PCR technique for improving the accuracy of sex determination of Korean cattle fetuses

Abstract

The present invention relates to a PCR technique for improving the accuracy of sex determination of Hanwoo fetuses. Specifically, the present invention allows for the pre-planning of farm operations by determining sex using the blood of a pregnant cow, and enables verification of how the feeding performance of the newborn calf changes by providing nutritional supplementation to the cow two months prior to calving.

Description

Technology Field

[0001] The present invention relates to a PCR technique for improving the accuracy of sex determination of Korean beef cattle fetuses. Background Technology

[0003] Cattle are monotetes, giving birth to only one calf per year. If the newborn calf is female, the farmer can sell the cow with a high parity and raise the new calf to utilize it as a breeding cow; if the newborn calf is male, it can be raised for six months and then sold to a fattening farm. As such, the sex of the newborn calf influences the farm's operational strategy. To date, ultrasound is the most frequently used method for early determination of fetal sex in cattle. However, the ability to determine fetal sex decreases as pregnancy progresses and is only possible between 56 and 98 days after ovulation (Heyman et al., 2002). Furthermore, the use of ultrasound to determine fetal sex in cattle is limited due to technical constraints, increased costs, and animal safety and management issues (Hylan et al., 2009).

[0004] Invasive methods for sex determination include chorionic villus sampling (CVS) and amniocentesis, which carry risks of premature birth and death. Lo et al. (1997) discovered that fetal DNA is present in the plasma and serum of healthy mothers. According to their findings, fetal DNA in maternal plasma accounts for an average of 3.4% of total DNA in early pregnancy and 6.2% in late pregnancy (Lo et al., 1998), and is cleared at a very rapid rate after birth (Lo et al., 1999). It is a well-known phenomenon that fetal nuclei reach the maternal peripheral circulation through the placental barrier. Therefore, pregnant females possess fetal DNA circulating during pregnancy, depending on the temporal relationship between pregnancy and birth and the increase in fetal DNA concentration in maternal plasma (Lo et al., 1998). Thus, it is believed that the presence of fetal DNA in the plasma of pregnant cows can predict the fetal sex in cattle.

[0005] Currently, research is underway on sex determination methods using fertilized eggs and artificial sex control through in vitro fertilization. However, these methods are currently applicable only to breeding cows conceived via in vitro fertilization and cannot be used on breeding cows conceived through natural or artificial insemination. Furthermore, there are many cases where fertilized eggs fail to implant properly due to sex determination or artificial sex control, resulting in miscarriage or failure to conceive. However, if blood is utilized, this approach can be applied not only to in vitro fertilization but also to breeding cows conceived through artificial insemination and natural pregnancy.

[0006] PCR is a technique capable of amplifying specific genes, and it has the advantage of being able to amplify fetal DNA within the plasma of a mother cow. Since sex determination via PCR is performed using male-specific target sequences, specific band amplification cannot be observed in the case of females. Therefore, it is determined that if the fetus in the womb is male, specific band amplification will appear, and if it is female, specific band amplification will not appear. We intend to determine sex through the amplification of these specific bands.

[0007] Therefore, in this invention, by using the blood of a pregnant cow to determine the sex, the farm's operational plan can be planned in advance, and by providing nutritional supplementation to the cow two months before calving, it is possible to check how the feeding performance of the newborn calf changes. Prior art literature

[0009] No. 10-2009-0035113 No. 10-2013-0000174 The problem to be solved

[0010] One objective of the present invention to solve the above problems is to provide a PCR technique for improving the accuracy of sex determination of Hanwoo fetuses.

[0011] In addition, one objective of the present invention to solve the above problems is to provide a diagnostic composition for improving the accuracy of sex determination of Hanwoo fetuses.

[0012] Finally, one objective of the present invention to solve the above problems is to provide a diagnostic kit for improving the accuracy of sex determination of Hanwoo fetuses.

[0013] The problems that the present invention aims to solve are not limited to those mentioned above, and other unmentioned problems will be clearly understood by a person skilled in the art from the description below. means of solving the problem

[0015] To achieve the above objectives, the present invention provides a composition for sex determination of a Hanwoo fetus comprising a primer having a nucleotide sequence represented by SEQ ID NOs 1 to 4 as an active ingredient.

[0016] In one embodiment of the present invention, the "primer having the nucleotide sequence represented by sequence no. 1 and 2" may be the first primer for sex determination of a Hanwoo fetus, and the "primer having the nucleotide sequence represented by sequence no. 3 and 4" may be the second primer for sex determination of a Hanwoo fetus.

[0017] In one embodiment of the present invention, the "primer" may be a first primer and a second primer used in sequence.

[0018] In one embodiment of the present invention, the "composition used with the first primer" comprises 3 µL of DNA, 2 µL of primer, 2 µL of PCR buffer (excluding MgCl2), 1 µL of 10 mM dNTP, and 1 µL of 20 mM MgCl2. , It may contain 0.2 uL of DNA Taq and 10.8 uL of distilled water, but is not limited to this.

[0019] In one embodiment of the present invention, the "composition used with the second primer" comprises 2 µL of DNA of the product amplified using the first primer, 2 µL of primer, 2 µL of PCR buffer (excluding MgCl2), 1 µL of 10 mM dNTP, and 1 µL of 20 mM MgCl2. , It may contain 0.2 uL of DNA Taq and 11.8 uL of distilled water, but is not limited to this.

[0020] In one embodiment of the present invention, the "composition" may be plasma separated from the blood of a Korean beef cattle, but is not limited thereto.

[0021] In addition, to achieve the above objectives, the present invention may be a method for determining the sex of a Hanwoo fetus through the following steps:

[0022] Step 1: Collecting blood from a pregnant Hanwoo;

[0023] Step 2: Separating plasma from collected blood;

[0024] Step 3 for extracting DNA from separated plasma;

[0025] Step 4, amplifying a target sequence using primers having nucleotide sequences represented by SEQ ID NOs 1 and 2;

[0026] Step 5 for obtaining the amplified product;

[0027] Step 6, amplifying the target sequence using primers having the nucleotide sequences represented by SEQ ID NOs 3 and 4 on the product obtained in Step 5;

[0028] It provides 7 steps to determine the sex of a Hanwoo fetus by verifying the amplification product.

[0029] In one embodiment of the present invention, the "4th step" may be carried out by a Polymerase Chain Reaction (PCR) method under conditions of 95°C for 5 minutes, 94°C for 30 seconds, 58°C for 30 seconds, 72°C for 30 seconds, 72°C for 10 minutes, and 4°C standing, but is not limited thereto.

[0030] In one embodiment of the present invention, the “6th step” may be carried out by a Polymerase Chain Reaction (PCR) method under conditions of 95°C for 5 minutes, 94°C for 30 seconds, 56°C for 30 seconds, 72°C for 30 seconds, 72°C for 10 minutes, and 4°C standing, but is not limited thereto.

[0031] In addition, to achieve the above objectives, the present invention provides primers having nucleotide sequences represented by SEQ ID NOs 1 to 4, which are used for PCR amplification to determine the sex of a Hanwoo fetus.

[0032] In one embodiment of the present invention, the "primer having the nucleotide sequence represented by sequence no. 1 and 2" may be the first primer for sex determination of a Hanwoo fetus, and the "primer having the nucleotide sequence represented by sequence no. 3 and 4" may be the second primer for sex determination of a Hanwoo fetus.

[0033] Finally, to achieve the above objectives, the present invention provides a kit for sex determination of a Hanwoo fetus comprising a primer having a nucleotide sequence represented by SEQ ID NOs 1 to 4 as an active ingredient. Effects of the invention

[0035] The present invention relates to a PCR technique for improving the accuracy of sex determination of Hanwoo fetuses. Specifically, the present invention allows for the pre-planning of farm operations by determining sex using the blood of a pregnant cow, and enables verification of how the feeding performance of the newborn calf changes by providing nutritional supplementation to the cow two months prior to calving. Brief explanation of the drawing

[0037] Figure 1 is a figure showing the experimental results of a comparative analysis of whole blood and plasma in one embodiment of the present invention. FIG. 2 is a figure showing the result of accurately expressing a DNA band to be confirmed in plasma using the primer of the present invention in one embodiment of the present invention. FIG. 3 illustrates, in one embodiment of the present invention, 1 of the present invention st This is a diagram comparing the results by adjusting the temperature to 57℃ or 58℃, which is the third step of PCR using primers. FIG. 4 illustrates, in one embodiment of the present invention, the 2 of the present invention nd This is a diagram comparing the results of the third step of PCR using primers, with the temperature adjusted to 56℃, 57℃, or 58℃. FIG. 5 illustrates, in one embodiment of the present invention, the 2 of the present invention ndThis is a comparison of the results when the concentration of MgCl2 in the buffer composition was 1 mM or 1.5 mM when performing PCR. FIG. 6 illustrates, in one embodiment of the present invention, the 2 of the present invention nd This is a diagram showing the results according to the type of primer when performing PCR. Figure 7 is a figure showing the results of electrophoresis performed after PCR to confirm β-actin expression, in which DNA was extracted from plasma and whole blood of non-pregnant Korean cattle in one embodiment of the present invention. Specific details for implementing the invention

[0038] Hereinafter, the present invention will be described in detail with reference to the attached drawings and embodiments thereof. However, the following embodiments are presented as examples of the present invention, and if it is determined that a detailed description of a technology or configuration well known to those skilled in the art may unnecessarily obscure the essence of the present invention, such detailed description may be omitted, and the present invention is not limited thereby. The present invention is capable of various modifications and applications within the scope of the claims set forth below and the equivalent scope interpreted therefrom.

[0039] Furthermore, the terminology used in this specification is used to appropriately describe preferred embodiments of the present invention, and may vary depending on the intent of the user or operator, or the conventions of the field to which the present invention belongs. Accordingly, the definitions of these terms should be based on the content throughout this specification. Throughout the specification, when a part is described as "comprising" a certain component, unless specifically stated otherwise, this means that it may include additional components rather than excluding other components.

[0040] Throughout this specification, '%' used to indicate the concentration of a particular substance is (w / w) % for solid / solid, (w / v) % for solid / liquid, and (v / v) % for liquid / liquid, unless otherwise noted.

[0042] In the present invention, "primer" refers to a single-stranded oligonucleotide that can act as a starting point for template-directed DNA synthesis under appropriate conditions in a suitable buffer solution (e.g., four different nucleoside triphosphates and a polymerizer such as DNA, RNA polymerase, or reverse transcriptase) and at a suitable temperature. The appropriate length of the primer may vary depending on the intended use, but is typically 15 to 30 nucleotides. Shorter primer molecules generally require lower temperatures to form a stable hybrid with the template. The primer sequence does not need to be perfectly complementary to the template, but must be sufficiently complementary to hybridize with the template.

[0043] In the present invention, "forward primer" and "reverse primer" refer to primers that bind to the 3'-terminus and 5'-terminus, respectively, of a specific region of a gene amplified by a gene amplification reaction and act as a starting point for DNA synthesis.

[0044] The "kit" of the present invention may comprise genomic DNA derived from a sample to be analyzed, a set of primers and probes of the present invention, an appropriate amount of DNA polymerase (e.g., a heat-stable DNA polymerase obtained from Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, or Pyrococcus furiosus (Pfu)), a dNTP mixture, a PCR buffer solution, and water. The PCR buffer solution may contain KCl, Tris-HCl, and MgCl2. In addition, components necessary for performing electrophoresis to verify whether the PCR product has been amplified may be additionally included in the kit of the present invention. In this case, the concentration of MgCl2 significantly affects the specificity and quantity of amplification, and preferably, it may be used in the range of 1.0-2.5 mM. Generally, Mg 2+ In the case of an excess of , non-specific PCR amplification products increase, and Mg 2+ If insufficient, the yield of the PCR product decreases, so an appropriate concentration range must be used. The above PCR buffer solution may additionally contain an appropriate amount of Triton X-100.

[0045] Meanwhile, the present invention provides a method for determining the sex of a Hanwoo fetus through the following steps:

[0046] Step 1: Collecting blood from a pregnant Hanwoo;

[0047] Step 2: Separating plasma from collected blood;

[0048] Step 3 for extracting DNA from separated plasma;

[0049] Step 4, amplifying a target sequence using primers having nucleotide sequences represented by SEQ ID NOs 1 and 2;

[0050] Step 5 for obtaining the amplified product;

[0051] Step 6, amplifying the target sequence using primers having the nucleotide sequences represented by SEQ ID NOs 3 and 4 on the product obtained in Step 5;

[0052] 7 steps to determine the sex of a Hanwoo fetus by verifying the amplification product.

[0053] In the present invention, DNA extraction in "step 3" may be performed using methods commonly used in the art, such as phenol / chloroform extraction, SDS extraction, and CTAB isolation (Cetyl Trimethyl Ammonium Bromide; Murray et al., Nuc. Res., 4321-4325, 1980), or may be performed using commercially available DNA extraction kits, but is not limited thereto. If the target sample is mRNA, total RNA is isolated according to methods commonly used in the art, and then cDNA is synthesized and used.

[0054] In the present invention, the method for amplifying a target sequence of “step 4 or step 6” comprises polymerase chain reaction (PCR), reverse transcription-polymerase chain reaction (RT-PCR), ligase chain reaction (LCR), Gap-LCR, repair chain reaction, transcription-mediated amplification (TMA), self-sustained sequence replication, selective amplification of target polynucleotide sequences, consensus sequence primed polymerase chain reaction (CP-PCR), arbitrary primed polymerase chain reaction (AP-PCR), nucleic acid sequence based amplification (NASBA), strand displacement amplification, and loop-mediated isothermal amplification; The LAMP, etc., may be used, but is not limited thereto. General PCR methods are well known in the art, and commercially available kits may be used. In addition, the amplified target sequence may be labeled with a detectable labeling substance. The labeling substance may be a fluorescent, phosphorescent, or radioactive substance, but is not limited thereto.

[0055] In the present invention, the confirmation of the amplified product of "Step 7" can be achieved by various methods commonly used in the art, for example, it is preferable to confirm by electrophoresis, but is not limited thereto. The gel used for electrophoresis in the present invention may be a gel that is commonly used in electrophoresis, and representative examples include agarose gel or polyacrylamide gel. After electrophoresis, the results of the electrophoresis can be analyzed by silver staining.

[0057] The present invention will be explained in more detail below through examples. However, the above examples and experimental examples are presented as illustrative examples of the present invention, and if it is determined that a detailed description of a technology or configuration well known to those skilled in the art may unnecessarily obscure the essence of the present invention, such detailed description may be omitted, and the present invention is not limited by this. The present invention is capable of various modifications and applications within the scope of the claims set forth below and the equivalent scope interpreted therefrom.

[0059] <Experimental Method 1> Test Animals and Experimental Design

[0060] For the sex determination experiment, 307 Hanwoo cows were used. The experimental groups consisted of two treatments using whole blood and plasma in the blood sample-based experiment, and a total of six treatments based on gestational age: 3, 4, 5, 6, 7, and 8 months. In the parity-based experiment, a total of five treatments were conducted: first, 1st, 2nd, 3rd, and 4th or more parities. In the farm-based experiment, a total of four treatments were conducted at Kangwon National University Ranch (Chuncheon), Yanggu Ranch (Yanggu), Jangheung Ranch (Jangheung), and the National Institute of Animal Science (Hoengseong).

[0062] <Experimental Method 2> Specification Management

[0063] Test animals were housed in pens (5 x 10 m) at a density of 3 to 5 animals per pen according to body weight, and feed was administered twice a day (07:00 and 18:00) in troughs installed based on the pen. The feed amount for Hanwoo cows was based on the Korean Hanwoo feeding standards.

[0064] In the sex determination experiment, the feeding amounts of compound feed and roughage were 3.0 and 5.0 kg / head / day, respectively (based on raw material), and were the same regardless of parity. Two months before calving, the control group was fed with CP 13–14% and TDN 69–71%, while the fortified treatment group was fed with CP 15–16% and TDN 70–72%.

[0065] Bedding made of sawdust was spread to a thickness of approximately 20 cm, and water cups were installed to ensure free access at all times. Other management practices were carried out in accordance with the experimental farm's customs.

[0067] <Experimental Method 3> Blood Collection and Analysis

[0068] Blood samples were collected from the 3rd to 8th month of gestation by parity and farm. Approximately 10 ml of blood was collected from the jugular vein of the test animals before morning feeding using an 18-gauge needle and a vacuum blood collection tube (Vacutainer; Becton-Dickinson, NJ, USA). The collected blood was stored in an ice box and transported to the laboratory; whole blood was immediately stored in a -30°C freezer, and plasma was separated by centrifugation at 1,250 Hg for 10 minutes. DNA was extracted from the whole blood used for sex determination and the separated plasma using a DNA Extract Kit (Exgene™Blood SV; GeneAll, Seoul, Korea). The concentrations of serum metabolites in the blood of calves born to sex-determined mare were analyzed using an automated blood analyzer (Hitachi 7020, Hitachi Ltd., Tokyo, Japan). The serum metabolites analyzed at this time were glucose (GLU), cholesterol (CHOL), blood urea nitrogen (BUN), aspartate aminotransferase (AST), gamma(γ)-glutamyl transferase (GGT), and non-esterified fatty acid (NEFA).

[0070] <Experimental Method 4> PCR Conditions

[0071] As for PCR conditions, 1 st PCR was set to 95℃ for 5 min, 94℃ for 30 sec, 58℃ for 30 sec, 72℃ for 30 sec, 72℃ for 10 min, 4℃ incubation, and 45 cycles, and 2 ndPCR was set to 95°C for 5 min, 94°C for 30 sec, 56°C for 30 sec, 72°C for 30 sec, 72°C for 10 min, 4°C for incubation, and 40 cycles. The PCR buffer used was Bioneer (ProFi Taq DNA Polymerase E-2202; Bioneer; Daejeon, Korea).

[0072] 1 st The composition of the PCR buffer used for the PCR was 3 µL DNA, 2 µL primer, 2 µL PCR buffer (without MgCl2), 1 µL 10 mM dNTP, and 1 µL 20 mM MgCl2. , The procedure was performed with a total volume of 20 µL, consisting of 0.2 µL of DNA Taq and 10.8 µL of DW. 2 nd The composition of the PCR buffer is 2 µL of DNA (using the 1st PCR product), 2 µL of primer, 2 µL of PCR buffer (without MgCl2), 1 µL of 10 mM dNTP, and 1 µL of 20 mM MgCl2. , The procedure was performed with a total amount of 20 uL, consisting of 0.2 uL of DNA Taq and 11.8 uL of DW.

[0073] For the primers used in the experiment, DNA found exclusively in males was used as a marker because fetal sex analysis had to be performed using DNA that does not originate from females. Gene expression was confirmed by electrophoresis using a 2.5% agarose gel at 100V for 25 minutes. The finally determined primer was 1 st For PCR, Forward 5'-ACGCCTTCATTGTGTGGTC-3', Reverse 5'-ACCATCCCTGTATGTGAAGG-3' 305bp, 2 nd For PCR, experiments were conducted by setting the Forward 5'-GAACGAAGACGAAAGGTGG-3' and Reverse 5'-CGGGTATTTGTCTCGGTG-3' to 159 bp.

[0075] <Experimental Result 1> PCR Conditions

[0076] The DNA concentration extracted from the blood of pregnant cows is as shown in Table 1 below.

[0078] sample 260:280 260:230 Concentration(ng / uL) Whole blood 1 1.112 0.893 25.900 Whole blood 2 1.298 0.742 13.500 Whole blood 3 1.271 1.052 6.100 Whole blood 4 1.500 1.065 3.300 Plasma 1 1.187 0.679 14.600 Plasma 2 1.333 0.667 8.800 Plasma 3 1.344 0.911 8.200 Plasma 4 1.145 0.823 7.900

[0080] As described above, DNA was extracted from the blood of pregnant cows, and the study was conducted to investigate how the concentration affects PCR. DNA was extracted from whole blood and plasma, and DNA concentrations were also measured by randomly selecting samples from whole blood and plasma.

[0081] The 260:280 ratio represents the purity of DNA or RNA; for DNA, a value closer to 1.8, and for RNA, a value closer to 2.0, indicates higher purity. Cases where the 260:280 ratio is low can be divided into two categories. The first is when the DNA concentration is low, and the second is when the ratio is low even though the DNA concentration is normal. Cases where the DNA ratio is low can be further divided into two categories. The first is when protein contamination is high, and the second is when the pH of the solution containing dissolved DNA is low, resulting in a lower 260:280 ratio value.

[0082] The 260:230 ratio indicates the purity of secondary nucleic acids; the 260:230 value of pure nucleic acids is higher than that of 260:280, typically ranging from 2.0 to 2.2. A low 260:230 ratio indicates the presence of contaminants that exhibit absorbance at 230 nm. Generally, the 260:230 ratio decreases when reagents used during the DNA extraction process remain.

[0083] The average 260:280 ratio of whole blood is 1.295, and the average 260:280 ratio of plasma is 1.252, indicating higher purity in whole blood compared to plasma. The average 260:230 ratio of plasma is 0.831, and the average 260:230 ratio of whole blood is 0.938, showing higher purity in whole blood compared to plasma.

[0084] The primer information used for PCR is as shown in Table 2 below.

[0086] Item 5'-Oligo Sequencing-3' Base pair Sequence number SRY 1 st first Forward ACGCCTTCATTGTGTGGTC 305 1 Reverse ACCATCCCTGTATGTGAAGG 305 2 2 nd first Forward GAACGAAGACGAAAGGTGG 159 3 Reverse CGGGTATTTGTCTCGGTG 159 4 1 st first Forward ACGCCTTCATTGTGTGGTC 182 5 Reverse CGGGTATTTGTCTCGGTG 182 6 2 nd first Forward GAACGAAGACGAAAGGTGG 124 7 Reverse GTGCCTCCTCAAAGAATGG 124 8 Beta-actin 1 st first Forward CACCGCAAATGCTTCTAGGC 243 9 Reverse CAATCAAGTCCTCGGCCACA 243 10

[0088] When performing the initial PCR, DNA expression is confirmed using a housekeeping gene called beta-actin. Heifer and Bull DNA were used. Subsequently, 1 st PCR with 182 bp primers (Sequence Nos. 5 and 6) and 2 nd 124bp primers (sequence numbers 7 and 8) were used for PCR, but 1 st PCR primers and 2 nd The base pairs of the PCR primers were close together, making them difficult to distinguish, and the PCR was not performed properly.

[0089] Therefore 1 st PCR primers 305 bp (Sequence Nos. 1 and 2), 2 nd The experiment was conducted by redesigning the PCR primers to 159 bp (Sequence Nos. 3 and 4). The redesigned 1 st PCR and 2 nd The difference in PCR primer sizes made it easier to distinguish the presence or absence of expression.

[0091] <Experimental Result 2> Comparative Analysis of Sex Determination Accuracy Based on Whole Blood and Plasma

[0092] The accuracy of sex determination by month of pregnancy according to test materials is as shown in Table 3 below.

[0094] Item Sex Month of pregnancy Accuracy 3 4 5 6 7 8 Whole Blood WB 1 F 2 3 / 5(60%) 9 / 12(75%) 8 / 9(88.9%) 4 / 4(100%) 4 / 5(80%) 5 / 9(55.6%) 33 / 44(75%) M 3 4 / 5(80%) 2 / 5(40%) 3 / 7(42.9%) 0 / 3(0%) 9 / 13(69.2%) 4 / 8(50%) 22 / 41(53.7%) T 4 70% 64.7% 68.8% 57.1% 72.2% 52.9% 64.7% Plasma F 17 / 17(100%) 17 / 17(100%) 11 / 11(100%) 27 / 28(96.4%) 34 / 34(100%) 26 / 26(100%) 132 / 133(99.2%) M 10 / 12(83.3%) 7 / 7(100%) 11 / 12(91.7%) 21 / 27(77.8%) 34 / 41(82.9%) 17 / 21(81.0%) 100 / 120(83.3%) T 93.1% 100% 95.7% 87.3% 90.7% 91.5% 91.7% Total F 20 / 22(90.9%) 26 / 29(89.7%) 19 / 20(95.0%) 31 / 32(96.9%) 38 / 39(97.4%) 31 / 35(88.6%) 165 / 177(93.2%) M 14 / 17(82.4%) 9 / 12(75%) 14 / 19(73.7%) 21 / 30(70.0%) 43 / 54(79.6%) 21 / 29(72.4%) 122 / 161(75.8%) T 87.1% 85.4% 84.6% 83.9% 87.1% 81.3% 84.9%

[0095] 1 WB: Whole blood 2 F: Female

[0096] 3 M: Male

[0097] 4 T: Total

[0098] * Calculation method: Matched sample divided by total sample multiplied by 100

[0100] When analyzing whole blood, the accuracy at 3 months of gestation was 60% for females and 80% for males, while when analyzing plasma, the accuracy at 3 months of gestation was 100% for females and 83.3% for males, showing significantly higher accuracy in plasma compared to whole blood.

[0101] At 4 months of gestation, the accuracy was 75% for females and 40% for males in whole blood, while it was 100% for females and 100% for males in plasma, showing significantly higher accuracy in plasma compared to whole blood.

[0102] At 5 months of gestation, the accuracy was 88.9% for female whole blood and 42.9% for male whole blood, 100% for female plasma and 91.7% for male plasma, showing significantly higher accuracy in plasma compared to whole blood.

[0103] The accuracy at 6 months of gestation was 100% for females and 69.2% for males in whole blood, and 96.4% for females and 77.8% for males in plasma; females showed slightly higher accuracy in whole blood compared to plasma, while males showed higher accuracy in plasma compared to whole blood.

[0104] The accuracy at 7 months of gestation was 80% for females and 69.2% for males in whole blood, and 100% for females and 82.9% for males in plasma, showing significantly higher accuracy in plasma compared to whole blood.

[0105] At 8 months of gestation, the accuracy was 55.6% for females and 50% for males using whole blood, while it was 100% for females and 81% for males using plasma, showing significantly higher accuracy in plasma compared to whole blood. Therefore, it was determined that conducting the experiment with plasma is more accurate than with whole blood.

[0107] <Experimental Result 3> Comparative Analysis of Sex Determination Accuracy According to Gestational Age and Parity

[0108] The accuracy of sex determination by month of pregnancy according to parity (the number of times a female gives birth to offspring) is as shown in Table 4 below.

[0110] Parity Sex Month of pregnancy Accuracy 3 4 5 6 7 8 0 F 7 / 7(100%) 7 / 7(100%) 5 / 5(100%) 10 / 11(90.9%) 10 / 10(100%) 4 / 4(100%) 43 / 44(97.7%) M 5 / 6(83.3%) 2 / 2(100%) 2 / 2(100%) 7 / 9(77.8%) 6 / 7(85.7%) 4 / 4(100%) 26 / 30(86.7%) T 92.3% 100% 100% 85% 94.1% 100% 93.2% 1 F 3 / 3(100%) 6 / 6(100%) 2 / 2(100%) 4 / 4(100%) 9 / 9(100%) 3 / 3(100%) 27 / 27(100%) M 0 / 1(0%) 1 / 1(100%) 3 / 3(100%) 2 / 3(66.7%) 7 / 9(77.8%) 5 / 5(100%) 18 / 22(81.8%) T 75% 100% 100% 85.7% 88.9% 100% 91.8% 2 F 4 / 4(100%) 2 / 2(100%) 1 / 1(100%) 8 / 8(100%) 10 / 10(100%) 9 / 9(100%) 34 / 34(100%) M 3 / 3(100%) 1 / 1(100%) 2 / 3(66.7%) 8 / 9(88.9%) 9 / 10(90%) 2 / 5(40%) 25 / 31(80.6%) T 100% 100% 75% 93.8% 95% 78.6% 90.8% 3 F - 1 / 1(100%) 2 / 2(100%) 1 / 1(100%) 3 / 3(100%) 4 / 4(100%) 11 / 11(100%) M 1 / 1(100%) 2 / 2(100%) 3 / 3(100%) 3 / 5(60.0%) 4 / 6(66.7%) 2 / 3(66.7%) 15 / 20(75%) T 100% 100% 100% 66.7% 77.8% 85.7% 83.9% over 4 F 3 / 3(100%) 1 / 1(100%) 1 / 1(100%) 4 / 4(100%) 2 / 2(100%) 6 / 6(100%) 17 / 17(100%) M 1 / 1(100%) 1 / 1(100%) 1 / 1(100%) 1 / 1(100%) 8 / 9(88.9%) 4 / 4(100%) 16 / 17(94.1%) T 100% 100% 100% 100% 90.9% 100% 97.1% Total F 17 / 17(100%) 17 / 17(100%) 11 / 11(100%) 27 / 28(96.4%) 34 / 34(100%) 26 / 26(100%) 132 / 133(99.2%) M 10 / 12(83.3%) 7 / 7(100%) 11 / 12(91.7%) 21 / 27(77.8%) 34 / 41(82.9%) 17 / 21(81.0%) 100 / 120(83.3%) T 93.1% 100% 95.7% 87.3% 90.7% 91.5% 91.7%

[0111] * Calculation method: Matched sample divided by total sample multiplied by 100

[0113] For heifers, the accuracy for females at 3 months of gestation was 100% and for males was 83.3%; for the first parity, the accuracy for females was 100% and for males was 0%; for the second parity, the accuracy for females was 100% and for males was 100%; for the third parity, there were no samples for females at 3 months of gestation and for males was 100%; and for the fourth parity or higher, the accuracy for females was 100% and for males was 100%, showing higher accuracy in the second and fourth parities or higher.

[0114] When comparing the gestational age at 4 months, there was no difference between treatments at 4 months of gestation, with 100% for first-time females and males, 100% for first-parity females and males, 100% for second-parity females and males, 100% for third-parity females and males, and 100% for fourth-parity or higher females and males.

[0115] The accuracy at 5 months of gestation was 100% for first-time mothers and 100% for males, 100% for first-parity mothers and 100% for males, 100% for second-parity mothers and 66.7% for males, 100% for third-parity mothers and 100% for males, and 100% for females and 4th-parity mothers and 100% for males, with the accuracy for second-parity males being slightly lower, while there was no difference in the other treatments.

[0116] The accuracy at 6 months of gestation was 90.9% for first-time females and 77.8% for males, 100% for first-parity females and 66.7% for males, 100% for second-parity females and 88.9% for males, 100% for third-parity females and 60% for males, and 100% for females and 4th-parity or higher females and 100% for males. The accuracy was lower for first-parity and third-parity males, while similar results were observed for first-parity, second-parity, and fourth-parity or higher females.

[0117] The accuracy at 7 months of gestation was 100% for first-time females and 85.7% for males, 100% for first-parity females and 77.8% for males, 100% for second-parity females and 90% for males, 100% for third-parity females and 66.7% for males, and 100% for females with four or more parities and 88.9% for males; overall, the accuracy of males was lower compared to other gestational ages.

[0118] The accuracy at 8 months of gestation was 100% for first-time females and 100% for males, 100% for first-parity females and 100% for males, 100% for second-parity females and 40% for males, 100% for third-parity females and 66.7% for males, and 100% for females and 100% for males in their fourth or later parities, with the accuracy of second-parity and third-parity males being low.

[0119] Overall, the results were similar, with 97.7% for first-time females and 86.7% for males, 100% for females in their first parity and 81.8% for males, 100% for females in their second parity and 80.6% for males, 100% for females in their third parity and 75% for males, and 100% for females in their fourth parity or later and 94.1% for males.

[0121] <Experimental Result 4> Comparative Analysis of Sex Determination Accuracy by Farm (Freshness, Distance, etc.)

[0122] The accuracy of sex determination by month of pregnancy according to farm is as shown in Table 5 below.

[0124] Farm Sex Month of pregnancy Accuracy 3 4 5 6 7 8 Y 1 F 3 / 3(100%) 2 / 2(100%) 1 / 1(100%) 2 / 2(100%) 6 / 6(100%) 3 / 3(100%) 17 / 17(100%) M 1 / 1(100%) 2 / 2(100%) 2 / 2(100%) 4 / 4(100%) 7 / 7(100%) 1 / 1(100%) 17 / 17(100%) T 100% 100% 100% 100% 100% 100% 100% J 2 F 3 / 3(100%) 9 / 9(100%) 7 / 7(100%) 11 / 11(100%) 10 / 10(100%) - 40 / 40(100%) M 4 / 4(100%) 3 / 3(100%) 7 / 8(87.5%) 9 / 14(64.3%) 5 / 8(62.5%) 1 / 1(100%) 29 / 38(76.3%) T 100% 100% 93.3% 80.0% 83.3% 100% 88.5% K 3 F - 6 / 6(100%) 3 / 3(100%) 2 / 2(100%) 1 / 1(100%) - 12 / 12(100%) M - - 2 / 2(100%) 3 / 3(100%) - - 5 / 5(100%) T - 100% 100% 100% 100% - 100% G 4 F 11 / 11(100%) - - 12 / 13(92.3%) 17 / 17(100%) 23 / 23(100%) 63 / 64(98.4%) M 5 / 7(71.4%) - - 4 / 6(66.7%) 22 / 26(84.6%) 15 / 19(78.9%) 46 / 58(79.3%) T 88.9% - - 84.2% 90.7% 90.5% 89.3% Total F 17 / 17(100%) 17 / 17(100%) 11 / 11(100%) 27 / 28(96.4%) 34 / 34(100%) 26 / 26(100%) 132 / 133(99.2%) M 10 / 12(83.3%) 7 / 7(100%) 11 / 12(91.7%) 21 / 27(77.8%) 34 / 41(82.9%) 17 / 21(81.0%) 100 / 120(83.3%) T 93.1% 100% 95.7% 87.3% 90.7% 91.5% 91.7%

[0125] 1 Y: Yanggu 2J: Jangheung

[0126] 3 K: Kangwon National University Animal Farm (Chuncheon, Kangwon National University Ranch)

[0127] 4 G: Gangwon-do Livestock Technology Research Institute (Hoengseong, Livestock Technology Research Institute)

[0128] * Calculation method: Matched sample divided by total sample multiplied by 100

[0130] At 3 months of gestation, the accuracy of Y was 100% for females and 100% for males, the accuracy of J was 100% for females and 100% for males, and the accuracy of G was 100% for females and 71.4% for males, showing lower results in G compared to Y and J.

[0131] The accuracy at 4 months of pregnancy showed similar results, with females of Y and males at 100%, females of J and males at 100%, and females of K at 100%.

[0132] The accuracy at 5 months of gestation was 100% for females and 100% for males of Y, 100% for females and 87.5% for males of J, and 100% for females and 100% for males of K, with no difference between treatments.

[0133] The accuracy at 6 months of gestation was 100% for females and 100% for males of Y, 100% for females and 64.3% for males of J, 100% for females and 100% for males of K, and 92.3% for females and 66.7% for males of G, showing lower results in G compared to other treatment groups.

[0134] The accuracy at 7 months of gestation was 100% for females and 100% for males of Y, 100% for females and 62.5% for males of J, 100% for females of K, and 100% for females and 84.6% for males of G, with males of J showing lower results compared to other treatment groups.

[0135] The accuracy at 8 months of gestation was 100% for females and 100% for males of Y, 64.3% for males of J, 100% for females of G, and 78.9% for males of G, with males of J showing lower results compared to other treatment groups.

[0136] When viewed as a whole, the results were 100% for females and 100% for males in Y, 100% for females and 76.3% for males in J, 100% for females and 100% for males in K, and 98.4% for females and 79.3% for males in G, showing lower results in J compared to other treatment groups. Therefore, it is determined that accuracy is lower as the distance from the farm increases, as freshness decreases and DNA is destroyed due to shock during transportation.

[0138] As described above, specific embodiments of the present invention have been described in detail; however, those skilled in the art who understand the spirit of the present invention will be able to easily propose other inventions that are inferior or other embodiments included within the scope of the spirit of the present invention by adding, changing, or deleting other components within the same spirit. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of the present invention is defined by the claims set forth below rather than by the detailed description above, and all modifications or variations derived from the meaning and scope of the claims and equivalent concepts should be interpreted as being included within the scope of the present invention.

Claims

Claim 1 A composition for sex determination of a Hanwoo fetus comprising, as active ingredients, a first primer set having nucleotide sequences represented by SEQ ID NOs 1 and 2, and a second primer set having nucleotide sequences represented by SEQ ID NOs 3 and 4. Claim 2 A composition for determining the sex of a Hanwoo fetus, wherein, in claim 1, the first primer set is a primer set for a first PCR for determining the sex of a Hanwoo fetus, and the second primer set is a primer set for a second PCR for determining the sex of a Hanwoo fetus. Claim 3 A composition for sex determination of a Hanwoo fetus, characterized in that, in paragraph 2, the first primer set and the second primer set are used sequentially. Claim 4 A composition for sex determination of a Hanwoo fetus according to claim 3, wherein the composition used together with the first primer set comprises 3 uL of DNA, 2 uL of primer, 2 uL of PCR buffer (excluding MgCl₂), 1 uL of 10 mM dNTP, 1 uL of 20 mM MgCl₂, 0.2 uL of DNA Taq, and 10.8 uL of distilled water. Claim 5 A composition for sex determination of a Hanwoo fetus according to claim 3, wherein the composition used together with the second primer set comprises 2 uL of DNA of the product amplified using the first primer set, 2 uL of primer, 2 uL of PCR buffer (excluding MgCl₂), 1 uL of 10 mM dNTP, 1 uL of 20 mM MgCl₂, 0.2 uL of DNA Taq, and 11.8 uL of distilled water. Claim 6 A composition for sex determination of a Hanwoo fetus, wherein, in any one of claims 1 to 5, the composition is a plasma separated from the blood of a Hanwoo. Claim 7 A method for determining the sex of a Hanwoo fetus comprising the following steps: (a) collecting blood from a pregnant Hanwoo; (b) separating plasma from the collected blood; (c) extracting DNA from the separated plasma; (d) amplifying a target sequence using a first primer set having base sequences represented by SEQ ID NOs 1 and 2; (e) obtaining an amplification product; (f) using the amplification product as a template to amplify a target sequence using a second primer set having base sequences represented by SEQ ID NOs 3 and 4; and (g) determining the fetus as male if a 159 bp amplification product is confirmed, and determining the fetus as female if the amplification product is not confirmed. Claim 8 A method for determining the sex of a Hanwoo fetus, wherein step (d) is performed under PCR conditions of 95°C for 5 minutes, 94°C for 30 seconds, 58°C for 30 seconds, 72°C for 30 seconds, and 72°C for 10 minutes. Claim 9 A method for determining the sex of a Hanwoo fetus, wherein step (f) is performed under PCR conditions of 95℃ for 5 minutes, 94℃ for 30 seconds, 56℃ for 30 seconds, 72℃ for 30 seconds, and 72℃ for 10 minutes. Claim 10 A primer set used for PCR amplification for sex determination of a Hanwoo fetus, comprising a first primer set having nucleotide sequences represented by SEQ ID NOs 1 and 2, and a second primer set having nucleotide sequences represented by SEQ ID NOs 3 and 4. Claim 11 A primer set according to claim 10, characterized in that the first primer set and the second primer set are used sequentially. Claim 12 A kit for sex determination of a Hanwoo fetus, comprising a first primer set having nucleotide sequences represented by SEQ ID NOs 1 and 2, and a second primer set having nucleotide sequences represented by SEQ ID NOs 3 and 4.

Images