Genetic Marker Having Single Nucleotide Polymorphism For Distinguishing Pseudosasa japonica Makino Or Pseudosasa japonica Makino var. pupurascens

Abstract

The present invention relates to a gene marker having a single nucleotide polymorphism (SNP) that can be usefully used to distinguish between *Bamboo scaber* and *Bamboo japonica*, a primer set for distinguishing between *Bamboo scaber* and *Bamboo japonica* using said marker, a PCR composition or kit comprising said primer set, and a method for distinguishing between *Bamboo scaber* and *Bamboo japonica* using said primer set. According to the present invention, *Bamboo scaber* or *Bamboo japonica* can be easily distinguished from similar counterfeit products such as giant bamboo, bamboo shoots, rhododendron, soft bamboo, black bamboo, sea bamboo, dwarf bamboo, sasa bamboo, island bamboo, Jeju sasa bamboo, island sasa bamboo, *Bamboo scaber*, *Bamboo shoots*, and *Sasa bamboo* (Damjukyeop).

Description

Technology Field

[0001] The present invention relates to a gene marker having a single nucleotide polymorphism for distinguishing between a minor and a minor, a primer set, a composition, a kit, and a method for distinguishing between a minor and a minor using the same. Background Technology

[0002] Bamboo is a monocotyledonous plant that has been used as a useful plant for humans for thousands of years. According to the *Donguibogam*, *Bencao Gangmu*, and *Shen Nong Ben Cao Jing*, bamboo has excellent effects in treating stroke and hypertension. In particular, bamboo leaves have been used for thirst caused by pneumonia and bronchitis for purposes such as fever reduction, expectoration, and cooling. Recent reports indicate that it is also used in the treatment of hypertension, atherosclerosis, and cardiovascular diseases, and is introduced as a crop beneficial for anticancer and anti-aging effects. Therefore, research is continuously being conducted on pharmaceutical compositions, as well as cosmetic compositions and functional food compositions utilizing bamboo leaves (Patent Document 1).

[0003] The bamboo subfamily includes the genus *Giant bamboo* ( Phyllostachys ), inside the hangover porridge ( Arundinaria ), Lee Dae-sok( Pseudosasa ), genus Sasa ( Sasa There are four genera, and the bamboo leaf, which is recorded in the Korean Pharmacopoeia and the Standards for Herbal Medicine (Crude Drug), is the above-ground part of the bamboo grass of the reed subfamily before flowering and can be used only as a herbal medicine (crude drug) and not as a food.

[0004] Ewha ( Pseudosasa japonica Makino) or Jajuidae ( Pseudosasa japonica Makino var. pupurascens ) is a plant of the genus *Idae* in the subfamily Bamboo that is readily available and usable for food, and it is difficult to distinguish it from other plants of the subfamily Bamboo, including *Sasa borealis* (Sasa borealis) in the subfamily Reed, based on its appearance alone. Therefore, research is being conducted on methods to genetically distinguish between *Idae* and *Idae*.

[0005] The inventors of the present invention have investigated a method to distinguish between *Idae* or *Jajudae* from similar counterfeit products such as giant bamboo, bamboo shoots, rhododendron, cotton bamboo, black bamboo, sea bamboo, dwarf bamboo, island bamboo, Jeju island bamboo, island island bamboo, *Gatdae*, *Gwonmun*, and *Sasa* (Damjukyeop). They identified a Single Nucleotide Polymorphism (SNP) in the barcode gene COI (Cytochrome c oxidase subunit I) that can distinguish between *Idae* or *Jajudae* from similar counterfeit products, and confirmed that *Idae* or *Jajudae* can be easily distinguished by a combination of six types of primers and probes specific to each sample, thereby completing the present invention. Prior art literature

[0006] Republic of Korea Published Patent Application No. 10-2017-0118429 (October 25, 2017) The problem to be solved

[0007] The present invention aims to provide a genetic marker, composition, primer set, or kit capable of distinguishing between *Leontopodium vitis-idaea* and *Leontopodium citrina* from similar counterfeit products of *Leontopodium vitis-idaea* or *Leontopodium citrina*, such as giant bamboo, bamboo shoot bamboo, rhododendron, cotton bamboo, black bamboo, sea bamboo, dwarf bamboo, island bamboo, Jeju dwarf bamboo, island dwarf bamboo, *Leontopodium vitis-idaea*, *Leontopodium clavatum*, and *Leontopodium clavatum* (Damjukyeop).

[0008] In addition, the present invention aims to provide a method for distinguishing between *Leontopodium vulgaris* and *Leontopodium citrina* using a genetic marker, composition, primer set, or kit that can distinguish between *Leontopodium vulgaris* and *Leontopodium citrina* from similar counterfeit products of *Leontopodium vulgaris* or *Leontopodium citrina*, such as giant bamboo, bamboo shoot bamboo, rhododendron, cotton bamboo, black bamboo, sea bamboo, dwarf bamboo, island bamboo, Jeju dwarf bamboo, island dwarf bamboo, *Leontopodium clavatum*, and *Leontopodium clavatum* (Damjukyeop). means of solving the problem

[0009] One aspect of the present invention comprises a polynucleotide comprising at least one selected from the group consisting of: a polynucleotide comprising eight or more consecutive nucleotides including one or more SNP locations selected from the group consisting of the 29th single nucleotide polymorphism (SNP) location of the nucleotide sequence of SEQ ID NO. 1, the 72nd and 75th SNP locations of the nucleotide sequence of SEQ ID NO. 2, the 69th SNP location of the nucleotide sequence of SEQ ID NO. 3, the 28th SNP location of the nucleotide sequence of SEQ ID NO. 4, the 50th SNP location of the nucleotide sequence of SEQ ID NO. 5, and the 66th SNP location of the nucleotide sequence of SEQ ID NO. 6; and a polynucleotide complementary to the polynucleotide. Pseudosasa japonica Makino) or Jajuidae ( Pseudosasa japonica Makino var. pupurascens Provides a genetic marker for the identification of ).

[0010] In one embodiment, the gene marker is intended to distinguish between *Lee Dae* or *Jaju Lee Dae* from *Gwangdae*, *Juksundae*, *Noejuk*, *Somdae*, *Ojuk*, *Haejangdae*, *Sasa*, *Seomdae*, *Jeju Sasa*, *Seom Sasa*, *Gatdae*, *Gwonmundae*, and *Sasa* (Damjukyeop), but is not limited thereto.

[0011] Another aspect of the present invention provides a primer set for distinguishing between two-generation or frequent two-generation, comprising a primer pair for binding to and amplifying a gene marker as described above.

[0012] In one embodiment, the primer pair may amplify the gene marker by binding to one or more polynucleotides of SEQ ID NOs 1 to 6 and their complementary base sequences, but is not limited thereto.

[0013] In a preferred embodiment, the primer pair comprises: i) a pair of a first primer composed of the nucleotide sequence of SEQ ID NO. 7 and a second primer composed of the nucleotide sequence of SEQ ID NO. 8 for amplifying a gene marker comprising the 29th SNP position of the nucleotide sequence of SEQ ID NO. 1; ii) a pair of a third primer composed of the nucleotide sequence of SEQ ID NO. 11 and a fourth primer composed of the nucleotide sequence of SEQ ID NO. 12 for amplifying a gene marker comprising the 72nd and 75th SNP positions of the nucleotide sequence of SEQ ID NO. 2; iii) a pair of a fifth primer composed of the nucleotide sequence of SEQ ID NO. 15 and a sixth primer composed of the nucleotide sequence of SEQ ID NO. 16 for amplifying a gene marker comprising the 69th SNP position of the nucleotide sequence of SEQ ID NO. 3; iv) a pair of a seventh primer composed of the nucleotide sequence of SEQ ID NO. 19 and an eighth primer composed of the nucleotide sequence of SEQ ID NO. 20 for amplifying a gene marker comprising the 28th SNP position of the nucleotide sequence of SEQ ID NO. 4; v) a pair of ninth primers composed of the nucleotide sequence of SEQ ID NO. 23 and tenth primers composed of the nucleotide sequence of SEQ ID NO. 24 for amplifying a gene marker including the 50th SNP position of the nucleotide sequence of SEQ ID NO. 5; and vi) a pair of twelfth primers composed of the nucleotide sequence of SEQ ID NO. 27 and the nucleotide sequence of SEQ ID NO. 28 for amplifying a gene marker including the 66th SNP position of the nucleotide sequence of SEQ ID NO. 6; may include at least one selected from the group consisting of these, but is not limited thereto. In a preferred embodiment, the primer set may include all of the aforementioned first to twelfth primers, and in a more preferred embodiment, the primer set may include all of the aforementioned first to sixth primers, but is not limited thereto.

[0014] Another aspect of the present invention provides a PCR composition for determining a minor or minor genus comprising a primer set of the present invention, or a kit for determining a minor or minor genus comprising a primer set or a PCR composition of the present invention.

[0015] In one embodiment, the PCR composition and kit of the present invention may further include a probe that specifically binds to a gene marker for distinguishing between a minor or a minor.

[0016] In a preferred embodiment, the probe may have a reporter attached to the 5' end or a quencher attached to the 3' end, but is not limited thereto.

[0017] In a preferred embodiment, the PCR composition or kit comprises: i) a pair of a first probe composed of the nucleotide sequence of SEQ ID NO. 9 and a second probe composed of the nucleotide sequence of SEQ ID NO. 10 for detecting a gene marker comprising the 29th SNP position of the nucleotide sequence of SEQ ID NO. 1; ii) a pair of a third probe composed of the nucleotide sequence of SEQ ID NO. 13 and a fourth probe composed of the nucleotide sequence of SEQ ID NO. 14 for detecting a gene marker comprising the 72nd and 75th SNP positions of the nucleotide sequence of SEQ ID NO. 2; iii) a pair of a fifth probe composed of the nucleotide sequence of SEQ ID NO. 17 and a sixth probe composed of the nucleotide sequence of SEQ ID NO. 18 for detecting a gene marker comprising the 69th SNP position of the nucleotide sequence of SEQ ID NO. 3; iv) a pair of a seventh probe composed of the nucleotide sequence of SEQ ID NO. 21 and an eighth probe composed of the nucleotide sequence of SEQ ID NO. 22 for detecting a gene marker comprising the 28th SNP position of the nucleotide sequence of SEQ ID NO. 4; v) a pair of a ninth probe composed of the nucleotide sequence of SEQ ID NO. 25 and a tenth probe composed of the nucleotide sequence of SEQ ID NO. 26 for detecting a gene marker including the 50th SNP position of the nucleotide sequence of SEQ ID NO. 5; and vi) a pair of a eleventh probe composed of the nucleotide sequence of SEQ ID NO. 29 and a twelveth probe composed of the nucleotide sequence of SEQ ID NO. 30 for detecting a gene marker including the 66th SNP position of the nucleotide sequence of SEQ ID NO. 6; at least one selected from the group consisting of these may be included, but is not limited thereto. In a preferred embodiment, the PCR composition or kit comprises all of the aforementioned first to twelfth probes, and in a more preferred embodiment, the PCR composition or kit may comprise all of the aforementioned first to sixth probes, but is not limited thereto.

[0018] In a more preferred embodiment, different reporters may be attached to the pair of probes for each gene marker, but are not limited thereto.

[0019] In one embodiment, the reporter may be, but is not limited to, Hex, Joe, Fam, fluorescein, fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethylrhodamine, FITC, Oregon green, alexa Fluor, ROX (carboxy-X-rhodamine), Texas Red, TET, TRITC, TAMRA, cyanine-based dyes, thiadicarbocyanine dyes, etc.

[0020] In another embodiment, the quencher may be Black Hole Quencher-1 (BHQ-1), BHQ-2, BH3-3, ROX, Dabcyl, TAMRA, Eclipse, DDQ, QSY, Blackberry Quencher, Qxl, Iowa Black FQ, Iowa Black RQ, or IRDye QC-1, but is not limited thereto.

[0021] Another aspect of the present invention provides a method for determining whether a genus or a genus has a mixture, comprising: 1) mixing a template DNA derived from a plant sample with the aforementioned PCR composition to prepare a mixture; and 2) PCR amplifying the resulting mixture to form an amplified product.

[0022] In a preferred embodiment, the above distinction is intended to distinguish between giant bamboo or purple bamboo and giant bamboo, bamboo shoot bamboo, rhododendron, cotton bamboo, black bamboo, sea bamboo, dwarf bamboo, island bamboo, Jeju dwarf bamboo, island dwarf bamboo, gatdae, kwonmun bamboo, and dwarf bamboo grass (damjukyeop), but is not limited thereto. Effects of the invention

[0023] According to the gene marker having a single nucleotide polymorphism of the present invention, a primer set for amplifying the gene marker, a composition, a kit, and a method for identification using the same, it is possible to easily distinguish between *Idae* or *Jaju Idae* from similar counterfeit products such as *Gwangdae*, *Juksundae*, *Noejuk*, *Somae*, *Ojuk*, *Haejangdae*, *Sasa*, *Seomdae*, *Jeju Sasa*, *Seom Sasa*, *Gatdae*, *Gwonmundae*, and *Sasa* (Damjukyeop). Brief explanation of the drawing

[0024] Figure 1 is a photograph and graph showing the results of DNA extraction from samples of 14 species of the bamboo subfamily (Bamboo, Purple Bamboo, Giant Bamboo, Bamboo Shoot Bamboo, Bamboo Shoot Bamboo, Bamboo Soft Bamboo, Black Bamboo, Haejang Bamboo, Sasa Bamboo, Island Bamboo, Jeju Sasa Bamboo, Island Sasa Bamboo, Gatdae, Gwonmun Bamboo) and 1 species of the reed subfamily Sasa Bamboo (Damjukyeop). Figures 2 to 7 are graphs showing that, as a result of real-time PCR analysis using pairs of primers and probes for the gene markers of SEQ ID NOs 1 to 6, either *Idae* or *Jajudae* can be distinguished among a total of 15 species (*Idae*, *Jajudae*, *Gwangdae*, *Juksundae*, *Noebuk*, *Somdae*, *Ojuk*, *Haejangdae*, *Joritdae*, *Seomdae*, *Jejujoritdae*, *Seomjoritdae*, *Gatdae*, *Gwonmundae*, and *Joritdae* (Damjukyeop). Figure 8 summarizes the SNP combinations and fluorescence signals that can distinguish between *Euonymus japonicus* or *Euonymus japonicus* among a total of 15 samples (*Euonymus japonicus*, *Euonymus fortunei*, *Phyllostachys bambusoides*, *Phyllostachys macrophyllus and *Phyllostachys macrophyllus* (*Phyllostachys macrophyllus*). Specific details for implementing the invention

[0025] First, the terms used in the present invention will be explained.

[0026] In this specification, the term “nucleotide” is a deoxyribonucleotide or ribonucleotide existing in a single-stranded or double-stranded form, and is used to include, without limitation, analogs of natural nucleotides unless otherwise specifically stated.

[0027] As used herein, the term "complementary" means sufficiently complementary to the extent that a primer or probe selectively hybridizes to a target nucleic acid sequence under certain annealing or hybridization conditions, and encompasses both substantially complementary and perfectly complementary, preferably meaning perfectly complementary.

[0028] The term "specific" as used in this specification means that each primer or probe of the present invention specifically binds only to the genetic marker of one or more target samples selected from giant bamboo, bamboo shoot bamboo, bamboo shoot bamboo, soft bamboo, black bamboo, sea bamboo, dwarf bamboo, island bamboo, Jeju dwarf bamboo, island dwarf bamboo, mustard bamboo, turban bamboo, and bamboo grass (damp bamboo leaves).

[0029] As used herein, the term "primer" refers to a single-stranded oligonucleotide sequence complementary to the nucleic acid strand to be copied, which can serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primer are designed to allow the initiation of the synthesis of the extension product. The specific length and sequence of the primer may be determined by the complexity of the required DNA or RNA target, as well as primer usage conditions such as temperature and ionic strength.

[0030] In this specification, the term “probe” means a natural or modified monomer or a linear oligomer having a bond comprising a deoxyribonucleotide and a ribonucleotide that can hybridize to a specific nucleotide sequence. Preferably, the probe is single-stranded for maximum efficiency in hybridization. The probe is preferably a deoxyribonucleotide. As a probe used in the present invention, a sequence that is completely complementary to the sequence containing the SNP may be used, but a substantially complementary sequence may also be used to the extent that it does not interfere with specific hybridization.

[0031] As used herein, the term "PCR" refers to a process of amplifying a target nucleic acid by using the target nucleic acid as a template and using primers specific to the target nucleic acid, and repeating the processes of denaturation, annealing, and extension reactions.

[0032] The present invention will be described in detail below.

[0033] The present invention provides a gene marker for distinguishing between two generations or frequently two generations, comprising at least one selected from the group consisting of: a polynucleotide comprising eight or more consecutive nucleotides including one or more SNP positions selected from the group consisting of the 29th single nucleotide polymorphism (SNP) position of the nucleotide sequence of SEQ ID NO. 1, the 72nd and 75th SNP positions of the nucleotide sequence of SEQ ID NO. 2, the 69th SNP position of the nucleotide sequence of SEQ ID NO. 3, the 28th SNP position of the nucleotide sequence of SEQ ID NO. 4, the 50th SNP position of the nucleotide sequence of SEQ ID NO. 5, and the 66th SNP position of the nucleotide sequence of SEQ ID NO. 6; and a polynucleotide complementary to the polynucleotide.

[0034] In one embodiment, the gene marker may be used to distinguish between *Lee Dae* or *Jaju Lee Dae* from *Gwangdae*, *Juksundae*, *Noejuk*, *Somdae*, *Ojuk*, *Haejangdae*, *Sasa*, *Seomdae*, *Jeju Sasa*, *Seom Sasa*, *Gatdae*, *Gwonmundae*, and *Sasa* (Damjukyeop), but is not limited thereto.

[0035] In one embodiment, the gene marker of the present invention comprises 8 to 170, e.g., 8 to 150, preferably 8 to 100, 8 to 60, 18 to 50, 18 to 30, or 18 to 24, or 8 to 24 consecutive polynucleotides, comprising the 29th nucleotide which is an SNP site as part of the 1st to 144th polynucleotides of the base sequence of SEQ ID NO. 1, preferably the 22nd to 119th polynucleotides; 8 to 170, e.g., 8 to 150, preferably 8 to 100, 8 to 60, 18 to 50, 18 to 30, or 18 to 24, or 8 to 24 consecutive polynucleotides comprising the 72nd or 75th nucleotide which is an SNP site as part of the 1st to 102nd polynucleotides of the base sequence of SEQ ID NO. 2, preferably the 25th to 81st polynucleotides; 8 to 170, e.g., 8 to 150, preferably 8 to 100, 8 to 60, 18 to 50, 18 to 30, or 18 to 24, or 8 to 24 consecutive polynucleotides comprising the 69th nucleotide, which is an SNP position, as part of the 1st to 105th polynucleotides of the base sequence of SEQ ID NO. 3, preferably the 20th to 84th polynucleotides; 8 to 170, e.g., 8 to 150, preferably 8 to 100, 8 to 60, 18 to 50, 18 to 30, or 18 to 24, or 8 to 24 consecutive polynucleotides comprising the 28th nucleotide which is an SNP site as part of the 1st to 100th polynucleotides of the base sequence of SEQ ID NO. 4, preferably the 20th to 84th polynucleotides;8 to 170, e.g., 8 to 150, preferably 8 to 100, 8 to 60, 18 to 50, 18 to 30, or 18 to 24, or 8 to 24 consecutive polynucleotides comprising the 50th nucleotide which is an SNP site as part of the 1st to 81st polynucleotides of the base sequence of SEQ ID NO. 5, preferably the 23rd to 57th polynucleotides; and may be one or more polynucleotides selected from the group consisting of 8 to 170, e.g. 8 to 150, preferably 8 to 100, 8 to 60, 18 to 50, 18 to 30, or 18 to 24, or 8 to 24 consecutive polynucleotides comprising the 66th nucleotide which is an SNP position as part of the 1st to 110th polynucleotides of the base sequence of SEQ ID NO. 6.;

[0036] In a preferred embodiment, the gene marker of the present invention may be one or more polynucleotides selected from the group consisting of: a polynucleotide consisting of consecutive nucleotides at positions 1 to 144 of the base sequence of SEQ ID NO. 1; a polynucleotide consisting of consecutive nucleotides at positions 1 to 102 of the base sequence of SEQ ID NO. 2; a polynucleotide consisting of consecutive nucleotides at positions 1 to 105 of the base sequence of SEQ ID NO. 3; a polynucleotide consisting of consecutive nucleotides at positions 1 to 100 of the base sequence of SEQ ID NO. 4; a polynucleotide consisting of consecutive nucleotides at positions 1 to 81 of the base sequence of SEQ ID NO. 5; and a polynucleotide consisting of consecutive nucleotides at positions 1 to 110 of the base sequence of SEQ ID NO. 6; and preferably, the gene marker of the present invention may include all of these six types of polynucleotides. More preferably, the gene marker of the present invention may be one or more polynucleotides selected from the group consisting of: a polynucleotide consisting of consecutive nucleotides at positions 12 to 129 of the base sequence of SEQ ID NO. 1; a polynucleotide consisting of consecutive nucleotides at positions 15 to 91 of the base sequence of SEQ ID NO. 2; a polynucleotide consisting of consecutive nucleotides at positions 10 to 94 of the base sequence of SEQ ID NO. 3; a polynucleotide consisting of consecutive nucleotides at positions 10 to 94 of the base sequence of SEQ ID NO. 4; a polynucleotide consisting of consecutive nucleotides at positions 13 to 67 of the base sequence of SEQ ID NO. 5; and a polynucleotide consisting of consecutive nucleotides at positions 18 to 96 of the base sequence of SEQ ID NO. 6.

[0037] The SNP of the present invention is a very stable genetic marker that can be directly used to distinguish between *Lee Dae* or *Jaju Lee Dae* from similar counterfeit products such as *Gwangdae*, *Juksundae*, *Noejuk*, *Somae*, *Ojuk*, *Haejangdae*, *Joritdae*, *Seomdae*, *Jeju Joritdae*, *Seom Joritdae*, *Gatdae*, *Gwonmundae*, and *Joritdae* (Damjukyeop). The fact that the SNP marker of the present invention can be used to distinguish between heterozygous and zygozygous is based on the fact that, depending on each sample, the 29th base, which is the SNP variant location in the base sequence indicated by SEQ ID NO. 1, is different as C or T, the 72nd and 75th bases, which are the SNP variant locations in the base sequence indicated by SEQ ID NO. 2, are different as A or C and G or A, respectively, the 69th base, which is the SNP variant location in the base sequence indicated by SEQ ID NO. 3, is different as G or C, the 28th base, which is the SNP variant location in the base sequence indicated by SEQ ID NO. 4, is different as A or G, the 50th base, which is the SNP variant location in the base sequence indicated by SEQ ID NO. 5, is different as A or G, and the 66th base, which is the SNP variant location in the base sequence indicated by SEQ ID NO. 6, is different as G or A.

[0038] For example, among the nucleotide sequences indicated by SEQ ID NO. 1, the 29th base, which is the SNP variant site, is C for *Phyllostachys macrophylla*, *Sasa borealis*, *Sasa japonica*, *Sasa punctata*, *Sasa rugosa*, *Sasa japonica var. japonica*, and *Sasa japonica var. jejuensis*, *Sasa japonica* inland, *Sasa borealis*, *Sasa borealis*, *Sasa borealis*, *Sasa borealis*, and *Sasa borealis* purpleis; and among the nucleotide sequences indicated by SEQ ID NO. 2, the 72nd and 75th bases, which are the SNP variant sites, are A and G for *Sasa borealis* inland, *Sasa borealis*, *Sasa borealis*, and *Sasa borealis*, and are C and A for *Sasa borealis*, *Sasa borealis*, *Sasa borealis*, *Sasa borealis* purpleis, *Phyllostachys macrophylla*, *Sasa borealis*, *Sasa borealis*, and *Sasa borealis*, and among the nucleotide sequences indicated by SEQ ID NO. 3, the 69th base, which is the SNP variant site, is G for *Sasa borealis*, *Sasa borealis*, and *Sasa borealis*, and *Sasa borealis* inland, The 28th base, which is the SNP mutation site in the base sequence indicated by SEQ ID NO. 4, is different as C for *Sasa japonica*, *Ojuk*, *Idae*, *Jajuk*, and *Sasa pumila* (Damjukyeop), and is different as G for *Gwangdae*, *Juksundae*, *Raejuk*, *Sasa japonica*, *Sasa japonica*, *Sasa pumila*, *Sasa pumila*, *Sasa jejuensis*, *Sasa pumila Since bamboo shoots, bamboo shoots, Jeju bamboo, island bamboo, gaddae, Gwonmun bamboo, Haejang bamboo, bamboo, island bamboo, Idae, purple Idae, and Sasa borealis (damjukyeop) exhibit different nucleotide polymorphisms as A, Idae or purple Idae can be clearly distinguished from giant bamboo, bamboo shoots, bamboo shoots, soft bamboo, black bamboo, Haejang bamboo, Sasa borealis, island bamboo, Jeju bamboo, island bamboo, gaddae, Gwonmun bamboo, and Sasa borealis (damjukyeop) by confirming the nucleotide sequences at the above SNP variant positions.

[0039] The present invention relates to a base variant at a corresponding SNP location in one or more polynucleotides or parts thereof among the sequences of SEQ ID NOs. 1 to 6, but when such SNP base variant is found in double-stranded gDNA (genomic DNA), it is interpreted to include a polynucleotide sequence complementary to the nucleotide sequence. Accordingly, the base at the SNP location in the complementary polynucleotide sequence also becomes a complementary base. In this regard, all sequences presented herein are based on sequences in the sense strand of genomic DNA unless otherwise noted.

[0040] In addition, the present invention provides a single nucleotide polymorphism marker composition, a primer set, a probe, and a kit capable of distinguishing between two generations or multiple generations using the gene marker having a single nucleotide polymorphism.

[0041] Specifically, the present invention provides a primer set for distinguishing between two-generation or frequent-generation, comprising a primer pair for amplifying a gene marker for distinguishing between two-generation or frequent-generation as described above.

[0042] In the present invention, the primer pairs each comprise, without limitation, any polynucleotide sequence capable of amplifying a gene marker for distinguishing between two generations or frequently two generations by binding to one or more polynucleotides of SEQ ID NOs 1 to 6 and their complementary base sequences.

[0043] In one embodiment, the primer pair of the present invention comprises: a pair of a first primer composed of the nucleotide sequence of SEQ ID NO. 7 and a second primer composed of the nucleotide sequence of SEQ ID NO. 8 for amplifying a gene marker that is SEQ ID NO. 1 or a part thereof; a pair of a third primer composed of the nucleotide sequence of SEQ ID NO. 11 and a fourth primer composed of the nucleotide sequence of SEQ ID NO. 12 for amplifying a gene marker that is SEQ ID NO. 2 or a part thereof; a pair of a fifth primer composed of the nucleotide sequence of SEQ ID NO. 15 and a sixth primer composed of the nucleotide sequence of SEQ ID NO. 16 for amplifying a gene marker that is SEQ ID NO. 3 or a part thereof; a pair of a seventh primer composed of the nucleotide sequence of SEQ ID NO. 19 and an eighth primer composed of the nucleotide sequence of SEQ ID NO. 20 for amplifying a gene marker that is SEQ ID NO. 4 or a part thereof; and a pair of a ninth primer composed of the nucleotide sequence of SEQ ID NO. 23 and a tenth primer composed of the nucleotide sequence of SEQ ID NO. 24 for amplifying a gene marker that is SEQ ID NO. 5 or a part thereof. It may include one or more combinations selected from the group consisting of a pair of a 11th primer composed of the nucleotide sequence of SEQ ID NO. 27 and a 12th primer composed of the nucleotide sequence of SEQ ID NO. 28 for amplifying a gene marker that is SEQ ID NO. 6 or a part thereof; preferably, it may include all of the six types of combinations, and more preferably, it may include all three types of combinations of the 1st to 6th primers.

[0044] The primers used in the present invention comprise hybridized nucleotide sequences that are complementary to the DNA sequence of a region adjacent to a target gene marker. Since the primers can be applied to the present invention as long as they hybridize with the template and possess sufficient complementarity to perform their inherent functions, the primers do not need to have sequences that are perfectly complementary to the template nucleotide sequence. Furthermore, the primers of the present invention may be modified (e.g., addition, deletion, substitution) within a range that does not affect the specific detection of the genus or the genus. For example, depending on the sequence length of each primer, the primers may comprise oligonucleotides consisting of fragments of 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, or 20 consecutive nucleotides within the sequence.

[0045] The oligonucleotide used as a primer in the present invention may also include a nucleotide analogue, for example, a phosphorothioate, an alkylphosphorothioate, or a peptide nucleic acid, or may include an intercalating agent.

[0046] In addition, the present invention provides a composition for determining a genital or a genital, comprising a primer set for determining the above-mentioned genital or a genital.

[0047] In addition, the present invention provides a kit for determining a genital or a minor genital, comprising a primer set for determining the genital or minor genital or a composition for determining the genital or minor genital.

[0048] In a preferred embodiment of the present invention, the composition for distinguishing between a minor or minor genus or the kit may further include, but is not limited to, a probe for detecting the gene marker for distinguishing between a minor or minor genus of the present invention.

[0049] In one embodiment, the probe of the present invention comprises: a pair of a first probe composed of the nucleotide sequence of SEQ ID NO. 9 and a second probe composed of the nucleotide sequence of SEQ ID NO. 10 for detecting a gene marker that is SEQ ID NO. 1 or a part thereof; a pair of a third probe composed of the nucleotide sequence of SEQ ID NO. 13 and a fourth probe composed of the nucleotide sequence of SEQ ID NO. 14 for detecting a gene marker that is SEQ ID NO. 2 or a part thereof; a pair of a fifth probe composed of the nucleotide sequence of SEQ ID NO. 17 and a sixth probe composed of the nucleotide sequence of SEQ ID NO. 18 for detecting a gene marker that is SEQ ID NO. 3 or a part thereof; a pair of a seventh probe composed of the nucleotide sequence of SEQ ID NO. 21 and an eighth probe composed of the nucleotide sequence of SEQ ID NO. 22 for detecting a gene marker that is SEQ ID NO. 4 or a part thereof; and a pair of a ninth probe composed of the nucleotide sequence of SEQ ID NO. 25 and a tenth probe composed of the nucleotide sequence of SEQ ID NO. 26 for detecting a gene marker that is SEQ ID NO. 5 or a part thereof. It may include one or more combinations selected from the group consisting of a pair of a 11th probe composed of the nucleotide sequence of SEQ ID NO. 29 and a 12th probe composed of the nucleotide sequence of SEQ ID NO. 30 for detecting a gene marker that is SEQ ID NO. 6 or a part thereof; preferably, it may include all of the six types of combinations, and more preferably, it may include all three types of combinations of the 1st to 6th probes.

[0050] The above pair of probes is intended to specifically detect different bases according to *Sasa borealis*, *Sasa borealis*, *Sasa borealis*, *Sasa borealis*, *Sasa borealis*, *Sasa borealis*, *Sasa borealis*, *Sasa borealis*, *Sasa borealis*, *Sasa borealis*, *Sasa borealis*, *Sasa borealis*, *Sasa borealis*, *Sasa borealis*, and *Sasa borealis* (*Sasa borealis*). For example, the first probe includes "FAM" for detecting C as a base corresponding to the 29th base corresponding to the SNP location of SEQ ID NO. 1 within its sequence, and the second probe includes "HEX" for detecting T as a base corresponding to the 29th base corresponding to the SNP location of SEQ ID NO. 1 within its sequence. Therefore, a person skilled in the art would understand that a pair of probes for the gene marker of SEQ ID NO. 1 may differ from the base sequences of the first and second probes, i.e., SEQ ID NO. 9 and SEQ ID NO. 10, provided that they each contain different bases (i.e., "C" and "T") corresponding to the 29th base, which is the SNP position of SEQ ID NO. 1. This may also apply equally to gene markers that are SEQ ID NO. 2 to SEQ ID NO. 6 or part thereof.

[0051] In one embodiment, the probe may be appropriately modified within a range where hybridization specificity is not impaired. For example, a reporter or a quencher may be attached to the end of the probe.

[0052] Fam or Hex may be attached to the 5' end of the probe as a reporter, and other fluorescent substances exhibiting fluorescence may be attached, but are not limited thereto. For example, the reporter may be one or more selected from the group consisting of Fam, Hex, Joe, fluorescein, fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethylrhodamine, FITC, Oregon green, Alexafluoro, ROX, Texas red, TET, TRITC, TAMRA, cyanine-based dyes, and cyanadicarbonin dyes.

[0053] BHQ-1 may be attached to the 3' end of the probe as a quencher, and other materials that can be used as a quencher may be attached, but are not limited thereto. For example, the quencher may be one or more selected from the group consisting of BHQ-1, BHQ-2, BH3-3, ROX, Dapsil, TAMRA, Eclipse, DDQ, QSY, BlackBerry Quencher, Qxl, Iowa Black FQ, Iowa Black RQ, and IRDye QC-1.

[0054] In one embodiment, a pair of probes for a specific gene marker may have different reporters attached to the ends of each probe. In a preferred embodiment, the pair of probes of SEQ ID NO. 9 and SEQ ID NO. 10 for the gene marker of SEQ ID NO. 1 may have Fam and Hex attached to their respective 5'-ends. In another preferred embodiment, the pair of probes of SEQ ID NO. 9 and SEQ ID NO. 10 for the gene marker of SEQ ID NO. 1 may have Hex and Fam attached to their respective 5'-ends. This may also apply equally to gene markers that are SEQ ID NO. 2 to SEQ ID NO. 6 or part thereof.

[0055] The kit of the present invention may additionally include other components in addition to the components described above. For example, when the kit of the present invention is applied to a PCR amplification process, the kit of the present invention may optionally include reagents necessary for PCR amplification, such as a buffer solution, DNA polymerase (e.g., Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus literalis or Pyrococcus furiosus It may include a heat-stable DNA polymerase obtained from (Pfu), a DNA polymerase cofactor, and dNTPs. The kit of the present invention may be manufactured into a plurality of separate packages containing the above-mentioned reagent components.

[0056] In addition, the present invention provides a method for distinguishing between a genus and a genus, comprising: 1) a step of preparing a mixture by mixing template DNA derived from a plant sample with the primer set; and 2) a step of forming an amplification product by PCR amplifying the mixture.

[0057] The above PCR refers to a process of amplifying a target nucleic acid by using a target nucleic acid as a template and primers specific to the target nucleic acid, and repeating the processes of denaturation, annealing, and extension reactions; it is the nucleic acid amplification method best known to those skilled in the art. Many variations and applications have been developed, for example, touchdown PCR, hot start PCR, nested PCR, and booster PCR, which modify the traditional PCR procedure to enhance the specificity or sensitivity of PCR. In addition, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction (IPCR), vectorette PCR, and TAIL-PCR (thermal asymmetric interlaced PCR) can be used for specific applications.

[0058] When performing the above PCR, the components necessary for the reaction may be provided in excess in the reaction vessel. The excess of the components necessary for the amplification reaction refers to an amount such that the amplification reaction is not substantially limited by the concentration of the components. Mg 2+Cofactors such as dATP, dCTP, dGTP, and dTTP can be provided to the reaction mixture in an amount such that the desired degree of amplification can be achieved. All enzymes used in the amplification reaction may be active under the same reaction conditions. A buffer can be prepared and added so that all enzymes are close to optimal reaction conditions.

[0059] The above method may further include a step of detecting or quantifying the amplified product after step 2). The detection or quantification of the amplified product may be performed through HRM analysis, DNA chip, gel electrophoresis, radiometric measurement, fluorescence measurement, or phosphorescence measurement, and in particular may be performed through HRM analysis, but is not limited thereto.

[0060] In addition, gel electrophoresis can be performed using agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplified product.

[0061] In addition, the fluorescence measurement method involves labeling the 5'-terminus of a primer with a fluorescent substance and performing PCR, so that the target sequence is labeled with a detectable fluorescent label, and the fluorescence thus labeled can be measured using a fluorescence detector.

[0062] In addition, for radioactivity measurement, a radioisotope is added to the PCR reaction solution during PCR to label the amplification product, and then radioactivity can be measured using a radioactivity measuring instrument, such as a Geiger counter or a liquid scintillation counter.

[0063] In one embodiment of the present invention, the first to twelfth primers and the first and twelfth probes were used, and when the specificity of the primers and probes was confirmed by real-time PCR using DNA isolated from each of the following species—*Sasa*, *Sasa*, *Phyllostachys*, *Phyllostachys lanceolata*, *Sasa*, *Sasa*, *Sasa*, *Sasa*, *Sasa*, *Sasa*, *Sasa*, *Sasa*, *Sasa*, *Sasa*, and *Sasa* (*Sasa*)—as a template, it was confirmed that each primer and probe pair exhibited a unique amplification and detection pattern specifically specific to each of the following species for the gene markers of SEQ ID NOs 1 to 6: *Sasa*, *Sasa*, *Phyllostachys lanceolata*, *Phyllostachys lanceolata*, *Sasa and *Sasa* (*Sasa*) (see FIGS. 2 to 7).

[0064] Hereinafter, the present invention will be described in detail with reference to examples to aid in understanding. However, the following examples are merely illustrative of the content of the present invention and the scope of the present invention is not limited to the following examples.

[0065] Example 1. DNA extraction from a sample

[0066] The standard samples of 14 species of the bamboo subfamily used in the experiment (Bamboo, Purple Bamboo, Giant Bamboo, Bamboo Shoot Bamboo, Bamboo Shoot Bamboo, Bamboo Spruce, Black Bamboo, Haejang Bamboo, Sasa Bamboo, Island Bamboo, Jeju Sasa Bamboo, Island Sasa Bamboo, Gatdae, and Gwonmun Bamboo) were provided by the Bamboo Resource Research Institute, and the standard sample of one species of the reed subfamily, Sasa japonica (Damjukyeop), was used by collecting leaves directly from Jeju Island.

[0067] DNA extraction was performed using the QIAamp PowerFecal Pro DNA kit (Qiagen, Germany).

[0068] 150 mg of leaf sample was placed in a 2 mL Safe-Lock tube along with 2 mm zirconia beads (15–20 beads), 800 µL of CD1 buffer was added, and the sample was swollen at 900 rpm (Vortemp 56, Labnet International) for 10 minutes at 65°C. After grinding and homogenizing using TissueLyser II (Qiagen, Germany), the sample was reacted again at 900 rpm (Vortemp 56, Labnet International) for 10 minutes at 65°C.

[0069] Subsequently, centrifuged for 5 minutes (11,000 xg) and transferred the supernatant to a new 2 ml tube. Centrifuged again for 2 minutes and transferred the supernatant to a new 2 ml tube. 200 µl of CD2 buffer (stored at 4°C) was added and mixed gently (Vortex 5 seconds). After centrifuging for 1 minute, the supernatant was transferred to a new 2 ml tube. 600 µl of CD3 buffer was added and mixed gently (Vortex 5 seconds). After centrifuging for 2 minutes, the supernatant was transferred to an MB column and centrifuged for 1 minute. The MB column was washed once with 500 µl of EA buffer. The MB column was washed once with 500 µl of C5 buffer. The MB column was rotated 180° and centrifuged for 2 minutes. After transferring the MB column to a new 1.5 mL E-tube, 30 µL of C6 buffer was added and the column was incubated at 65°C for 10 minutes, followed by centrifugation for 1 minute. The eluent was returned to the column and incubated at 65°C for 5 minutes, followed by centrifugation for 1 minute for final elution.

[0070] The absorbance of the isolated gene was measured using a spectrophotometer, and then A 260nm Assuming the gene concentration was 50 μg / ml when =1, the concentration and purity were calculated as follows.

[0071] 1) Gene concentration (µg / ml) = 50 µg / ml x A 260nm × Dilution factor

[0072] 2) A 260nm / A230nm Genetic purity = 2.0 or higher (1.5 or higher is also acceptable)

[0073] 3) A 260nm / A 280nm Genetic purity = 1.8~1.9

[0074] In addition, the isolated genes were diluted to 20 ng / µl, and 5–20 µl were analyzed using an automated capillary electrophoresis system (Qsep400, BioD) to check the DNA status (see Fig. 1).

[0075] Example 2. Lee Dae Or development of genetic markers for identifying variability

[0076] After obtaining DNA base sequence information for each of the above samples, the results were compared and analyzed using the CLUSTALW program to select distinguishable SNPs in the COI, the barcode gene of 14 species of the Bamboo subfamily and Sasa borealis (Sasa japonica) of the Reed subfamily. Six SNP combinations capable of distinguishing between Sasa borealis and Sasa borealis were selected from a total of 15 samples as suitable genetic markers for identifying Sasa borealis or Sasa borealis (Table 1).

[0077] Sequence number Sequence List(5'->3') Allele Sequence No. 1 ATCGTTACAAAGGGCGATGCTATCACATYGAGCCCGTTGTTGGGGAGGAAAATCAATATATCGCTTATGTAGCTTATCCATTAGACCTATTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAACGTATTTG 29th position, Y=C / T Sequence No. 2 CTTCCATTGTGGGTAACGTATTTGGTTTCAAAGCCCTACGCGCTCTACGTCTGGAGGATCTGCGAATTCCCMCTRCTTATTCAAAAACTTTCCAAGGTCCGC 72nd position, M=A / C 75th position, R=A / G Sequence No. 3 TCCCCCAATTTGGCGACCTACCATAGGATTTGTTATGTAAATAGGTATATGTTCCTTTCCATTATGAATSGCGATTGTATGGCCAACCATTGCGGGTAGAATGCTA 69th position, S=G / C Sequence No. 4 GGCTTCCGCATCGATGAAGAACGTAGCRAAATGCGATACCTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGG 28th position, R=A / G Sequence No. 5 GACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCRAAATGCGATACCTGGTGTGAATTGCAGAATC 50th position, R=A / G Sequence No. 6 GAATTCTCTAGCATTTGATTCCTTACTAACAAAGGATTTATTGGTACACTTGAAAGGTACCCCAGRAAATCGAAGCAAGAGTTTACTAATTGGTTTAGATGGATCCTTCG 66th position, R=G / A

[0078] A primer pair that specifically amplifies the gene markers of SEQ ID NOs 1 to 6 containing this SNP location and a probe pair that can specifically detect them were designed. Primers and probes for gene markers PJ_ITS-2, PJ_ITS-5, PJ_rbcL-1, PJ_matK-1, and PJ_psbA-2 were designed by Metabion (Germany), and primers and probes for gene marker PJ_rbcL-2-v.2 were designed by SFC (Korea).

[0079] Information regarding the above primers and probes is shown in Table 2.

[0080] SNP id nucleotide sequence Sequence number size Tm Length(bp) Sequence position fluorescent marker note PJ_rbcL-1 Forward direction ATCGTTACAAAGGGCGATGCT 7 21 59 144 1-21 Fam: Giant bamboo, bamboo shoots, rhizome bamboo, black bamboo, cotton bamboo, Sasa borealis (Damjukyeop) reverse direction CAAATACGTTACCCACAATGGAAGT 8 25 63 119-144 First probe TCACAT C GAGCCCGTTG 9 17 55 23-39 Fam 2nd probe TCACAT T GAGCCCGT 10 15 46 23-37 Hex PJ_rbcL-2-v.2 Forward direction CTTCCATTGTGGGTAACGTATTTG 11 24 62 102 1-24 Fam: Jeju Sasa, Island Sasa, Gatdae, Gwonmunjuk reverse direction GCGGACCTTGGAAAGTTTTTG 12 21 59 82-102 First probe TGCGAATTCCC A CT G C 13 16 52 58-74 Fam 2nd probe TGCGAATTCCC C CT A C 14 16 50 58-74 Hex PJ_psbA-2 Forward direction TCCCCCAATTTGCGACCTA 15 19 57 105 1-19 Fam: Haejangjuk, Joritdae, Seomdae reverse direction TAGCATTCTACCCGCAATGGT 16 21 59 85-105 First probe CATTAT GATE G GCGATTG 17 18 49 59-76 Fam 2nd probe TTTCCATTATGAAT C GC 18 17 45 55-71 Hex PJ_ITS-2 Forward direction GGCTCTCGCATCGATGAAG 19 19 59 100 1-19 Fam: Sasa borealis (Bamboo leaf) reverse direction CCTCGGGCGCAACTTG 20 16 56 85-100 First probe CGTAGC A AAATGCGATA 21 17 48 22-38 Fam 2nd probe ACGTAGC G AAATGCGAT 22 17 50 21-37 Hex PJ_ITS-5 Forward direction GACTCTCGGCAACGGATATCTC 23 22 64 81 1-22 Fam: Sasa borealis (Bamboo leaf) reverse direction GATTCTGCAATTCACACCAGGTAT 24 24 62 58-81 First probe TGAAGAACGTAGC A AAA 25 17 45 37-53 Fam 2nd probe AACGTAGC G AAATG 26 14 38 42-55 Hex PJ_matK-1 Forward direction GAATTCTCTAGCATTTGATTCCTTACT 27 27 62 110 1-27 Fam: Cotton bamboo, Black bamboo reverse direction CGAAGGATCCATCTAAACCAATTA 28 24 60 87-110 First probe CTTGAAAGGTACCCCAG G AA 29 20 58 49-68 Fam 2nd probe TACCCCAG A AAATCGAAGCA 30 20 56 58-77 Hex

[0081] Example 3. Method for determining between two-generation and frequent two-generation by real-time PCR

[0082] The DNA of the sample obtained in Example 1 above was used as a template for real-time PCR. PCR products were obtained according to the conditions in Table 3 using the primer and probe pairs designed in Example 2 above.

[0083] PCR reaction conditions for 6 markers Real-time PCR 20 µl reaction solution Forward Primer 10 pmole (10μM stock, 1μL) Reverse Primer 10 pmole (10μM stock, 1μL) 1st probe 5 pmole (5μM stock, 1μL) 2nd probe 5 pmole (5μM stock, 1μL) Template DNA amount 40ng (20 ng / µl, 2µl) PCR temperature cycling 95℃, 3 min → [95℃, 10 sec → 60℃, 30 sec], repeat 40 times Probe detection conditions FAM, HEX fluorescence signal (no quencher) Manual reference doesn't exist reaction reagent qPCRBIO 2X probe mixture (50 nM ROX)

[0084] In Real-time PCR software (7500 Software v2.3, Applied Biosystems), the settings were configured as Plot type: △Rn vs Cycle, Graph Type: Linear, Threshold: Auto, Auto Baseline). For each reaction, the detection of Fam and Hex wavelength signals was verified, and C T It was determined that amplification occurred when the value did not exceed 34. As a result, it was confirmed that the pairs of primers and probes specific to SEQ ID NOs 1 to 6 designed in Example 2 could specifically amplify and detect samples corresponding to each SNP position (Figs. 2 to 7).

[0085] Figure 8 summarizes the distinguishable combinations and fluorescence signals of the 15 types of samples used in this embodiment. Referring to this, by combining the Fam and Hex signals amplified from six genetic markers, it is possible to distinguish detailed species of Group 1 (Giant bamboo, Bamboo shoot bamboo, Bamboo rhizome), Group 2 (Som bamboo, Black bamboo), Group 3 (Haejang bamboo, Sasa bamboo, Island bamboo), Group 4 (Jeju Sasa bamboo, Island Sasa bamboo, Gatdae bamboo, Kwonmun bamboo), Group 5 (Idae bamboo, Purple Idae bamboo), and Group 6 (Sasa bamboo (Damjukyeop)). In particular, Group 5 (Idae bamboo, Purple Idae bamboo) can be identified by using the genetic markers PJ_rbcL-1 (Sequence No. 1), PJ_rbcL-2-v.2 (Sequence No. 2), and PJ_psbA-2 (Sequence No. 3).

Claims

Claim 1 A primer pair for amplifying a gene marker comprising at least one selected from the group consisting of: a polynucleotide comprising eight or more consecutive nucleotides including one or more SNP locations selected from the group consisting of the 29th single nucleotide polymorphism (SNP) location of the nucleotide sequence of SEQ ID NO. 1, the 72nd and 75th SNP locations of the nucleotide sequence of SEQ ID NO. 2, the 69th SNP location of the nucleotide sequence of SEQ ID NO. 3, the 28th SNP location of the nucleotide sequence of SEQ ID NO. 4, the 50th SNP location of the nucleotide sequence of SEQ ID NO. 5, and the 66th SNP location of the nucleotide sequence of SEQ ID NO. 6; and a polynucleotide complementary to said polynucleotide. Pseudosasa japonica Makino) or Jajuidae ( Pseudosasa japonica Makino var. pupurascens Primer set for identifying ). Claim 2 Claim 1, wherein the genetic marker is a primer set for distinguishing *Lee Dae* or *Jaju Lee* from *Gwangdae* or *Jaju Lee*, which is intended to distinguish *Lee Dae* or *Jaju Lee* from *Gwangdae*, *Juksundae*, *Noejuk*, *Somae*, *Ojuk*, *Haejangdae*, *Joritdae*, *Seomdae*, *Jeju Joritdae*, *Seom Joritdae*, *Gatdae*, *Gwonmundae*, and *Joritdae* grass. Claim 3 In claim 1, the primer pair comprises: i) a pair of a first primer composed of the nucleotide sequence of SEQ ID NO. 7 and a second primer composed of the nucleotide sequence of SEQ ID NO. 8 for amplifying a gene marker comprising the 29th SNP position of the nucleotide sequence of SEQ ID NO. 1; ii) a pair of a third primer composed of the nucleotide sequence of SEQ ID NO. 11 and a fourth primer composed of the nucleotide sequence of SEQ ID NO. 12 for amplifying a gene marker comprising the 72nd and 75th SNP positions of the nucleotide sequence of SEQ ID NO. 2; iii) a pair of a fifth primer composed of the nucleotide sequence of SEQ ID NO. 15 and a sixth primer composed of the nucleotide sequence of SEQ ID NO. 16 for amplifying a gene marker comprising the 69th SNP position of the nucleotide sequence of SEQ ID NO. 3; iv) a pair of a seventh primer composed of the nucleotide sequence of SEQ ID NO. 19 and an eighth primer composed of the nucleotide sequence of SEQ ID NO. 20 for amplifying a gene marker comprising the 28th SNP position of the nucleotide sequence of SEQ ID NO. 4; v) a pair of a ninth primer composed of the nucleotide sequence of SEQ ID NO. 23 and a tenth primer composed of the nucleotide sequence of SEQ ID NO. 24 for amplifying a gene marker including the 50th SNP position of the nucleotide sequence of SEQ ID NO. 5; and vi) a pair of a twelfth primer composed of the nucleotide sequence of SEQ ID NO. 27 and a tenth primer composed of the nucleotide sequence of SEQ ID NO. 28 for amplifying a gene marker including the 66th SNP position of the nucleotide sequence of SEQ ID NO. 6; a primer set for distinguishing between two generations or frequently occurring two generations, selected from the group consisting of at least one of the above. Claim 4 A PCR composition for determining a bisexual or cisexual gender, comprising: a polynucleotide consisting of eight or more consecutive nucleotides including one or more SNP locations selected from the group consisting of the 29th single nucleotide polymorphism (SNP) location of the nucleotide sequence of SEQ ID NO. 1, the 72nd and 75th SNP locations of the nucleotide sequence of SEQ ID NO. 2, the 69th SNP location of the nucleotide sequence of SEQ ID NO. 3, the 28th SNP location of the nucleotide sequence of SEQ ID NO. 4, the 50th SNP location of the nucleotide sequence of SEQ ID NO. 5, and the 66th SNP location of the nucleotide sequence of SEQ ID NO. 6; a primer pair for amplifying a gene marker selected from the group consisting of at least one polynucleotide; and a probe pair for detecting a single nucleotide polymorphism (SNP) in the gene marker amplified by the primer pair. Claim 5 In claim 4, the primer pair comprises: i) a pair of a first primer composed of the nucleotide sequence of SEQ ID NO. 7 and a second primer composed of the nucleotide sequence of SEQ ID NO. 8 for amplifying a gene marker comprising the 29th SNP position of the nucleotide sequence of SEQ ID NO. 1; ii) a pair of a third primer composed of the nucleotide sequence of SEQ ID NO. 11 and a fourth primer composed of the nucleotide sequence of SEQ ID NO. 12 for amplifying a gene marker comprising the 72nd and 75th SNP positions of the nucleotide sequence of SEQ ID NO. 2; iii) a pair of a fifth primer composed of the nucleotide sequence of SEQ ID NO. 15 and a sixth primer composed of the nucleotide sequence of SEQ ID NO. 16 for amplifying a gene marker comprising the 69th SNP position of the nucleotide sequence of SEQ ID NO. 3; iv) a pair of a seventh primer composed of the nucleotide sequence of SEQ ID NO. 19 and an eighth primer composed of the nucleotide sequence of SEQ ID NO. 20 for amplifying a gene marker comprising the 28th SNP position of the nucleotide sequence of SEQ ID NO. 4; v) a pair of a ninth primer composed of the nucleotide sequence of SEQ ID NO. 23 and a tenth primer composed of the nucleotide sequence of SEQ ID NO. 24 for amplifying a gene marker including the 50th SNP position of the nucleotide sequence of SEQ ID NO. 5; and vi) a pair of a eleventh primer composed of the nucleotide sequence of SEQ ID NO. 27 and a twelveth primer composed of the nucleotide sequence of SEQ ID NO. 28 for amplifying a gene marker including the 66th SNP position of the nucleotide sequence of SEQ ID NO. 6; at least one selected from the group consisting of the above, and the probe pair comprises: i) a pair of a first probe composed of the nucleotide sequence of SEQ ID NO. 9 and a second probe composed of the nucleotide sequence of SEQ ID NO. 10 for detecting a gene marker including the 29th SNP position of the nucleotide sequence of SEQ ID NO. 1; and ii) a pair of a third probe composed of the nucleotide sequence of SEQ ID NO. 13 and a fourth probe composed of the nucleotide sequence of SEQ ID NO. 14 for detecting gene markers including the 72nd and 75th SNP positions of the nucleotide sequence of SEQ ID NO. 2;iii) a pair of a fifth probe composed of the nucleotide sequence of SEQ ID NO. 17 and a sixth probe composed of the nucleotide sequence of SEQ ID NO. 18 for detecting a gene marker including the 69th SNP position of the nucleotide sequence of SEQ ID NO. 3; iv) a pair of a seventh probe composed of the nucleotide sequence of SEQ ID NO. 21 and an eighth probe composed of the nucleotide sequence of SEQ ID NO. 22 for detecting a gene marker including the 28th SNP position of the nucleotide sequence of SEQ ID NO. 4; v) a pair of a ninth probe composed of the nucleotide sequence of SEQ ID NO. 25 and a tenth probe composed of the nucleotide sequence of SEQ ID NO. 26 for detecting a gene marker including the 50th SNP position of the nucleotide sequence of SEQ ID NO. 5; A PCR composition for distinguishing between two generations or multiple generations, comprising at least one selected from the group consisting of: vi) a pair of a 11th probe composed of the nucleotide sequence of SEQ ID NO. 29 and a 12th probe composed of the nucleotide sequence of SEQ ID NO. 30 for detecting a gene marker including the 66th SNP position of the nucleotide sequence of SEQ ID NO. 6; Claim 6 A PCR composition for determining a bisexual or frequently bisexual, wherein the primer pair comprises: a pair of a first primer and a second primer; a pair of a third primer and a fourth primer; and a pair of a fifth primer and a sixth primer. Claim 7 A PCR composition for determining between two or more generations, wherein, in claim 4, different reporters are bound to pairs of probes for each gene marker. Claim 8 The PCR composition for determining a bisexual or purple bisexual, wherein the reporter is selected from the group consisting of Hex, Joe, Fam, fluorescein, fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethylrhodamine, FITC, Oregon green, Alexafluoro, ROX, Texas red, TET, TRITC, TAMRA, cyanine-based dyes, and cyanodicarbonin dyes. Claim 9 A PCR composition for distinguishing between two-stage or frequent two-stage, wherein, in claim 4, a reporter is attached to the 5' end of the probe or a quencher is attached to the 3' end of the probe. Claim 10 In claim 9, the quencher is a PCR composition for determining a bisexual or a cissexual selected from the group consisting of BHQ-1, BHQ-2, BH3-3, ROX, Dapsil, TAMRA, Eclipse, DDQ, QSY, BlackBerry Quencher, Qxl, Iowa Black FQ, Iowa Black RQ, and IRDye QC-1. Claim 11 A kit for determining whether a genital or common genital area comprises a primer set according to any one of claims 1 to 3. Claim 12 A kit for determining whether a genital or common genital cancer is present, comprising a PCR composition of any one of claims 4 to 10. Claim 13 A method for determining the age of the plant, comprising: 1) a step of preparing a mixture by mixing template DNA derived from a plant sample with a PCR composition of any one of claims 4 to 10; and 2) a step of PCR amplifying the mixture to form an amplified product. Claim 14 A method for determining the age of the present invention, further comprising: 3) a step of detecting or quantifying the amplified product according to claim 13. Claim 15 A method for distinguishing bamboo according to claim 14, wherein the above-mentioned distinction is for distinguishing bamboo from giant bamboo, bamboo shoot bamboo, rhododendron, cotton bamboo, black bamboo, sea bamboo, dwarf bamboo, island bamboo, Jeju dwarf bamboo, island dwarf bamboo, gatdae, Gwonmun bamboo, and dwarf bamboo grass. Claim 16 A method for determining a variegated plant, comprising: 1) a step of preparing a mixture by mixing template DNA derived from a plant sample with a PCR composition of any one of claims 4 to 10; and 2) a step of PCR amplifying the mixture to form an amplified product. Claim 17 A method for distinguishing *Ziziphus jujuba* according to claim 16, wherein the above-mentioned distinction is for distinguishing *Ziziphus jujuba* from *Ziziphus jujuba*, and *Ziziphus jujuba*.

Images