Genetic Marker Having Single Nucleotide Polymorphism For Distinguishing Seed Of Ziziphus jujuba var. spinosa

Abstract

The present invention relates to a gene marker having a single nucleotide polymorphism (SNP) that can be usefully used to identify Ziziphus jujuba, a primer set for identifying Ziziphus jujuba using said marker, a PCR composition or kit comprising said primer set, and a method for identifying Ziziphus jujuba using said. According to the present invention, Ziziphus jujuba can be easily distinguished from counterfeit products such as Ziziphus jujuba, Ziziphus jujuba, and Ziziphus jujuba.

Description

Technology Field

[0001] The present invention relates to a gene marker having a single nucleotide polymorphism for identifying Ziziphus jujuba, a primer set for identifying Ziziphus jujuba using the same, a composition, a kit, and a method for identification. Background Technology

[0002] Sanjoin belongs to the Rhamnaceae family ( Rhamnaceae )'s mountain jujube tree ( Ziziphus jujuba var. spinosa The ripe seeds of (Bunge) Hu ex HFChow) are flattened round or flattened oval in shape, reddish-purple or reddish-brown in color, and are 5–9 mm long, 5–7 mm wide, and 2–4 mm thick.

[0003] According to the *Donguibogam*, Sanjoin is neutral in nature, sweet in taste, and non-toxic. Sanjoin is used for nervous tension, insomnia, amnesia, and night sweats, and is known to strengthen the spleen and stomach and be effective for anemia. Sanjoin can be used in the form of a powder that has been roasted and then powdered, boiled in water like tea, or dried after hot water extraction, but is not particularly limited to these methods (Patent Document 1).

[0004] Counterfeit products that may be mixed in due to their similar appearance to Sanjoin include the Indian jujube, a plant of the same genus ( Ziziphus mauritiana The seeds of Lam.) such as *Myeonjoin* or *Myeonsanjoin*, and *Hovenia dulcis* ( Hovenia dulcis The seeds of ) or legumes ( Fabaceae ) plant silver alfalfa (jeombey) Leucaena leucocephala There is a species of (Lam.) de Wit called *Eunhaphwanja*, which is currently being distributed in the domestic market mixed with *Sanjoin*. Accordingly, research is being conducted on a method to specifically distinguish *Sanjoin* from counterfeit products such as *Myeonjoin*, *Jiguja*, and *Eunhaphwanja*.

[0005] The inventors of the present invention have researched a method to distinguish Sanjoin from counterfeit products such as Myeonjoin, Jiguja, and Eunhaphwanja, and have identified a Single Nucleotide Polymorphism (SNP) in the barcode gene COI (Cytochrome c oxidase subunit I) that can distinguish Sanjoin, Myeonjoin, Jiguja, and Eunhaphwanja. From this, they confirmed that Sanjoin can be easily distinguished by a combination of five types of primers and probes specific to each of Sanjoin, Myeonjoin, Jiguja, and Eunhaphwanja, and thus completed the present invention. Prior art literature

[0006] Republic of Korea Published Patent Application No. 10-2019-0133552 (December 3, 2019) The problem to be solved

[0007] The present invention aims to provide a genetic marker, composition, primer set, or kit capable of distinguishing Sanjoin from imitation counterfeit Sanjoin products such as Myeonjoin, Jiguja, and Eunhaphwanja.

[0008] In addition, the present invention aims to provide a method for identifying Sanjoin using a genetic marker, composition, primer set, or kit that can identify Sanjoin from similar counterfeit products such as Myeonjoin, Jiguja, and Eunhaphwanja. means of solving the problem

[0009] One aspect of the present invention comprises a polynucleotide comprising at least one selected from the group consisting of: a polynucleotide comprising eight or more consecutive nucleotides including one or more SNP locations selected from the group consisting of the 38th single nucleotide polymorphism (SNP) location of the nucleotide sequence of SEQ ID NO. 1, the 71st SNP location of the nucleotide sequence of SEQ ID NO. 2, the 50th SNP location of the nucleotide sequence of SEQ ID NO. 3, the 36th SNP location of the nucleotide sequence of SEQ ID NO. 4, and the 53rd SNP location of the nucleotide sequence of SEQ ID NO. 5; and a polynucleotide complementary to said polynucleotide. Ziziphus jujuba var. spinosa Provides a genetic marker for the identification of ).

[0010] In one embodiment, the gene marker is intended to distinguish Sanjoin from Myeonjoin, Jiguja, and Eunhaphwanja, but is not limited thereto.

[0011] Another aspect of the present invention provides a primer set for identifying Sanjoin, comprising a primer pair for binding to and amplifying a gene marker as described above.

[0012] In one embodiment, the primer pair may amplify the gene marker by binding to one or more polynucleotides of SEQ ID NOs 1 to 5 and their complementary base sequences, but is not limited thereto.

[0013] In a preferred embodiment, the primer pair comprises: i) a pair of a first primer composed of the nucleotide sequence of SEQ ID NO. 6 and a second primer composed of the nucleotide sequence of SEQ ID NO. 7 for amplifying a gene marker comprising the 38th SNP position of the nucleotide sequence of SEQ ID NO. 1; ii) a pair of a third primer composed of the nucleotide sequence of SEQ ID NO. 10 and a fourth primer composed of the nucleotide sequence of SEQ ID NO. 11 for amplifying a gene marker comprising the 71st SNP position of the nucleotide sequence of SEQ ID NO. 2; iii) a pair of a fifth primer composed of the nucleotide sequence of SEQ ID NO. 14 and a sixth primer composed of the nucleotide sequence of SEQ ID NO. 15 for amplifying a gene marker comprising the 50th SNP position of the nucleotide sequence of SEQ ID NO. 3; iv) a pair of a seventh primer composed of the nucleotide sequence of SEQ ID NO. 18 and an eighth primer composed of the nucleotide sequence of SEQ ID NO. 19 for amplifying a gene marker comprising the 36th SNP position of the nucleotide sequence of SEQ ID NO. 4; and v) may include at least one selected from the group consisting of a pair of a ninth primer composed of the nucleotide sequence of SEQ ID NO. 22 and a tenth primer composed of the nucleotide sequence of SEQ ID NO. 23 for amplifying a gene marker including the 53rd SNP position of the nucleotide sequence of SEQ ID NO. 5, but is not limited thereto. In a preferred embodiment, the primer set comprises all of the aforementioned first to tenth primers, and in a more preferred embodiment, the primer set may comprise all of the aforementioned first to sixth primers, but is not limited thereto.

[0014] Another aspect of the present invention provides a PCR composition for identifying Ziziphus jujuba comprising a primer set of the present invention, or a kit for identifying Ziziphus jujuba comprising a primer set or a PCR composition of the present invention.

[0015] In one embodiment, the PCR composition and kit of the present invention may further include a probe that specifically binds to a gene marker for identifying Ziziphus jujuba.

[0016] In a preferred embodiment, the probe may have a reporter attached to the 5' end or a quencher attached to the 3' end, but is not limited thereto.

[0017] In a preferred embodiment, the PCR composition or kit comprises: i) a pair of a first probe composed of the nucleotide sequence of SEQ ID NO. 8 and a second probe composed of the nucleotide sequence of SEQ ID NO. 9 for detecting a gene marker including the 38th SNP position of the nucleotide sequence of SEQ ID NO. 1; ii) a pair of a third probe composed of the nucleotide sequence of SEQ ID NO. 12 and a fourth probe composed of the nucleotide sequence of SEQ ID NO. 13 for detecting a gene marker including the 71st SNP position of the nucleotide sequence of SEQ ID NO. 2; iii) a pair of a fifth probe composed of the nucleotide sequence of SEQ ID NO. 16 and a sixth probe composed of the nucleotide sequence of SEQ ID NO. 17 for detecting a gene marker including the 50th SNP position of the nucleotide sequence of SEQ ID NO. 3; iv) a pair of a seventh probe composed of the nucleotide sequence of SEQ ID NO. 20 and an eighth probe composed of the nucleotide sequence of SEQ ID NO. 21 for detecting a gene marker including the 36th SNP position of the nucleotide sequence of SEQ ID NO. 4; and v) a pair of a ninth probe composed of the nucleotide sequence of SEQ ID NO. 24 and a tenth probe composed of the nucleotide sequence of SEQ ID NO. 25 for detecting a gene marker including the 53rd SNP position of the nucleotide sequence of SEQ ID NO. 5; may include at least one selected from the group consisting of these, but is not limited thereto. In a preferred embodiment, the PCR composition or kit comprises all of the aforementioned first to tenth probes, and in a more preferred embodiment, the PCR composition or kit may comprise all of the aforementioned first to sixth probes, but is not limited thereto.

[0018] In a more preferred embodiment, different reporters may be attached to the pair of probes for each gene marker, but are not limited thereto.

[0019] In one embodiment, the reporter may be, but is not limited to, Hex, Joe, Fam, fluorescein, fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethylrhodamine, FITC, Oregon green, alexa Fluor, ROX (carboxy-X-rhodamine), Texas Red, TET, TRITC, TAMRA, cyanine-based dyes, thiadicarbocyanine dyes, etc.

[0020] In another embodiment, the quencher may be Black Hole Quencher-1 (BHQ-1), BHQ-2, BH3-3, ROX, Dabcyl, TAMRA, Eclipse, DDQ, QSY, Blackberry Quencher, Qxl, Iowa Black FQ, Iowa Black RQ, or IRDye QC-1, but is not limited thereto.

[0021] Another aspect of the present invention provides a method for identifying Ziziphus jujuba, comprising: 1) a step of preparing a mixture by mixing template DNA derived from a plant sample with the aforementioned PCR composition; and 2) a step of PCR amplifying the mixture to form an amplified product.

[0022] In a preferred embodiment, the above determination is intended to distinguish Sanjoin from Myeonjoin, Jiguja, and Eunhaphwanja, but is not limited thereto. Effects of the invention

[0023] According to the gene marker having a single nucleotide polymorphism of the present invention, a primer set for amplifying the gene marker, a composition, a kit, and a method for identification using the same, Sanjoin can be easily distinguished from counterfeit products such as Myeonjoin, Jiguja, and Eunhaphwanja that may be mixed in due to their similar appearance. Brief explanation of the drawing

[0024] Figure 1 is a photograph and graph showing the results of DNA extraction from samples of Sanjoin, Myeonjoin, Jiguja, and Eunhaphwanja. Figures 2 to 6 are graphs showing that Sanjoin, Myeonjoin, Jiguja, and Eunhaphwanja can be distinguished as a result of real-time PCR analysis using pairs of primers and probes for the gene markers of SEQ ID NOs 1 to 5, respectively. Figure 7 summarizes the SNP combinations and fluorescence signals that can distinguish between Sanjoin, Myeonjoin, Jiguja, and Eunhapwanja in an embodiment of the present invention. Specific details for implementing the invention

[0025] First, the terms used in the present invention will be explained.

[0026] In this specification, the term “nucleotide” is a deoxyribonucleotide or ribonucleotide existing in a single-stranded or double-stranded form, and is used to include, without limitation, analogs of natural nucleotides unless otherwise specifically stated.

[0027] As used herein, the term "complementary" means sufficiently complementary to the extent that a primer or probe selectively hybridizes to a target nucleic acid sequence under certain annealing or hybridization conditions, and encompasses both substantially complementary and perfectly complementary, preferably meaning perfectly complementary.

[0028] The term “specific” as used in this specification means that each primer or probe of the present invention specifically binds only to the genetic marker of one or more target samples selected from Sanjoin, Myeonjoin, Jiguja, and Eunhaphwan.

[0029] As used herein, the term "primer" refers to a single-stranded oligonucleotide sequence complementary to the nucleic acid strand to be copied, which can serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primer are designed to allow the initiation of the synthesis of the extension product. The specific length and sequence of the primer may be determined by the complexity of the required DNA or RNA target, as well as primer usage conditions such as temperature and ionic strength.

[0030] In this specification, the term “probe” means a natural or modified monomer or a linear oligomer having a bond comprising a deoxyribonucleotide and a ribonucleotide that can hybridize to a specific nucleotide sequence. Preferably, the probe is single-stranded for maximum efficiency in hybridization. The probe is preferably a deoxyribonucleotide. As a probe used in the present invention, a sequence that is completely complementary to the sequence containing the SNP may be used, but a substantially complementary sequence may also be used to the extent that it does not interfere with specific hybridization.

[0031] As used herein, the term "PCR" refers to a process of amplifying a target nucleic acid by using the target nucleic acid as a template and using primers specific to the target nucleic acid, and repeating the processes of denaturation, annealing, and extension reactions.

[0032] The present invention will be described in detail below.

[0033] The present invention provides a genetic marker for identifying Ziziphus jujuba, comprising at least one selected from the group consisting of: a polynucleotide composed of eight or more consecutive nucleotides including one or more SNP locations selected from the group consisting of the 38th single nucleotide polymorphism (SNP) location of the nucleotide sequence of SEQ ID NO. 1, the 71st SNP location of the nucleotide sequence of SEQ ID NO. 2, the 50th SNP location of the nucleotide sequence of SEQ ID NO. 3, the 36th SNP location of the nucleotide sequence of SEQ ID NO. 4, and the 53rd SNP location of the nucleotide sequence of SEQ ID NO. 5; and a polynucleotide complementary to the polynucleotide.

[0034] In one embodiment, the gene marker may be used to distinguish Sanjoin from Myeonjoin, Jiguja, and Eunhaphwanja, but is not limited thereto.

[0035] In one embodiment, the gene marker of the present invention comprises 8 to 170, e.g., 8 to 150, preferably 8 to 100, 8 to 60, 18 to 50, 18 to 30, or 18 to 24, or 8 to 24 consecutive polynucleotides, comprising the 38th nucleotide which is an SNP site as part of the 1st to 64th polynucleotides of the base sequence of SEQ ID NO. 1, preferably the 23rd to 48th polynucleotides; 8 to 170, e.g., 8 to 150, preferably 8 to 100, 8 to 60, 18 to 50, 18 to 30, or 18 to 24, or 8 to 24 consecutive polynucleotides comprising the 71st nucleotide which is an SNP site as part of the 1st to 102nd polynucleotides of the base sequence of SEQ ID NO. 2, preferably the 26th to 77th polynucleotides; 8 to 170, e.g., 8 to 150, preferably 8 to 100, 8 to 60, 18 to 50, 18 to 30, or 18 to 24, or 8 to 24 consecutive polynucleotides comprising the 50th nucleotide which is an SNP site as part of the 1st to 81st polynucleotides of the base sequence of SEQ ID NO. 3, preferably the 26th to 53rd polynucleotides; 8 to 170, e.g., 8 to 150, preferably 8 to 100, 8 to 60, 18 to 50, 18 to 30, or 18 to 24, or 8 to 24 consecutive polynucleotides comprising the 36th nucleotide which is an SNP site as part of the 1st to 64th polynucleotides of the base sequence of SEQ ID NO. 4, preferably the 23rd to 48th polynucleotides;and may be one or more polynucleotides selected from the group consisting of 8 to 170, e.g. 8 to 150, preferably 8 to 100, 8 to 60, 18 to 50, 18 to 30, or 18 to 24, or 8 to 24 consecutive polynucleotides comprising the 53rd nucleotide which is an SNP position as part of the 1st to 90th polynucleotides of the base sequence of SEQ ID NO. 5.;

[0036] In a preferred embodiment, the gene marker of the present invention may be one or more polynucleotides selected from the group consisting of: a polynucleotide composed of consecutive nucleotides at positions 1 to 64 of the base sequence of SEQ ID NO. 1; a polynucleotide composed of consecutive nucleotides at positions 1 to 102 of the base sequence of SEQ ID NO. 2; a polynucleotide composed of consecutive nucleotides at positions 1 to 81 of the base sequence of SEQ ID NO. 3; a polynucleotide composed of consecutive nucleotides at positions 1 to 64 of the base sequence of SEQ ID NO. 4; and a polynucleotide composed of consecutive nucleotides at positions 1 to 90 of the base sequence of SEQ ID NO. 5; and preferably, the gene marker of the present invention may include all of these five types of polynucleotides. More preferably, the gene marker of the present invention comprises a polynucleotide composed of consecutive nucleotides at positions 13 to 58 of the base sequence of SEQ ID NO. 1; It may be one or more polynucleotides selected from the group consisting of: a polynucleotide consisting of consecutive nucleotides at positions 16 to 87 of the base sequence of SEQ ID NO. 2; a polynucleotide consisting of consecutive nucleotides at positions 16 to 63 of the base sequence of SEQ ID NO. 3; a polynucleotide consisting of consecutive nucleotides at positions 13 to 58 of the base sequence of SEQ ID NO. 4; and a polynucleotide consisting of consecutive nucleotides at positions 11 to 75 of the base sequence of SEQ ID NO. 5.

[0037] The SNP of the present invention is a very stable genetic marker that can be directly used to distinguish Sanjoin from counterfeit products such as Myeonjoin, Jiguja, and Eunhaphwanja, which may be mixed in due to their similar morphology. The fact that the SNP marker of the present invention can be used to distinguish Sanjoin is based on the fact that, depending on Sanjoin, Myeonjoin, Jiguja, and Eunhaphwanja, the 38th base, which is the SNP variant location in the base sequence indicated by SEQ ID NO. 1, is different as T or C; the 71st base, which is the SNP variant location in the base sequence indicated by SEQ ID NO. 2, is different as G or C; the 50th base, which is the SNP variant location in the base sequence indicated by SEQ ID NO. 3, is different as A or G; the 36th base, which is the SNP variant location in the base sequence indicated by SEQ ID NO. 4, is different as G or A; and the 53rd base, which is the SNP variant location in the base sequence indicated by SEQ ID NO. 5, is different as A or C.

[0038] For example, among the base sequences indicated by SEQ ID NO. 1, the 38th base, which is the SNP variant location, is different as C for Myeonjoin and Eunhaphwanja and T for Sanjoin; among the base sequences indicated by SEQ ID NO. 2, the 71st base, which is the SNP variant location, is different as G for Sanjoin and Jiguja and C for Myeonjoin; among the base sequences indicated by SEQ ID NO. 3, the 50th base, which is the SNP variant location, is different as G for Jiguja and A for Sanjoin and Myeonjoin; among the base sequences indicated by SEQ ID NO. 4, the 36th base, which is the SNP variant location, is different as A for Jiguja and G for Myeonjoin and Eunhaphwanja; and among the base sequences indicated by SEQ ID NO. 5, the 53rd base, which is the SNP variant location, is different as A for Sanjoin and C for Myeonjoin and Jiguja, thus exhibiting different base polymorphisms. Therefore, Sanjoin can be clearly distinguished from Myeonjoin, Jiguja, and Eunhaphwanja by confirming the base sequences at the above SNP variant locations.

[0039] The present invention relates to a base variant at a corresponding SNP location in one or more polynucleotides or parts thereof among the sequences of SEQ ID NOs. 1 to 5, but when such SNP base variant is found in double-stranded gDNA (genomic DNA), it is interpreted to include a polynucleotide sequence complementary to the nucleotide sequence. Accordingly, the base at the SNP location in the complementary polynucleotide sequence also becomes a complementary base. In this regard, all sequences presented in this specification are based on sequences in the sense strand of genomic DNA unless otherwise noted.

[0040] In addition, the present invention provides a single nucleotide polymorphism marker composition, a primer set, a probe, and a kit capable of identifying Ziziphus jujuba using the gene marker having single nucleotide polymorphism.

[0041] Specifically, the present invention provides a primer set for identifying Ziziphus jujuba, comprising a primer pair for amplifying a gene marker for identifying Ziziphus jujuba as described above.

[0042] In the present invention, each primer pair comprises, without limitation, any polynucleotide sequence capable of amplifying a gene marker for identifying Sanjoin by binding to one or more polynucleotides of SEQ ID NOs 1 to 5 and their complementary base sequences.

[0043] In one embodiment, the primer pair of the present invention comprises: a pair of a first primer composed of the nucleotide sequence of SEQ ID NO. 6 and a second primer composed of the nucleotide sequence of SEQ ID NO. 7 for amplifying a gene marker that is SEQ ID NO. 1 or a part thereof; a pair of a third primer composed of the nucleotide sequence of SEQ ID NO. 10 and a fourth primer composed of the nucleotide sequence of SEQ ID NO. 11 for amplifying a gene marker that is SEQ ID NO. 2 or a part thereof; a pair of a fifth primer composed of the nucleotide sequence of SEQ ID NO. 14 and a sixth primer composed of the nucleotide sequence of SEQ ID NO. 15 for amplifying a gene marker that is SEQ ID NO. 3 or a part thereof; and a pair of a seventh primer composed of the nucleotide sequence of SEQ ID NO. 18 and an eighth primer composed of the nucleotide sequence of SEQ ID NO. 19 for amplifying a gene marker that is SEQ ID NO. 4 or a part thereof. It may include one or more combinations selected from the group consisting of a ninth primer composed of the nucleotide sequence of SEQ ID NO. 22 and a tenth primer composed of the nucleotide sequence of SEQ ID NO. 23 for amplifying a gene marker that is SEQ ID NO. 5 or a part thereof; preferably, it may include five or three types among the primer pairs, and more preferably, it may include all of the first to sixth primers or all of the first to tenth primers.

[0044] The primers used in the present invention comprise hybridized nucleotide sequences that are complementary to the DNA sequence of a region adjacent to a target gene marker. Since the primers can be applied to the present invention as long as they hybridize with the template and possess sufficient complementarity to perform their inherent functions, the primers do not need to have sequences that are perfectly complementary to the template nucleotide sequence. Furthermore, the primers of the present invention may be modified (e.g., addition, deletion, substitution) within a range that does not affect the specific detection of Ziziphus jujuba. For example, depending on the sequence length of each primer, the primers may comprise oligonucleotides consisting of fragments of 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, or 20 consecutive nucleotides within the sequence.

[0045] The oligonucleotide used as a primer in the present invention may also include a nucleotide analogue, for example, a phosphorothioate, an alkylphosphorothioate, or a peptide nucleic acid, or may include an intercalating agent.

[0046] In addition, the present invention provides a composition for identifying Ziziphus jujuba comprising the above-mentioned primer set for identifying Ziziphus jujuba.

[0047] In addition, the present invention provides a kit for identifying Ziziphus jujuba, comprising the above-mentioned primer set for identifying Ziziphus jujuba or the above-mentioned composition for identifying Ziziphus jujuba.

[0048] In a preferred embodiment of the present invention, the composition for identifying Ziziphus jujuba or the kit may further include a probe for detecting the genetic marker for identifying Ziziphus jujuba of the present invention, but is not limited thereto.

[0049] In one embodiment, the probe of the present invention comprises: a pair of a first probe composed of the nucleotide sequence of SEQ ID NO. 8 and a second probe composed of the nucleotide sequence of SEQ ID NO. 9 for detecting a gene marker that is SEQ ID NO. 1 or a part thereof; a pair of a third probe composed of the nucleotide sequence of SEQ ID NO. 12 and a fourth probe composed of the nucleotide sequence of SEQ ID NO. 13 for detecting a gene marker that is SEQ ID NO. 2 or a part thereof; a pair of a fifth probe composed of the nucleotide sequence of SEQ ID NO. 16 and a sixth probe composed of the nucleotide sequence of SEQ ID NO. 17 for detecting a gene marker that is SEQ ID NO. 3 or a part thereof; and a pair of an eighth probe composed of the nucleotide sequence of SEQ ID NO. 20 and a nucleotide sequence of SEQ ID NO. 21 for detecting a gene marker that is SEQ ID NO. 4 or a part thereof. It may include one or more combinations selected from the group consisting of a pair of a ninth probe composed of the nucleotide sequence of SEQ ID NO. 24 and a tenth probe composed of the nucleotide sequence of SEQ ID NO. 25 for detecting a gene marker that is SEQ ID NO. 5 or a part thereof; preferably, it may include all of the five types of combinations, and more preferably, it may include all three types of combinations of the first to sixth probes.

[0050] The above pair of probes is intended to specifically detect different bases corresponding to Sanjoin, Myeonjoin, Jiguja, and Eunhaphwanja at the SNP location of the corresponding gene marker. For example, the first probe includes "FAM" within its sequence to detect C as the base corresponding to the 38th base corresponding to the SNP location of Sequence No. 1, and the second probe includes "HEX" within its sequence to detect T as the base corresponding to the 38th base corresponding to the SNP location of Sequence No. 1. Therefore, a person skilled in the art would understand that, as long as the probe pair for the gene marker of Sequence No. 1 includes different bases (i.e., "C" and "T") corresponding to the 38th base corresponding to the SNP location of Sequence No. 1, the base sequences of the first and second probes, i.e., Sequence No. 8 and Sequence No. 9, may differ. This may also apply equally to gene markers that are Sequence Nos. 2 to 5 or part thereof.

[0051] In one embodiment, the probe may be appropriately modified within a range where hybridization specificity is not impaired. For example, a reporter or a quencher may be attached to the end of the probe.

[0052] Fam or Hex may be attached to the 5' end of the probe as a reporter, and other fluorescent substances exhibiting fluorescence may be attached, but are not limited thereto. For example, the reporter may be one or more selected from the group consisting of Fam, Hex, Joe, fluorescein, fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethylrhodamine, FITC, Oregon green, Alexafluoro, ROX, Texas red, TET, TRITC, TAMRA, cyanine-based dyes, and cyanadicarbonin dyes.

[0053] BHQ-1 may be attached to the 3' end of the probe as a quencher, and other materials that can be used as a quencher may be attached, but are not limited thereto. For example, the quencher may be one or more selected from the group consisting of BHQ-1, BHQ-2, BH3-3, ROX, Dapsil, TAMRA, Eclipse, DDQ, QSY, BlackBerry Quencher, Qxl, Iowa Black FQ, Iowa Black RQ, and IRDye QC-1.

[0054] In one embodiment, a pair of probes for a specific gene marker may have different reporters attached to the ends of each probe. In a preferred embodiment, the pair of probes of SEQ ID NO. 8 and SEQ ID NO. 9 for the gene marker of SEQ ID NO. 1 may have Fam and Hex attached to their respective 5'-ends. In another preferred embodiment, the pair of probes of SEQ ID NO. 8 and SEQ ID NO. 9 for the gene marker of SEQ ID NO. 1 may have Hex and Fam attached to their respective 5'-ends. This may also apply equally to gene markers that are SEQ ID NO. 2 to SEQ ID NO. 5 or part thereof.

[0055] The kit of the present invention may additionally include other components in addition to the components described above. For example, when the kit of the present invention is applied to a PCR amplification process, the kit of the present invention may optionally include reagents necessary for PCR amplification, such as a buffer solution, DNA polymerase (e.g., Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus literalis or Pyrococcus furiosus It may include a heat-stable DNA polymerase obtained from (Pfu), a DNA polymerase cofactor, and dNTPs. The kit of the present invention may be manufactured into a plurality of separate packages containing the above-mentioned reagent components.

[0056] In addition, the present invention provides a method for identifying Ziziphus jujuba, comprising: 1) a step of preparing a mixture by mixing template DNA derived from a plant sample with the primer set; and 2) a step of forming an amplification product by PCR amplifying the mixture.

[0057] The above PCR refers to a process of amplifying a target nucleic acid by using a target nucleic acid as a template and primers specific to the target nucleic acid, and repeating the processes of denaturation, annealing, and extension reactions; it is the nucleic acid amplification method best known to those skilled in the art. Many variations and applications have been developed, for example, touchdown PCR, hot start PCR, nested PCR, and booster PCR, which modify the traditional PCR procedure to enhance the specificity or sensitivity of PCR. In addition, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction (IPCR), vectorette PCR, and TAIL-PCR (thermal asymmetric interlaced PCR) can be used for specific applications.

[0058] When performing the above PCR, the components necessary for the reaction may be provided in excess in the reaction vessel. The excess of the components necessary for the amplification reaction refers to an amount such that the amplification reaction is not substantially limited by the concentration of the components. Mg 2+Cofactors such as dATP, dCTP, dGTP, and dTTP can be provided to the reaction mixture in an amount such that the desired degree of amplification can be achieved. All enzymes used in the amplification reaction may be active under the same reaction conditions. A buffer can be prepared and added so that all enzymes are close to optimal reaction conditions.

[0059] The above method may further include a step of detecting or quantifying the amplification product after step 2). The detection or quantification of the amplification product may be performed through HRM analysis, DNA chip, gel electrophoresis, radiometric measurement, fluorescence measurement, or phosphorescence measurement.

[0060] In addition, gel electrophoresis can be performed using agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplified product.

[0061] In addition, the fluorescence measurement method involves labeling the 5'-terminus of a primer with a fluorescent substance and performing PCR, so that the target sequence is labeled with a detectable fluorescent label, and the fluorescence thus labeled can be measured using a fluorescence detector.

[0062] In addition, for radioactivity measurement, a radioisotope is added to the PCR reaction solution during PCR to label the amplification product, and then radioactivity can be measured using a radioactivity measuring instrument, such as a Geiger counter or a liquid scintillation counter.

[0063] In one embodiment of the present invention, when the specificity of the primers and probes was confirmed by real-time PCR using the first to ten primers and the first probe and the tenth probe, respectively, with DNA isolated from Ziziphus jujuba, Ziziphus jujuba, Ziziphus jujuba, and Ziziphus jujuba as a template, it was confirmed that each primer and probe pair exhibited a unique amplification and detection pattern specifically specific to Ziziphus jujuba, Ziziphus jujuba, Ziziphus jujuba, and Ziziphus jujuba for the gene markers of SEQ ID NOs 1 to 5 (see FIGS. 2 to 6).

[0064] Hereinafter, the present invention will be described in detail with reference to examples to aid in understanding. However, the following examples are merely illustrative of the content of the present invention and the scope of the present invention is not limited to the following examples.

[0065] Example 1. DNA extraction from a sample

[0066] The standard samples of Sanjoin and Myeonjoin used in the experiment were obtained from China, the standard sample of Jiguja was the Ministry of Food and Drug Safety standard sample (HODU2017), and the standard sample of Eunhaphwanja was collected directly from leaves in Sejong City.

[0067] DNA extraction was performed using the QIAamp PowerFecal Pro DNA kit (Qiagen, Germany). 150 mg of seed samples (5–6) were placed in a 2 mL Safe-Lock tube along with one 6.5 mm ceramic bead and 25–30 1.4 mm ceramic beads, followed by the addition of 800 µL of CD1 buffer. The samples were swollen at 900 rpm (Vortemp 56, Labnet International) for 10 minutes at 65°C. After grinding and homogenizing using TissueLyser II (Qiagen, Germany), the mixture was reacted again at 900 rpm (Vortemp 56, Labnet International) for 10 minutes at 65°C.

[0068] Subsequently, centrifuged for 5 minutes (11,000 xg) and transferred the supernatant to a new 2 ml tube. Centrifuged again for 2 minutes and transferred the supernatant to a new 2 ml tube. 200 µl of CD2 buffer (stored at 4°C) was added and mixed gently (Vortex 5 seconds). After centrifuging for 1 minute, the supernatant was transferred to a new 2 ml tube. 600 µl of CD3 buffer was added and mixed gently (Vortex 5 seconds). After centrifuging for 2 minutes, the supernatant was transferred to an MB column and centrifuged for 1 minute. The MB column was washed once with 500 µl of EA buffer. The MB column was washed once with 500 µl of C5 buffer. The MB column was rotated 180° and centrifuged for 2 minutes. After transferring the MB column to a new 1.5 ml tube, 30 µl of C6 buffer was added and the column was incubated at 65°C for 10 minutes, followed by centrifugation for 1 minute. The eluent was returned to the column and incubated at 65°C for 5 minutes, followed by centrifugation for 1 minute for final elution.

[0069] The absorbance of the isolated gene was measured using a spectrophotometer, and then A 260nm Assuming the gene concentration was 50 μg / ml when =1, the concentration and purity were calculated as follows.

[0070] 1) Gene concentration (µg / ml) = 50 µg / ml x A 260nm x Dilution factor

[0071] 2) A 260nm / A 230nm Genetic purity = 2.0 or higher (1.5 or higher is also acceptable)

[0072] 3) A 260nm / A 280nm Genetic purity = 1.8~1.9

[0073] In addition, the isolated genes were diluted to 20 ng / µl, and 5–20 µl were analyzed using an automated capillary electrophoresis system (Qsep400, BioD) to check the DNA status (see Fig. 1).

[0074] Example 2. Development of a genetic marker for the identification of Ziziphus jujuba.

[0075] After obtaining DNA base sequence information for each of the above samples, SNPs distinguishable from COI, the barcode gene of Sanjoin, Myeonjoin, Jiguja, and Eunhaphwanja, were selected by comparing and analyzing using the CLUSTALW program. Five SNP combinations capable of distinguishing Sanjoin from Sanjoin, Myeonjoin, Jiguja, and Eunhaphwanja samples were selected as suitable genetic markers for identifying Sanjoin (Table 1).

[0076] Sequence number Sequence List(5'->3') Allele Sequence No. 1 CTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTYTTTGAACGCAAGTTGCGCCCGAAGCC 38th position, Y = T / C Sequence No. 2 GGGCTAATTGGAACTAATGTATCAAGCTTCTTTATAGCATTATCCATTATAAATGAATTTTCTAGCATTTSACTCCGTACCACTGAAAGATTTAGTCGCACA 71st position, S=G / C Sequence No. 3 CCACTGAAAGATTTAGTCGCACACTTAAAAGATAGCCTAAAAAGCCGAARGAATGGTTGGCTAATTGGTTTATATAGATCC 50th position, R=A / G Sequence No. 4 CTTGGTGTGAATTGCAGAATCCCGTGAACCATCGARTCTTTGAACGCAAGTTGCGCCCGAAGCC 36th position, R=G / A Sequence No. 5 TTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTACACTCCTGAMTATGAAACCAAAGATACTGATATCTTGGCAGCGTTTC 53rd position, M=A / C

[0077] A primer pair that specifically amplifies the gene markers of SEQ ID NOs 1 to 5 containing this SNP location and a probe pair that can specifically detect them were designed. The primers and probes for these five gene markers were produced by Metabion (Germany).

[0078] Information regarding the above primers and probes is shown in Table 2.

[0079] SNP id nucleotide sequence Sequence number size Tm Length(bp) fluorescent marker note ZI_ITS-8 Forward direction CTTGGTGTGAATTGCAGAATCC 6 22 60 64 Fam: Myeonjoin, Eunhaphwanja Hex: Sanjoin reverse direction GGCTTCGGGCGCAACT 7 16 56 First probe TGAACCATCGAGT C TT 8 16 46 Fam 2nd probe TGAACCATCGAGT T TT 9 16 43 Hex ZI_matK-1 Forward direction GGGCTAATTGGAACTAATGTATCAA 10 25 61 102 Fam: Sanjoin, Jiguja Hex: Myeonjoin reverse direction TGTGCGACTAAATCTTTCAGTGGTA 11 25 63 First probe ATTTTCTAGCATTT G ACTCC 12 20 52 Fam 2nd probe AATTTTCTAGCATTT C ACTC 13 20 50 Hex ZI_matK-3 Forward direction CCACTGAAAGATTTAGTCGCACACT 14 25 64 81 Fam: Jiguja Hex: Sanjoin, Myeonjoin reverse direction GGATCTATATAAACCAATTAGCCAACCA 15 28 64 First probe CCTAAAAAGCCGAA G GA 16 17 50 Fam 2nd probe CCTAAAAAGCCGAA A GA 17 17 48 Hex ZI_ITS-7 Forward direction CTTGGTGTGAATTGCAGAATCC 18 22 60 64 Fam: Earthling Hex: Face Joiner, Silver Synthesis Case reverse direction GGCTTCGGGCGCAACT 19 16 56 First probe TGAACCATCGA A TCTT 20 16 43 Fam 2nd probe TGAACCATCGA G TCT 21 15 43 Hex ZI_rbcL-11 Forward direction TTGGATTCAAAGCCGGTGTT 22 20 56 90 Fam: Sanjoin Hex: Myeonjoin, Jiguja reverse direction GAAACGCTGCCAAGATATCAGTATC 23 25 64 First probe TTGACTTATTACACTCCTGA A TA 24 23 56 Fam 2nd probe TGACTTATTACACTCCTGA C TA 25 22 57 Hex

[0080] Example 3. Method for identifying Ziziphus jujuba by real-time PCR

[0081] The DNA of the sample obtained in Example 1 above was used as a template for real-time PCR. PCR products were obtained according to the conditions in Table 3 using the primer and probe pairs designed in Example 2 above.

[0082] PCR reaction conditions for 5 markers Real-time PCR 20 µl reaction solution Forward Primer 10 pmole (10μM stock, 1μL) Reverse Primer 10 pmole (10μM stock, 1μL) 1st probe 5 pmole (5μM stock, 1μL) 2nd probe 5 pmole (5μM stock, 1μL) Template DNA amount 40 ng (20 ng / µl, 2 µl) PCR temperature cycling 95℃, 3 min → [95℃, 10 sec → 60℃, 30 sec], repeat 40 times; for marker ZI_matK-3: 95℃, 3 min → [95℃, 10 sec → 64℃, 30 sec], repeat 40 times Probe detection conditions FAM, HEX fluorescence signal (no quencher) Manual reference doesn't exist reaction reagent qPCRBIO 2X probe mixture (50 nM ROX)

[0083] In Real-time PCR software (7500 Software v2.3, Applied Biosystems), the settings were configured as Plot type: △Rn vs Cycle, Graph Type: Linear, Threshold: Auto, Auto Baseline). For each reaction, the detection of Fam and Hex wavelength signals was verified, and C TIf the value did not exceed 34, it was determined to be amplified.

[0084] As a result, it was confirmed that the pairs of primers and probes specific to SEQ ID NOs 1 to 5 designed in Example 2 could specifically amplify and detect samples corresponding to each SNP location (Figs. 2 to 6). The method for identifying Ziziphus jujuba based on the real-time PCR results is summarized as follows.

[0085] In marker ZI_ITS-8, Sanjoin is amplified only in probes bound to a Hex fluorescence reporter, while Myeonjoin and Eunhaphwanja are amplified only in probes bound to a Fam fluorescence reporter. In marker ZI_matK-1, Sanjoin and Jiguja are amplified only in probes bound to a Fam fluorescence reporter, while Myeonjoin is amplified only in probes bound to a Hex fluorescence reporter. In marker ZI_matK-3, Sanjoin and Myeonjoin are amplified only in probes bound to a Hex fluorescence reporter, while Jiguja is amplified only in probes bound to a Fam fluorescence reporter; thus, Sanjoin can be clearly distinguished among Sanjoin, Myeonjoin, Jiguja, and Eunhaphwanja. The distinguishable combinations and fluorescence signals of the Sanjoin, Myeonjoin, Jiguja, and Eunhaphwanja samples used in this example are summarized and shown in Figure 7.

Claims

Claim 1 A sanjoin (composed of a primer pair for amplifying a gene marker comprising at least one selected from the group consisting of: a polynucleotide comprising eight or more consecutive nucleotides including one or more SNP locations selected from the group consisting of the 38th single nucleotide polymorphism (SNP) location of the nucleotide sequence of SEQ ID NO. 1, the 71st SNP location of the nucleotide sequence of SEQ ID NO. 2, the 50th SNP location of the nucleotide sequence of SEQ ID NO. 3, the 36th SNP location of the nucleotide sequence of SEQ ID NO. 4, and the 53rd SNP location of the nucleotide sequence of SEQ ID NO. 5; and a polynucleotide complementary to said polynucleotide. Ziziphus jujuba var. spinosa Primer set for identifying ). Claim 2 A primer set for identifying Ziziphus jujuba, wherein the gene marker is for distinguishing Ziziphus jujuba from Ziziphus jujuba, Ziziphus jujuba, and Ziziphus jujuba. Claim 3 delete Claim 4 delete Claim 5 In claim 1, the primer pair comprises: i) a pair of a first primer composed of the nucleotide sequence of SEQ ID NO. 6 and a second primer composed of the nucleotide sequence of SEQ ID NO. 7 for amplifying a gene marker comprising the 38th SNP position of the nucleotide sequence of SEQ ID NO. 1; ii) a pair of a third primer composed of the nucleotide sequence of SEQ ID NO. 10 and a fourth primer composed of the nucleotide sequence of SEQ ID NO. 11 for amplifying a gene marker comprising the 71st SNP position of the nucleotide sequence of SEQ ID NO. 2; iii) a pair of a fifth primer composed of the nucleotide sequence of SEQ ID NO. 14 and a sixth primer composed of the nucleotide sequence of SEQ ID NO. 15 for amplifying a gene marker comprising the 50th SNP position of the nucleotide sequence of SEQ ID NO. 3; iv) a pair of a seventh primer composed of the nucleotide sequence of SEQ ID NO. 18 and an eighth primer composed of the nucleotide sequence of SEQ ID NO. 19 for amplifying a gene marker comprising the 36th SNP position of the nucleotide sequence of SEQ ID NO. 4; A primer set for identifying Ziziphus jujuba, comprising at least one selected from the group consisting of: v) a ninth primer composed of the nucleotide sequence of SEQ ID NO. 22 and a tenth primer composed of the nucleotide sequence of SEQ ID NO. 23 for amplifying a gene marker including the 53rd SNP position of the nucleotide sequence of SEQ ID NO.

5. Claim 6 A PCR composition for identifying Ziziphus jujuba, comprising: a polynucleotide consisting of eight or more consecutive nucleotides including one or more SNP locations selected from the group consisting of the 38th single nucleotide polymorphism (SNP) location of the nucleotide sequence of SEQ ID NO. 1, the 71st SNP location of the nucleotide sequence of SEQ ID NO. 2, the 50th SNP location of the nucleotide sequence of SEQ ID NO. 3, the 36th SNP location of the nucleotide sequence of SEQ ID NO. 4, and the 53rd SNP location of the nucleotide sequence of SEQ ID NO. 5; a primer pair for amplifying a gene marker selected from the group consisting of at least one polynucleotide complementary to the polynucleotide; and a probe pair for detecting a single nucleotide polymorphism (SNP) in the gene marker amplified by the primer pair. Claim 7 In claim 6, the primer pair comprises: i) a pair of a first primer composed of the nucleotide sequence of SEQ ID NO. 6 and a second primer composed of the nucleotide sequence of SEQ ID NO. 7 for amplifying a gene marker comprising the 38th SNP position of the nucleotide sequence of SEQ ID NO. 1; ii) a pair of a third primer composed of the nucleotide sequence of SEQ ID NO. 10 and a fourth primer composed of the nucleotide sequence of SEQ ID NO. 11 for amplifying a gene marker comprising the 71st SNP position of the nucleotide sequence of SEQ ID NO. 2; iii) a pair of a fifth primer composed of the nucleotide sequence of SEQ ID NO. 14 and a sixth primer composed of the nucleotide sequence of SEQ ID NO. 15 for amplifying a gene marker comprising the 50th SNP position of the nucleotide sequence of SEQ ID NO. 3; iv) a pair of a seventh primer composed of the nucleotide sequence of SEQ ID NO. 18 and an eighth primer composed of the nucleotide sequence of SEQ ID NO. 19 for amplifying a gene marker comprising the 36th SNP position of the nucleotide sequence of SEQ ID NO. 4; and at least one selected from the group consisting of v) a ninth primer composed of the nucleotide sequence of SEQ ID NO. 22 and a tenth primer composed of the nucleotide sequence of SEQ ID NO. 23 for amplifying a gene marker including the 53rd SNP position of the nucleotide sequence of SEQ ID NO. 5; and said probe pair is i) a first probe composed of the nucleotide sequence of SEQ ID NO. 8 and a second probe composed of the nucleotide sequence of SEQ ID NO. 9 for detecting a gene marker including the 38th SNP position of the nucleotide sequence of SEQ ID NO. 1; ii) a third probe composed of the nucleotide sequence of SEQ ID NO. 12 and a fourth probe composed of the nucleotide sequence of SEQ ID NO. 13 for detecting a gene marker including the 71st SNP position of the nucleotide sequence of SEQ ID NO. 2; iii) a fifth probe composed of the nucleotide sequence of SEQ ID NO. 16 and a sixth probe composed of the nucleotide sequence of SEQ ID NO. 17 for detecting a gene marker including the 50th SNP position of the nucleotide sequence of SEQ ID NO. 3;iv) a pair of a seventh probe composed of the nucleotide sequence of SEQ ID NO. 20 and an eighth probe composed of the nucleotide sequence of SEQ ID NO. 21 for detecting a gene marker including the 36th SNP position of the nucleotide sequence of SEQ ID NO. 4; and v) a pair of a ninth probe composed of the nucleotide sequence of SEQ ID NO. 24 and a tenth probe composed of the nucleotide sequence of SEQ ID NO. 25 for detecting a gene marker including the 53rd SNP position of the nucleotide sequence of SEQ ID NO. 5; a PCR composition for identifying Ziziphus jujuba, selected from the group consisting of at least one of the above. Claim 8 A PCR composition for identifying Ziziphus jujuba according to claim 7, wherein the primer pair comprises a pair of a first primer and a second primer; a pair of a third primer and a fourth primer; and a pair of a fifth primer and a sixth primer. Claim 9 A PCR composition for identifying Ziziphus jujuba according to claim 6, wherein different reporters are bound to pairs of probes for each gene marker. Claim 10 A PCR composition for identifying Ziziphus jujuba, wherein the reporter is selected from the group consisting of Hex, Joe, Fam, fluorescein, fluorescein chlorotriazinyl, Rhodamine Green, Rhodamine Red, tetramethylrhodamine, FITC, Oregon Green, Alexafluoro, ROX, Texas Red, TET, TRITC, TAMRA, cyanine-based dyes, and cyanodicarbonine dyes. Claim 11 A PCR composition for identifying Ziziphus jujuba according to claim 6, wherein a reporter is attached to the 5' end of the probe or a quencher is attached to the 3' end of the probe. Claim 12 The PCR composition for identifying Ziziphus jujuba according to claim 11, wherein the quencher is selected from the group consisting of BHQ-1, BHQ-2, BH3-3, ROX, Dapsil, TAMRA, Eclipse, DDQ, QSY, BlackBerry Quencher, Qxl, Iowa Black FQ, Iowa Black RQ, and IRDye QC-1. Claim 13 A kit for identifying Sanjoin comprising a primer set of any one of claims 1, 2 and 5. Claim 14 A kit for identifying Ziziphus jujuba, comprising a PCR composition of any one of claims 6 to 12. Claim 15 A method for identifying Ziziphus jujuba, comprising: 1) a step of preparing a mixture by mixing template DNA derived from a plant sample with a PCR composition of any one of claims 6 to 12; and 2) a step of PCR amplifying the mixture to form an amplified product. Claim 16 A method for identifying Sanjoin according to claim 15, further comprising: 3) a step of detecting or quantifying the amplified product. Claim 17 A method for distinguishing Sanjoin from Myeonjoin, Jiguja, and Eunhaphwanja in claim 15.

Images