chemical modifications that promote the stabilization of the terminal 5'-phosphate of an oligonucleotide or are phosphatase-resistant analogs of 5'-phosphate include, but are not limited to, 5'-methyl phosphonate, 5'-methylene phosphonate, 5'-methylene phosphonate analogs, 5'-E-vinyl phosphonate (5'-E-VP), 5'-phosphorothioate, and 5'-C-methyl analogs. A chemical modification that promotes the stabilization of AON terminal 5'-phosphate and is a phosphatase-resistant analog of 5'-phosphate is described in the literature [Khvorova and Watts, (2017) "The chemical evolution of oligonucleotide therapies of clinical utility" Nat Biotechnol., 35(3):238-48], the contents of which are incorporated herein by reference.

[0322] In some embodiments described herein, the STMN2 AON described herein may comprise a chemically modified nucleoside, e.g., 2' O-methylribonucleoside, e.g., 2' O-methylcytidine, 2' O-methylguanosine, 2' O-methyluridine, and / or 2' O-methyladenosine. The STMN2 AON described herein may comprise one or more chemically modified bases, including 5-methylpyrimidine, e.g., 5-methylcytosine, and / or 5-methylpurine, e.g., 5-methylguanine. The chemically modified base may further comprise pseudo-uridine or 5'-methoxyuridine. The STMN2 AON described herein may comprise any of the following chemically modified nucleosides: 5-methyl-2'-O-methylcytidine, 5-methyl-2'-O-methylthymidine, 5-methylcytidine, 5-methyluridine and / or 5-methyl 2'-deoxycytidine.

[0323] The STMN2 AON described herein may include a phosphate backbone in which one or more of the oligonucleoside links are phosphate links. The STMN2 AON described herein may comprise a modified oligonucleotide backbone, wherein one or more of the nucleoside linkages of the nucleobase sequence are phosphorothioate linkages, alkyl phosphate linkages, phosphorodithioate linkages, phosphotriester linkages, alkylphosphonate linkages, 3-methoxypropylphosphonate linkages, methylphosphonate linkages, aminoalkylphosphotriester linkages, alkylene phosphonate linkages, phosphinate linkages, phosphoramidate linkages, phosphoramidotthiate linkages, phosphorodiamidate linkages (e.g., phosphorodiamidate morpholino (PMO), 3'-aminoribose or 5'-aminoribose) linkages, aminoalkylphosphoramidate linkages, thiophosphoramidate linkages, thionoalkylphosphonate linkages, thionoalkylphosphotriester linkages, thiophosphate linkages, selenophosphate linkages, and It is selected from the group consisting of boranophosphate linkages. In some embodiments of the STMN2 AON described herein, at least one nucleoside linkage in the nucleobase sequence is a phosphorothioate linkage. For example, in some embodiments of the STMN2 AON described herein, one, two, three, or more nucleoside linkages in the nucleobase sequence are phosphorothioate linkages. In a preferred embodiment of the STMN2 AON described herein, all nucleoside linkages in the nucleobase sequence are phosphorothioate linkages. Thus, in some embodiments, all nucleotide linkages of the STMN2 AON of any of Sequence Identification No.: 1-446, Sequence Identification No.: 894-918, Sequence Identification No.: 945-1390, or Sequence Identification No.: 1392-1432 are phosphorothioate linkages.In some embodiments, one or more of the nucleotide linkages of STMN2 AON of any of sequence identification number: 1-446, sequence identification number: 894-918, sequence identification number: 945-1390 or sequence identification number: 1392-1432 are phosphorothioate linkages.

[0324] In some embodiments, the disclosed STMN2 AON may optionally have at least one modified nucleobase, e.g., 5-methylcytosine, and / or at least one methylphosphonate nucleotide, which is considered to be located, e.g., at only one of the 5' or 3' ends, or at both the 5' and 3' ends, or along the oligonucleotide sequence. In some embodiments, all internucleoside linkages of the STMN2 AON oligonucleotides of the disclosure are phosphorothioate linkages, and each linked nucleoside of the oligonucleotide is a 2'-O-(2-methoxyethyl)(2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0325] The STMN2 AON under consideration may optionally include at least one modified sugar. For example, the sugar moiety of at least one nucleotide constituting the oligonucleotide is ribose, in which the 2'-OH group may be replaced by any one selected from the group consisting of OR, R, R'OR, SH, SR, NH2, NR2, N3, CN, F, Cl, Br, and I (where R is alkyl or aryl and R' is alkylene). Examples of modified sugar moiety include 2'-OMe modified sugar moiety, cyclic sugar moiety, 2'-O-(2-methoxyethyl) (2'MOE), 2'-deoxy-2'-fluoronucleoside, 2'-fluoro-β-D-arabinonucleoside, lock nucleic acid (LNA), binding ethyl 2'-4'-crosslinked nucleic acid (cEt), S-cEt, hexitol nucleic acid (HNA), and tricyclic analogs (e.g., tcDNA).

[0326] In some embodiments, STMN2 AON comprises: 2'OMe (e.g., STMN2 AON comprising one or more 2'OMe modified sugars), MOE (e.g., STMN2 AON comprising one or more MOE modified sugars (e.g., 2'-MOE)), PNA (e.g., STMN2 AON comprising one or more N-(2-aminoethyl)-glycine units connected by amide bonds or carbonylmethylene linkages as repeating units instead of a sugar-phosphate backbone), LNA (e.g., STMN2 AON comprising one or more lock riboses and may be a mixture of 2'-deoxynucleotides or 2'OMe nucleotides), c-ET (e.g., STMN2 AON comprising one or more cET sugars), cMOE (e.g., STMN2 AON comprising one or more cMOE sugars), morpholino oligomer (e.g., STMN2 AON comprising a backbone comprising one or more PMOs), Deoxy-2'-fluoronucleoside (e.g., STMN2 AON comprising one or more 2'-fluoro-β-D-arabinonucleosides), ENA (e.g., STMN2 AON comprising one or more ENA-modified sugars), HNA (e.g., STMN2 AON comprising one or more HNA-modified sugars), or tcDNA (e.g., STMN2 AON comprising one or more tcDNA-modified sugars). In some embodiments, STMN2 AON comprises one or more phosphorothioate linkages, phosphodiester linkages, phosphotriester linkages, methylphosphonate linkages, phosphoramidate linkages, morpholino linkages, PNA linkages, or any combination of phosphorothioate linkages, phosphodiester linkages, phosphotriester linkages, methylphosphonate linkages, phosphoramidate linkages, morpholino linkages, and PNA linkages.In some embodiments, STMN2 AON comprises one or more phosphorothioate linkages, phosphodiester linkages, or a combination of phosphorothioate and phosphodiester linkages.

[0327] motor neuron disease

[0328] Motor neuron diseases are a group of diseases characterized by the loss of function of motor neurons that coordinate voluntary muscle movements by the brain. Motor neuron diseases can affect upper and / or lower motor neurons and may have sporadic or familial origins. Motor neuron diseases include amyotrophic lateral sclerosis (ALS or Lou Gehrig's disease), progressive medullary palsy, pseudomedullary palsy, progressive muscular atrophy, primary lateral sclerosis, spinal muscular atrophy, post-poliomyelitis syndrome, and ALS with frontotemporal dementia.

[0329] Symptoms of motor neuron disease include muscle wasting or weakness, muscle pain, spasms, slurred speech, difficulty swallowing, loss of muscle control, joint pain, stiff limbs, difficulty breathing, drooling, and complete loss of muscle control over basic functions such as breathing, swallowing, feeding, speaking, and limb movement. These symptoms are also sometimes accompanied by depression, memory loss, difficulty planning, language deficits, behavioral changes, and difficulty evaluating spatial relationships and / or personality changes.

[0330] Motor neuron disease can be evaluated and diagnosed by a skilled clinician, such as a neurologist, using various tools and tests. For example, the presence or risk of developing motor neuron disease can be evaluated or diagnosed using blood and urine tests (e.g., tests testing for the presence of creatinine kinase), magnetic resonance imaging (MRI), electromyography (EMG), nerve conduction studies (NCS), spinal puncture, lumbar puncture, and / or muscle biopsy. Motor neuron disease can be diagnosed in the context of a physical examination and / or neurological examination to assess changes in motor and sensory skills, neurological function, hearing and speech, vision, coordination and balance, mental status, and mood or behavior.

[0331] Amyotrophic lateral sclerosis

[0332] ALS is a progressive motor neuron disease that destroys signals to all voluntary muscles. ALS causes atrophy of both upper and lower motor neurons. Symptoms of ALS include weakness and wasting of the medullary muscles, generalized and bilateral loss of strength, rigidity, muscle spasms, muscle cramps, fasciculations, slurred speech, and difficulty breathing or loss of breathing ability. Some individuals with ALS also suffer from cognitive decline. At the molecular level, ALS is characterized by protein and RNA aggregates within the cytoplasm of motor neurons, including aggregates of the RNA-binding protein TDP43.

[0333] ALS is most common in men over the age of 40, but it can also occur in women and children. The risk of ALS is also increased in individuals who smoke, are exposed to chemicals such as lead, or have served in the military. Most cases of ALS are sporadic, and only about 10% of cases are familial. The causes of ALS include sporadic or hereditary gene mutations, high levels of glutamate, and improper protein handling. Gene mutations associated with ALS include mutations in the genes SOD1, C9orf72, TARDBP, FUS, ANG, ATXN2, CHCHD10, CHMP2B, DCTN1, ErbB4, FIG4, HNRPA1, MATR3, NEFH, OPTN, PFN1, PRPH, SETX, SIGMAR1, SMN1, SPG11, SQSTM1, TBK1, TRPM7, TUBA4A, UBQLN2, VAPB, and VCP.

[0334] Frontotemporal dementia

[0335] Frontotemporal dementia (FTD) is a form of dementia that affects the frontal and temporal lobes of the brain. It has an earlier average age of onset than Alzheimer's disease, at 40 years. Symptoms of FTD include extreme changes in behavior and personality, language and vocabulary problems, and motor-related symptoms such as tremors, rigidity, muscle spasms, weakness, and difficulty swallowing. Subtypes of FTD include behavioral variant frontotemporal dementia (bvFTD), characterized by changes in personality and behavior, and primary progressive aphasia (PPA), which affects language skills, speaking, writing, and comprehension. FTD is associated with the accumulation of tau protein (pig bodies) and altered TDP43 function. Approximately 30% of FTD cases are familial, and no other risk factors besides a family history of the disease are known. Gene mutations associated with FTD include mutations in the genes C9orf72, progranulin (GRN), microtubule-associated protein tau (MAPT), UBQLN2, VPC, CHMP2B, TARDBP, FUS, ITM2B, CHCHD10, SQSTM1, PSEN1, PSEN2, CTSF, CYP27A1, TBK1, and TBP.

[0336] Amyotrophic lateral sclerosis with frontotemporal dementia

[0337] Amyotrophic lateral sclerosis with frontotemporal dementia (ALS with FTD) is a clinical syndrome in which FTD and ALS occur in the same individual. Interestingly, mutations within C9orf72 are the most common cause of the familial forms of ALS and / or FTD. Additionally, mutations within TBK1, VCP, SQSTMI, UBQLN2, and CHMP2B are also associated with ALS with FTD. Symptoms of ALS with FTD include dramatic personality changes, as well as muscle weakness, muscle atrophy, fasciculas, rigidity, dysarthria, dysphagia, and degeneration of the spinal cord, motor neurons, and the frontal and temporal lobes of the brain. At the molecular level, ALS with FTD is characterized by the accumulation of TDP-43 and / or FUS proteins in the cytoplasm. TBK1 mutations are associated with ALS, FTD, and ALS with FTD.

[0338] Treatment methods

[0339] The present disclosure considers treating a neurological disease in a patient requiring treatment for the neurological disease (e.g., amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD) and / or neuropathy, e.g., chemotherapy-induced neuropathy), comprising, in part, administering a disclosed inhibitor of an STMN2 transcript containing a latent exon. In some embodiments, a method for treating a neurological disease in a patient requiring treatment for the neurological disease is provided herein, comprising administering a disclosed STMN2 AON. In some embodiments of the present disclosure, an effective amount of the disclosed inhibitor of an STMN2 transcript containing a potential exon is administered to a patient in need of such an inhibitor to treat a neurological disease and / or to increase, restore, or stabilize STMN2 activity and / or function by increasing, restoring, or stabilizing the expression of STMN2 mRNA that can be translated to produce a functional STMN2 protein.

[0340] In some embodiments, treating a neurological disease involves improving or reducing at least one symptom associated with the neurological disease (e.g., reducing muscle weakness in a patient with ALS). A method for treating a neurological disease in a patient with a neurological disease (e.g., ALS, FTD, or ALS accompanied by FTD) is provided, comprising administering an initiated inhibitor of an STMN2 transcript containing a latent exon, e.g., STMN2 AON. In some embodiments, a method for slowing the progression of a neurological disease, e.g., a motor neuron disease, is provided.

[0341] A method for treating a neurological disease, reducing the risk of its occurrence, or delaying its onset in a subject requiring treatment of the neurological disease, reduction of the risk of its occurrence, or delaying its onset is provided herein, comprising administering an initiated inhibitor of an STMN2 transcript containing a latent exon, e.g., STMN2 AON. The method comprises, e.g., treating a subject at risk of developing a neurological disease; e.g., administering an effective amount of the initiated STMN2 AON to the subject. Neurological diseases that can be treated in this manner include motor neuron disease, ALS, FTD, ALS with FTD, progressive medullary palsy, pseudomedullary palsy, progressive muscular atrophy, primary lateral sclerosis, spinal muscular atrophy, and post-poliomyelitis syndrome.

[0342] A method for preventing or treating neurological diseases (e.g., PD, ALS, FTD, and ALS accompanied by FTD) forms part of the present disclosure. Such a method may include administering a pharmaceutical formulation comprising STMN2 AON, e.g., the STMN2 AON disclosed herein, to a patient who requires such a method or is at risk thereof. For example, a method for preventing or treating neurological diseases is provided, comprising administering the STMN2 AON disclosed herein to a patient who requires the prevention or treatment of neurological diseases.

[0343] Patients treated using the above method may experience an increase, recovery, or stabilization of STMN2 mRNA expression that can be translated to produce functional STMN2 protein by at least about 5%, 10%, 20%, 30%, 40%, or even 50%, thereby increasing, recovering, or stabilizing STMN2 activity and / or function in target cells (e.g., motor neurons) after administration of an inhibitor of the STMN2 transcript containing a latent exon, for example, after 1 day, 2 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months or more. Administration of such an inhibitor of the STMN2 transcript containing a latent exon may be performed, for example, on a basis of at least 1 day. The inhibitor of the STMN2 transcript containing a latent exon may be administered orally. In some embodiments, an inhibitor of an STMN2 transcript containing a latent exon is administered into the spinal canal or into a pool. For example, in one embodiment described herein, an inhibitor of an STMN2 transcript containing a latent exon is administered into the spinal canal or into a pool about every three months. As a result of administering the inhibitor of an STMN2 transcript containing a latent exon disclosed herein, the delay or improvement in clinical signs of neurological disease in a patient may be at least, for example, six months, one year, eighteen months, or even two years or more, compared to a patient who has not received the inhibitor of an STMN2 transcript containing a latent exon as disclosed herein.

[0344] Inhibitors of STMN2 transcripts containing latent exons according to the present invention, e.g., STMN2 AONs, may be used alone or in combination with each other, thereby at least two inhibitors of STMN2 transcripts containing latent exons according to the present invention may be used together as a single composition or as part of a therapeutic regimen. STMN2 oligonucleotides may be used alone or in combination with each other, thereby at least two STMN2 oligonucleotides may be used together as a single composition or as part of a therapeutic regimen. Inhibitors of STMN2 transcripts containing latent exons according to the present invention may also be used in combination with other drugs for treating neurological diseases or conditions.

[0345] Treatment and Evaluation

[0346] A patient as described herein refers to any animal, including but not limited to mammals, primates, and humans, that is at risk of, suffers from, or has been diagnosed with a neurological disease. In certain embodiments, the patient may be a non-human mammal, such as a cat, dog, or horse. In certain embodiments, the patient is a human. The patient may be an individual diagnosed as being at high risk of developing a neurological disease, a person diagnosed with a neurological disease, a person who has previously suffered from a neurological disease, or an individual evaluated for any sign or symptom associated with a neurological disease, such as amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), and / or neuropathy, such as chemotherapy-induced neuropathy.

[0347] As used herein, “patients in need” refers to patients suffering from any symptoms or signs of a neurological disease, patients who may suffer from any symptoms or signs of a neurological disease, or any patient who may benefit from the method of the present disclosure for treating a neurological disease. Patients in need may include patients diagnosed as being at risk of developing a neurological disease, patients who have previously suffered from a neurological disease, or patients who have previously received treatment for a neurological disease.

[0348] The term "effective dose" as used herein refers to an amount of agent sufficient to at least partially treat the condition when administered to a patient. The therapeutic effective dose will vary depending on the severity of the condition, the route of administration of the component, and the age, weight, etc. of the patient to be treated. Accordingly, the effective dose of an STMN2 transcript inhibitor containing a latent exon is the amount of STMN2 transcript inhibitor containing a latent exon necessary to treat the neurological disease in a patient so that administration of the agent prevents the onset of neurological disease in the subject, prevents the progression of neurological disease (e.g., prevents the onset or increased severity of neurological symptoms such as muscle weakness, spasms, or fasciculation), or alleviates or completely cures all associated symptoms of neurological disease, that is, to induce regression of the disease.

[0349] Therapeutic efficacy may be evaluated by the evaluation of gross symptoms associated with neurological diseases, analysis of histology, biochemical assays, imaging methods, e.g., magnetic resonance imaging, or other known methods. For example, therapeutic efficacy may be evaluated by administering an initiated inhibitor of the STMN2 transcript containing a latent exon to a patient suffering from a neurological disease, and then analyzing the gross symptoms of the disease, e.g., changes in muscle strength and control, or other aspects of the gross pathological condition associated with the neurological disease.

[0350] Therapeutic efficacy can also be evaluated at the tissue or cellular level by, for example, obtaining a tissue biopsy (e.g., brain, spinal cord, muscle, or motor neuron tissue biopsy) and evaluating the gross tissue or cell morphology or staining characteristics. Biochemical assays investigating protein or RNA expression can also be used to evaluate therapeutic efficacy. For example, levels of proteins or gene products indicating neurological disease in dissociated cells or non-dissociated tissues can be evaluated through immunocytochemistry, immunohistochemistry, Western blotting or Northern blotting methods, or methods useful for evaluating RNA levels, such as quantitative or semi-quantitative polymerase chain reactions (e.g., digital PCR (digital PCR, dPCR, or dePCR), qPCR, etc.). In addition, useful biomarkers found in cerebrospinal fluid, cerebrospinal fluid, extracellular vesicles (e.g., exosome-like cerebrospinal fluid extracellular vesicles (“CSF exosomes”), e.g., as described in the literature [Welton et al., (2017) “Cerebrospinal fluid extracellular vesicle enrichment for protein biomarker discovery in neurological disease; multiple sclerosis” J Extracell Vesicles., 6(1):1-10; and Street et al., (2012) “Identification and proteomic profiling of exosomes in human cerebrospinal fluid” J Transl. Med., 10:5]), urine, feces, lymph fluid, blood, plasma, or serum (e.g., neurofilament light chain (NEFL), neurofilament heavy chain (NEFH), TDP-43, or p75 extracellular domain (p75) ECDDisease status and therapeutic efficacy can be evaluated by assessing the presence or level of expression of )). Additionally, the presence or level of expression of useful biomarkers found in plasma, neuronal extracellular vesicles / exosomes can be evaluated. Further measurements of efficacy may include intensity duration time constant (SDTC), short-interval cortical inhibition (SICI), kinetics, accurate testing of limb isometric intensity (ATLIS), compound muscle action potential (Bio), and ALSFRS-R. In certain embodiments, the urinary neurotrophin receptor p75 extracellular domain (p75 ECD Phosphorylated neurofilament heavy chains (pNFH) in cerebrospinal fluid (CSF) are biomarkers for disease progression and prognosis in amyotrophic lateral sclerosis (ALS). Phosphorylated neurofilament heavy chains (pNFH) in CSF predict disease status and survival in patients with C9ORF72-associated amyotrophic lateral sclerosis (c9ALS). CSF pNFH as a prognostic biomarker for clinical trials will increase the likelihood of successful treatment for c9ALS.

[0351] In evaluating therapeutic efficacy, a suitable control group may be selected to ensure a valid evaluation. For example, symptoms evaluated in a patient with neurological disease after administration of an initiating inhibitor of an STMN2 transcript containing a latent exon may be compared to symptoms in the same patient or another patient not diagnosed with neurological disease before treatment or at the beginning of the course of treatment. Alternatively, the results of biochemical or histological analysis of tissues after administration of an initiating inhibitor of an STMN2 transcript containing a latent exon may be compared to those of tissues from the same patient, from an individual not diagnosed with neurological disease, or from the same patient prior to administration of the initiating inhibitor of an STMN2 transcript containing a latent exon. Additionally, blood, plasma, serum, cell, urine, lymph fluid, cerebrospinal fluid, or fecal samples after administration of the initiating inhibitor of an STMN2 transcript containing a latent exon may be compared to equivalent samples from an individual not diagnosed with neurological disease or from the same patient prior to administration of the initiating inhibitor of an STMN2 transcript containing a latent exon. In some embodiments, extracellular vesicles (e.g., CSF exosomes) after administration of an inhibitor of the STMN2 transcript containing a latent exon can be compared with extracellular vesicles from an individual not diagnosed with a neurological disease or from the same patient before administration of the inhibitor of the STMN2 transcript containing a latent exon.

[0352] Verification of the inhibition of STMN2 transcripts containing latent exons can be determined by direct or indirect evaluation of STMN2 expression levels or activity. For example, total inhibition of STMN2 transcripts containing latent exons can be evaluated using biochemical assays that measure STMN2 protein or RNA expression. For example, total STMN2 levels can be evaluated by measuring STMN2 protein levels in cells or tissues by Western blot. Additionally, total inhibition of STMN2 transcripts containing latent exons can be determined by measuring STMN2 mRNA levels by Northern blot or quantitative polymerase chain reaction. Furthermore, STMN2 protein levels or levels of other proteins exhibiting STMN2 signaling activity can be evaluated in dissociated cells, non-dissociated tissues, extracellular vesicles (e.g., CSF exosomes), blood, serum, or feces through immunocytochemical or immunohistochemical methods.

[0353] Furthermore, the coordination of STMN2 transcript splicing containing latent exons involves parameters such as autophagy, endocytosis, protein aggregation, and useful biomarkers (e.g., neurofilament light chains (NEFL), neurofilament heavy chains (NEFH), TDP-43, or p75 found in plasma, cerebrospinal fluid, extracellular vesicles (e.g., CSF exosomes), blood, urine, lymph, feces, or tissues). ECDThe efficacy of inhibiting STMN2 transcripts containing latent exons can be evaluated indirectly by assessing the presence or level of expression of ). Additionally, the inhibition of STMN2 transcripts containing latent exons can be evaluated indirectly by measuring the presence or level of expression of parameters, such as autophagy, endocytosis, protein aggregation, and physiological biomarkers, such as compound muscle action potentials (bio). Additional measurements may include intensity duration time constant (SDTC), short-interval cortical inhibition (SICI), kinetics, accurate testing of limb isometric intensity (ATLIS), compound muscle action potentials, and ALSFRS-R. In certain embodiments, the urine neurotrophin receptor p75 extracellular domain (p75 ECD Phosphorylated neurofilament heavy chains (pNFH) in cerebrospinal fluid (CSF) are biomarkers for disease progression and prognosis in amyotrophic lateral sclerosis (ALS). Phosphorylated neurofilament heavy chains (pNFH) in CSF predict disease status and survival in patients with c9ALS. CSF pNFH as a prognostic biomarker for clinical trials will increase the likelihood of successful treatment for c9ALS.

[0354] In some embodiments, the present disclosure provides a method for correcting the splicing of an STMN2 transcript having latent exons and thereby restoring full-length STMN2 protein expression in cells of a patient suffering from a neurological disease. The splicing of the STMN2 transcript may be corrected in any cells in which STMN2 expression or activity occurs, including cells of the nervous system (including the central nervous system, peripheral nervous system, motor neurons, brain, brainstem, frontal lobe, temporal lobe, and spinal cord), musculoskeletal system, cerebrospinal fluid, and cerebrospinal fluid. Cells of the musculoskeletal system include skeletal muscle cells (e.g., myocytes). Motor neurons include upper motor neurons and lower motor neurons.

[0355] Pharmaceutical composition and route of administration

[0356] The present disclosure also provides a method for treating a neurological disease by administering a pharmaceutical composition comprising a disclosed inhibitor of an STMN2 transcript containing a latent exon. In another aspect, the present disclosure provides a pharmaceutical composition for use in treating a neurological disease. The pharmaceutical composition may consist of a disclosed antisense oligonucleotide targeting an STMN2 transcript containing a latent exon and a pharmaceutically acceptable carrier. As used herein, the term “pharmaceutical composition” means a mixture containing a specified amount of a therapeutic compound, e.g., a therapeutically effective amount of a therapeutic compound, in a pharmaceutically acceptable carrier to be administered to mammals, e.g., humans, for treating a neurological disease. In some embodiments, a pharmaceutical composition comprising a disclosed inhibitor of an STMN2 transcript containing a latent exon and a pharmaceutically acceptable carrier is considered herein. In another aspect, the present disclosure provides the use of a disclosed inhibitor of an STMN2 transcript containing a latent exon in the manufacture of a medicine for treating a neurological disease. As used herein, the term “medicine” has essentially the same meaning as the term “pharmaceutical composition.”

[0357] As used herein, "pharmaceutical acceptable carriers" means buffers, carriers, and excipients suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications, corresponding to a reasonable benefit / risk ratio. Carrier(s) must be "acceptable" in the sense that they are compatible with other components of the formulation and are not harmful to the recipient. Pharmaceutically acceptable carriers include buffers, solvents, dispersion media, coatings, isotonic agents, and absorption retardants that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutical active substances is known in the relevant art. In one embodiment, the pharmaceutical composition is administered orally and comprises an enteric coating suitable for controlling the site of absorption of the encapsulated material within the digestive system or gastrointestinal tract. For example, the enteric coating may comprise an ethyl acrylate-methacrylic acid copolymer.

[0358] In one embodiment, the disclosed inhibitor of an STMN2 transcript containing a latent exon and any pharmaceutical composition thereof may be administered by one or more routes including topically, intrathecally, intrathecally, parenterally (e.g., subcutaneously, intramuscularly, intradermally, duodenally, or intravenously), into a lesion, orally, rectalally, buccally, sublingually, vaginally, transpulmonaryly, tracheally, intranasally, transdermally, or duodenally. As used herein, the term parenterally includes subcutaneous injection, intrapancreatic administration, intravenously, intrathecally, intrathecally, intramuscularly, intraperitoneally, intrasternal injection, or infusion techniques. For example, the disclosed inhibitor of an STMN2 transcript containing a latent exon may be administered subcutaneously to a subject. In another example, the disclosed inhibitor of an STMN2 transcript containing a latent exon may be administered orally to a subject. In another example, an initiated inhibitor of an STMN2 transcript containing a latent exon may be administered directly to the nervous system or specific regions or cells of the nervous system (e.g., brain, brainstem, lower motor neurons, spinal cord, upper motor neurons) via parenteral administration, and, for example, an initiated inhibitor of an STMN2 transcript containing a latent exon may be administered into the spinal canal or into the cistern.

[0359] In some embodiments, an inhibitor of the STMN2 transcript containing a latent exon, e.g., STMN2 AON, may be encapsulated within a nanoparticle coating. Nanoparticle encapsulation is believed to prevent AON degradation and enhance cellular uptake. For example, in some embodiments, the inhibitor of the STMN2 transcript containing a latent exon is encapsulated within a coating of a cationic polymer, e.g., synthetic polymers (e.g., poly-L-lysine, polyamidoamine, poly(β-amino ester), and polyethyleneimine) or naturally occurring polymers (e.g., chitosan and protamine). In some embodiments, the inhibitor of the STMN2 transcript containing a latent exon is encapsulated within a lipid or lipid-like substance, e.g., cationic lipid, cationic lipid-like substance, or ionizable lipid that is positively charged only at an acidic pH. For example, in some embodiments, the inhibitor of the STMN2 transcript containing a latent exon is encapsulated within lipid nanoparticles containing a hydrophobic moiety, e.g., cholesterol and / or polyethylene glycol (PEG) lipid.

[0360] In some embodiments, an inhibitor of the STMN2 transcript containing a latent exon, e.g., STMN2 AON, is conjugated to a bioactive ligand. For example, in some embodiments described herein, an inhibitor of the STMN2 transcript containing a latent exon, e.g., STMN2 AON, is conjugated to a peptide, lipid, N-acetylgalactosamine (GalNAc), cholesterol, vitamin E, antibody, or cell-penetrating peptide (e.g., transcriptional activator (TAT) and penetratin).

[0361] Pharmaceutical compositions containing disclosed inhibitors of STMN2 transcripts containing potential exons as disclosed herein may be provided in the form of dosage units and may be prepared by any suitable method. Pharmaceutical compositions should be formulated to be compatible with their intended route of administration. Useful formulations may be prepared by methods widely known in the pharmaceutical art. For example, refer to the literature [Remington's Pharmaceutical Sciences, 18th ed. (Mack Publishing Company, 1990)].

[0362] In some embodiments, the pharmaceutical formulation is sterilized. Sterilization can be achieved, for example, by filtration through a sterile filter membrane. If the composition is freeze-dried, filtration sterilization may be performed before or after freeze-drying and reconstitution.

[0363] Parenteral administration

[0364] The pharmaceutical compositions of the present disclosure may be formulated for parenteral administration and may be formulated for injection via, for example, intravenous, intra-aqueous, intramuscular, subcutaneous, intrathecal, intralesional, or intraperitoneal routes. The preparation of aqueous compositions, such as aqueous pharmaceutical compositions, containing the disclosed inhibitor of an STMN2 transcript containing a latent exon will be known to those skilled in the art in light of the present disclosure. Typically, such compositions may be prepared as injectables as liquid solutions or suspensions; solid forms suitable for use in preparing solutions or suspensions upon addition of liquid prior to injection may also be prepared; and formulations may also be emulsified.

[0365] Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; preparations comprising physiological saline, phosphate-buffered saline, artificial cerebrospinal fluid, sesame oil, peanut oil, or aqueous propylene glycol; and sterile powders for the immediate preparation of sterile injectable solutions or dispersions. In all cases, the forms must be sterile and fluid enough to allow for easy syringeability. They must be stable under manufacturing and storage conditions and preserved against the action of microorganisms, such as bacteria and fungi.

[0366] A solution of the active compound as a free base or a pharmacologically acceptable salt may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. The dispersion may also be prepared in glycerol, liquid polyethylene glycol and mixtures thereof, and in oil. Additionally, sterile fixation oils may be used as solvents or suspension media. For this purpose, any non-irritating fixation oil containing synthetic mono- or diglycerides may be used. Additionally, fatty acids, such as oleic acid, may be used in the preparation of injectables. Sterile injectable preparations may also be sterile injectable solutions, suspensions, or emulsions in non-toxic, parenterally acceptable diluents or solvents, such as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be used are water, Ringer's solution, USP, and isotonic sodium chloride solution. In one embodiment, the disclosed STMN2 antisense oligonucleotide may be suspended in a carrier fluid comprising 1% (w / v) sodium carboxymethylcellulose and 0.1% (v / v) TWEEN™ 80. Under normal storage and use conditions, these formulations contain a preservative to prevent microbial growth.

[0367] Injectable formulations, e.g., sterile injectable aqueous or oily suspensions, may be formulated according to known techniques using suitable dispersants or wetting agents and suspending agents. Generally, dispersions are prepared by incorporating various sterile active ingredients into a sterile vehicle containing a basic dispersion medium and other necessary ingredients from those listed above. Sterile injectable solutions of the present disclosure may be prepared by incorporating the disclosed STMN2 antisense oligonucleotide (e.g., an inhibitor of the STMN2 transcript containing a latent exon) with various other ingredients listed above into a required amount of a suitable solvent, and then filtering and sterilizing as necessary. In the case of sterile powders for the preparation of sterile injectable solutions, preferred manufacturing methods are vacuum-drying and freeze-drying techniques that produce a powder of the active ingredient plus any additional desired ingredient from its previously sterile-filtered solution. Injectable formulations may be sterilized, for example, by filtration through a bacteria-retaining filter.

[0368] The preparation of more concentrated or highly concentrated solutions for intramuscular injection is also considered. In this regard, it is preferable to use DMSO as a solvent, as this will induce extremely rapid penetration to deliver a high concentration of the initiated inhibitor of the STMN2 transcript containing the potential exon to a small area.

[0369] Preservatives suitable for use in such solutions include benzalkonium chloride, benzethonium chloride, chlorobutanol, thimerosal, etc. Suitable buffers include boric acid, sodium bicarbonate and potassium bicarbonate, sodium borate and potassium borate, sodium carbonate and potassium carbonate, sodium acetate, sodium phosphate, etc., in amounts sufficient to maintain the pH to about pH 6 to pH 8, e.g., about pH 7 to pH 7.5. Suitable enteric agents include dextran 40, dextran 70, dextrose, glycerin, potassium chloride, propylene glycol, sodium chloride, etc., and accordingly, the sodium chloride equivalent of the solution is in the range of 0.9 plus or minus 0.2%. Suitable antioxidants and stabilizers include sodium bisulfite, sodium metabisulfite, sodium thiosulfite, thiourea, etc. Suitable wetting agents and purifying agents include polysorbate 80, polysorbate 20, poloxamer 282, and tiloxafol. Suitable viscosity-increasing agents include dextran 40, dextran 70, gelatin, glycerin, hydroxyethylcellulose, hydroxymethylpropylcellulose, lanolin, methylcellulose, petrolatum, polyethylene glycol, polyvinyl alcohol, polyvinylpyrrolidone, carboxymethylcellulose, etc.

[0370] Oral administration

[0371] In some embodiments, a tablet comprising a composition suitable for oral delivery of an inhibitor of an STMN2 transcript containing a latent exon, e.g., an enteric coating, e.g., a gastric-resistant coating, is considered herein, such that the composition can deliver an inhibitor of an STMN2 transcript containing a latent exon, e.g., to the gastrointestinal tract of a patient.

[0372] For example, an oral tablet (e.g., formed at least partially from granules) is provided comprising granules comprising an STMN2 antisense oligonucleotide represented by any of the STMN2 transcripts containing a latent exon, e.g., STMN2 antisense oligonucleotides, e.g., SEQ ID NO: 1-446, SEQ ID NO: 894-918, SEQ ID NO: 945-1390, or SEQ ID NO: 1392-1432, and pharmaceutically acceptable excipients. Such tablets may be coated with an enteric coating. The tablets under consideration may comprise pharmaceutically acceptable excipients, e.g., fillers, binders, disintegrants and / or lubricants, as well as coloring agents, release agents, coating agents, sweeteners, flavoring agents, e.g., wintergreen, orange, xylitol, sorbitol, fructose, and maltodextrin, and perfumes, preservatives and / or antioxidants.

[0373] In some embodiments, the pharmaceutical formulation under consideration comprises a disclosed inhibitor of an STMN2 transcript containing a potential exon, for example, an STMN2 antisense oligonucleotide represented by any of SEQ ID NO: 1-446, SEQ ID NO: 894-918, SEQ ID NO: 945-1390, or SEQ ID NO: 1392-1432, an and a pharmaceutically acceptable salt, for example, an antisense oligonucleotide represented by any of SEQ ID NO: 1-446, SEQ ID NO: 894-918, SEQ ID NO: 945-1390, or SEQ ID NO: 1392-1432, and a pharmaceutically acceptable filler. For example, the disclosed inhibitor of an STMN2 transcript containing a latent exon and the filler may optionally be blended with other excipients to form granules. In some embodiments, wet granulation may be used to form the in-granular phase, for example, by adding a liquid (e.g., water) to the blend of the STMN2 transcript inhibitor compound containing a latent exon and the filler, and then drying, milling, and / or sieving the mixture to produce granules. A person skilled in the art will understand that the in-granular phase may be achieved using other methods.

[0374] In some embodiments, the formulation under consideration comprises an extragranular phase, which may include one or more pharmaceutically acceptable excipients and may be blended with an intragranular phase to form the disclosed formulation.

[0375] The disclosed formulation may comprise a granular phase containing a filler. Exemplary fillers include, but are not limited to, cellulose, gelatin, calcium phosphate, lactose, sucrose, glucose, mannitol, sorbitol, microcrystalline cellulose, pectin, polyacrylate, dextrose, cellulose acetate, hydroxypropylmethyl cellulose, partially pre-gelatinized starch, calcium carbonate, and combinations thereof.

[0376] In some embodiments, the disclosed formulation may comprise an intragranular phase and / or an extragranular phase comprising a binder capable of functioning to hold together the components of the pharmaceutical formulation. Exemplary binders of the present disclosure may include, but are not limited to, starch, sugar, cellulose or modified cellulose, such as hydroxypropyl cellulose, lactose, pre-gelatinized maize starch, polyvinylpyrrolidone, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, low-substituted hydroxypropyl cellulose, sodium carboxymethyl cellulose, methyl cellulose, ethyl cellulose, sugar alcohols, and combinations thereof.

[0377] For example, formulations under consideration comprising an intragranular phase and / or an extragranular phase may comprise a disintegrant, such as, but not limited to, starch, cellulose, cross-linked polyvinylpyrrolidone, sodium starch glycolate, sodium carboxymethyl cellulose, alginate, corn starch, sodium cross-mellose, cross-linked carboxymethyl cellulose, low-substituted hydroxypropyl cellulose, acacia, and combinations thereof. For example, the intragranular phase and / or the extragranular phase may comprise a disintegrant.

[0378] In some embodiments, the formulation under consideration comprises an disclosed inhibitor of an STMN2 transcript containing a potential exon, an intragranular phase comprising an excipient selected from mannitol, microcrystalline cellulose, hydroxypropylmethyl cellulose and sodium starch glycolate or a combination thereof, and an extragranular phase comprising one or more of microcrystalline cellulose, sodium starch glycolate and magnesium stearate or a mixture thereof.

[0379] In some embodiments, the formulation under consideration may include a lubricant, for example, the phase other than the granules may contain a lubricant. The lubricant includes, but is not limited to, talc, silica, fat, stearin, magnesium stearate, calcium phosphate, silicon dioxide, calcium silicate, calcium phosphate, colloidal silicon dioxide, metallic stearate, hydrogenated vegetable oil, partially hydrogenated vegetable oil, corn starch, sodium benzoate, polyethylene glycol, sodium acetate, calcium stearate, sodium lauryl sulfate, sodium chloride, magnesium lauryl sulfate, talc, and stearic acid.

[0380] In some embodiments, the pharmaceutical formulation comprises an enteric coating. Generally, the enteric coating creates a barrier that controls the location where the drug is absorbed along the digestive tract for oral medicines. The enteric coating may comprise a polymer that disintegrates at different rates depending on pH. The enteric coating may comprise, for example, cellulose acetate phthalate, methyl acrylate-methacrylic acid copolymer, cellulose acetate succinate, hydroxylpropylmethyl cellulose phthalate, methyl methacrylate-methacrylic acid copolymer, ethyl acrylate-methacrylic acid copolymer, methacrylic acid copolymer type C, polyvinyl acetate-phthalate, and cellulose acetate phthalate.

[0381] Exemplary enteric coatings include Opadry® AMB, Acryl-EZE®, and Eudragit® grades. In some embodiments, the enteric coating may constitute about 5 wt% to about 10 wt%, about 5 wt% to about 20 wt%, 8 wt% to about 15 wt%, about 8 wt% to about 20 wt%, about 10 wt% to about 20 wt%, or about 12 wt% to about 20 wt% or about 18 wt% of the tablets considered. For example, the enteric coating may comprise an ethyl acrylate-methacrylic acid copolymer.

[0382] For example, in the embodiments considered, a tablet is provided comprising or essentially composed of about 0.5 wt% to about 70 wt%, for example about 0.5 wt% to about 10 wt%, or about 1 wt% to about 20 wt% of the disclosed STMN2 antisense oligonucleotide or a pharmaceutically acceptable salt thereof. Such tablets may comprise, for example about 0.5 wt% to about 60 wt% of mannitol, for example about 30 wt% to about 50 wt% of mannitol, for example about 40 wt% of mannitol; and / or about 20 wt% to about 40 wt% of microcrystalline cellulose or about 10 wt% to about 30 wt% of microcrystalline cellulose. For example, the disclosed tablet may comprise an intragranular phase comprising about 30% to about 60% by weight, for example about 45% to about 65% by weight, or alternatively about 5% to about 10% by weight of the disclosed STMN2 antisense oligonucleotide, about 30% to about 50% by weight, or alternatively about 5% to about 15% by weight of mannitol, about 5% to about 15% by weight of microcrystalline cellulose, about 0% to about 4% by weight, or about 1% to about 7% by weight of hydroxypropylmethylcellulose, and about 0% to about 4% by weight, for example about 2% to about 4% by weight of sodium starch glycolate.

[0383] In another embodiment under consideration, a pharmaceutical tablet formulation for oral administration of a disclosed inhibitor of an STMN2 transcript comprising a potential exon comprises an intragranular phase, wherein the intragranular phase comprises the disclosed STMN2 AON or a pharmaceutically acceptable salt thereof (e.g., sodium salt) and a pharmaceutically acceptable filler, and the formulation may also comprise an extragranular phase comprising a pharmaceutically acceptable excipient, e.g., a disintegrant. The extragranular phase may comprise a component selected from microcrystalline cellulose, magnesium stearate, and mixtures thereof. The pharmaceutical composition may also comprise an enteric coating of about 12% to 20% by weight of the tablet. For example, a pharmaceutically acceptable tablet for oral use may comprise about 0.5% to 10% by weight of the disclosed STMN2 AON, for example, the disclosed STMN2 AON or a pharmaceutically acceptable salt thereof, about 30% to 50% by weight of mannitol, about 10% to 30% by weight of microcrystalline cellulose, and an enteric coating comprising an ethyl acrylate-methacrylic acid copolymer.

[0384] In another example, a pharmaceutically acceptable tablet for oral use may comprise an inner granular phase comprising about 5 to about 10 wt% of the disclosed STMN2 AON, e.g., the disclosed STMN2 AON or its pharmaceutically acceptable salt, about 40 wt% mannitol, about 8 wt% microcrystalline cellulose, about 5 wt% hydroxypropylmethyl cellulose, and about 2 wt% sodium starch glycolate; an outer granular phase comprising about 17 wt% microcrystalline cellulose, about 2 wt% sodium starch glycolate, and about 0.4 wt% magnesium stearate; and an enteric coating on the tablet phase comprising an ethyl acrylate-methacrylic acid copolymer.

[0385] In some embodiments, the pharmaceutical composition may contain an enteric coating comprising about 13 weight% or about 15 weight%, 16 weight%, 17 weight% or 18 weight%, e.g., Acrylate EZE® (see, e.g., PCT publication number WO 2010 / 054826 (the full text thereof is incorporated herein by reference)).

[0386] The rate at which the coating dissolves and the active ingredient is released is its dissolution rate. In one embodiment, the tablet under consideration may have a dissolution profile in which about 50% to about 100% of the inhibitor of the STMN2 transcript containing the latent exon is released after about 120 minutes to about 240 minutes, for example after 180 minutes, when tested, for example, in a phosphate buffer of pH 7.2 at 100 rpm and 37°C in a USP / EP Type 2 device (paddle). In another embodiment, the tablet under consideration may have a dissolution profile in which substantially none of the inhibitor of the STMN2 transcript containing the latent exon is released after 120 minutes when tested, for example, in a dilute HCl of pH 1.0 at 100 rpm and 37°C in a USP / EP Type 2 device (paddle). In another embodiment, the tablet under consideration may have a solubility profile in which about 10% to about 30% or about 50% or less of the inhibitor of the STMN2 transcript containing the potential exon is released after 30 minutes when tested, for example, in a phosphate buffer of pH 6.6 at 100 rpm and 37°C in a USP / EP type 2 device (paddle).

[0387] In some embodiments, the method provided herein may further comprise administering at least one other agent for the treatment of the diseases and disorders disclosed herein. In one embodiment, the other agent considered may be co-administered (e.g., sequentially or simultaneously).

[0388] Dosage and frequency of administration

[0389] The dosages or amounts listed below are for oligonucleotides or their pharmaceutically acceptable salts.

[0390] In some embodiments, the formulation comprises a dosage form comprising an inhibitor of an STMN2 transcript containing a potential exon, for example, an STMN2 antisense oligonucleotide, at least 1 μg, at least 5 μg, at least 10 μg, at least 20 μg, at least 30 μg, at least 40 μg, at least 50 μg, at least 60 μg, at least 70 μg, at least 80 μg, at least 90 μg, or at least 100 μg. In some embodiments, the formulation comprises STMN2 antisense oligonucleotide 10 mg to 500 mg, 1 mg to 10 mg, 10 mg to 20 mg, 20 mg to 30 mg, 30 mg to 40 mg, 40 mg to 50 mg, 50 mg to 60 mg, 60 mg to 70 mg, 70 mg to 80 mg, 80 mg to 90 mg, 90 mg to 100 mg, 100 mg to 150 mg, 150 mg to 200 mg, 200 mg to 250 mg, 250 mg to 300 mg, 300 mg to 350 mg, 350 mg to 400 mg, 400 mg to 450 mg, 450 mg to 500 mg, 500 mg to 600 mg, 600 mg to 700 mg, It includes dosage forms comprising 700 mg to 800 mg, 800 mg to 900 mg, 900 mg to 1 g, 1 mg to 50 mg, 20 mg to 40 mg, or 1 mg to 500 mg.

[0391] In some embodiments, the formulation comprises an inhibitor of the STMN2 transcript containing a potential exon, for example, about 10 mg to about 500 mg of STMN2 AON, or a dosage form essentially made thereof. For example, an initiated inhibitor of STMN2 transcripts containing latent exons, approximately 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1 g, 1.5 g, 2.0 g, 2.5 g, 3.0 g, 3.5 g, 4.0 g, Formulations containing 4.5 g or 5.0 g are considered herein. In some embodiments, the formulation may contain about 40 mg, 80 mg, or 160 mg of an initiated inhibitor of an STMN2 transcript containing a latent exon. In some embodiments, the formulation may contain at least 100 μg of an initiated inhibitor of an STMN2 transcript containing a latent exon. For example, the formulation may contain about 0.1 mg, 0.2 mg, 0.3 mg, 0.4 mg, 0.5 mg, 1 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, or 30 mg of an initiated inhibitor of an STMN2 transcript containing a latent exon. The amount administered will depend on variables such as the type and severity of the disease or indication to be treated, the patient's overall health and size, the in vivo efficacy of the initiated inhibitor of the STMN2 transcript containing a latent exon, the pharmaceutical formulation, and the route of administration. The initial dose may be increased beyond the upper level to rapidly achieve the target blood or tissue level.Alternatively, the initial dose may be lower than the optimal dose, and the dose may be gradually increased during the course of treatment. Human doses may be optimized, for example, in a conventional Phase I dose escalation study. The frequency of administration may vary depending on factors such as the route of administration, the dose, and the disease to be treated. Exemplary frequencies of administration are once daily, once weekly, and once every two weeks. In some embodiments, administration is once daily for seven days. In some embodiments, administration is once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, once every eleven weeks, or once every twelve weeks. In some embodiments, administration is once every month to every three months.

[0392] Combination therapy

[0393] In various embodiments, STMN2 AON as disclosed herein may be administered in combination with one or more additional therapies. The combination therapy of the disclosed oligonucleotide and one or more additional therapies may, in some embodiments, be synergistic in treating any of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD) and / or neuropathy, such as chemotherapy-induced neuropathy.

[0394] Exemplary additional therapies include riluzole (Rilutek), edaravone (Radicava), rivastigmine, donepezil, galantamine, selective serotonin reuptake inhibitors, antipsychotics, cholinesterase inhibitors, memantine, benzodiazepine anxiolytics, AMX0035 (Elibrio), zilucoplan (RA101495), dual AON intrathecal administration (e.g., BIIB067, BIIB078), BIIB100, levodopa / carbidopa, dopaminergic agonists (e.g., ropinirol, pramipexole, rotigotine), medroxyprogesterone, KCNQ2 / KCNQ3 antagonists, anticonvulsants, and psychostimulants. Additional therapies may further include respiratory management, physical therapy, occupational therapy, speech therapy, and nutritional support. In various embodiments, the additional therapy may be a second antisense oligonucleotide. For example, the second antisense oligonucleotide may target STMN2 transcripts (e.g., STMN2 pre-mRNA, mature STMN2 mRNA) to modulate the expression level of full-length STMN2 protein.

[0395] In various embodiments, the disclosed oligonucleotide and one or more additional therapies may be conjugated to each other and provided in a conjugated form. Further description of a conjugate comprising the disclosed oligonucleotide is provided below. In various embodiments, the disclosed oligonucleotide and one or more additional therapies are provided jointly. In various embodiments, the disclosed oligonucleotide and one or more additional therapies are provided simultaneously. In various embodiments, the disclosed oligonucleotide and one or more additional therapies are provided sequentially.

[0396] composite

[0397] In certain embodiments, an oligomer compound comprising an oligonucleotide (e.g., STMN2 oligonucleotide) and optionally one or more conjugate groups and / or terminal groups is provided herein. The conjugate group comprises one or more conjugate moietyes and a conjugate linker connecting the conjugate moietyes to the oligonucleotide. The conjugate group may be attached to one or both ends of the oligonucleotide and / or any internal position. In certain embodiments, the conjugate group is attached to the 2'-position of the nucleoside of the modified oligonucleotide. In certain embodiments, the conjugate group attached to one or both ends of the oligonucleotide is a terminal group. In certain such embodiments, the conjugate group or terminal group is attached to the 3' and / or 5'-terminus of the oligonucleotide. In certain such embodiments, the conjugate group (or terminal group) is attached to the 3'-terminus of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 3'-terminus of the oligonucleotide. In certain embodiments, the conjugate group (or terminal group) is attached to the 5'-terminus of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 5'-terminus of the oligonucleotide.

[0398] Examples of terminal groups include, but are not limited to, conjugate groups, capping groups, phosphate moiety, protecting groups, modified or unmodified nucleosides and two or more independently modified or unmodified nucleosides.

[0399] Conjugate

[0400] In certain embodiments, STMN2 AON is covalently attached to one or more conjugate groups. In certain embodiments, the conjugate group modifies one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cell distribution, cell absorption, charge, and clearance. In certain embodiments, the conjugate group modifies (e.g., increases) the circulation time of the oligonucleotide in the bloodstream so that an increased concentration of the oligonucleotide is delivered to the brain. In certain embodiments, the conjugate group modifies (e.g., increases) the residence time of the oligonucleotide in a target organ (e.g., brain) so that the increased residence time of the oligonucleotide improves its performance (e.g., efficacy). In certain embodiments, the conjugate group increases the delivery of the oligonucleotide to the brain through the blood-brain barrier and / or brain parenchyma (e.g., through receptor-mediated cell passage). In certain embodiments, the conjugate group enables the oligonucleotide to target a specific organ (e.g., brain). In certain embodiments, the conjugate group imparts new properties to the attached oligonucleotide, for example, a fluorescent group or reporter group that enables the detection of the oligonucleotide. Specific conjugate groups and conjugate moieties, e.g.: cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. NY. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains, e.g., do-decane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane palmityl acetate moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO2014 / 179620) have been previously described.

[0401] Conjugate moiety

[0402] The conjugate moiety comprises, but is not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moietyes, polyethylene glycol, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moietyes, folates, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorescent dyes, and dyes. In certain embodiments, the conjugate moiety is selected from peptides, lipids, N-acetylgalactosamine (GalNAc), cholesterol, vitamin E, lipoic acid, pantothenic acid, polyethylene glycol, antibodies (e.g., antibodies for crossing the blood-brain barrier, e.g., anti-transferrin receptor antibodies), or cell-penetrating peptides (e.g., transcriptional activators (TAT) and penetratin).

[0403] In certain embodiments, the conjugate moiety comprises an active drug substance, e.g., aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, caprofen, dansilsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepine, indomethacin, barbiturate, cephalosporin, sulfa drug, antidiabetic agent, antibacterial agent, or antibiotic.

[0404] Conjugate linker

[0405] The conjugated moiety is attached to STMN2 AON via a conjugated linker. In certain oligomer compounds, the conjugated linker is a single chemical bond (i.e., the conjugated moiety is attached directly to the oligonucleotide via a single bond). In certain embodiments, the conjugated linker comprises a chain structure, a repeating unit, such as an oligomer of ethylene glycol, a nucleoside, or an amino acid unit.

[0406] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linker.

[0407] In certain embodiments, a conjugate linker comprising the conjugate linker described above is known in the art to be useful for attaching a bifunctional linking moiety, e.g., a conjugate group, to a parent compound, e.g., the oligonucleotide provided herein. Generally, the bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a specific site on the parent compound, and the other is selected to bind to the conjugate group. Examples of functional groups used in the bifunctional linking moiety include, but are not limited to, electrophiles for reacting with a nucleophilic group and nucleophiles for reacting with an electrophilic group. In certain embodiments, the bifunctional linking moiety comprises one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0408] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers are substituted or unsubstituted C1-C 10Alkyl, substituted or unsubstituted C2-C 10 Alkenyl or substituted or unsubstituted C2-C 10 Alkynyl includes, but is not limited to, preferred substituents, and a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxyl, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0409] In certain embodiments, the conjugate linker comprises 1 to 10 linker-nucleosides. In certain embodiments, the conjugate linker comprises 2 to 5 linker-nucleosides. In certain embodiments, the conjugate linker comprises 3 linker-nucleosides.

[0410] In certain embodiments, these linker-nucleosides are modified nucleosides. In certain embodiments, these linker-nucleosides comprise a modified sugar moiety. In certain embodiments, the linker-nucleosides are unmodified. In certain embodiments, the linker-nucleosides comprise an optionally protected heterocyclic base selected from purines, substituted purines, pyrimidines, or substituted pyrimidines. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. Typically, it is desirable for the linker-nucleosides to be cleaved from the compound after the oligomer compound reaches the target tissue. Thus, the linker-nucleosides are typically linked to each other and to the remainder of the oligomer compound through cleavable bonds. In certain embodiments, these cleavable bonds are phosphodiester bonds.

[0411] In the present invention, linker nucleosides are not considered to be part of an oligonucleotide. Accordingly, in an embodiment in which an oligonucleotide comprises a specified number or range of linked nucleosides and / or a specified percentage complementarity to a reference nucleic acid, and in which an oligonucleotide comprises a conjugated group comprising a conjugated linker that also comprises a linker nucleoside, these linker nucleosides are not counted for the length of the oligonucleotide and are not used to determine the percentage complementarity of the oligonucleotide to the reference nucleic acid.

[0412] In certain embodiments, it is preferable that the conjugate group be cleaved from the STMN2 AON. For example, under certain circumstances, an oligomer compound containing a specific conjugate moiety is better absorbed by a specific cell type, but when the oligomer compound is absorbed, it is preferable that the conjugate group be cleaved to release an unconjugated or molybdenum oligonucleotide. Accordingly, a specific conjugate linker may contain one or more cleavable moietys. In certain embodiments, the cleavable moiety is a cleavable link. In certain embodiments, the cleavable moiety is an atomic group containing at least one cleavable link. In certain embodiments, the cleavable moiety comprises an atomic group having one, two, three, four, or more than four cleavable links. In certain embodiments, the cleavable moiety is selectively cleaved within the cell or a subcellular compartment, such as inside a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.

[0413] In certain embodiments, the cleavable link is selected from amides, esters, ethers, esters of one or both of phosphodiesters, phosphate esters, carbamates, or disulfides. In certain embodiments, the cleavable link is one or both of the esters of phosphodiesters. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate link between an oligonucleotide and a conjugate moiety or conjugate group.

[0414] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, one or more linker nucleosides are connected to each other and / or to the remainder of the oligomer compound via cleavable bonds. In certain embodiments, these cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside attached to the 3' or 5'-terminal nucleoside of the oligonucleotide by phosphate nucleoside inter-nucleoside linking and covalently attached to the conjugate linker or the remainder of the conjugate moiety by phosphate or phosphorothioate linking. In certain such embodiments, the cleavable moiety is a 2'-deoxyadenosine.

[0415] terminal

[0416] In certain embodiments, the oligomer compound comprises one or more terminal groups. In certain such embodiments, the oligomer compound comprises a stabilized 5'-phosphate. The stabilized 5'-phosphate comprises, but is not limited to, a 5'-phosphonate, which includes, but is not limited to, 5'-vinylphosphonate. In certain embodiments, the terminal group comprises one or more abasic nucleosides and / or inverted nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides. In certain such embodiments, the 2'-linked nucleosides are abasic nucleosides.

[0417] Diagnostic method

[0418] The present disclosure also provides a method for diagnosing a patient with a neurological disease that relies on the detection of STMN2 expression signal levels in one or more biological samples from the patient. As used herein, the term “STMN2 expression signal” may refer to STMN2 gene expression, or any indicator of gene or gene product activity. STMN2 gene products include RNA (e.g., mRNA), peptides, and proteins. Indicators of STMN2 gene expression that may be evaluated include, but are not limited to, STMN2 gene or chromatin status, STMN2 gene interactions with cellular components regulating gene expression, STMN2 gene product expression levels (e.g., expression levels of STMN2 transcripts containing latent exons, STMN2 protein expression levels), or interactions between STMN2 RNA or protein and transcription, translation, or post-translational processing mechanisms.

[0419] Detection of STMN2 expression signals can be achieved through in vivo, in vitro, or in vitro methods. In a preferred embodiment, the method of the present disclosure may be performed in vitro. The detection method may involve detection in a patient's blood, serum, feces, tissue, cerebrospinal fluid, cerebrospinal fluid, extracellular vesicles (e.g., CSF exosomes), or cells. Detection may be achieved by measuring the expression signal of an STMN2 transcript containing latent exons in whole tissue, tissue explant, cell culture, dissociated cells, cell extracts, extracellular vesicles (e.g., CSF exosomes), or body fluids including blood, cerebrospinal fluid, cerebrospinal fluid, urine, lymph, or serum. Detection methods under consideration include assays for measuring the level of STMN2 gene product expression, such as Western blotting, FACS, ELISA, other quantitative linkage assays, cell or tissue growth assays, Northern blot, quantitative or semi-quantitative polymerase chain reaction, dPCR, the Quanterix SR-X™ Ultra-Sensitive Biomarker Detection System operated by Simoa® Bead Technology, medical imaging methods (e.g., MRI), or immunohistochemistry methods (e.g., immunohistochemistry or immunocytochemistry).

[0420] Additional embodiments

[0421] A compound is disclosed herein comprising an oligonucleotide comprising a sequence having at least 90% identity with respect to at least 10 adjacent nucleotides of a transcript comprising sequence number 1391 or sequence number 944, or sequence number 1391 or sequence number 944, wherein at least one nucleoside link of the nucleotide sequence is a non-natural link. Additionally, an oligonucleotide is disclosed herein comprising a sequence having at least 90% identity with respect to at least 10 adjacent nucleotides of a transcript comprising sequence identification number: 1391 or sequence identification number: 944, or sequence identification number: 1391 or sequence identification number: 944, wherein at least one nucleoside link of the nucleotide sequence is a non-natural link.

[0422] In one aspect, the oligonucleotide comprises at least 10 adjacent nucleotide sequences that share 90% identity with an equal length portion of any one of sequence identification number: 1-446, sequence identification number: 894-918, sequence identification number: 945-1390, or sequence identification number: 1392-1432. In one aspect, the oligonucleotide comprises at least 11, 12, 13, 14, 15, 16, or 17 adjacent nucleotide sequences that share at least 90% identity with an equal length portion of any one of sequence identification number: 1-446, sequence identification number: 894-918, sequence identification number: 945-1390, or sequence identification number: 1392-1432. In one aspect, oligonucleotides are sequence identification numbers: 31, 36, 41, 46, 55, 144, 146, 150, 169, 170, 171, 172, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 390, 395, 400, 975, 980, 985, 999, 1088, 1090, 1094, 1113, 1114, 1115, 1116, 1117, 1121, 1125, 1129, 1141, It comprises at least 10 adjacent nucleobase sequences that share at least 90% identity with any one of the same length portions of 1147, 1153, 1159, 1181, 1188, 1193, 1196, 1324, 1329, 1334, 1339, or 1344, 1339, or 1344, wherein at least one nucleoside linkage of the nucleobase sequence is a non-natural linkage.In one aspect, oligonucleotides are sequence identification numbers: 31, 36, 41, 46, 55, 144, 146, 150, 169, 170, 171, 172, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 390, 395, 400, 975, 980, 985, 999, 1088, 1090, 1094, 1113, 1114, 1115, 1116, 1117, 1121, 1125, 1129, 1141, It includes at least 11, 12, 13, 14, 15, 16, or 17 adjacent nucleobase sequences that share at least 90% identity with an equal length portion of any one of 1147, 1153, 1159, 1181, 1188, 1193, 1196, 1324, 1329, 1334, 1339, or 1344.

[0423] Additionally, an oligonucleotide is disclosed herein that comprises at least 90% complementary nucleotide sequences to at least 10 adjacent nucleotide sequences of a transcript comprising at least 90% identity with respect to at least 20 to 50 adjacent nucleotide portions thereof, wherein at least one nucleoside linkage of the nucleotide sequences is a non-natural linkage. In one aspect, the oligonucleotide comprises at least 10 adjacent nucleotide sequences that share 90% identity with an equal length portion of either Sequence Identification No. 1-446 or Sequence Identification No. 894-918. In one aspect, the oligonucleotide comprises at least 11, 12, 13, 14, 15, 16, or 17 adjacent nucleotide sequences that share at least 90% identity with an equal length portion of either Sequence Identification No. 1-446 or Sequence Identification No. 894-918. In one aspect, oligonucleotides are sequence identification numbers: 31, 36, 41, 46, 55, 144, 146, 150, 169, 170, 171, 172, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 390, 395, 400, 975, 980, 985, 999, 1088, 1090, 1094, 1113, 1114, 1115, 1116, 1117, 1121, 1125, 1129, 1141, It includes at least 10 adjacent nucleobase sequences that share at least 90% identity with any one of 1147, 1153, 1159, 1181, 1188, 1193, 1196, 1324, 1329, 1334, 1339, or 1344, wherein at least one nucleoside linkage of the nucleobase sequence is a non-natural linkage.In one aspect, oligonucleotides are sequence identification numbers: 31, 36, 41, 46, 55, 144, 146, 150, 169, 170, 171, 172, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 390, 395, 400, 975, 980, 985, 999, 1088, 1090, 1094, 1113, 1114, 1115, 1116, 1117, 1121, 1125, 1129, 1141, It includes at least 11, 12, 13, 14, 15, 16, or 17 adjacent nucleobase sequences that share at least 90% identity with an equal length portion of any one of 1147, 1153, 1159, 1181, 1188, 1193, 1196, 1324, 1329, 1334, 1339, or 1344.

[0424] Additionally, disclosed herein is a statmin-2 (STMN2) antisense oligonucleotide comprising a nucleic acid sequence that is at least 90% complementary to a sequence of 10 consecutive nucleotide sequences of an STMN2 transcript comprising a potential exon comprising at least 90% identical nucleotide sequences for 20 to 50 consecutive nucleotide portions thereof, wherein at least one nucleoside linkage of the nucleotide sequence is a non-natural linkage. Additionally, disclosed herein is a statmin-2 (STMN2) antisense oligonucleotide comprising a nucleic acid sequence that shares at least 90% identity with a sequence of 10 consecutive nucleotide sequences of any one of Sequence Identification No. 1-446, wherein at least one nucleoside linkage of the nucleotide sequence is a non-natural linkage. In one aspect, the nucleic acid sequence shares at least 90% identity with a sequence of 11, 12, 13, 14, 15, 16, or 17 nucleotides in any one of sequence identification numbers: 1-446.

[0425] Additionally, sequence identification numbers: 31, 36, 41, 46, 55, 144, 146, 150, 169, 170, 171, 172, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 390, 395, 400, 975, 980, 985, 999, 1088, 1090, 1094, 1113, 1114, 1115, 1116, 1117, 1121, 1125, 1129, 1141, 1147, Disclosed herein is a statmin-2 (STMN2) antisense oligonucleotide comprising a nucleic acid sequence that shares at least 90% identity with any one of 10 consecutive nucleobase sequences of 1153, 1159, 1181, 1188, 1193, 1196, 1324, 1329, 1334, 1339, or 1344, wherein at least one nucleoside link of the nucleotide sequence is a non-natural link. In one aspect, the nucleic acid sequence is sequence identification number: 31, 36, 41, 46, 55, 144, 146, 150, 169, 170, 171, 172, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 390, 395, 400, 975, 980, 985, 999, 1088, 1090, 1094, 1113, 1114, 1115, 1116, 1117, 1121, 1125, 1129, 1141, It shares at least 90% identity with a sequence of 11, 12, 13, 14, 15, 16, or 17 nucleobases from any one of 1147, 1153, 1159, 1181, 1188, 1193, 1196, 1324, 1329, 1334, 1339, or 1344.

[0426] General variations

[0427] Although specific compounds, compositions, and methods described herein have been specifically described according to specific embodiments, the following examples are merely illustrative of the compounds described herein and are not intended to limit them. Each reference, GeneBank accession number, etc. cited in this application is incorporated herein by reference in its entirety.

[0428] In the sequence list attached to this application, each sequence is identified as “RNA” or “DNA” as necessary, but in practice, these sequences may be modified by any combination of chemical modifications. A person skilled in the art will readily recognize that designations such as “RNA” or “DNA” describing such modified oligonucleotides are optional in certain cases. For example, an oligonucleotide comprising a nucleoside containing a 2’-OH sugar moiety and a thymine base may be described as DNA having a modified sugar (2’-OH instead of one 2’-H of DNA) or RNA having a modified base (thymine (methylated uracil) instead of uracil of RNA). Accordingly, the nucleic acid sequences provided herein, including but not limited to the nucleic acid sequences in the sequence list, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to nucleic acids having such modified nucleobases. As additional examples and without limitation, oligomer compounds having the nucleobase sequence "ATCGATCG" include compounds containing RNA bases, e.g., compounds having the sequence "AUCGAUCG", and some DNA bases and some RNA bases, e.g., compounds having "AUCGATCG", and other modified nucleosides, e.g., "AT m CGAUCG" (here m It encompasses any oligomer compound having such a nucleus base sequence, whether modified or unmodified, including but not limited to oligomer compounds having a cytosine base containing a methyl group at the 5-position (C represents a cytosine base containing a methyl group at the 5-position).

[0429] Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric centers and thus produce enantiomers, diastereomers, and other stereoisomer coordinations that can be defined in terms of absolute stereochemistry as (R) or (S), e.g. as α or β for sugar anomers, e.g. as (D) or (L) for amino acids, etc. Compounds provided herein that are shown or described as having specific stereoisomer coordinations comprise only the shown compounds. Unless otherwise specified, compounds provided herein that are shown or described with undefined stereochemistry have included all such possible isomers, including their stereorandom forms and optically pure forms. Likewise, unless otherwise indicated, all tautomeric forms of the compounds of the present invention are also included. Unless otherwise indicated, compounds described herein are intended to comprise corresponding salt forms.

[0430] The compounds described herein include variations in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the element represented. For example, the compounds of the present invention comprising hydrogen atoms each 1 H encompasses all possible deuterium substitutions for hydrogen atoms. Isotope substitutions covered by the compounds of the present invention include, but are not limited to, the following: 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C, 14 Instead of N 15 N, 16 Instead of O 17 O or 18 O, and 32 Instead of S 33 S, 34 S, 35 S or 36S. In certain embodiments, non-radioactive isotope substitution can impart new properties to oligomeric compounds that are beneficial for use as therapeutic or research tools.

[0431] Examples

[0432] The disclosure is further illustrated by the following examples. The examples are provided for illustrative purposes only and should not be construed as limiting the scope or content of the disclosure in any way.

[0433] Example 1: Initial Design and Selection of STMN2 Antisense Oligonucleotides

[0434] To identify STMN2 antisense oligonucleotides (AONs) that can act as inhibitors of STMN2 transcripts containing potential exons, antisense oligonucleotides complementary to STMN2 RNA were designed and tested.

[0435] FIGS. 1a-1c illustrate portions of the STMN2 transcript and STMN2 antisense oligonucleotides designed to target specific portions of the STMN2 transcript. Specifically, regions of the STMN2 transcript include branching points (e.g., branching points 1, 2, and 3), a 3' splice acceptor region, an ESE binding region, a TDP43 binding site, and a poly-A region. STMN2 antisense oligonucleotides are identified according to the corresponding location in the STMN2 transcript. For example, FIG. 1a illustrates STMN2 antisense oligonucleotides targeting locations 36 through 60 of the STMN2 transcript, including branching point 1. Similarly, different STMN2 antisense oligonucleotides target locations 144 through 178 of the STMN2 transcript, including branching point 3. Other STMN2 antisense oligonucleotides may be designed using any of the sequences disclosed above (e.g., sequence identification numbers: 1-446, 894-918, 945-1390, or 1392-1432).

[0436] Generally, the length of the STMN2 antisense oligonucleotide is 25 nucleotides. However, variants of the STMN2 antisense oligonucleotide were also designed in various lengths (e.g., 23-mer, 21-mer, or 19-mer). Specific STMN2 AON and AON variants designed and developed for testing are presented in Table 7 below.

[0437] Table 7: Identification information of STMN2 AON and AON variants including sequence and chemical information.

[0438]

[0439]

[0440]

[0441]

[0442]

[0443]

[0444]

[0445] Example 2: Method for evaluating STMN2 antisense oligonucleotide

[0446] STMN2 antisense oligonucleotides were evaluated in SY5Y cells and human motor neurons. Specifically, the following Examples 3, 4, and 5 describe the results generated from the evaluation of STMN2 antisense oligonucleotides in SY5Y cells. The following Examples 6 and 7 describe the results generated from the evaluation of STMN2 antisense oligonucleotides in human motor neurons.

[0447] STMN2 antisense oligonucleotides were evaluated in SY5Y cells. Cells were plated in 6-well or 96-well plates and cultured at 80% full growth rate. Antisense oligonucleotides against TDP43 (AON) were transfected with RNAiMax (Thermo Fisher Scientific, Waltham, Massachusetts, USA) to express latent exons, thereby preventing the transcription of full-length STMN2 (STMN2-FL) products. The vehicle was treated with RNAiMax alone. Positive controls included cells treated with TDP43 siRNA alone ("siRNA TDP43") and / or TDP43 AON alone ("AON TDP43" or "TDP43 AON"). siRNA TDP43 was purchased from Horizon / Dharmacon as ON-TARGETplus Human TARDBP (23435) siRNA - SMARTpool (#L-012394-00-0005). TARDBP (23435) siRNA comprises four individual siRNAs targeting four distinct sequences:

[0448]

[0449] TDP43 AON is a capmer oligonucleotide and has the following sequence and chemistry:

[0450]

[0451] Here, * = phosphorothioate, underlined = DNA, remainder = 2'MOE RNA; each "C" is 5-MeC.

[0452] To evaluate the ability of STMN2 AON to restore STMN2-FL, antisense oligonucleotides for STMN2 were co-incubated with TDP43 AON in RNAiMax. After 96 hours, transcript levels (e.g., full-length STMN2 transcript, STMN2 transcript with latent exons, or TDP43 transcript) were detected by RT-qPCR using Tackman. Specifically, to detect GAPDH, RT-qPCR was performed using the Thermo Fisher Tackman gene expression assay Hs03929097_g1. RT-qPCR was performed using the following primer sequences to detect STMN2 transcripts containing latent exons: 1) forward primer: 5' - CTCAGTGCCTTATTCAGTCTTCTC - 3' (Sequence ID: 1444), 2) reverse primer: 5' - TCTTCTGCCGAGTCCCATTT-3' (Sequence ID: 1445), and 3) probe: 5' - / 56-FAM / TCAGCGTCTGCACATCCCTACAAT / 3BHQ_1 / -3' (Sequence ID: 1446). RT-qPCR was performed using the following primer sequences to detect the full-length STMN2 transcript: 1) forward primer: 5' -CCACGAACTTTAGCTTCTCCA - 3' (Sequence ID: 1447), 2) reverse primer: 5' -GCCAATTGTTTCAGCACCTG - 3' (Sequence ID: 1448), and 3) probe: 5' - / 56-FAM / ACTTTCTTCTTTCCTCTGCAGCCTCC / 3BHQ_1 / - 3' (Sequence ID: 1449).

[0453] RT-qPCR was performed on an Applied Biosystems® 7500 real-time PCR system. One cycle of reverse transcription was performed at 50°C for 5 minutes. One cycle of RT inactivation / initial denaturation was performed at 95°C for 20 seconds. 45 cycles of amplification were performed at 95°C for 1 second, followed by 60°C for 20 seconds.

[0454] STMN2-FL or STMN2 latent signal (Ct) was normalized against GAPDH (deltaCt). To visualize quantitative changes (e.g., % increase in STMN-FL), the normalized STMN2-FL signal was further normalized against the vehicle (treated with RNAiMax alone, deltaCt). Relative amounts at the transcriptome level are given by equation RQ=2 -델타델타Ct It was calculated using [this], and a comparison of treatment conditions to a normal, healthy level (1.0) was described using this.

[0455] The percentage decrease in STMN2 expression with latent exons was calculated using the following equation:

[0456]

[0457] The percentage increase in full-length STMN2 mRNA transcripts was calculated using the following formula:

[0458]

[0459] STMN2 antisense oligonucleotides were also evaluated for their efficacy in reducing latent exons and increasing STMN2 full-length transcripts in human motor neurons. 15 x 10 iCell human motor neurons (Cellular Dynamics International) were placed in a 96-well plate for RT-qPCR RNA quantification according to the manufacturer's instructions. 3 3 x 10⁶ cells in a 6-well plate for canine cell / well or Western blot protein quantification5 Canine cells were plated into wells. Neurons were transfected with TDP43 AON and / or STMN2 AON using an internal transporter (GeneTools, LLC.), or treated with the internal transporter alone. Treatment conditions were tested in biological triple (qRT-PCR) or double (Western blot) wells. The same TDP43 AON described above was used here to evaluate human motor neurons. TDP43 AON is a capmer oligonucleotide and has the following sequence and chemistry:

[0460]

[0461] Here, * = phosphorothioate, underlined = DNA, remainder = 2'MOE RNA; each "C" is 5-MeC.

[0462] After 72 hours, antisense oligonucleotides and internal transporters were washed and replaced with fresh medium. After an additional 72 hours, RNA was collected from 96-well plates for RT-qPCR, or proteins were collected from 6-well plates for Western blot. RNA was isolated, cDNA was generated, and multiplexed RT-qPCR assays were performed using Tackman probes for the quantification of STMN2 latent exons, STMN2 full-length transcripts, and reference GAPDH. The same primers described above for detecting GAPDH, STMN2 transcripts with latent exons, and full-length STMN2 in relation to SY5Y cells were applied here to perform RT-qPCR on human motor neurons. For protein quantification, the soluble portion of the protein collection was denatured, separated by SDS-PAGE, transferred to a polyvinylidene difluoride membrane, and probed with antibodies against GAPDH (Proteintech, 60004-1-1g), TDP-43 (Proteintech, 10782-2-AP), and statmin-2 (Thermo Fisher, PA5-23049).

[0463] STMN2 antisense oligonucleotides were tested for their ability to increase or restore full-length STMN2 mRNA levels (i.e., mRNA into which full-length STMN2 is translated) in TDP43-silenced cells (e.g., SY5Y cells and human motor neurons). In some cases, STMN2 antisense oligonucleotides were tested for their ability to decrease STMN2 transcripts containing latent exons. As further described below, the quantified percentage increase / restoration of STMN2-FL and / or the percentage decrease of STMN2 transcripts containing latent exons are described in relation to the levels of STMN-FL and / or STMN2 transcripts containing latent exons in controls (e.g., cells treated with 500 nM TDP43 AON).

[0464] Example 3: STMN2 antisense oligonucleotide restores full-length STMN2 in SY5Y cells and reduces STMN2 transcripts with latent exons.

[0465] Figures 1b and 1c demonstrate the efficacy of STMN2 AON targeting different regions of the STMN2 transcript containing latent exons. Specifically, Figure 1b illustrates STMN2 AON designed and evaluated in SY5Y cells. Figure 1c illustrates STMN2 AON designed and evaluated in human motor neurons. STMN2 AON, indicated by solid lines, produced cells with STMN2-FL mRNA expression increased by more than 50% compared to TDP43 AON treated alone. STMN2 AON, indicated by dotted lines, produced cells with STMN2-FL (full length) mRNA increased by less than 50% compared to TDP43 AON treated alone.

[0466] Referring to Figure 2, when treated with 500 nM TDP43 AON, the TDP43 transcript decreased by approximately 52%, and STMN2-FL decreased by approximately 57%. 500 nM treatment of STMN2 AON with sequence ID number 36 increased TDP43 levels by 25% and STMN-FL levels by 55% (67% rescued). 50 nM and 500 nM treatments of STMN2 AON with sequence ID number 177 increased STMN-FL levels by 58% (68% rescued) and 53% (66% rescued), respectively. 500 nM treatment of STMN2 AON with sequence ID number 203 increased TDP43 levels by 15% and STMN-FL levels by 72% (74% rescued). Treatment with 50 nM and 500 nM of STMN2 AON with sequence identification number 395 increased STMN-FL levels by 49% (64% rescued) and 37% (59% rescued), respectively. The dotted line indicates the expression level of FL-STMN2 in response to 500 nM TDP43 AON.

[0467] Referring to Figure 3, when treated with 500 nM TDP43 AON, the amount of STMN2 transcripts with latent exons increased by more than 20-fold. Treatment with 500 nM of STMN2 AON with sequence identification number: 173 reduced the level of STMN2 transcripts with latent exons by 68%. Treatment with 500 nM of STMN2 AON with sequence identification number: 181 reduced the level of STMN2 transcripts with latent exons by 65%. Treatment with 500 nM of STMN2 AON with sequence identification number: 197 reduced the level of STMN2 transcripts with latent exons by 39%. Treatment with 500 nM of STMN2 AON with sequence identification number: 215 reduced the level of STMN2 transcripts with latent exons by 31%. Treatment with 500 nM of STMN2 AON with sequence identification number: 385 reduced the level of STMN2 transcripts with latent exons by 53%. Treatment with 500 nM of STMN2 AON with sequence identification number: 400 reduced the level of STMN2 transcripts with latent exons by 74%. The dotted line indicates the expression level of STMN2 with latent exons in response to 500 nM TDP43 AON.

[0468] Referring to Figure 4, STMN2-FL decreased by approximately 59% upon treatment with 500 nM TDP43 AON. Treatment with 500 nM of STMN2 AON with sequence identification number 173 increased STMN-FL levels by 166% (68% rescued). Treatment with 500 nM of STMN2 AON with sequence identification number 197 increased STMN-FL levels by 146% (60% rescued). The dotted line indicates the expression level of FL-STMN2 in response to 500 nM TDP43 AON.

[0469] Referring to Figure 5a, when treated with 500 nM TDP43 AON, the amount of STMN2 transcripts with latent exons increased by more than 36-fold. Treatment with 500 nM of STMN2 AON with sequence identification number: 185 reduced the level of STMN2 transcripts with latent exons by 58%. Treatment with 500 nM of STMN2 AON with sequence identification number: 237 reduced the level of STMN2 transcripts with latent exons by 87%. Treatment with 500 nM of STMN2 AON with sequence identification number: 380 reduced the level of STMN2 transcripts with latent exons by 70%. Treatment with 500 nM of STMN2 AON with sequence identification number: 390 reduced the level of STMN2 transcripts with latent exons by 58%. The dotted line indicates the expression level of STMN2 with a latent exon that responded to 500 nM TDP43 AON.

[0470] Referring to Figure 5b, STMN2-FL decreased by 66% upon treatment with 500 nM TDP43 AON. Treatment with 500 nM of STMN2 AON with sequence identification number 185 increased STMN-FL levels by 209% (71% rescued). Treatment with 500 nM of STMN2 AON with sequence identification number 237 increased STMN-FL levels by 347% (118% rescued). The dotted line indicates the expression level of FL-STMN2 in response to 500 nM TDP43 AON.

[0471] Referring to Fig. 6a, when treated with 500 nM TDP43 AON (two different syntheses), the amount of STMN2 transcripts containing latent exons increased by more than 20-fold. Treatment with 500 nM of STMN2 AON with sequence identification number 144 reduced the level of STMN2 transcripts containing latent exons by 83 to 88%. Treatment with 500 nM of STMN2 AON with sequence identification number 237 reduced the level of STMN2 transcripts containing latent exons by 92 to 93%. The dotted line indicates the expression level of STMN2 containing latent exons in response to 500 nM TDP43 AON.

[0472] Referring to Fig. 6b, STMN2-FL decreased by approximately 80% upon treatment with 500 nM TDP43 AON. Treatment with 500 nM of STMN2 AON with sequence identification number 144 increased STMN-FL levels by 376% to 429% (79% to 90% rescued). Treatment with 500 nM of STMN2 AON with sequence identification number 237 increased STMN-FL levels by 490% to 538% (103% to 113% rescued). The dotted line indicates the expression level of FL-STMN2 in response to 500 nM TDP43 AON.

[0473] Referring to Figure 7a, treatment with 500 nM TDP43 AON increased the amount of latent exon STMN2 transcripts by more than 23-fold. Treatment with 500 nM STMN2 AON with sequence identification number 173 reduced the level of latent exon STMN2 transcripts by 83%. Treatment with 500 nM STMN2 AON with sequence identification number 177 reduced the level of latent exon STMN2 transcripts by 83%. Treatment with 500 nM STMN2 AON with sequence identification number 181 reduced the level of latent exon STMN2 transcripts by 72%. The dotted line indicates the expression level of latent exon STMN2 in response to 500 nM TDP43 AON.

[0474] Referring to Fig. 7b, STMN2-FL decreased by approximately 58% upon treatment with 500 nM TDP43 AON. Treatment with 500 nM of STMN2 AON with sequence number 173 increased STMN-FL levels by 219% (92% rescued). Treatment with 500 nM of STMN2 AON with sequence number 181 increased STMN-FL levels by 188% (79% rescued). Treatment with 500 nM of STMN2 AON with sequence number 185 increased STMN-FL levels by 174% (73% rescued). The dotted line indicates the expression level of FL-STMN2 in response to 500 nM TDP43 AON.

[0475] Referring to Figure 8a, when treated with 500 nM TDP43 AON, the amount of STMN2 transcripts with latent exons increased by more than 20-fold. Treatment with 500 nM of STMN2 AON with sequence identification number 197 reduced the level of STMN2 transcripts with latent exons by 65%. Treatment with 500 nM of STMN2 AON with sequence identification number 237 reduced the level of STMN2 transcripts with latent exons by 94%. The dotted line indicates the expression level of STMN2 with latent exons in response to 500 nM TDP43 AON.

[0476] Referring to Fig. 8b, STMN2-FL decreased by 59% upon treatment with 500 nM TDP43 AON. Treatment with 500 nM of STMN2 AON with sequence number 197 increased STMN-FL levels by 185% (76% rescued). Treatment with 500 nM of STMN2 AON with sequence number 237 increased STMN-FL levels by 227% (93% rescued). Treatment with 500 nM of STMN2 AON with sequence number 380 increased STMN-FL levels by 171% (70% rescued). The dotted line indicates the expression level of FL-STMN2 in response to 500 nM TDP43 AON.

[0477] Referring to Fig. 9a, treatment with 500 nM TDP43 AON resulted in an increase of more than 50-fold in the amount of STMN2 transcripts containing latent exons. Treatment with 500 nM of STMN2 AON with sequence identification number 144 reduced the level of STMN2 transcripts containing latent exons by 92%. Treatment with 500 nM of STMN2 AON with sequence identification number 173 reduced the level of STMN2 transcripts containing latent exons by 82%. Treatment with 500 nM of STMN2 AON with sequence identification number 237 reduced the level of STMN2 transcripts containing latent exons by 96%. The dotted line indicates the expression level of STMN2 containing latent exons in response to 500 nM TDP43 AON.

[0478] Referring to Fig. 9b, STMN2-FL decreased by 67% upon treatment with 500 nM TDP43 AON. Treatment with 500 nM of STMN2 AON with sequence number 144 increased STMN-FL levels by 235% (87% rescued). Treatment with 500 nM of STMN2 AON with sequence number 173 increased STMN-FL levels by 232% (86% rescued). Treatment with 500 nM of STMN2 AON with sequence number 237 increased STMN-FL levels by 243% (90% rescued). The dotted line indicates the expression level of FL-STMN2 in response to 500 nM TDP43 AON.

[0479] Referring to Fig. 10a, treatment with 500 nM TDP43 AON increased the amount of STMN2 transcripts containing latent exons by more than 65-fold. Treatment with 200 nM of STMN2 AON with sequence ID: 181 reduced the level of STMN2 transcripts containing latent exons by 50%. Treatment with 500 nM of STMN2 AON with sequence ID: 181 reduced the level of STMN2 transcripts containing latent exons by 73%. Referring to Fig. 10b, treatment with 500 nM TDP43 AON reduced STMN2-FL by 67%. Treatment with 50 nM of STMN2 AON with sequence ID: 181 increased the STMN-FL level by 215% (71% rescued). Treatment of STMN2 AON with sequence identification number: 181 at 200 nM increased STMN-FL levels by 197% (65% rescued). Treatment of STMN2 AON with sequence identification number: 181 at 500 nM increased STMN-FL levels by 194% (64% rescued).

[0480] Referring to Fig. 11a, treatment with 500 nM TDP43 AON increased the amount of STMN2 transcripts containing latent exons by more than 26-fold. Treatment with 500 nM of STMN2 AON containing sequence number 185 reduced the level of STMN2 transcripts containing latent exons by 47%. Referring to Fig. 11b, treatment with 500 nM TDP43 AON reduced STMN2-FL by 74%. Treatment with 50 nM of STMN2 AON containing sequence number 185 increased the level of STMN-FL by 173% (45% rescued). Treatment with 200 nM of STMN2 AON containing sequence number 185 increased the level of STMN-FL by 346% (90% rescued). 500 nM treatment of STMN2 AON with sequence identification number: 185 increased STMN-FL levels by 265% (69% rescued).

[0481] Referring to Fig. 12a, treatment with 500 nM TDP43 AON increased the amount of STMN2 transcripts containing latent exons by more than 41-fold. Treatment with 500 nM of STMN2 AON with sequence identification number 197 reduced the level of STMN2 transcripts containing latent exons by 51%. Referring to Fig. 12b, treatment with 500 nM TDP43 AON reduced STMN2-FL by 65%. Treatment with 20 nM of STMN2 AON with sequence identification number 197 increased the STMN-FL level by 186% (65% rescued). Treatment with 50 nM of STMN2 AON with sequence identification number 197 increased the STMN-FL level by 231% (81% rescued). Treatment of STMN2 AON with sequence identification number: 197 at 200 nM increased STMN-FL levels by 254% (89% rescued). Treatment of STMN2 AON with sequence identification number: 197 at 500 nM increased STMN-FL levels by 269% (94% rescued).

[0482] Referring to Fig. 13a, treatment with 500 nM TDP43 AON increased the amount of STMN2 transcripts containing latent exons by more than 41-fold. Treatment with 500 nM of STMN2 AON with se...

Claims

Claim 1 An oligonucleotide comprising at least 19 adjacent nucleobase sequences that are 100% complementary to the same length sub-nucleobase sequence within positions 144-276 of sequence identification number: 944, wherein at least one nucleoside link of the linked nucleoside is a non-natural link. Claim 2 In claim 1, the nucleobase sequence comprises: a) at least 19 adjacent nucleobase portions that are 100% complementary to an equal length portion of either sequence identification number: 591-699 or 919-943; b) at least 19, 20, 21, 22, 23, 24, or 25 adjacent nucleobase portions that share 100% identity with an equal length portion of any one of sequence identification numbers: 144-252, 894-918, 1088-1196, or 1392-1432; or c) Sequence identification number: at least 19, 20 sharing 100% identity with an equal length portion of any one of 144, 146, 150, 169, 170, 171, 172, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 985, 999, 1088, 1090, 1094, 1113, 1114, 1115, 1116, 1117, 1121, 1125, 1129, 1141, 1147, 1153, 1159, 1181, 1188, or 1193 An oligonucleotide comprising a portion of 21, 22, 23, 24, or 25 adjacent nucleobases. Claim 3 An oligonucleotide comprising a linked nucleoside having at least 19 adjacent nucleobase sequences, wherein the nucleobase sequence comprises a portion of at least 19 adjacent nucleosbases sharing 100% identity with respect to an equal length portion of either Sequence Identification Number: 894-918 or Sequence Identification Number: 1392-1432, or wherein the nucleobase sequence comprises a portion of at least 19, 20, 21, 22, 23, 24, or 25 adjacent nucleosbases sharing 100% identity with respect to either Sequence Identification Number: 894-918 or Sequence Identification Number: 1392-1432. Claim 4 In claim 1, a) the nucleobase sequence is complementary to the same length portion of the nucleobase within any one of positions 144-168, 146-170, 150-170, 150-172, 150-174, 169-193, 169-189, 169-191, 170-190, 170-192, 171-191, 171-193, 172-192, 172-194, 170-194, 171-195, 172-196, 173-197, 185-209, 197-221, 237-261, 249-273, or 252-276 of sequence identification number: 944, at least It includes portions of 19, 20, 21, 22, 23, 24, or 25 adjacent nucleobases; or b) where the nucleobase sequence is at position 144-164, 144-166, 145-167, 146-166, 146-168, 147-165, 148-168, 173-191, 173-193, 173-195, 173-197, 175-195, 175-197, 177-197, 179-197, 185-205, 185-207, 197-217, 197-219, 187-209, 189-209, 191-209, 237-255, 237-257, 237-259, of sequence identification number: 944 An oligonucleotide comprising at least 19, 20, 21, 22, 23, 24, or 25 adjacent nucleotide portions complementary to the equal length portion of a nucleotide within any one of 239-259, 239-261, 241-261, 237-257, 249-269, or 249-271. Claim 5 In any one of claims 1 to 4, a) the oligonucleotide is 19 to 25 nucleosides long; or b) the oligonucleotide is at least one nucleoside linkage selected from the group consisting of a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, an alkylphosphonate linkage, a 3-methoxypropylphosphonate linkage, a phosphorodithioate linkage, a phosphotriester linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidotyadate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage, or any of the above. It comprises combination(s); c) at least 2, 3, or 4 nucleoside linkages of the oligonucleotide are phosphodiester nucleoside linkages; d) the oligonucleotide comprises at least 2, 3, or 4 modified nucleoside linkages, wherein i) each modified nucleoside linkage of the oligonucleotide is independently selected from a phosphorothioate linkage, a phosphoramidate linkage, a phosphoramidothoate linkage, or a phosphorodiamidate linkage; ii) all nucleoside linkages of the oligonucleotide are phosphorothioate linkages; or iii) the phosphorothioate nucleoside linkage is present as either Rp coordination or Sp coordination; e) the oligonucleotide comprises at least one modified nucleobase; f) the oligonucleotide comprises at least one modified sugar moiety; or g) the oligonucleotide comprises one or more 2'-O-(2-methoxyethyl)(2'-MOE) nucleosides linked via phosphorothioate nucleoside linkages;or h) an oligonucleotide comprising three linked nucleosides linked by phosphothioate nucleoside linkages at the 5' end and three linked nucleosides linked by phosphothioate nucleoside linkages at the 3' end.; Claim 6 In any one of claims 1 to 4, a) the oligonucleotide represents an increase of at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, or 400% of the full-length STMN2 transcript or STMN2 protein, wherein the increase is compared to a level prior to exposure of the neuron to the oligonucleotide, or wherein the increase in full-length STMN2 protein is measured compared to a reduced level of full-length STMN2 protein achieved using TDP43 antisense oligonucleotide; or b) an oligonucleotide that represents at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% relief of the full-length STMN2 transcript or STMN2 protein, wherein the increase is compared to the level before the neuron was exposed to the oligonucleotide, or an oligonucleotide that represents at least 50%, 60%, 70%, 80%, or 90% reduction of the STMN2 transcript having a cryptic exon. Claim 7 A pharmaceutical composition comprising one or more of the oligonucleotides of any one of claims 1 to 4 or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient, for use in: a) treating a neurological disease or neuropathy in a patient requiring treatment for a neurological disease or neuropathy; b) restoring axonal growth or regeneration of motor neurons in a patient requiring treatment for a neurological disease or neuropathy; or c) increasing, promoting, stabilizing, or maintaining STMN2 expression or function in neurons of a patient requiring treatment for a neurological disease or neuropathy, wherein i) the neurological disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, and corticobasal degeneration (CBD); and ii) the neuropathy is chemotherapy-induced neuropathy. Claim 8 A pharmaceutical composition suitable for administration according to claim 7, by local, intrathecal, intravesical, parenteral, subcutaneous, intramuscular, intradermal, duodenal, intravenous, intralesional, oral, pulmonary, tracheal, nasal, transdermal, rectal, buccal, sublingual, vaginal, or duodenal administration. Claim 9 An in vitro method for restoring axonal growth or regeneration of a motor neuron or for increasing, promoting, stabilizing, or maintaining STMN2 expression or function in a neuron, wherein the method comprises exposing the neuron to a pharmaceutical composition comprising an oligonucleotide of any one of claims 1 to 4 or a pharmaceutically acceptable salt thereof, or one or more of the oligonucleotides of any one of claims 1 to 4 or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient, wherein the neuron is a neuron of a patient requiring treatment for a neurological disease or neuropathy. Claim 10 A pharmaceutical composition according to claim 7, wherein i) the patient of b) or c) is determined to have a transcript comprising the latent exon sequence of sequence identification number: 447; or ii) a therapeutically effective amount of oligonucleotide is administered into the spinal canal or into a water tank. Claim 11 In paragraph 7, i) the patient is a human; or ii) the patient for treatment has neurofilament light chains (NEFL), neurofilament heavy chains (NEFH), phosphorylated neurofilament heavy chains (pNFH), TDP-43, or p75 in the patient's plasma, cerebrospinal fluid, cerebrospinal fluid, extracellular vesicles, blood, urine, lymph, feces, or tissues ECD A pharmaceutical composition identified by measuring the presence or expression level of Claim 12 In claim 7, a pharmaceutical composition for use in combination with one or more second therapeutic agents selected from riluzole (Rilutek), edaravone (Radicava), rivastigmine, donepezil, galantamine, selective serotonin reuptake inhibitors, antipsychotics, cholinesterase inhibitors, memantine, benzodiazepine anxiolytics, AMX0035 (Elibrio), zilucoplan (RA101495), dual AON intrathecal administration, BIIB100, levodopa / carbidopa, dopaminergic agonists, medroxyprogesterone, KCNQ2 / KCNQ3 open agents, anticonvulsants, and psychostimulant agonists for treating the above-mentioned neurological disease, or with a therapy selected from respiratory management, physiotherapy, occupational therapy, speech therapy, and nutritional support, wherein the patient for treatment possesses the patient's plasma, cerebrospinal fluid, cerebrospinal fluid, extracellular vesicles, blood, urine, lymph fluid, Neurofilament light chain (NEFL), neurofilament heavy chain (NEFH), phosphorylated neurofilament heavy chain (pNFH), TDP-43, or p75 in feces or tissues ECD A pharmaceutical composition identified by measuring the presence or expression level of Claim 13 Sequence identification numbers: 144-252, 894-918, 1088-1196, or 1392-1432. An oligonucleotide comprising a linked nucleoside having any one of these nucleobase sequences, or 1392-1432, or a salt thereof that is pharmaceutically acceptable, wherein the oligonucleotide is a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a phosphorodithioate linkage, a phosphotriester linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothydate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, An oligonucleotide comprising at least one nucleoside linkage selected from the group consisting of a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage; or wherein at least one of the linked nucleosides is substituted with a component selected from the group consisting of 2'-O-(2-methoxyethyl) nucleoside (2'-O-methoxyethylribonucleoside (2'-MOE)), 2'-O-methyl nucleoside, 2'-deoxy-2'-fluoronucleoside, 2'-fluoro-β-D-arabinonucleoside, locking nucleic acid (LNA), binding methoxyethyl (cMOE), binding ethyl (cET), and peptide nucleic acid (PNA). Claim 14 In claim 13, a) i) at least one nucleoside linkage of the oligonucleotide is a phosphothioate linkage; ii) the oligonucleotide comprises three linked nucleosides linked via a phosphodiester nucleoside linkage at the 5' end and three linked nucleosides linked via a phosphodiester nucleoside linkage at the 3' end; or iii) the oligonucleotide comprises one or more 2'-O-(2-methoxyethyl) nucleosides linked via a phosphothioate nucleoside linkage; or b) i) at least one nucleoside linkage of the oligonucleotide is a phosphothioate linkage; or ii) the oligonucleotide comprises five linked nucleosides linked via a phosphodiester nucleoside linkage; or c) an oligonucleotide in which all nucleoside links of the oligonucleotide are phosphothioate linkages. Claim 15 a) treating a neurological disease or neuropathy in a patient requiring treatment for a neurological disease or neuropathy; b) restoring axonal growth or regeneration of motor neurons in a patient requiring treatment for a neurological disease or neuropathy; or c) a pharmaceutical composition comprising the oligonucleotide of claim 13 or 14 or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient, for use in increasing, promoting, stabilizing, or maintaining STMN2 expression or function in neurons of a patient requiring treatment for a neurological disease or neuropathy, wherein i) the neurological disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, and corticobasal degeneration (CBD); and ii) the neuropathy is chemotherapy-induced neuropathy. Claim 16 A pharmaceutical composition comprising an oligonucleotide of any one of claims 1 to 4 or a pharmaceutically acceptable salt thereof, capable of increasing, restoring, or stabilizing the expression of STMN2 mRNA or the function of STMN2 protein that enables the translation of functional STMN2 in cells of a human patient suffering from a neurological disease or neuropathy, wherein the level of increase, restoration, or stabilization of expression or function is sufficient for use in the treatment of a neurological disease or neuropathy, wherein i) the neurological disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, and corticobasal degeneration (CBD); and ii) the neuropathy is a pharmaceutical composition in which chemotherapy-induced neuropathy. Claim 17 An oligonucleotide according to any one of claims 1 to 4, comprising one or more chiral centers, double bonds, or one or more chiral centers and double bonds, existing as a stereoisomer selected from geometric isomers, enantiomers, and diastereomers. Claim 18 delete Claim 19 delete Claim 20 delete Claim 21 delete Claim 22 delete Claim 23 delete Claim 24 delete Claim 25 delete Claim 26 delete Claim 27 delete Claim 28 delete Claim 29 delete Claim 30 delete Claim 31 delete Claim 32 delete Claim 33 delete Claim 34 delete Claim 35 delete Claim 36 delete Claim 37 delete Claim 38 delete Claim 39 delete Claim 40 delete Claim 41 delete Claim 42 delete Claim 43 delete Claim 44 delete Claim 45 delete Claim 46 delete Claim 47 delete Claim 48 delete Claim 49 delete Claim 50 delete Claim 51 delete Claim 52 delete Claim 53 delete Claim 54 delete Claim 55 delete Claim 56 delete Claim 57 delete Claim 58 delete Claim 59 delete Claim 60 delete Claim 61 delete Claim 62 delete Claim 63 delete Claim 64 delete Claim 65 delete Claim 66 delete Claim 67 delete Claim 68 delete Claim 69 delete Claim 70 delete Claim 71 delete Claim 72 delete Claim 73 delete Claim 74 delete Claim 75 delete Claim 76 delete Claim 77 delete Claim 78 delete Claim 79 delete Claim 80 delete Claim 81 delete Claim 82 delete Claim 83 delete Claim 84 delete Claim 85 delete Claim 86 delete Claim 87 delete Claim 88 delete Claim 89 delete Claim 90 delete Claim 91 delete

Images