Fusion protein comprising HEI10 and fluorescent protein for increasing chromosomal crossover recombination in meiosis of plant and uses thereof

Abstract

The present invention relates to a fusion protein of HEI10-fluorescent protein that increases chromosomal crossover recombination during meiosis in plants and its use. More specifically, the invention relates to a method for increasing the number of homologous chromosome crossover recombinations during meiosis in plant cells by overexpressing HEI10-mRFP1 or HEI10-sfGFP, which are fusion proteins of HEI10-fluorescent protein. Since the HEI10-fluorescent protein according to the present invention has the effect of increasing the crossover frequency in the whole genome by more than 4 times, exceeding 2 times the conventional HEI10 overexpression, and increasing crossover by 2.7 times in pericentromeric regions that are heterochromatic and polymorphic, using the method of the present invention will maximize the acceleration of crop breeding and the acceleration of quantitative trait mapping.

Description

Technology Field

[0001] The present invention relates to a fusion protein of HEI10-fluorescent protein that increases chromosomal crossover recombination in meiosis in plants and the use thereof. Background Technology

[0002] During meiotic prophase I, programmed DNA double-strand breaks are formed and repaired using homologous chromosomes as a template to form crossovers or non-crossovers. Although meiotic DNA double-strand breaks are formed in excess, only a very small fraction stabilize into recombination intermediates and eventually mature into crossovers; these crossovers are essential for the precise separation of homologous chromosomes and the recombination of genetic variations. In plants, the number of crossovers is strictly limited, usually remaining at one to three per chromosome pair. They are non-uniformly distributed along the chromosomes, increasing in euchromatin where gene density is high and being strongly suppressed in pericentromeric heterochromatin. These constraints limit the generation and redistribution of genetic variations; consequently, strategies to increase and rearrange the number of crossovers hold significant implications for both basic genetics and crop improvement.

[0003] Meiotic crossing over occurs through two conserved pathways (class I and class II). In Arabidopsis thaliana, class I (interfering) crossing over accounts for approximately 85–90% of all events and requires ZMM pro-crossover proteins such as ZIP4, SHOC1, PTD, HEI10, MSH4-MSH5, and MER3, as well as MutLγ complexes. Class I crossing over is influenced by crossover interference and exhibits wider spacing along the chromosomes compared to random distribution. Notably, class I crossing over can tolerate high levels of interhomologous sequence polymorphism, allowing it to form efficiently even in highly polymorphic regions. However, extensive structural variation or extremely high polymorphism density inhibits the formation of such crossovers. Conversely, class II (non-interfering) crossing over accounts for approximately 10–15% of total events; it is highly sensitive to interhomologous polymorphisms and is restricted by various anti-crossover elements, including the helicases RECQ4A and RECQ4B. Disrupting these anti-crossover pathways increases the number of non-interfering crossing overs in both inbred and hybrid backgrounds, although this increase is significantly reduced in hybrids with high levels of polymorphism. Furthermore, increased crossing over tends to occur preferentially in regions with relatively low sequence divergence. This suggests that sequence divergence strongly restricts the formation of class II crossing over.

[0004] The patterning of class I crossing over in Arabidopsis is closely associated with the synaptonemal complex (SC), which provides a structural framework for homologous chromosome alignment and recombination regulation. Several studies have identified HEI10, a dosage-sensitive ubiquitin E3 ligase, as a key regulator of the number and location of class I crossing over. It has been suggested that HEI10 dynamically accumulates along the SC at recombination intermediate sites and operates via diffusion-mediated coarsening, a self-organizing process that selectively targets a small number of crossing over sites.

[0005] Genetic loss of the transverse or central elements of the SC disrupts homologous synapses and crossover interference, which inhibits the coarsening of HEI10 along the SC and consequently leads to an approximately twofold increase in both the number of HEI10 foci and the number of crossovers. HEI10 abundance is strictly regulated at various stages, including transcription, phosphorylation, and proteolysis. Increasing HEI10 dose through the endogenous HEI10 transgene increases crossovers by up to twofold, and recq4a recq4b ( recq4ab ) or SC horizontal axis element zyp1ab This increase is more pronounced in the variant background. Similarly, the dominant-negative cochaperone allele (J3 G155R ) increases the abundance of HEI10 and approximately doubles the crossover frequency at the whole-genome level. However, it is not yet clear whether this doubling reflects an implicit upper limit of HEI10-mediated crossover regulation or if it can exceed that upper limit.

[0006] Meanwhile, Korean registered patent No. 2887451 discloses 'a J3 chaperone that increases chromosomal crossover recombination in meiosis in plants and its use,' and Korean registered patent No. 2410996 discloses 'a Protein phosphatase 4 complex that increases chromosomal crossover recombination in meiosis in plant cells and its use,' but there is no description of the 'fusion protein of HEI10-fluorescent protein that increases chromosomal crossover recombination in meiosis in plants and its use' of the present invention. The problem to be solved

[0007] The present invention was derived from the above-mentioned needs, and the inventors, in order to explore HEI10-mediated crossover recombination, used Arabidopsis thaliana lines expressing HEI10 tagged with mRFP1 (monomeric red fluorescent protein 1) at the carboxy-terminus ( HEI10-mRFP1We constructed a ) and performed genome-wide crossover mapping. Contrary to expectations, HEI10-mRFP1 increased the crossover frequency by more than four times across the entire genome and increased crossover by 2.7 times in heterochromatin and polymorphic pericentromeric regions. High-resolution crossover mapping and immunocytological analysis demonstrated that mRFP1 tagging stabilizes HEI10 and significantly weakens crossover interference intensity, enabling crossovers located close to each other; this was consistent with changes in the formation of HEI10 foci patterns. Through these results, we completed the present invention by confirming that HEI10-mRFP1 is an effective means to overcome recombination barriers in highly polymorphic and interspecific hybrids and enables the utilization of genetic variations that were obscured by tight linkage or isolated in pericentromeric regions. means of solving the problem

[0008] To solve the above problem, the present invention provides a method for increasing the number of crossover recombinations of homologous chromosomes during meiosis of plant cells, comprising the step of transforming plant cells with a recombinant vector containing a nucleic acid sequence encoding a fusion protein of HEI10 protein and a fluorescent protein, and overexpressing the nucleic acid sequence encoding the fusion protein of HEI10 protein and a fluorescent protein.

[0009] In addition, the present invention provides a method for producing a transgenic plant having an increased number of cross-recombinations of homologous chromosomes compared to the wild type, comprising the steps of: transforming a plant cell with a recombinant vector containing a nucleic acid sequence encoding a fusion protein of HEI10 protein and a fluorescent protein to overexpress the nucleic acid sequence encoding the fusion protein of HEI10 protein and a fluorescent protein; and redifferentiating a transgenic plant from a plant cell in which the nucleic acid sequence encoding the fusion protein of HEI10 protein and a fluorescent protein is overexpressed.

[0010] In addition, the present invention provides a transgenic plant having an increased number of cross-recombinations of homologous chromosomes compared to the wild type produced by the above method, and a transgenic seed thereof.

[0011] In addition, the present invention provides a composition for increasing the number of cross-recombinations of homologous chromosomes during meiosis of plant cells, comprising as an active ingredient a nucleic acid sequence encoding a fusion protein of HEI10 protein and a fluorescent protein. Effects of the invention

[0012] HEI10-mRFP1 according to the present invention has the effect of increasing the crossover frequency by more than 4 times in the whole genome and by 2.7 times in pericentromeric regions that are heterochromatic and polymorphic. Since an increase in the number of crossovers can shorten the duration of crossbreeding and accelerate the construction of quantitative trait loci, the method of the present invention can be usefully utilized in the agricultural field. Brief explanation of the drawing

[0013] Figure 1 shows that HEI10-mRFP1 increased the crossover frequency in fluorescent tagged lines (FTLs) of chromosomal arms and pericentromeric regions. a shows seed (triangular) and pollen (circular) FTLs distributed throughout the Arabidopsis thaliana genome, where lines indicate the locations of intervals. b shows wild-type Col, HEI10 , HEI10-Myc and HEI10-mRFP1 In T1 transgenic plants 420 It shows the crossing frequency of the interval. c is identical to b, but at different levels. 420 It shows the proportion of T1 plants indicating the crossover frequency. d is 420 Crossover (in cM units) and endogenous HEI10 and HEI10-mRFP1 This represents the correlation between transcription levels; the red line indicates linear regression, and the points represent independent HEI10-mRFP1 It represents a transformant, and the green dots are the three used in GBS (genotyping-by-sequencing). HEI10-mRFP1 Represents the transgenic lines (#1, #2, #3). The wild-type Col (blue dot) was used as an internal control. e represents Col and two HEI10-mRFP1 Shows the crossing frequencies of pollen FTLs in transgenic lines (#1, #2), where f is Col and HEI10-mRFP1 This shows the crossing frequencies of genomic seed FTLs (Col Traffic Lines, CTLs) in the transgenic line (#1). Data are expressed as mean ± standard deviation (mean ± sd) (n = number of plants), and asterisks indicate significant differences (*** P <0.001; two-sided Welch's t-test). g is Col, h2a.wand three independent HEI10-mRFP1 This shows the crossover frequencies of the CTL 3.9 interval in the transgenic lines (#2, #3, #4). Data in b, e, and g are expressed as mean ± standard deviation (n = number of plants), and statistical significance was determined using Tukey's HSD. P It was evaluated using ANOVA including < 0.05. Figure 2 confirms that HEI10-mRFP1 increased crossing over in both chromosomal arms and the pericerocentric region. a is Col × L for GBS. er This is a diagram showing the process of F2 population generation, where b is the wild type (WT), h2a.w , HEI10 , J3 G155R , recq4ab and HEI10-mRFP1 Col × L er This shows the distribution of the number of crossing over per F2 individual in the hybrid, where the red dotted line represents the mean value (n = number of F2 plants). c is identical to b but represents the number of crossing over per chromosome, and d is WT, h2a.w , HEI10 , J3 G155R , recq4ab and HEI10-mRFP1This shows the crossing-over frequency (cM / Mb) (top) and difference plot (genotype - WT = Δ cM / Mb) (bottom) along the five Arabidopsis chromosomes. The top blocks of the graph represent centromeres (black), indels (cyan), translocations (blue), and inversions (pink), while solid lines indicate telomeres. The pericentromere region is indicated by blue shading. e is identical to d but shows the crossing-over frequency (cM / Mb) (top) and difference plot (Δ cM / Mb) (bottom) along the chromosome telomere-centromere axis, with dotted lines marking the boundaries between the chromosome arms and the pericentromere region. f shows the number of crossing-overs occurring along the chromosome arms (left) and the pericentromere region (right) for each F2 individual; dots represent individual plants, and the red line represents the mean value (n = number of F2 individuals). Significant differences in b, c, and f were determined using one-way ANOVA and Tukey's HSD test ( P < 0.05). Figure 3 confirms that HEI10-mRFP1 increases recombination in the repressed periceromeric region. a is a schematic diagram of Arabidopsis chromosome 1 showing chromosome arms, the periceromeric high-recombination zone (HRZ), low-recombination zone (LRZ), non-recombination zone (NRZ), and centromere, along with a table summarizing the definitions of these regions for all five chromosomes. b is the wild type (WT; n = 1,862), h2a.w (n = 286), HEI10 (n = 192), J3 G155R (n = 288), recq4ab (n = 96), and HEI10-mRFP1 (n = 287) Col × L erAs a result of analyzing the crossover frequencies (cM / Mb) within HRZ, LRZ, and NRZ in the F2 group, significant differences were determined using one-way ANOVA and Tukey's HSD test ( P c is identical to b but shows the crossing-over frequencies (cM / Mb) in the HRZ, LRZ, NRZ, and centromere regions across the five Arabidopsis chromosomes. The top blocks of the graph indicate centromeres (black), indels (cyan), translocations (blue), and inversions (pink); the vertical dashed line represents the HRZ-LRZ boundary, and the centromere region is shown in gray shading. d is identical to c but highlights the LRZ, NRZ, and centromere regions, with the vertical dashed line indicating the LRZ-NRZ boundary. Figure 4 relates to the construction of a high-resolution cross-map of HEI10-mRFP1 using long-read sequencing, where a is Col × L er This is a schematic diagram showing the process of constructing a crossover map using field reading sequencing of the F2 population. b is WT, recq4ab and HEI10-mRFP1 (#2) Col × L er This is an analysis of the number of crossovers per gigabase (Gb) of nanopore sequencing data performed on the genomic DNA of F2 seedlings, where the dots represent the number of crossovers obtained from each Gb subsample (10 resamplings) for the Total, Chromosome Arm, and Pericentromere regions. Statistical significance was determined using one-way ANOVA and Tukey's HSD test ( P < 0.05). c is identical to b but shows the results for each chromosome, and d is identical to b but highlights HRZ and LRZ. e is WT, recq4ab and HEI10-mRFP1This shows the crossover frequency (crossovers / Gb) (top) and difference plot (Δ crossovers / Gb) (bottom) along the five Arabidopsis chromosomes. The top blocks of the graph represent centromeres (black), indels (cyan), translocations (blue), and inversions (pink); the solid lines represent telomeres, and the centromere region is indicated by blue shading. f is identical to e but represents the crossover frequency along the chromosomal axis from telomeres (TEL) to centromeres (CEN), with the dotted lines indicating the boundaries of the chromosomal arm-centromere region. g is WT, recq4ab and HEI10-mRFP1 This is a metaplot of SNP densities around crossovers mapped using GBS and COmapper, representing the results compared with random genomic locations, where n represents the number of crossovers. h is equivalent to g but indicates the statistical significance of the difference in SNP density according to distance from the crossover location, and each point represents the SNP density per 40 bp interval (bin). Significance relative to random locations was evaluated using the Wilcoxon rank-sum test. Purple and blue points indicate higher and lower SNP densities compared to random locations, respectively, while gray points indicate insignificant differences. Figure 5 shows the results confirming that HEI10-mRFP1 can almost completely eliminate crossover interference. a is Col and HEI10-mRFP1 FTL of pollen tetrad analysis performed in I1bc , I3bc and I5ab This shows the cross-interference ratio for , where data are expressed as mean ± standard deviation and n represents the number of plant individuals. An asterisk indicates a significant difference (*** P < 0.001; two-sided Welch t-test). b is wild type (WT), recq4ab and HEI10-mRFP1This represents the crossing-over frequency (cM / Mb) along chromosome 1 during male meiosis, where n is Col × L er ul L er backcross-to-L er It refers to the number of F1 individuals. c is the WT in male meiosis, recq4ab and HEI10-mRFP1 This shows the analysis of the distribution of inter-crossover distances (Mb) of chromosomes; the blue line represents the expected random distribution, the red line represents the actual observed distribution, and the vertical dotted line indicates the mean distance. Significance was evaluated using the Wilcoxon test. d is identical to c but is based on results from F2 chromosomes. e is a graph showing the coincidence coefficient (CoC) calculated based on inter-interval distances from 1 Mb to 13 Mb for each chromosome, and significance was evaluated using the one-sample t-test. Figure 6 confirms that HEI10-mRFP1 changes the spacing and number of HEI10 foci located along the synaptonemal complex (SC). a is Col and HEI10-mRFP1 Representative 3D-SIM images of late pachytene nuclei immunostained for HEI10 and ZYP1, with nuclear DNA stained with DAPI (scale bar = 5 µm). b shows the comparison results between late pachytene cytological data and coarsening model simulations, with Col and HEI10-mRFP1 This represents the number of HEI10 foci per bivalent chromosome and the distribution of spacing between adjacent HEI10 foci. c is Col and HEI10-mRFP1This is a representative image of diplotene nuclei immunostained for HEI10, ASY1, and ZYP1 (scale bar = 5 μm), and d is the result of quantitative analysis of HEI10 foci immunostained in diplotene nuclei. Each dot represents a single nucleus, the horizontal line indicates the mean ± standard deviation, and statistical significance was evaluated using the Wilcoxon rank-sum test (Col, n = 14; HEI10-mRFP1 #2, n = 19; P = 1.35 × 10 -6 ; n is the number of nuclei captured. e is at the Taesagi stage HEI10-mRFP1 Representative image of HEI10-mRFP1 from lineage (#5); chromatin was counterstained with DAPI, and the HEI10-mRFP1 signal is indicated in red. The merged image is presented in the panel below (scale bar = 2 µm). f is 420 Showing low (#5, 30.4 cM) and high (#2, 44.1 cM) crossover frequencies in the reporter HEI10-mRFP1 This is a representative image of a radiator nucleus showing HEI10-mRFP1 foci of the lineage. The HEI10-mRFP1 signal (red) was merged with DAPI (blue) (scale bar = 2 μm). g is equivalent to f and represents the quantitative result of the number of HEI10-mRFP1 foci; each dot represents a single nucleus, and the horizontal line indicates the mean ± standard deviation. Statistical significance was evaluated using the Wilcoxon rank-sum test (#5, n = 17; #2, n = 21; P = 6.87 × 10 -14 ; n is the number of nuclei). Figure 7 analyzes the effect of HEI10-mRFP1 on fertility, where a is Col and HEI10-mRFP1Shows representative silique images of the lines (scale bar = 10 mm). b is the result of quantitative analysis of the number of seeds per pod, where each point represents the average of 5 pods collected from a single plant (n = 15 plants per genotype). c is Col and HEI10-mRFP1 This is an image showing Alexander-stained pollen from anther (scale bar = 200 μm). d shows the results of analyzing the viable pollen proportion for each genotype presented in c (n = 5 plants per genotype). e shows DAPI-stained male meiotic chromosome samples, illustrating normal and abnormal structures during metaphase I and anaphase I. Red arrows indicate abnormal chromosomal behaviors, including chromosome bridges, fragments, and lagging chromosomes (scale bar = 5 μm). f shows the analysis of the frequency of abnormal chromosomal behaviors, with the total number of cells (n) indicated above the bars. In b and d, the red lines represent the mean ± standard deviation (sd), and statistical significance was evaluated using Tukey's HSD test following one-way ANOVA. P < 0.05). Figure 8 confirms that HEI10-sfGFP, fused with sfGFP—a fluorescent protein similar to mRFP1—increased crossing over in both chromosomal arms and pericerocentric regions to the same level as HEI10-mRFP1. a is the wild type (WT), HEI10-Myc, HEI10-mRFP1 and HEI10-sfGFP Col × L er This shows the distribution of the number of crossing over per F2 individual in the hybrid, where the red dotted line represents the mean value (n = number of F2 plants). b is identical to a but represents the number of crossing over per chromosome, and c is WT, HEI10-Myc, HEI10-mRFP1 and HEI10-sfGFP These are the crossing-over frequency (cM / Mb) (top) and difference plot (ΔcM / Mb) (bottom) along the five Arabidopsis chromosomes. The top blocks of the graph represent centromeres (black), indels (cyan), translocations (blue), and inversions (pink), while the solid lines indicate telomeres. The pericentromere region is indicated by blue shading. d is identical to c but shows the crossing-over frequency (cM / Mb) (top) and difference plot (ΔcM / Mb) (bottom) along the chromosome telomere-centromere axis, with the dotted lines marking the boundaries between the chromosome arms and the pericentromere region. e shows the number of crossing-overs occurring along the chromosome arms (left) and the pericentromere region (right) for each F2 individual; the dots represent individual plants, and the red line represents the average value. f is WT, HEI10-Myc, HEI10-mRFP1 and HEI10-sfGFP This is the result of analyzing the crossover frequencies (cM / Mb) within HRZ and LRZ. Significant differences in a, b, e, and f were determined using one-way ANOVA and Tukey's HSD test. P < 0.05). FIG. 9 is a schematic diagram of a DNA construct introduced into a plant to overexpress HEI10-mRPF1, and the DNA construct used for HEI10-sfGFP overexpression is identical except for the fluorescent protein portion (mRFP1). The mRFP1 and sfGFP proteins used in the present invention consist of the amino acid sequences of SEQ ID NOs 33 and 34, respectively, and the HEI10-mRPF1 DNA construct and the HEI10-sfGFP DNA construct consist of the nucleotide sequences of SEQ ID NOs 35 and 36, respectively. Specific details for implementing the invention

[0014] To achieve the objective of the present invention, the present invention provides a method for increasing the number of crossover recombinations of homologous chromosomes during meiosis of a plant cell, comprising the step of transforming a plant cell with a recombinant vector comprising a nucleic acid sequence encoding a fusion protein of HEI10 protein and a fluorescent protein, and overexpressing the nucleic acid sequence encoding the fusion protein of HEI10 protein and a fluorescent protein.

[0015] Homologous chromosomes refer to chromosomes that are nearly identical in size and shape, inherited one from each of the paired parents within a cell during the process of meiosis. During the prophase I of meiosis, crossing over occurs in which parts of these homologous chromosomes are exchanged (recombined), and this crossing of homologous chromosomes contributes to the formation of genetic diversity.

[0016] In a method for increasing the number of cross-recombinations of homologous chromosomes during meiosis of a plant cell according to the present invention, the HEI10 protein may be composed of the amino acid sequence of SEQ ID NO. 2, but is not limited thereto.

[0017] The range of the HEI10 protein includes a protein having the amino acid sequence indicated by SEQ ID NO. 2 and a functional equivalent of said protein. "Functional equivalent" refers to a protein that exhibits substantially the same physiological activity as the protein indicated by SEQ ID NO. 2, having sequence homology of at least 70%, preferably 80%, more preferably 90%, and even more preferably 95% or more with the amino acid sequence indicated by SEQ ID NO. 2 as a result of the addition, substitution, or deletion of amino acids.

[0018] Furthermore, the present invention provides a gene encoding the HEI10 protein. The gene encoding the HEI10 protein of the present invention may include a nucleotide sequence represented by SEQ ID NO. 1. Additionally, homologs of the nucleotide sequence are included within the scope of the present invention. Specifically, the gene may include nucleotide sequences having sequence homology of at least 70%, more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95% with respect to the nucleotide sequence of SEQ ID NO. 1. The "% of sequence homology" for a polynucleotide is determined by comparing two optimally arranged sequences with a comparison region, and a portion of the polynucleotide sequence in the comparison region may include additions or deletions (i.e., gaps) compared to a reference sequence (without additions or deletions) for the optimal arrangement of the two sequences.

[0019] In addition, in the method for increasing the number of cross-recombinations of homologous chromosomes during meiosis of plant cells according to the present invention, the fluorescent protein may be fused to the carboxyl terminus of the HEI10 protein, but is not limited thereto.

[0020] In a method for increasing the number of cross-recombinations of homologous chromosomes during meiosis of plant cells according to the present invention, the fluorescent protein used to produce a fusion protein comprises: (i) a Ser-Tyr-Gly, Gln-Tyr-Gly, or Met-Tyr-Gly motif sequence that contributes to chromophore formation, wherein the motif sequence may include a conservative variant capable of fluorescence expression and chromophore formation; (ii) a plurality of beta-strands forming a GFP (Green Fluorescent Protein)-like beta-barrel structure; and (iii) a GFP-family fluorescent protein or a DsRed (Discosoma Red Fluorescent Protein)-family fluorescent protein, preferably selected from the group consisting of GFP, EGFP, sfGFP, YFP, CFP, DsRed, mRFP1, mCherry, mKate, and functional variants that substantially retain the fluorescent properties thereof. It may be one, and more preferably sfGFP or mRFP1, but is not limited thereto.

[0021] The term "functional variant" above refers to a fluorescent protein that substantially maintains the fluorescence expression ability, chromophore formation ability, and beta-barrel structure of the original fluorescent protein even if one or more amino acid substitutions, deletions, insertions, or additions are present. Additionally, protein information on the GFP, EGFP, sfGFP, YFP, CFP, DsRed, mRFP1, mCherry, mKate, and their functional variants can be obtained from known databases in the art, including GenBank of the NCBI (National Center for Biotechnology Information).

[0022] In the present invention, the term "recombinant" refers to a cell that replicates a heterogeneous nucleic acid, expresses said nucleic acid, or expresses a protein encoded by a peptide, a heterogeneous peptide, or a heterogeneous nucleic acid. A recombinant cell may express a gene or gene fragment not found in the natural form of said cell in either a sense or antisense form. Additionally, a recombinant cell may express a gene found in a cell in its natural state, provided that said gene is modified and reintroduced into the cell by artificial means.

[0023] Additionally, in the present invention, the term "vector" is used to refer to DNA fragment(s) or nucleic acid molecules delivered into a cell. A vector replicates DNA and can be independently reproduced in a host cell. The term "carrier" is commonly used interchangeably with "vector." The term "expression vector" refers to a recombinant DNA molecule comprising a target coding sequence and an appropriate nucleic acid sequence essential for expressing the coding sequence in a specific host organism.

[0024] The vector of the present invention can typically be constructed as a vector for cloning or expression. Additionally, the vector of the present invention can be constructed using a prokaryotic or eukaryotic cell as a host. For example, when the vector of the present invention is an expression vector and uses a prokaryotic cell as a host, it generally comprises a potent promoter capable of proceeding transcription (e.g., pLλ promoter, trp promoter, lac promoter, T7 promoter, tac promoter, etc.), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. As a host cell, Escherichia coli ( Escherichia coli When ) is used, E. coli The promoter and operator sites of the tryptophan biosynthetic pathway, and the left-handed promoter of phage λ (pLλ promoter) can be used as regulatory sites.

[0025] In addition, when the vector of the present invention is an expression vector and uses a eukaryotic cell as a host, a promoter derived from the genome of a mammalian cell (e.g., a metallothionein promoter) or a promoter derived from a mammalian virus (e.g., an adenovirus late promoter, a vaccinia virus 7.5K promoter, an SV40 promoter, a cytomegalovirus promoter, and a tk promoter of HSV) may be used, and generally has a polyadenylation sequence as a transcription termination sequence.

[0026] The recombinant vector of the present invention is preferably a plant expression vector.

[0027] In the plant expression vector according to the present invention, the promoter may be a CaMV 35S, actin, ubiquitin, pEMU, MAS, or histone promoter, but is not limited thereto. The term "promoter" refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in a plant cell. A "constitutive promoter" is a promoter that is active under most environmental conditions, developmental states, or cell differentiation. Since the selection of transformants can be made by various tissues at various stages, a constitutive promoter may be preferred in the present invention. Therefore, a constitutive promoter does not limit the selectivity.

[0028] In the plant expression vector according to the present invention, a conventional terminator may be used, examples of which include nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, phaseolin terminator, and the terminator of the octopine synthase gene of Agrobacterium tumefaciens, but are not limited thereto.

[0029] The expression vector preferably comprises one or more selector markers. The marker is a nucleic acid sequence having characteristics that can typically be selected by chemical means, and includes any gene capable of distinguishing transformed cells from non-transformed cells. Examples include, but are not limited to, herbicide resistance genes such as glyphosate or phosphinotricin, and antibiotic resistance genes such as kanamycin, G418, bleomycin, hygromycin, and chloramphenicol.

[0030] Transformation of a plant refers to any method of transferring DNA into a plant. Such transformation methods do not necessarily require a period of regeneration and / or tissue culture. Transformation of plant species is now common for plant species including both dicotyledonous and monocotyledonous plants. In principle, any transformation method can be used to introduce hybrid DNA according to the present invention into a suitable progenitor cell. The methods include the calcium / polyethylene glycol method on protoplasts (Krens, FA et al, 1982, Nature 296, 72-74; Negrutiu I et al, 1987, Plant Mol Biol 8, 363-373), electroporation of protoplasts (Shillito RD et al, 1985, Bio / Technol 3, 1099-1102), microinjection into plant elements (Crossway A et al, 1986, Mol Gen Genet 202, 179-185), particle impaction of various plant elements (DNA or RNA-coated) (Klein TM et al, 1987, Nature 327, 70), and infection by (incomplete) viruses in Agrobacterium tumefaciens-mediated gene transfer via plant infiltration or transformation of mature pollen or microspores (EP 0 301 It may be suitably selected from (No. 316), etc. A preferred method according to the present invention comprises Agrobacterium-mediated DNA delivery. Particularly preferred is to use so-called binary vector technology as described in EP A 120 516 and U.S. Patent No. 4,940,838.

[0031] A method for increasing the number of crossover recombinations of homologous chromosomes according to one embodiment of the present invention is characterized by an increase in the number of crossover recombinations compared to the wild type in both euchromatin regions and heterochromatin regions. In particular, the increase in the number of crossover recombinations in heterochromatin and polymorphic pericentromeric regions is a first discovery that has not been previously reported.

[0032] The present invention also provides a method for producing a transgenic plant having an increased number of cross-recombinations of homologous chromosomes compared to the wild type, comprising the steps of: transforming a plant cell with a recombinant vector containing a nucleic acid sequence encoding a fusion protein of HEI10 protein and a fluorescent protein to overexpress the nucleic acid sequence encoding the fusion protein of HEI10 protein and a fluorescent protein; and redifferentiating a transgenic plant from the plant cell in which the nucleic acid sequence encoding the fusion protein of HEI10 protein and a fluorescent protein is overexpressed.

[0033] In the method for producing a transgenic plant according to the present invention, the range of HEI10 protein, the fluorescent protein, and the method of transgenerating the plant are as described above.

[0034] The method for producing a transgenic plant of the present invention includes the step of redifferentiating a transgenic plant from the transgenic plant cell. Any method known in the art may be used for the method of redifferentiating a transgenic plant from the transgenic plant cell.

[0035] The present invention also provides a transgenic plant having an increased number of cross-recombinations of homologous chromosomes compared to the wild type produced by the above method, and a transgenic seed thereof.

[0036] The transgenic plant according to the present invention is characterized by an increased number of cross-recombinations compared to the wild type in both the euchromatin and heterochromatin regions.

[0037] In one embodiment of the present invention, the plant body may be a dicotyledonous plant such as Arabidopsis thaliana, potato, eggplant, tobacco, chili pepper, tomato, burdock, crown daisy, lettuce, balloon flower, spinach, chard, sweet potato, carrot, water parsley, napa cabbage, cabbage, mustard greens, watermelon, Korean melon, cucumber, pumpkin, gourd, strawberry, soybean, mung bean, kidney bean, pea, etc., or a monocotyledonous plant such as rice, barley, wheat, rye, corn, sugarcane, oat, onion, etc., preferably a dicotyledonous plant, and more preferably Arabidopsis thaliana, but is not limited thereto.

[0038] The present invention also provides a composition for increasing the number of cross-recombinations of homologous chromosomes during meiosis of plant cells, comprising as an active ingredient a nucleic acid sequence encoding a fusion protein of HEI10 protein and a fluorescent protein.

[0039] In addition to the active ingredient, the composition for increasing the number of cross-recombinations of homologous chromosomes during meiosis of plant cells according to the present invention may further include, but is not limited to, one or more proteins selected from the group consisting of PP4 (Protein phosphatase 4) complex, J3 chaperone, FANCM (Fanconi anemia group M protein), RECQ4A (ATP-dependent DNA helicase Q-like 4A), RECQ4B, FIGL1 (AAA-ATPase FIDGETIN-LIKE 1), HCR1 (HIGH CROSSOVER RATE 1 / PROTEIN PHOSPHATASE X1) and HCR2 (HIGH CROSSOVER RATE 2 / HEAT SHOCK FACTOR BINDING PROTEIN).

[0041] The present invention will be explained in detail below through examples. However, the following examples are merely illustrative of the present invention, and the scope of the present invention is not limited to the following examples.

[0043] 재료 및 방법

[0044] 1. 식물 생장 및 재료

[0045] Arabidopsis thaliana Arabidopsis thaliana The Columbia-0(Col) line of ) was used as the wild type. Plants were grown in a growth chamber controlled under conditions of 20°C, 50–60% relative humidity, and a 16-hour photoperiod / 8-hour dark period. For seed scoring and pollen tetrad analysis qrt Fluorescent tagged lines (FTLs) in the background were used according to previously reported methods. Col × L for genotyping-by-sequencing er Landsberg for hybrid background creation erecta -0(L er The ) system was used. Col and L er lineage recq4ab and h2a.w mutants and HEI10 and J3 G155R Transgenic plants were used as previously reported (Fernandes JB et al., Proc Natl Acad Sci US A. 2018, 115(10):2431-2436; Ziolkowski PA et al., Genes Dev. 2017, 31(3):306-317; Kim H et al., Nat Plants. 2024, 10(3):453-468; Son N et al., Proc Natl Acad Sci US A. 2025, 122(14):e2413698122).

[0047] 2. HEI10-Myc 및 HEI10-mRFP1 식물체의 제조

[0048] 420 In the reporter background HEI10-Myc and HEI10-mRFP1 In order to produce transgenic lines, HEI10 A genomic region containing the promoter and 5'-UTR was treated with L0-HEI10 promoter F and R primers on Arabidopsis ( A. thaliana PCR amplification was performed using Columbia-0 accession genomic DNA as a template. The PCR product was cloned into pAGM9121 (Addgene), a universal Level 0 (Lv0) vector for Golden Gate cloning. HEI10 The genomic region of the coding sequence was amplified by overlapping PCR using L0-HEI10 gDNA-F, HEI10 gDNA OLF, HEI10 gDNA OLR, and L0-HEI10 gDNA-NSR primers, and the resulting PCR product was cloned into pAGM9121. The mRFP1 coding sequence was amplified by overlapping PCR using the mRFP1-1 plasmid (#63816, Addgene) as a template, using L0-mRFP F, L0-mRFP OLF, L0-mRFP OLR, and L0-mRFP R primers, and cloned into pAGM9121 for C-terminal tagging.

[0049] HEI10 Promoter and 5'-UTR, HEI10Lv0 vectors containing the coding region, four copies of the Myc tag (pICSL50010), or mRFP1 were assembled with pICH41421 (NOS terminator) to form the Lv1 vector pICH47742. Subsequently, each Lv1 vector containing the HEI10-Myc or HEI10-mRFP1 expression cassettes contained antibiotic resistance genes BAR It was assembled into the Level 2 (Lv2) binary vector pAGM4723 together with pICSL11017 containing and the end linker pICH41744. The Lv2 binary vector was Agrobacterium tumefaciens ( Agrobacterium tumefaciens ) was introduced into GV3101-pSOUP and using floral dipping qrt Arabidopsis thaliana in the background 420 ( GR / ++ ) was transformed into hemizygous plants (Francis KE et al., Proc Natl Acad Sci US A. 2007, 104(10):3913-8; Melamed-Bessudo C et al., Plant J. 2005, 43(3):458-66). HEI10-mRFP1 The T-DNA insertion sites of lines (#1-#3) were verified by genomic PCR using locus-specific primers and T-DNA-specific primers. The PCR reaction was performed using 10× PCR Master Mix (GENETBIO) in a total reaction volume of 20 µl, and TUB2 ( TUBULIN BETA CHAIN ​​2 ) was used as an internal control. The oligonucleotide sequences used in the present invention are as shown in Table 1.

[0050] Primer used in the present invention Primer name 서열정보 (5'-3') (서열번호) HEI10 promoter F CCCGAAGACGGCTCAGGAGAAAAACCGAGTTACATACGT (3) L0-HEI10 promoter-R CCCGAAGACGGCTCGCATTCCGTCAACCTCTAATATAAGTA (4) L0-HEI10 gDNA-F CCCGAAGACGGCTCAAATGATGAGATGCAACGCGTGTTGGA (5) L0-HEI10 gDNA OLF GAACAGAGAAACCATTCGCAA (6) L0-HEI10 gDNA OLR TTGCGAATGGTTTCTCTGTTC (7) L0-HEI10 gDNA-NSR CCGAAGACGGCTCGCGAACCTAGCCTGAGAATAGAAGCAACAAAATATTTTAG (8) L0-mRFP F CCGAAGACGGCTCATTCGATGGCCTCCTCCGAGGACG (9) L0-mRFP OLF GTAATGCAGAAGAAAACTATGGGCTGGGA (10) L0-mRFP OLR TCCCAGCCCATAGTTTTCTTCTGCATTAC (11) L0-mRFP R CCGAAGACGGCTCGAAGCTCAGGCGCCGGTGGAGTGGC (12) L0-sfGFP F CCGAAGACGGCTCAAATGAGCAAAGGAGAAGAACTTTTCACTGG (13) L0-sfGFP R CCGAAGACGGCTCGAAGCCTATTTGTAGAGCTCATCCATGCC (14) HEI10-qRT-F TCAGTAATGATGGGGCATGTCC (15) HEI10-qRT-R AGAAATTCCAGCCATCGCCA (16) mRFP-qRT-F GAGGGCTTCAAGTGGGAGC (17) mRFP-qRT-R CCTTGTAGATGAACTCGCCGT (18) TUB2-qRT-F CTCACTACCCCCAGCTTTGG (19) TUB2-qRT-R TCAGAGTTGAGTTGACCAGGGA (20) HEI10-mRFP1_#1_locus1_gene_F TGTTGGAACAAGCTTTGGTTC (21) HEI10-mRFP1_#1_locus1_gene_R AAGATCGATAATTGCAGCACG (22) HEI10-mRFP1_#2_locus1_gene_F CTACCTGAGAGATACCAACAATAACAAC (23) HEI10-mRFP1_#2_locus1_gene_R GCTGGTTTTTGATTCACAAGGAAGCAAG (24) HEI10-mRFP1_#2_locus2_gene_F GAAATTGGACGAGATGGGTCTCG (25) HEI10-mRFP1_#2_locus2_gene_R CCCAGAAAATTGGTGGAACATGAGG (26) HEI10-mRFP1_#3_locus1_gene_F AGTTTCTGACGATGCAAGAT (27) HEI10-mRFP1_#3_locus1_gene_R TGGTATGTTTAACGTCCCGA (28) HEI10-mRFP1_T-DNA_R1 CACAGAGTGTTCAACCCCAG (29) HEI10-mRFP1_T-DNA_R2 AGGAGACATGCGAAACGATC (30) TUB2-F CAGGTTTGTCACTCGTTGGGA (31) TUB2-R AACACCATGTAGACCAAGCA (32)

[0052] 3. Measurement of Interference Ratio Using Crossover Frequency and FTLs (Fluorescent Tagged Lines)

[0053] Crossover frequency (in cM units) was measured by analyzing the number of fluorescent and non-fluorescent seeds in FTL / ++ hemizygous plants using the CellProfiler image analysis pipeline. Crossover frequency was calculated using the following formula.

[0054]

[0055] Here, N Green and N Red are the number of green-alone fluorescent seeds and red-alone fluorescent seeds, respectively, and N Total represents the total seed count. The statistical significance of differences in crossover frequencies between genotypes was evaluated using a two-sided Welch's t-test. Measurements of crossover frequency and interference ratio based on pollen tetrads were qrt1 In a mutant background, the study was performed using pollen FTLs and DeepTetrad according to previously reported methods (Nageswaran DC et al., Nat Plants. 2021, 7(4):452-467; Berchowitz LE, Copenhaver GP. Nat Protoc. 2008, 3(1):41-50; Lim EC et al., Plant J. 2020, 101(2):473-483).

[0057] 4. RT-qPCR Analysis

[0058] Total RNA was extracted from unopened floral buds prior to flowering stage 12 using TRIzol Reagent (Invitrogen), and cDNA was synthesized using the reverse transcription kit EZ405S (Enzynomics). Quantitative PCR (qPCR) was performed on the CFX Real-Time PCR Detection System (Bio-Rad) using the TOPreal SYBR Green qPCR PreMIX (RT500S, Enzynomics). Relative expression levels TUB2 It was normalized based on . In the fold-change analysis HEI10 For expression, Col was set to the reference value (reference, 1.0), and HEI10-mRFP1 In the case of expression 420 Representing a recombination frequency of 20.27 cM in the interval HEI10-mRFP1 The lineage was used as the reference value (1.0). All RT-qPCRs were performed in 4 replicates per biological sample.

[0060] 5. Genotyping-by-sequencing (GBS) for crossover site mapping

[0061] Two to three mature leaves were collected from each plant, and genomic DNA (gDNA) was extracted using a CTAB-based method. The leaf samples were placed in a 2 mL tube containing four 3 mm diameter stainless steel beads, flash-frozen in liquid nitrogen, and ground using an MM400 mixer mill (Retsch, Germany). The ground tissue was treated with 500 µL of CTAB buffer (1% w / v CTAB, 50 mM Tris-HCl pH 8.0, 0.7 M NaCl, 10 mM EDTA) at 65°C for 30 minutes. Subsequently, chloroform extraction and isopropanol precipitation were performed. The resulting gDNA pellet was washed twice with 1 mL of 70% ethanol, air-dried, and resuspended in nuclease-free water. For library construction, one barcoded sequencing library was prepared using 150 ng of gDNA per sample. Libraries were pooled and then sequenced using the Illumina HiSeq X platform in a paired-end 150-bp read format (Macrogen, Korea). Crossovers were analyzed using the TIGER pipeline (Rowan BA et al., G3 (Bethesda). 2015, 5(3):385-98).

[0063] 6. Bioinformatics analysis of cross-sectional and genomic features

[0064] To analyze genome-wide crossover patterns, SNPs, and SPO11-1-oligonucleotide and MNase-seq (micrococcal nuclease digestion followed by deep sequencing of nucleosomal DNA) data, the TAIR10 reference genome was tiled into 100-kb bins. The coverage of the SPO11-1-oligonucleotide and MNase-seq data was normalized based on sequencing reads of randomly cleaved gDNA prior to plotting. Crossover sites were first mapped to the TAIR10 genome, and then Liftoff (v.1.6.3) was used to lift-over a 2-kb window centered on each crossover site to the Col-CEN v1.2 reference genome. To analyze SNP density around crossover sites, SNP frequencies in 10-bp bins within a 4-kb window centered on each crossover site were calculated using deepTools computeMatrix (v.3.5.4). The coefficient of coincidence (CoC) was calculated using a custom R script based on the 1-Mb bin restricted to the same chromosomal arm. The short arms of chromosomes 2 and 4 were excluded from the interference analysis.

[0066] 7. Long-read sequencing for crossover point mapping

[0067] For nanopore sequencing of pooled seedling gDNA from F2 seeds obtained from F1 plants, freshly harvested F2 seeds were sterilized, germinated, and cultivated on 1 / 2 MS agar medium supplemented with 1% sucrose under controlled conditions (20°C, 16-hour photoperiod / 8-hour dark period). On the 10th day after germination, a total of 1,000 seedlings were harvested and immediately frozen in liquid nitrogen. Subsequently, the seedlings were ground into a powder under liquid nitrogen using a pre-chilled mortar and pestle. gDNA was extracted using the CTAB method and quantified using the Qubit dsDNA Broad Range Assay Kit (Q32853, Thermo Fisher). A nanopore long-read sequencing library was constructed using 19 µg of seedling-derived gDNA with the Ligation Sequencing Kit V14 SQK-LSK114 (Nanopore). The library was sequenced on the PromethION platform (BGI, Hong Kong, China). Crossing points were analyzed using the COmapper pipeline (Byun D et al., New Phytol. 2025, 247(4):1942-1957).

[0069] 8. Cytological Analysis and Immunostaining

[0070] Chromosome spreading and DAPI staining using pollen mother cells from fixed floral buds were performed to visualize chromosome structures according to previously reported methods. Briefly, floral buds measuring 0.2–0.7 mm, fixed in a 3:1 (v / v) ethanol:acetic acid solution, were treated with a mixed solution of 1% cellulase, 1% pectolase, and 1% cytohelicase at 37°C for 1.5 hours. Subsequently, the samples were spread onto slides in 60% acetic acid, heated at 48°C, and finally enclosed in a DAPI / Vectashield solution.

[0071] For the immunodetection of recombinant proteins, fresh anthers collected from flower buds measuring 0.3–0.45 mm were enzymatically dissociated (0.4% cytohelicase, 1.5% sucrose, 1% PVP). Subsequently, the samples were treated with 1% Lipsol for 1 minute and fixed with 4% paraformaldehyde. The samples were incubated at 4°C for 24 hours using a primary antibody against ASY1 (guinea pig, 1:1,000) and a primary antibody against HEI10 (chicken, 1:1,000), followed by treatment with a secondary antibody at 37°C for 1 hour. Confocal images were acquired on a Zeiss LSM 800 using a ×63 / 1.42 oil objective with a 0.14 μm Z-step interval and analyzed using a Zeiss Zen 2.6.

[0072] For the analysis of HEI10 foci in late-pachytene and diplotene nuclei, sample preparation was performed according to the method described in Morgan C et al. (Nat Commun. 2021, 12(1):4674). The antibodies used were as follows: anti-HEI10 (rabbit, 1:500), anti-ZYP1 (rat, 1:500), anti-ASY1 (guinea-pig, 1:500), anti-rabbit Alexa Fluor 488 (AB_2896346, goat, 1:200), anti-rat Alexa Fluor 555 (ab150150, donkey, 1:200), and anti-guinea-pig Alexa Fluor 647 (AB_2535867, goat, 1:200). 3D-SIM (three-dimensional structured illumination microscopy) was performed using a Zeiss Elyra 7 microscope. The instrument was equipped with two PCO-edge 4.2 sCMOS cameras, a Plan-Apochromat ×63 NA 1.40 oil objective, 405 / 488 / 561 / 640 nm lasers, and ZEN 3.13 acquisition software. Slides were captured in 3D-SIM mode at 30°C, applying 13-phase conditions according to the microscope manufacturer's guidelines. Additionally, immersion oil with a refractive index of 1.518, optimized for imaging at that temperature, was used. Z-stack images were acquired at intervals of 0.1 μm, and the same microscope laser power and camera gain values ​​were maintained for all images.

[0073] wild type and HEI10-mRFP1To detect late-taic foci in all lines, individual bivalents were tracked in Fiji using the ZYP1 image channel and SNT plugin (Arshadi C et al., Nat Methods. 2021, 18(4):374-377). Subsequently, the detection of HEI10 foci along each bivalent was performed using the FociMapper analysis tool, with the following variable values: xy_res: 0.0313 μm, z_res: 0.1 μm, sphere_radius: 0.2 μm, peak_threshold: 0.4, screening_distance: 10, threshold_type: per-trace. Automatic foci detection at the copier stage was performed using TrackMate's LoG detector (Ershov D et al., Nat Methods. 2022, 19(7):829-832), and the variable values ​​used were as follows: diameter: 0.1 μm, threshold: 350000.

[0075] 9. Mathematical Modeling

[0076] Coarsening model simulations for cross-pattern formation were performed according to the method described by Morgan C et al. (Nat Commun. 2021). For the Col simulation, variable values ​​were set to be identical to those used in the wild-type simulation by Morgan C et al. (Nat Commun. 2021). In the HEI10-mRFP1 simulation, all variable values ​​were fixed, except for the variables defining the initial HEI10 concentration in the SC (synaptonemal complex), the initial HEI10 concentration in the recombination intermediates, and the standard deviation of the initial HEI10 amounts in the recombination intermediates. All of these variable values ​​were set to increase by 11.3 times compared to the wild-type Col levels.

[0078] 10. Detection of HEI10-mRFP1 fluorescence in Arabidopsis male meiotic stem cells

[0079] Stage 9 Arabidopsis buds were used for the analysis of male meiocytes. Anthers undergoing meiosis were dissected in a small amount of distilled water. For nuclear staining, DAPI (MBD0015, Sigma-Aldrich) was added to a final concentration of 1 µg / mL. -1Approximately 10 µl of DAPI solution was placed on a glass slide, and the dissected drug was transferred into the solution drop. Subsequently, the drug was gently squashed from under the coverslip using a disposable syringe needle to release the meiotic stem cells. Fluorescence imaging was performed immediately using a Zeiss LSM 800 confocal microscope (Carl Zeiss), and the same acquisition setting was applied to all samples within each experiment. Individual radicular stage nuclei expressing HEI10-mRFP1 were imaged in confocal Z-stack format. The acquired Z-stack images were converted to maximum intensity projection using Zeiss ZEN software, and the number of HEI10-mRFP1 foci per cell was counted using CellProfiler. The statistical significance of differences in the number of HEI10-mRFP1 foci between genotypes was evaluated using the Wilcoxon rank-sum test.

[0081] 11. Immunoblot analysis using transient expression of Arabidopsis protoplasts

[0082] For the transient assay of Arabidopsis thaliana, the Lv0 vectors of HEI10 were assembled into the Lv1 vector pICH4772 along with a 35S promoter (pICH51266), a Myc tag (pICSL50010) or mRFP1, and a NOS terminator (pICH41421). Arabidopsis protoplast preparation and immunoblot analysis were performed according to the method reported by Nageswaran DC et al. (Nat Plants. 2021). Briefly, approximately 20 × 10³ protoplasts were transfected with 10 μg of Lv1 plasmid DNA expressing HEI10-Myc or HEI10-mRFP1 and incubated at 20°C for 6 hours. Subsequently, 50 μM cycloheximide (C7698, Sigma-Aldrich) was added, and the mixture was incubated for 0, 1, or 2 hours. Protoplasts were harvested by centrifugation, and total protein was extracted using Tris-based buffer (50 mM Tris-HCl pH 7.5, 100 mM NaCl, 5 mM EDTA, 1 mM dithiothreitol, 1% Triton X-100, protease inhibitor cocktail; Roche). Proteins were separated by SDS-PAGE on a 10% polyacrylamide gel, transferred to a nitrocellulose membrane, and detected using α-mRFP antibody (Sigma-Aldrich ZRB2088, 1:2,000) or α-Myc antibody (Santa Cruz sc-40, 1:2,000). Band intensity was quantified using ImageJ.

[0084] 12. Fertility assay

[0085] All reproductive capacity analyses were performed using the main inflorescence stems of Arabidopsis thaliana. Seed sets were evaluated by clearing 7th–11th siliques with a 2:1 (v / v) ethanol:glacial acetic acid solution and imaging them at 0.73× magnification using a Leica M165 FC microscope equipped with a Leica DFC450 C camera. Seed number was quantified using ImageJ on 5 siliques per plant from 15 plants per genotype. Pollen viability was evaluated by performing Alexander staining on pollen collected from 5 blooming flowers per plant. Samples were photographed at 10× magnification using a ZEISS Axioplan 2 microscope and a ZEISS Axiocam 820 Color camera. Viable pollen (magenta, round shape) and non-viable pollen (grey, collapsed shape) were quantified on more than 500 pollen grains per plant from 5 plants per genotype.

[0087] 13. Statistics and Reproducibility

[0088] At least four biological replicates were used to measure crossover frequency and interference in seed and pollen FTLs. No data were excluded during the analysis. For each biological replicate, crossover frequency was calculated based on the separation patterns of approximately 1,000–2,000 seeds and 500–1,000 pollen tetrads. Sample sizes were determined based on the number of seeds or pollen tetrads produced from individual plants and were similar to those in previously reported similar studies. Genome-wide crossover map analysis was performed based on one randomly selected F1 individual per genotype, and 96–288 F2 individuals were sequenced for each genotype. These sample sizes were estimated based on existing studies that evaluated the effect of F2 population size on the accuracy of crossover distribution reproduction. For comparisons of two or more groups (Figs. 1b, e, g, 2b, c, f, 3b, 4b-d), Tukey's HSD ( P ANOVA including (< 0.05) was used. Two-sided Welch's t-test (Fig. 1f, 5a) and Wilcoxon rank-sum test (Fig. 4h, 5c, d) were applied to compare the two groups.

[0090] Example 1. Effect of HEI10-mRFP1 on increasing crossover frequency in chromosome arms and pericentromeres

[0091] To investigate the potential capabilities of HEI10, native HEI10 A plant transformation plasmid was constructed to produce transformants expressing HEI10 tagged with four Myc copies (HEI10-Myc) or mRFP1 (HEI10-mRFP1) at the C-terminus under the control of a promoter. The said construct is seed-based 420It was introduced into an FTL (fluorescent tagged line) reporter, which enabled high-speed measurement of crossover frequency (cM) in a subtelomeric region of approximately 5.1 Mb in length on chromosome 3 (Fig. 1a). Expressing additional label-free HEI10 HEI10 Similar to primary transformed (T1) plants (28.25 ± 6.05 cM), HEI10-Myc T1 plants also increased compared to the wild type (19.87 ± 1.49 cM) 420 It showed a crossover frequency (25.98 ± 2.88 cM) (Fig. 1b). Contrary to expectations, HEI10-mRFP1 A larger increase (31.95 ± 6.91 cM) was observed in T1 plants (Fig. 1b, c), suggesting that mRFP1 tagging can increase the abundance or activity of HEI10. Also HEI10-mRFP1 In the transgenic flower HEI10-mRFP1 at the transcriptome level and 420 We observed a correlation between the crossover frequencies (Fig. 1d). This is based on the previous HEI10 This is consistent with the dose effect of HEI10 on cross-formation observed in transformants. It is worth noting, HEI10-mRFP1 38.7% of T1 individuals (24 out of 62 individuals, n = 24 / 62) 420 It was observed that the interval showed a genetic distance exceeding 35 cM (Fig. 1c). This suggests the possibility that some individuals may even exceed the theoretical maximum of 50 cM for the two linkage markers. To further investigate this increased crossover rate, 420 Two values ​​of 42.39 cM and 44.08 cM, respectively, in the interval HEI10-mRFP1 lines (#1, #2) in flowerpot FTL( I1bc , I3bc , I5abIt was crossed with ). This pollen FTL enables high-speed measurement of genetic distances exceeding 50 cM through tetrad analysis using DeepTetrad. HEI10-mRFP1 The lines showed more than a twofold increase in genetic distance compared to the wild type in all tested intervals, with the increase ranging from 2.10 to 4.05 times (Fig. 1e).

[0092] HEI10-mRFP1 To evaluate the genome-wide impact of, HEI10-mRFP1 One of the lines (#1) was crossed with additional seed FTLs located on different chromosomes, and the crossing frequency was measured (Fig. 1f). In all seed FTLs HEI10-mRFP1 The strain showed a higher crossing frequency compared to the wild type, and the short interval CTL5.14 A 3.34-fold increase was observed, located in chromosome arms or subtelomeric regions. CTL1.17 , CTL2.2 , CTL3.15 In this case, the genetic distance exceeded 40 cM (Fig. 1f). Of particular note is, HEI10-mRFP1 This means that the crossing frequency increased even within this pericentromeric region. The segment crossing the centronode CTL3.9 and CTL5.5 Increases of 1.50 times and 1.42 times were observed, respectively (Fig. 1f). HEI10-mRFP1 To independently verify the increase in pericentronode crossover caused by, CTL3.9 Using the reporter, three additional HEI10-mRFP1 Lines (#2, #3, #4) were analyzed. All lines were wild-type (17.4 cM) and promoted pericerotomical crossing through the decompaction of heterochromatin h2a.w Higher compared to the mutant (20.4 cM) CTL3.9It showed a crossover frequency (25.6-26.9 cM) (Fig. 1g). These results show that HEI10-mRFP1 strongly increases the crossover frequency not only in the chromosomal arms but also in the pericentromere region.

[0094] Example 2. High-resolution mapping of genome-wide level crossovers amplified by HEI10-mRFP1

[0095] To investigate the effect of HEI10-mRFP1 on crossover numbers and distribution at high resolution, three HEI10-mRFP1 L lineage (#1, #2, #3) er Genome-wide cross-mapping using genotyping-by-sequencing (GBS) was performed on F2 offspring generated by self-pollination of F1 hybrid plants obtained by crossing with an accession (Fig. 2a). For GBS-based cross-mapping, 420 38.5 cM or more in the section, CTL3.9 Showing 26.1 cM or more in the interval HEI10-mRFP1 Lineages were selected (Figs. 1b, f, g). These crossover maps enabled the precise identification of crossover locations and numbers across the entire genome, and the results were wild-type, h2a.w , HEI10 , J3 G155R and recq4ab It was compared with the background (Figs. 2b-f). Also, three HEI10-mRFP1 The insertion sites of T-DNA transformations in the lines were identified. The three lines exhibited similar levels of crossover increase (#1 = 33.6 / F2, #2 = 36.5 / F2, #3 = 32.7 / F2) and distribution patterns; although slightly more crossovers were observed in line #2, which had two T-DNA insertions (data excluded), the data from the three lines were integrated for subsequent analysis. As a result, HEI10-mRFP1In this case, the number of crossing over increased 4.29-fold compared to the wild type (7.99 / F2), showing an average of 34.3 / F2, and an increase in crossing over was observed across the euchromatic arms of all five chromosomes (Fig. 2b-e). In particular, these levels HEI10 (15.3 / F2), J3 G155R (15.8 / F2), and recq4ab (28.4 / F2) was higher than the level observed in the background (Fig. 2b-e).

[0096] In previous studies, the pericentromere was defined as a continuous region surrounding the centromere that exhibits DNA methylation higher than the genome-wide mean (Fig. 2d). Notably, HEI10-mRFP1 increased crossing over in the pericentromere as well, exhibiting 4.59 crossings per F2 generation. This represents an approximately 2.82-fold increase compared to the wild type (1.63 / F2), significantly exceeding previously achieved levels of genetic increase. Conversely, no crossing over was observed in the centromere itself (Figs. 2d-f). These results suggest that increased abundance or activity of HEI10 may lead to an additional increase in class I crossing over in the heterochromatic pericentromere. Consistent with this interpretation, class I crossing over is known to increase by approximately twofold. HEI10 (2.02 / F2) and J3 G155R (2.07 / F2) showed a moderate increase (~1.2 times) even around centronode crossing, which showed an increase of about 1.3 times (2.22 / F2) h2a.w It was similar to the mutant. On the other hand, it mainly increases class II crossing over sensitive to interhomologous polymorphism. recq4abThe mutant (1.95 / F2) did not significantly increase centromere crossing over, even though crossing over in the euchromatin arms increased by about 3.5-fold, showing only a slight increase (Fig. 2d-f).

[0098] Example 3. Effect of HEI10-mRFP1 on promoting cross-formation in the pericentromeric region

[0099] HEI10-mRFP1 is the wild type, h2a.w , HEI10 , J3 G155R and recq4ab To evaluate more deeply how crossover frequencies and distribution within the pericentromeric region are altered compared to, the pericentromeric region was subdivided into three zones: a high-recombination zone (HRZ; approx. 5.35 cM / Mb), a low-recombination zone (LRZ; approx. 0.82 cM / Mb), and a non-recombination zone (NRZ; 0 cM / Mb). These zones were defined based on crossover frequencies higher, lower, or with no recombination, respectively, than the genome-wide average (~3.04 cM / Mb), and the NRZ was located proximal to centromeres (Fig. 3a). HEI10-mRFP1 Compared to all other genotypes, it showed the highest crossover frequency in both HRZ and NRZ, increasing by approximately 2.8 times and 2.7 times, respectively, compared to the wild type (Fig. 3b-d). h2a.w , HEI10 , J3 G155R and recq4ab In addition, while HRZ showed a moderate increase in crossover frequency (~1.2–1.34-fold) compared to the wild type (Fig. 3b, c), LRZ showed a significant increase (~1.87-fold), which HEI10-mRFP1 except h2a.wThat was all (Fig. 3b, d). Of particular note is that while no crossing over within NRZ was observed in any other genotype, HEI10-mRFP1 In the lineage (287 F2 individuals), two crossovers were detected within the NRZ (Fisher's exact test, two-tailed, P = 2.4 × 10 -4 ) (Fig. 3b). Taken together, these results show that HEI10-mRFP1 uniquely and strongly promotes cross-formation throughout the pericentronode HRZ and LRZ regions, and enables rare cross-formation even within the NRZ where recombination does not typically occur.

[0100] To independently evaluate genome-wide cross-amplification by HEI10-mRFP1, Col × L er Nanopore long-read sequencing was performed on a sample containing 1,000 F2 progeny DNAs derived from F1 hybrid plants, followed by unbiased high-resolution mapping by detecting crossovers using COmapper (Fig. 4a). This approach reproduced the crossover landscape of HEI10-mRFP1 observed in GBS, and wild-type and recq4ab It also matched existing datasets for . Wild type and recq4ab Compared to, HEI10-mRFP1 It significantly increased crossovers per megabase not only in the chromosomal arms but also within the pericentromere region (Figs. 4b-f). Increased levels of crossovers were observed in both the HRZ and LRZ, as well as along individual chromosomes, demonstrating that HEI10-mRFP1 increases class I crossovers at a genome-wide level, including in the LRZ, where they are typically suppressed (Figs. 2, 3, and 4b-f).

[0101] Since the frequency of Class I crossovers shows a positive correlation with the density of single nucleotide polymorphisms (SNPs) between homologous chromosomes at both kilobase and megabase scales, the SNP density around the crossover site was analyzed using high-resolution datasets generated via GBS (> 3× coverage) and COmapper (Fig. 4g, h). Wild type and HEI10-mRFP1 In all plants, crossing over was preferentially located in SNP-rich regions (> 2.5 SNPs / kb) compared to random SNP distributions. On the other hand recq4ab The additional crossovers observed in [the study] occurred primarily in regions with low SNP density (< 2.5 SNPs / kb) and showed a negative correlation with SNP density. This result is consistent with previous reports (Dluzewska J et al., Nat Commun. 2023, 14(1):6716; Byun D et al., New Phytol. 2025, 247(4):1942-1957) (Fig. 4g, h). These results suggest that high SNP density inhibits class II crossovers in the pericerocentric region. Taken together, these results demonstrate that HEI10-mRFP1 selectively amplifies class I crossovers in polymorphic genomic regions, including SNP-rich pericerocentric regions, providing a mechanistic basis for explaining the significant increase in crossovers observed in both the HRZ and LRZ.

[0103] Example 4. Crossover interference loss effect of HEI10-mRFP1

[0104] Based on the fact that class I crossing over is increased approximately 4.3-fold at the genome-wide level and 2.8-fold in the pericentrocentric region by HEI10-mRFP1, we investigated whether crossing over occurs at closer locations as crossover interference decreases correspondingly. To this end, tricolor pollen FTL ( I1bc , I5ab , I3bc Over 2,700 tetrads per FTL were analyzed using high-speed tetrad analysis, and the degree of interference was quantified using the ratio of genetic distance (cM) based on the presence of adjacent crossings (Figs. 1a, 5a). In the wild type, the interference ratio was lower than 1 for all three FTLs, indicating that adjacent crossings are being suppressed. On the other hand HEI10-mRFP1 In plants I1bc (interval I1b , 1.85 Mb; I1c , 4.09 Mb) and I5ab ( I5a , 4.92 Mb; I5b The interference ratio was found to be approximately 1.0 in the , 2.65 Mb) sections, which means that crossover interference was virtually completely eliminated. In comparison, the two shorter sections ( I3b , 2.63 Mb; I3c including , 1.19 Mb) I3bc In this case, the interference ratio was found to be approximately 0.77, which means that the interference was strongly weakened but not completely lost (Fig. 5a).

[0105] To evaluate genome-wide level cross-interference at higher resolution, wild type, recq4ab and HEI10-mRFP1 of Col × L er A GBS-based crossover map of male meiosis was constructed using a backcross population for the F1 hybrids (Fig. 5b). Consistent with the F2 analysis results, HEI10-mRFP1 is wild type and recq4abIt showed a significantly increased crossover frequency at the genome-wide level compared to all types (Fig. 5b). Next, crossover interference was quantified by analyzing the inter-crossover distance along individual chromosomes (Fig. 5c). In the wild type, crossovers were distributed more evenly and widely (average ~13.66 Mb) than expected from a random distribution (~8.20 Mb), which reflects strong interference. On the other hand HEI10-mRFP1 In this case, the distance between crossovers became significantly shorter (~5.81 Mb), and the distribution approached the random expectation (~5.05 Mb). This pattern is recq4ab It was similar to the non-interfering distribution observed in, but interference was not completely eliminated (Wilcoxon test, P < 7.04 × 10 -14 ) (Fig. 5c). In particular HEI10-mRFP1 The distribution of crossover distances at short dielectric scales (< ~1 Mb) suggests the presence of residual interference, which I3bc This is consistent with an interference ratio of approximately 0.77 observed in (Fig. 5a, c). Similar results were obtained in the cis-inter-crossover distance analysis using the F2GBS dataset. That is, HEI10-mRFP1 It showed a significantly reduced crossover distance (~3.42 Mb) compared to the wild type (~9.34 Mb), which was very close to the random expected value (~3.20 Mb) (Wilcoxon test, P = 0.35; Fig. 5d). This means that cross-interference has almost completely disappeared. However, HEI10-mRFP1 Because the F2GBS dataset contains abundant trans-crossovers, the cis-inter-crossover distance estimates may be biased toward shorter intervals.

[0106] HEI10-mRFP1To more quantitatively evaluate the attenuation of interference in [location], the correlation coefficient (CoC) was calculated along the chromosomes (Fig. 5e). CoC is the value obtained by dividing the frequency of double crossover observed between two intervals by the expected frequency assuming independent occurrence; a value closer to 1 indicates no interference, while a value closer to 0 indicates strong interference. In wild-type male meiosis, the CoC remained close to 0 when the interval distance was 5 Mb or less, and approached 1 only after exceeding 8 Mb. This indicates that double crossover at close positions is strongly suppressed. On the other hand HEI10-mRFP1 In this case, the CoC value was significantly lower than 1 only at the shortest segment distance (1 Mb), while for segment distances exceeding 2 Mb, the CoC approached 1. This pattern is recq4ab It was similar to the incoherent cross pattern observed in (Fig. 5e). These results are HEI10-mRFP1 It shows that crossover interference is mostly lost at the genome-wide level, and the remaining interference is detected only at short distances (< ~1 Mb).

[0108] Example 5. Effect of increasing the number of HEI10 focuses and reducing the spacing between focuses in HEI10-mRFP1

[0109] To determine how HEI10-mRFP1 changes the number and spatial patterning of HEI10 focuses, the wild-type Col and 3D-SIM (three-dimensional structured illumination microscopy), an ultra-high-resolution imaging technique, were used. HEI10-mRFP1 HEI10 focuses were quantified in the nuclei of late pachytene in plants. HEI10 was immunostained with ZYP1, a marker of the synaptonem complex (SC), which allowed for the precise measurement of the number and spacing of HEI10 focuses along synapsed chromosome pairs. HEI10-mRFP1It significantly increased the number of HEI10 focuses per bivalent chromosome during the late fetal stage (mean = 6.9, Wilcoxon test, P = 7.42 × 10 -27 ), which was much higher than the average value of Col (2.0) (Fig. 6a, b). Consistent with this increase, HEI10-mRFP1 It significantly reduced the distance between adjacent HEI10 focuses along the SC, and as a result, the coincidence of closely located focuses increased. The average inter-focus distance of HEI10-mRFP1 was 4.9 μm, which was a significant decrease from the average value of 18.5 μm of wild-type Col (Wilcoxon test, P = 6.11 × 10 -39 ) (Fig. 6a, b).

[0110] The inventors of the HEI10 coarse conversation model HEI10-mRFP1 We verified whether the number of focal points and inter-focus distance observed in the system could be reproduced (Fig. 6b). The simulation was performed using the same parameter values ​​for Col as those used by Morgan C et al. (Nat Commun. 2021), and HEI10-mRFP1 The only difference in the simulation was that the initial amount of HEI10 at the SC and recombination intermediate positions was increased by 11.3 times. HEI10-mRFP1 The simulation showed an increased number of focuses (average = 7.0) and reduced inter-focus spacing (average = 6.8 μm) compared to the Col simulation (Wilcoxon test, all cases P < 1.0 × 10 -100 ), this was consistent with the experimental data. However, in the experimental data, an excessive number of HEI10 focuses located very close to each other appeared compared to the simulation results (Wilcoxon test,P = 2.46 × 10 -48 On the other hand, HEI10-mRFP1 The distribution of the number of focuses at itself was well reproduced by simulation (Wilcoxon test, P = 0.48).

[0111] It is noteworthy that the HEI10 signal immunohistochemically stained along the SC during the late Taichaline stage is higher than that of the wild type. HEI10-mRFP1 It appeared consistently more strongly in (Fig. 6a). When a bright SC-associated HEI10 focus was observed in the wild-type late Taicine nuclei, almost no HEI10 staining signal was present in the rest of the SC. Conversely HEI10-mRFP1 In the lineage, even when bright SC-associated focus was detected, a significant level of HEI10 signal remained throughout the SC. This pattern suggests that the abundance or stability of HEI10 protein was increased by mRFP1 tagging. These SC-associated HEI10 signals HEI10-mRFP1 It decreased in diplotene nuclei (Fig. 6c, d), and at the same time, the number of detectable HEI10 focuses significantly increased compared to wild-type nuclei (Wilcoxon test, P = 1.35 × 10 -6 ).

[0112] To independently verify the location and signal specificity of HEI10-mRFP1, HEI10-mRFP1 Male meiocytes were purified from plants (#1, #2, #3, #5), and HEI10-mRFP1 was directly observed using a confocal microscope. Consistent with the immunostaining results, HEI10-mRFP1 exhibited signals continuously associated with SC during the Tachycardia phase and simultaneously accumulated in the form of discontinuous focuses (Fig. 6e). Next, we [analyzed] the high-recombination cells used in the GBS analysis HEI10-mRFP1Line #2 (44.08 cM in the 420 interval) and low-recombination showing a lower recombination frequency (30.41 cM) in the same interval HEI10-mRFP1 The number of HEI10-mRFP1 focuses at the copier stage was quantified by comparing system (#5) (Figs. 6e, f). As a result, the recombination HEI10-mRFP1 The system maintained more HEI10-mRFP1 focus up to the copier stage compared to the low-recombination system (Wilcoxon test, P = 6.87 × 10 -7 (Figs. 6e, f). Taken together, these results show that there is a dosage-dependent association between the persistence of the HEI10-mRFP1 focus and the crossover frequency output that persists up to the copier stage, which is consistent with the interpretation that HEI10-mRFP1 is maintained for a long time at crossover-designated sites.

[0114] Example 6. Effect of HEI10-mRFP1 on fertility

[0115] from Arabidopsis recq4 , zyp1 , and recq4zyp1 It is known that increased crossing frequency in anti-recombination mutants such as [specific mutant] has only a relatively minor effect on seed fertility. However, crossing formation in the centromere-adjacent LRZ is associated with chromosome missegregation and reduced fertility. Since HEI10-mRFP1 increases crossing frequency in the centromere-adjacent LRZ by approximately 2.7-fold (Figs. 3b, c), we investigated whether the crossing expansion induced by HEI10-mRFP1 impairs fertility or meiotic chromosome separation (Fig. 7). Three HEI10-mRFP1In all lines, the number of seeds per pod decreased slightly but significantly compared to the wild type (~7%, Fig. 7a, b). This is HEI10 It was similar to the level of reduction (~12%) reported in the overexpression line (C2). Also HEI10-mRFP1 The lines also showed a moderate but significant decrease (~10%) in pollen viability (Fig. 7c, d). Consistent with these fertility defects, cytological analysis of male meiotic stem cells revealed abnormal chromosomal structures, such as chromosome connections, chromosome fragments, and persistently remaining chromosome threads, in approximately 5% of metaphase I and anaphase I cells (Fig. 7e, f). On the other hand, most HEI10-mRFP1 Meiotic stem cells exhibited normal chromosomal behavior. Taken together, the results demonstrate that HEI10-mRFP1 significantly increases crossing over at a genome-wide level while causing only a relatively minor reduction in fertility.

[0117] Example 7. Effect of HEI10-GFP on increasing crossing-over frequency in chromosomal arms and pericerocentric regions

[0118] To verify the effects of a fusion protein similar to HEI10-mRFP1, the inventors prepared a plant body overexpressing an HEI10-sfGFP fusion protein in which sfGFP is tagged at the C-terminus of the HEI10 protein. The method for preparing the plant body is described in '2' above. HEI10-Myc and HEI10-mRFP1 The procedure was performed in the same manner as 'preparation of plant material', but the sfGFP sequence was amplified by overlapping PCR using the SpyCatcher003-sfGFP plasmid (#133449, Addgene) as the template strand using the L0-sfGFP F, L0-sfGFP R primer set, and cloned into pAGM9121 for C-terminal tagging.

[0119] Fusion proteins with different C-terminal tags attached to the HEI10 protein are identical native HEI10 When expressed as a promoter HEI10-sfGFP In this example, similar to that shown in Example 2, across the chromosome and in the pericentrosome region HEI10-mRFP1 It significantly increased the crossover to a level similar to that of (Fig. 8). On the other hand HEI10-Myc In this case, a level of crossover increase similar to that of HEI10 without terminal tags was observed. These results suggest that not only mRFP1 but also HEI10 protein-fluorescent protein fusion proteins tagged with other fluorescent proteins, including the similar fluorescent protein sfGFP, can significantly increase crossover.

[0121] This research was conducted with support from the Samsung Future Technology Foundation's Samsung Future Technology Development Program (Project No.: SSTF-BA2202-09) and the National Research Foundation of Korea's Individual Basic Research Program (Ministry of Science and ICT) (Project No.: RS-2024-00335818).

Claims

Claim 1 A method for increasing the number of crossover recombinations in both the euchromatin and heterochromatin regions of homologous chromosomes during meiosis of plant cells, comprising the step of transforming a plant cell with a recombinant vector comprising a nucleic acid sequence encoding a fusion protein in which a fluorescent protein is fused to the carboxyl terminus of the HEI10 protein consisting of the amino acid sequence of SEQ ID NO. 2 and a nucleic acid sequence encoding a fusion protein of the HEI10 protein and a fluorescent protein, wherein the fluorescent protein is selected from the group consisting of GFP, EGFP, sfGFP, YFP, CFP, DsRed, mRFP1, mCherry, mKate, and functional variants thereof. Claim 2 delete Claim 3 delete Claim 4 delete Claim 5 A step of transforming a plant cell with a recombinant vector comprising a nucleic acid sequence encoding a fusion protein in which a fluorescent protein is fused to the carboxyl terminus of the HEI10 protein consisting of the amino acid sequence of SEQ ID NO. 2, and overexpressing the nucleic acid sequence encoding the fusion protein of the HEI10 protein and the fluorescent protein; A method for producing a transgenic plant having an increased number of cross-recombinations in both the euchromatin and heterochromatin regions of homologous chromosomes compared to the wild type, comprising the step of redifferentiating a transgenic plant from a plant cell in which a nucleic acid sequence encoding a fusion protein of the HEI10 protein and a fluorescent protein is overexpressed, wherein the fluorescent protein is any one selected from the group consisting of GFP, EGFP, sfGFP, YFP, CFP, DsRed, mRFP1, mCherry, mKate, and functional variants thereof. Claim 6 delete Claim 7 delete Claim 8 Transgenic plantlets having an increased number of cross-recombinations in both the euchromatin and heterochromatin regions of homologous chromosomes compared to the wild type produced by the method of paragraph 5. Claim 9 Transformed seeds of a plant body according to Paragraph 8. Claim 10 A composition for increasing the number of cross-recombinations in both the euchromatin and heterochromatin regions of homologous chromosomes during meiosis of plant cells, comprising as an active ingredient a nucleic acid sequence encoding a fusion protein in which a fluorescent protein is fused to the carboxyl terminus of a HEI10 protein consisting of the amino acid sequence of SEQ ID NO. 2, and the fluorescent protein is selected from the group consisting of GFP, EGFP, sfGFP, YFP, CFP, DsRed, mRFP1, mCherry, mKate, and functional variants thereof.

Images