Genetic marker having single nucleotide polymorphism for distinguishing Achyranthes japonica Nakai or Achyranthes bidentata Blume

KR103024417B1Active Publication Date: 2026-09-29KT&G CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
KR1020230160839
Authority / Receiving Office
KR · KR
Patent Type
Patents
Current Assignee / Owner
Filing Date
2023-11-20
Publication Date
2026-09-29
Estimated Expiration
2043-11-20

Smart Images

  • Figure 112023128799993-PAT00001_ABST
    Figure 112023128799993-PAT00001_ABST
Patent Text Reader

Abstract

The present invention relates to a genetic marker having a single nucleotide polymorphism (SNP) that can be usefully used to distinguish between Achyranthes japonica and Achyranthes root, a primer set for distinguishing between Achyranthes japonica and Achyranthes root using said marker, a PCR composition or kit comprising said primer set, and a method for distinguishing between Achyranthes japonica and Achyranthes root using said. According to the present invention, Achyranthes japonica or Achyranthes root can be easily distinguished from counterfeit Achyranthes root.
Need to check novelty before this filing date? Find Prior Art

Description

Technology Field

[0001] The present invention relates to a gene marker having a single nucleotide polymorphism for distinguishing between Achyranthes root and Achyranthes root. Background Technology

[0002] Achyranthes root is a perennial plant belonging to the Amaranthaceae family. Achyranthes japonica Nakai or Achyranthes Achyranthes bidentata It is a medicinal herb listed in the Korean Pharmacopoeia as the root of *Achyranthes bidentata*. Achyranthes bidentata, also known as *Usul*, is a medicinal herb used in traditional Korean medicine and can be used as a food ingredient. Although it has been reported to be non-cytotoxic and non-genotoxic, the development and commercialization of processed foods utilizing it have been almost non-existent to date. In traditional Korean medicine, *Usul* is described as having a neutral nature with bitter and sour tastes, and is known to act on the kidneys and liver to remove blood stasis. Reported physiological activities of *Usul* include antioxidant activity, antibacterial and antimalarial activity, anti-inflammatory activity, and effects such as heavy metal removal and detoxification (Non-patent Literature 1).

[0003] Cheonwooseul, a plant of the same family as Achyranthes (ox knee or Achyranthes). Cyathula officinalis KCKuan) is easily confused with Achyranthes root (*ox knee* or *ox knee*) due to the similar appearance of its roots, but it cannot be used as either a food or a herbal medicine.

[0004] The inventors, in order to distinguish between Achyranthes root (*Achyranthes japonica* or *Achyranthes root*) usable as food and herbal medicine and the counterfeit *Achyranthes japonica*, utilize a DNA barcode marker present in chloroplasts rbc L gene and mat We identified a distinguishable single nucleotide polymorphism (SNP) in the K gene, designed primers and probes specific to Achyranthes root, confirmed that Achyranthes root can be detected, and completed the present invention. The problem to be solved

[0005] The present invention aims to provide a genetic marker, composition, primer set, or kit capable of distinguishing between Achyranthes root and Achyranthes root.

[0006] In addition, the present invention aims to provide a method for distinguishing between Achyranthes japonica and Achyranthes bidentata using a genetic marker, composition, primer set, or kit capable of distinguishing between Achyranthes japonica and Achyranthes bidentata. means of solving the problem

[0007] One aspect of the present invention comprises a polynucleotide comprising at least one selected from the group consisting of: a polynucleotide comprising eight or more consecutive nucleotides including one or more SNP locations selected from the group consisting of the 50th single nucleotide polymorphism (SNP) location of the nucleotide sequence of SEQ ID NO. 1 and the 36th SNP location of the nucleotide sequence of SEQ ID NO. 2; and a polynucleotide complementary to said polynucleotide. Achyranthes japonica Nakai or Achyranthes Achyranthes bidentata Provides a genetic marker for the identification of Blume.

[0008] Another aspect of the present invention provides a primer set for distinguishing between Achyranthes japonica and Achyranthes bidentata, comprising a primer pair for amplifying the gene marker.

[0009] Another aspect of the present invention provides a PCR composition for distinguishing between Achyranthes japonica or Achyranthes bidentata comprising the above primer set.

[0010] Another aspect of the present invention provides a kit for identifying Achyranthes japonica or Achyranthes bidentata, comprising a primer set for identifying Achyranthes japonica or Achyranthes bidentata or a PCR composition for identifying Achyranthes japonica or Achyranthes bidentata.

[0011] Another aspect of the present invention provides a method for distinguishing between Achyranthes root and Achyranthes root, comprising: 1) a step of preparing a mixture by mixing a template DNA derived from a sample with the primer set; and 2) a step of PCR amplifying the mixture to form an amplified product. Effects of the invention

[0012] According to the gene marker having a single nucleotide polymorphism of the present invention, a primer set using said gene marker, a composition, a kit, and a method for identification using said the same, it is possible to distinguish between Achyranthes root and Achyranthes root, and in particular, Achyranthes root or Achyranthes root can be easily distinguished from Achyranthes root.

[0013] Accordingly, according to the present invention, there is an advantage in that the cost and time required to identify Achyranthes japonica or Achyranthes bidentata can be minimized by easily and accurately distinguishing Achyranthes japonica or Achyranthes bidentata from Achyranthes japonica. Brief explanation of the drawing

[0014] Figure 1 is a photograph showing the results of DNA extraction from samples of Achyranthes root, Achyranthes root, and Achyranthes root. Figure 2 is a graph showing that real-time PCR analysis using pairs of primers and probes for the gene markers of SEQ ID NOs 1 to 4 can distinguish between Achyranthes bidentata and Achyranthes japonica. Specific details for implementing the invention

[0015] First, the terms used in the present invention will be explained.

[0016] In this specification, the term “nucleotide” refers to a deoxyribonucleotide or ribonucleotide existing in a single-stranded or double-stranded form, and includes analogs of natural nucleotides unless otherwise specifically stated.

[0017] As used herein, the term "complementary" means sufficiently complementary to the extent that a primer or probe selectively hybridizes to a target nucleic acid sequence under certain annealing or hybridization conditions, and encompasses both substantially complementary and perfectly complementary, preferably meaning perfectly complementary.

[0018] The term "specific" as used in this specification means that it does not bind to *Cheonwooseul* but binds specifically only to *Soemureup* or *Useul*.

[0019] As used herein, the term "primer" refers to a single-stranded oligonucleotide sequence complementary to the nucleic acid strand to be copied, which can serve as a starting point for the synthesis of a primer extension product. The length and sequence of the following primers are designed to allow the initiation of the synthesis of the extension product. The specific length and sequence of the primers may be determined based on the complexity of the required DNA or RNA target, as well as primer usage conditions such as temperature and ionic strength.

[0020] In this specification, the term “probe” means a natural or modified monomer or a linear oligomer having a bond comprising a deoxyribonucleotide and a ribonucleotide that can hybridize to a specific nucleotide sequence. Preferably, the probe is single-stranded for maximum efficiency in hybridization. The probe is preferably a deoxyribonucleotide. As a probe used in the present invention, a sequence perfectly complementary to the sequence containing the SNP may be used, but a sequence substantially complementary may also be used to the extent that it does not interfere with specific hybridization.

[0021] As used herein, the term "PCR" refers to a process of amplifying a target nucleic acid by using the target nucleic acid as a template and using primers specific to the target nucleic acid, and repeating the processes of denaturation, annealing, and extension reactions.

[0022] The present invention will be described in detail below.

[0023] The present invention provides a genetic marker for distinguishing between Achyranthes japonica or Achyranthes bidentata, comprising at least one selected from the group consisting of: a polynucleotide composed of eight or more consecutive nucleotides including one or more SNP positions selected from the group consisting of the 50th single nucleotide polymorphism (SNP) position of the nucleotide sequence of SEQ ID NO. 1 and the 36th SNP position of the nucleotide sequence of SEQ ID NO. 2; and a polynucleotide complementary to said polynucleotide.

[0024] In one embodiment, the gene marker of the present invention comprises 8 to 105, e.g., 8 to 80, preferably 8 to 70, 8 to 60, 18 to 50, 18 to 30, or 18 to 24, or 8 to 24 consecutive polynucleotides, comprising the 50th nucleotide which is an SNP site as part of the 1st to 105th polynucleotides of the base sequence of SEQ ID NO. 1, preferably the 40th to 60th polynucleotides; and may be one or more polynucleotides selected from the group consisting of 8 to 112, e.g. 8 to 100, preferably 8 to 80, 8 to 70, 8 to 60, 18 to 50, 18 to 30, or 18 to 24, or 8 to 24 consecutive polynucleotides including the 36th nucleotide which is an SNP position as part of the 1st to 112th polynucleotides of the base sequence of SEQ ID NO. 2, preferably the 26th to 46th polynucleotides.

[0025] In a preferred embodiment, the gene marker of the present invention may be one or more polynucleotides selected from the group consisting of: a polynucleotide consisting of consecutive nucleotides at positions 1 to 105 of the base sequence of SEQ ID NO. 1; and a polynucleotide consisting of consecutive nucleotides at positions 1 to 112 of the base sequence of SEQ ID NO. 2.

[0026] The SNP of the present invention is a highly stable genetic marker that can be directly used to distinguish between Achyranthes japonica and Achyranthes bidentata from counterfeit Achyranthes bidentata, which may be mixed in due to morphological similarity. The ability of the SNP marker of the present invention to distinguish between Achyranthes japonica and Achyranthes bidentata is due to the presence of DNA barcode markers in chloroplasts. rbc In the base sequence indicated by SEQ ID NO. 1 in the L gene, the 50th base, which is the SNP variant site, differs as T or C, and mat It is based on the fact that the 36th base, which is the SNP variant location in the base sequence indicated by sequence number 2 in the K gene, is different as C or A.

[0027] For example, the 50th base, which is an SNP variant location in the base sequence indicated by SEQ ID NO. 1, is different as T for Achyranthes root or Achyranthes root and C for Achyranthes root, and the 36th base, which is an SNP variant location in the base sequence indicated by SEQ ID NO. 2, is different as C for Achyranthes root or Achyranthes root and A for Achyranthes root, thus exhibiting different base polymorphisms. Therefore, by confirming the base sequences at the above SNP variant locations, Achyranthes root or Achyranthes root can be clearly distinguished from Achyranthes root.

[0028] The present invention relates to base variants at each SNP position in the sequence of SEQ ID NO. 1 or SEQ ID NO. 2, but when such SNP base variants are found in double-stranded gDNA (genomic DNA), they are interpreted to include polynucleotide sequences complementary to the nucleotide sequences. Accordingly, the base at the SNP position in the complementary polynucleotide sequence is also a complementary base. In this regard, all sequences presented in this specification are based on sequences in the sense strand of genomic DNA unless otherwise noted.

[0029] In addition, the present invention provides a genetic marker for distinguishing between Achyranthes bidentata and Achyranthes japonica, comprising a polynucleotide consisting of consecutive nucleotides from the 1st to 94th, preferably the 26th to 40th, of the base sequence represented by SEQ ID NO. 3, in order to clearly distinguish between Achyranthes bidentata and Achyranthes japonica from Achyranthes japonica.

[0030] The present invention provides a genetic marker for distinguishing between Achyranthes root and Achyranthes root, comprising a polynucleotide consisting of consecutive nucleotides from the 1st to 69th, preferably the 31st to 44th, of the base sequence represented by SEQ ID NO. 4, in order to clearly distinguish between Achyranthes root and Achyranthes root from a counterfeit Achyranthes root.

[0031] In addition, the present invention provides a single nucleotide polymorphism marker composition, a primer set, a composition, and a kit capable of distinguishing between Achyranthes root and Achyranthes root using the gene marker having a single nucleotide polymorphism.

[0032] Specifically, the present invention provides a primer set for distinguishing between Achyranthes japonica and Achyranthes bidentata, comprising a primer pair having a sequence complementary to the gene marker having a single nucleotide polymorphism and specifically binding to the gene marker.

[0033] In the present invention, the primer pair comprises, without limitation, any polynucleotide sequence capable of amplifying a gene marker for distinguishing between Achyranthes root and Achyranthes root by binding to the polynucleotide of SEQ ID NO. 1 or SEQ ID NO. 2 and its complementary base sequence.

[0034] In one embodiment, the primer pair of the present invention may comprise one or more selected from the group consisting of: a pair of a first primer composed of the nucleotide sequence of SEQ ID NO. 5 and a second primer composed of the nucleotide sequence of SEQ ID NO. 6 for amplifying a gene marker that is SEQ ID NO. 1 or a part thereof; and a pair of a third primer composed of the nucleotide sequence of SEQ ID NO. 7 and a fourth primer composed of the nucleotide sequence of SEQ ID NO. 8 for amplifying a gene marker that is SEQ ID NO. 2 or a part thereof, and preferably may comprise all of the first to fourth primers.

[0035] In addition, the primer set for distinguishing between Achyranthes japonica and Achyranthes bidentata according to the present invention comprises, without limitation, any polynucleotide sequence capable of amplifying a gene marker for distinguishing between Achyranthes japonica and Achyranthes bidentata by binding to the polynucleotide of SEQ ID NO. 3 and its complementary base sequence.

[0036] In one embodiment, the primer set of the present invention may further include a pair of a fifth primer composed of the nucleotide sequence of SEQ ID NO. 9 and a sixth primer composed of the nucleotide sequence of SEQ ID NO. 10 for amplifying a gene marker that is SEQ ID NO. 3 or a part thereof.

[0037] In addition, the primer set for distinguishing between Achyranthes root and Achyranthes root of the present invention includes, without limitation, any polynucleotide sequence capable of amplifying a gene marker for distinguishing Achyranthes root by binding to the polynucleotide of SEQ ID NO. 4 and its complementary base sequence.

[0038] In one embodiment, the primer set of the present invention may further include a pair of a seventh primer composed of the nucleotide sequence of SEQ ID NO. 11 and an eighth primer composed of the nucleotide sequence of SEQ ID NO. 12 for amplifying a gene marker that is SEQ ID NO. 4 or a part thereof.

[0039] The primers used in the present invention comprise hybridized nucleotide sequences that are complementary to the DNA sequence of a region adjacent to a target gene marker. Since the primers can be applied to the present invention as long as they hybridize with the template and possess sufficient complementarity to perform their inherent functions, the primers do not need to have sequences that are perfectly complementary to the template nucleotide sequence. Furthermore, the primers of the present invention may be modified (e.g., addition, deletion, substitution) within a range that does not affect the specific detection of Achyranthes root or Achyranthes root. For example, depending on the sequence length of each primer, the primers may comprise oligonucleotides consisting of fragments of 14 or more, 15 or more, 16 or more, or 17 or more consecutive nucleotides within the sequence.

[0040] The oligonucleotide used as a primer in the present invention may also include a nucleotide analogue, for example, a phosphorothioate, an alkylphosphorothioate, or a peptide nucleic acid, or may include an intercalating agent.

[0041] In addition, the present invention provides a composition for identifying Achyranthes japonica or Achyranthes bidentata comprising a primer set for identifying Achyranthes japonica or Achyranthes bidentata.

[0042] In addition, the present invention provides a kit for identifying Achyranthes japonica or Achyranthes bidentata comprising a primer set for identifying Achyranthes japonica or Achyranthes bidentata or a composition for identifying Achyranthes japonica or Achyranthes bidentata.

[0043] In a preferred embodiment of the present invention, the composition for distinguishing between Achyranthes japonica and Achyranthes bidentata or the kit may additionally include a probe for detecting a genetic marker for distinguishing between Achyranthes japonica and Achyranthes bidentata, but is not limited thereto.

[0044] In one embodiment, the probe of the present invention may comprise one or more combinations selected from the group consisting of: a pair of a first probe composed of the nucleotide sequence of SEQ ID NO. 13 and a second probe composed of the nucleotide sequence of SEQ ID NO. 14 for detecting a gene marker that is SEQ ID NO. 1 or a part thereof; and a pair of a third probe composed of the nucleotide sequence of SEQ ID NO. 15 and a fourth probe composed of the nucleotide sequence of SEQ ID NO. 16 for detecting a gene marker that is SEQ ID NO. 2 or a part thereof, and preferably may comprise all of the first to fourth probes.

[0045] The above probe is intended to specifically detect different bases corresponding to Achyranthes bidentata and Achyranthes japonica, or Achyranthes japonica, at the SNP location of the corresponding gene marker. For example, the first probe includes a "T" within its sequence to detect a base corresponding to the 50th base at the SNP location of SEQ ID NO. 1, and the second probe includes a "C" within its sequence to detect a base corresponding to the 50th base at the SNP location of SEQ ID NO. 1. Therefore, a person skilled in the art would understand that, as long as they each include different bases (i.e., "T" and "C") corresponding to the 50th base at the SNP location of SEQ ID NO. 1, the probe pair for the gene marker of SEQ ID NO. 1 may differ from the base sequences of the first and second probes, i.e., SEQ ID NO. 13 and SEQ ID NO. 14. This may also apply equally to the gene marker of SEQ ID NO. 2 or a part thereof.

[0046] In one embodiment, the probe of the present invention may further comprise one or more selected from the group consisting of: a fifth probe composed of the nucleotide sequence of SEQ ID NO. 17 for detecting a gene marker that is SEQ ID NO. 3 or a part thereof; and a sixth probe composed of the nucleotide sequence of SEQ ID NO. 18 for detecting a gene marker that is SEQ ID NO. 4 or a part thereof.

[0047] In one embodiment, the probe may be appropriately modified within a range where hybridization specificity is not impaired. For example, a reporter or a quencher may be attached to the end of the probe.

[0048] Fam may be attached to the 5' end of the probe as a reporter, and other fluorescent substances exhibiting fluorescence may be attached, but are not limited thereto. For example, the reporter may be one or more selected from the group consisting of Hex, Joe, Fam, fluorescein, fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethylrhodamine, FITC, Oregon green, Alexafluoro, ROX, Texas red, TET, TRITC, TAMRA, cyanine-based dyes, and cyanadicarbonin dyes.

[0049] Black Hole Quencher-1 (BHQ-1) may be attached to the 3' end of the probe as a quencher, and other materials that can be used as a quencher may be attached, but are not limited thereto. For example, the quencher may be one or more selected from the group consisting of BHQ-2, BH3-3, ROX (carboxy-X-rhodamine), Dabcyl, TAMRA, Eclipse, DDQ, QSY, Blackberry Quencher, Qxl, Iowa Black FQ, Iowa Black RQ, and IRDye QC-1.

[0050] In one embodiment, a pair of probes for a specific gene marker may have different reporters attached to the ends of each probe. In a preferred embodiment, the pair of probes of SEQ ID NO. 13 and SEQ ID NO. 14 for the gene marker of SEQ ID NO. 1 may have Fam and Hex attached to their respective 5'-ends. In another preferred embodiment, the pair of probes of SEQ ID NO. 13 and SEQ ID NO. 14 for the gene marker of SEQ ID NO. 1 may have Hex and Fam attached to their respective 5'-ends. This may also apply equally to the gene marker of SEQ ID NO. 2 or a part thereof.

[0051] The kit of the present invention may additionally include other components in addition to the components described above. For example, when the kit of the present invention is applied to a PCR amplification process, the kit of the present invention may optionally include reagents necessary for PCR amplification, such as a buffer solution, DNA polymerase (e.g., Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus literalis or Pyrococcus furiosus It may include a heat-stable DNA polymerase obtained from (Pfu), a DNA polymerase cofactor, and dNTPs. The kit of the present invention may be manufactured into a plurality of separate packages containing the above-mentioned reagent components.

[0052] In addition, the present invention provides a method for distinguishing between Achyranthes root and Achyranthes root, comprising: 1) a step of preparing a mixture by mixing template DNA derived from a sample with the primer set; and 2) a step of PCR amplifying the mixture result.

[0053] PCR is the most well-known nucleic acid amplification method, referring to a process of amplifying a target nucleic acid by using a target nucleic acid as a template and primers specific to the target nucleic acid, and repeating the processes of denaturation, annealing, and extension reactions. Many variations and applications have been developed; for example, touchdown PCR, hot start PCR, nested PCR, and booster PCR are modifications of the traditional PCR procedure to enhance the specificity or sensitivity of PCR. Additionally, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction (IPCR), vectorette PCR, and TAIL-PCR (thermal asymmetric interlaced PCR) can be used for specific applications.

[0054] When performing the above PCR, the components necessary for the reaction may be provided in excess in the reaction vessel. The excess of the components necessary for the amplification reaction refers to an amount such that the amplification reaction is not substantially limited by the concentration of the components. Mg 2+ Cofactors such as dATP, dCTP, dGTP, and dTTP can be provided to the reaction mixture in an amount such that the desired degree of amplification can be achieved. All enzymes used in the amplification reaction may be active under the same reaction conditions. A buffer can be prepared and added so that all enzymes are close to optimal reaction conditions.

[0055] The above method may further include a step of detecting or quantifying the amplified product after step 2). The detection or quantification of the amplified product may be performed using a DNA chip, gel electrophoresis, high-resolution melting (HRM) analysis, radiometric measurement, fluorescence measurement, or phosphorescence measurement, but is not limited thereto.

[0056] In addition, gel electrophoresis can be performed using agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplified product.

[0057] HRM analysis technology is a relatively new post-PCR analysis method used to identify variations in nucleic acid sequences. This method is based on detecting small differences in the PCR melting curve. It analyzes and processes data using software specifically designed for HRM analysis, which is connected to a PCR instrument and detects differences in the degree of dissociation of dsDNA with the dye (labeling substance) used according to temperature.

[0058] In addition, for radioactivity measurement, a radioisotope is added to the PCR reaction solution during PCR to label the amplification product, and then radioactivity can be measured using a radioactivity measuring instrument, such as a Geiger counter or a liquid scintillation counter.

[0059] In addition, the fluorescence measurement method involves labeling the 5'-terminus of a primer with a fluorescent substance and performing PCR, so that the target sequence is labeled with a detectable fluorescent label, and the fluorescence thus labeled can be measured using a fluorescence detector.

[0060] In one embodiment of the present invention, when the specificity of the primers and probes was confirmed by real-time PCR using the first to eighth primers and the first to sixth probes, and using DNA isolated from Achyranthes root, Achyranthes root, and Achyranthes root, respectively, as a template, it was confirmed that each primer pair and probe exhibited different unique amplification and detection patterns for the gene markers of SEQ ID NOs 1 to 4, depending on whether it was Achyranthes root, Achyranthes root, or Achyranthes root (see FIG. 2).

[0061] Hereinafter, the present invention will be described in detail with reference to examples to aid in understanding. However, the following examples are merely illustrative of the content of the present invention and the scope of the present invention is not limited to the following examples.

[0062] Example 1. DNA extraction from a sample

[0063] The standard samples of Achyranthes bidentata used in the experiment were obtained from Korea, and the standard samples of Achyranthes bidentata and Achyranthes japonica were obtained from China.

[0064] DNA extraction was performed using the QIAamp PowerFecal Pro DNA Kit (Qiagen, Germany). 800 µl of CD1 buffer was added to 100 mg of dry root, and the mixture was swollen at 900 rpm (Vortemp 56, Labnet International) for 10 minutes at 65°C. After homogenization using TissueLyser II (Qiagen, Germany), the mixture was reacted again at 900 rpm (Vortemp 56, Labnet International) for 10 minutes at 65°C.

[0065] Subsequently, centrifuged for 5 minutes (11,000 xg) and transferred the supernatant to a new 2 ml tube. Centrifuged again for 2 minutes and transferred the supernatant to a new 2 ml tube. 200 µl of CD2 buffer (stored at 4°C) was added and mixed gently (Vortex 5 seconds). After centrifuging for 1 minute, the supernatant was transferred to a new 2 ml tube. 600 µl of CD3 buffer was added and mixed gently (Vortex 5 seconds). After centrifuging for 2 minutes, the supernatant was transferred to an MB column and centrifuged for 1 minute. The MB column was washed once with 500 µl of EA buffer. The MB column was washed once with 500 µl of C5 buffer. The MB column was rotated 180° and centrifuged for 2 minutes. After transferring the MB column to a new 1.5 ml tube, 30 µl of C6 buffer was added and the column was incubated at 65°C for 10 minutes, followed by centrifugation for 1 minute. The eluent was returned to the column and incubated at 65°C for 5 minutes, followed by centrifugation for 1 minute for final elution.

[0066] The absorbance of the isolated gene was measured using a spectrophotometer, and then A 260nm Assuming the gene concentration was 50 μg / ml when =1, the concentration and purity were calculated as follows.

[0067] 1) Gene concentration (µg / ml) = 50 µg / ml x A 260nm x Dilution factor

[0068] 2) A 260nm / A 230nm Genetic purity = 2.0 or higher (1.5 or higher is also acceptable)

[0069] 3) A 260nm / A 280nm Genetic purity = 1.8~1.9

[0070] In addition, the isolated genes were diluted to 20 ng / µl, and 5–20 µl were analyzed using an automated capillary electrophoresis system (Qsep400, BioD) to check the DNA status (see Fig. 1).

[0071] Example 2. Development of a genetic marker for distinguishing between Achyranthes root and Achyranthes root

[0072] After obtaining the DNA base sequence information of each of the above samples, the CLUSTALW program was used for comparison and analysis to determine the barcode genes present in the chloroplasts. rbc L gene and mat Distinguishable SNPs in the K gene were selected (Sequence Nos. 1 and 2), and genetic markers specifically present in Achyranthes japonica, Achyranthes bidentata, and Achyranthes japonica, respectively, in the internal transcription spacer (ITS) of nuclear ribosomal DNA were selected (Sequence Nos. 3 and 4). Thus, combinations of four genetic markers capable of distinguishing Achyranthes japonica or Achyranthes bidentata from Achyranthes japonica were selected (Table 1).

[0073] Sequence number Sequence List(5'->3') Allele Sequence No. 1 ggcttaccagtcttgatcgttacaaaggacgatgctaccacatcgagccygttgctggcgaagaaaatcaatatatttgttatgtagcgtatcctttagaccttt 50th position, y=t / c Sequence No. 2 attctccgcaatcaatcctcttatttaagatcaacmtcttttggagctcttcttgaacgaatacatttttacggaaagttaaaatatctagttaaagttaaggcttttgggg 36th position, m=c / a Sequence No. 3 gtccagtccctccctaatgttggggagttcccccttgattggtggtgctgcccaacacaataacgaaccccggcgtgatatgcgccaaggaaca - Sequence No. 4 ttgcccagtccctccctaatgccgaggggtacccccttgtttgggggtgctgcttggcacaacaacgaa -

[0074] Primer pairs that specifically amplify the gene markers of SEQ ID NOs. 1 to 4 and probes capable of specifically detecting them were designed. The primers and probes for these four gene markers were produced by SFC (Korea). Information regarding the primers and probes is shown in Table 2.

[0075] SNP id nucleotide sequence Sequence number size Tm Length(bp) fluorescent marker note AR_rbcL_1 Forward direction ggcttaccagtcttgatcgttaca 5 24 58 105 Fam: Ox Knee, Achyranthes Hex: Heavenly Achyranthes reverse direction Aaaggtctaaaggatacgctacataaca 6 28 58 First probe cacatcgagcctgtt 13 15 65 Fam 2nd probe Cacatcgagcccgtt 14 15 65 Hex AR_matK_1 Forward direction attctccgcaatcaatcctcttat 7 24 58 112 Fam: Ox Knee, Achyranthes Hex: Heavenly Achyranthes reverse direction Ccccaaaagccttaactttaactaga 8 26 59 First probe agatcaacctcttttg 15 16 66 Fam 2nd probe taagatcaacatcttttg 16 18 66 Hex AR_ITS_1 Forward direction Gtccagtccctccctaatgttg 9 22 58 94 Fam: Ox knee, Achyranthes reverse direction tgttccttggcgcatatcac 10 20 58 probe agttcccccttgatt 17 15 65 Fam AR_ITS_2 Forward direction ttgcccagtccctccctaat 11 20 59 69 Fam: Cheon Woo-seul reverse direction ttcgttgttgtgccaagca 12 19 58 probe acccccttgtttgg 18 14 65 Fam

[0076] Example 3. Method for distinguishing between Achyranthes japonica and Achyranthes bidentata by real-time PCR

[0077] The DNA of the sample obtained in Example 1 above was used as a template for real-time PCR. PCR products were obtained according to the conditions in Table 3 using the primers and probes designed in Example 2 above.

[0078] PCR reaction conditions for 4 markers Real-time PCR 20 µl reaction solution Forward Primer 10 pmole (10μM stock, 1μL) Reverse Primer 10 pmole (10μM stock, 1μL) 1st probe 5 pmole (5μM stock, 1μL) 2nd probe 5 pmole (5μM stock, 1μL) Template DNA amount 40 ng (20 ng / µl, 2 µl) PCR temperature cycling 95℃, 3 min → [95℃, 10 sec → 60℃, 30 sec], repeat 40 times Probe detection conditions FAM, HEX fluorescence signal (no quencher) Manual reference doesn't exist reaction reagent qPCRBIO 2X probe mixture (50 nM ROX)

[0079] In Real-time PCR software (7500 Software v2.3, Applied Biosystems), the settings were configured as Plot type: △Rn vs Cycle, Graph Type: Linear, Threshold: Auto, Auto Baseline). For each reaction, the detection of Fam and Hex wavelength signals was verified, and C T If the value did not exceed 34, it was determined to be amplified.

[0080] As a result, it was confirmed that the pairs of primers and probes specific to SEQ ID NO. 1 and SEQ ID NO. 2 designed in Example 2 can specifically amplify and detect samples corresponding to each SNP location, and that the pairs of primers and probes specific to Examples 3 and 4 can also specifically amplify and detect samples corresponding to each gene marker (Fig. 2). The method for distinguishing between Achyranthes root and Achyranthes root based on the above real-time PCR results is summarized as follows.

[0081] In marker AR_rbcL_1, amplification of Achyranthes root or Achyranthes root occurs only in probes bound to a Fam fluorescence reporter, and amplification of Achyranthes root occurs only in probes bound to a Hex fluorescence reporter. Similarly, in marker AR_matK_1, amplification of Achyranthes root or Achyranthes root occurs only in probes bound to a Fam fluorescence reporter, and amplification of Achyranthes root occurs only in probes bound to a Hex fluorescence reporter.

[0082] In addition, regarding marker AR_ITS_1, amplification of Achyranthes japonica or Achyranthes root occurs in the probe bound to the Fam fluorescence reporter, whereas amplification of Achyranthes root does not occur in this probe. Conversely, regarding marker AR_ITS_2, amplification of Achyranthes root occurs in the probe bound to the Fam fluorescence reporter, whereas amplification of Achyranthes japonica or Achyranthes root does not occur in this probe. Therefore, by utilizing a combination of these genetic markers, Achyranthes japonica or Achyranthes root can be clearly distinguished from Achyranthes root. The combinations and fluorescence signals capable of distinguishing the samples of Achyranthes japonica or Achyranthes root used in this example are summarized and shown in Table 4 below.

[0083] AR_ITS_1 AR_ITS_2 AR_rbcL_1 AR_matK_1 Ox knee, Achyranthes FAM - FAM FAM Cheon Woo-seul - FAM HEX HEX

Claims

Claim 1 A primer pair for amplifying a gene marker comprising at least one selected from the group consisting of: a polynucleotide comprising eight or more consecutive nucleotides including one or more SNP locations selected from the group consisting of the 50th single nucleotide polymorphism (SNP) location of the nucleotide sequence of SEQ ID NO. 1 and the 36th SNP location of the nucleotide sequence of SEQ ID NO. 2; and a polynucleotide complementary to said polynucleotide; Achyranthes japonica Nakai or Achyranthes Achyranthes bidentata Primer set for identifying Blume. Claim 2 In claim 1, the gene marker is Achyranthes root or Achyranthes root ( Cyathula officinalis A primer set for distinguishing between Achyranthes japonica and Achyranthes bidentata, intended to be distinguished from KCKuan. Claim 3 delete Claim 4 A primer set for identifying Achyranthes japonica or Achyranthes bidentata, wherein the primer pair is capable of amplifying the gene marker by binding to the polynucleotide of SEQ ID NO. 1 or SEQ ID NO. 2 and its complementary base sequence. Claim 5 A primer set for distinguishing Achyranthes root or Achyranthes root according to claim 1, wherein the primer pair comprises at least one selected from the group consisting of: i) a pair of a first primer composed of the nucleotide sequence of SEQ ID NO. 5 and a second primer composed of the nucleotide sequence of SEQ ID NO. 6 for amplifying a gene marker comprising the 50th SNP position of the nucleotide sequence of SEQ ID NO. 1; and ii) a pair of a third primer composed of the nucleotide sequence of SEQ ID NO. 7 and a fourth primer composed of the nucleotide sequence of SEQ ID NO. 8 for amplifying a gene marker comprising the 36th SNP position of the nucleotide sequence of SEQ ID NO.

2. Claim 6 A PCR composition for distinguishing between Achyranthes bidentata and Achyranthes japonica, comprising: a primer pair for amplifying a gene marker comprising at least one selected from the group consisting of: a polynucleotide comprising eight or more consecutive nucleotides including one or more SNP locations selected from the group consisting of the 50th single nucleotide polymorphism (SNP) location of the nucleotide sequence of SEQ ID NO. 1 and the 36th SNP location of the nucleotide sequence of SEQ ID NO. 2; and a polynucleotide complementary to said polynucleotide; and a probe pair for detecting a single nucleotide polymorphism (SNP) in the gene marker amplified by said primer pair. Claim 7 In claim 6, the primer pair is at least one selected from the group consisting of: i) a pair of a first primer composed of the nucleotide sequence of SEQ ID NO. 5 and a second primer composed of the nucleotide sequence of SEQ ID NO. 6 for amplifying a gene marker including the 50th SNP position of the nucleotide sequence of SEQ ID NO. 1; and ii) a pair of a third primer composed of the nucleotide sequence of SEQ ID NO. 7 and a fourth primer composed of the nucleotide sequence of SEQ ID NO. 8 for amplifying a gene marker including the 36th SNP position of the nucleotide sequence of SEQ ID NO. 2; and the probe pair is a pair of a first probe composed of the nucleotide sequence of SEQ ID NO. 13 and a second probe composed of the nucleotide sequence of SEQ ID NO. 14 for detecting a gene marker including the 50th SNP position of the nucleotide sequence of SEQ ID NO. 1; A PCR composition for distinguishing between Achyranthes root and Achyranthes root, comprising at least one selected from the group consisting of: ii) a pair of a third probe composed of the nucleotide sequence of SEQ ID NO. 15 and a fourth probe composed of the nucleotide sequence of SEQ ID NO. 16 for detecting a gene marker including the 36th SNP position of the nucleotide sequence of SEQ ID NO.

2. Claim 8 In claim 7, the primer pair is a PCR composition for distinguishing between Achyranthes root and Achyranthes root, comprising all of the first to fourth primers. Claim 9 A PCR composition for distinguishing between Achyranthes japonica or Achyranthes bidentata according to claim 6, wherein different reporters are bound to probe pairs for each gene marker. Claim 10 A PCR composition for identifying Achyranthes root or Achyranthes root, wherein the reporter is selected from the group consisting of Hex, Joe, Fam, fluorescein, fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethylrhodamine, FITC, Oregon green, Alexafluoro, ROX, Texas red, TET, TRITC, TAMRA, cyanine-based dyes, and cyanodicarbonin dyes. Claim 11 A kit for identifying Achyranthes japonica or Achyranthes bidentata, comprising a primer set for identifying Achyranthes japonica or Achyranthes bidentata according to any one of claims 1, 2, 4 and 5. Claim 12 A kit for identifying Achyranthes japonica or Achyranthes bidentata, comprising a PCR composition for identifying Achyranthes japonica or Achyranthes bidentata according to any one of claims 6 to 10. Claim 13 A method for distinguishing between Achyranthes root and Achyranthes root, comprising: 1) a step of preparing a mixture by mixing template DNA derived from a plant sample with a PCR composition of any one of claims 6 to 10; and 2) a step of PCR amplifying the resulting mixture to form an amplified product. Claim 14 A method for determining Achyranthes root or Achyranthes root according to claim 13, further comprising: 3) a step of detecting or quantifying the amplified product.

Citation Information

Patent Citations

  • Genetic Marker Having Single Nucleotide Polymorphism For Distinguishing Varieties Of Peony

    KR1020230100949A

  • Genetic Marker Having Single Nucleotide Polymorphism For Distinguishing Salvia plebeia

    KR1020230100950A

  • Genetic Marker Having Single Nucleotide Polymorphism For Distinguishing Varieties Of Ginseng

    KR1020230149050A