SNP marker for discriminating the number of ribs in pigs and the use thereof

Abstract

The present invention relates to an SNP marker for determining the number of ribs in a pig, and a method for determining the number of ribs in a pig by using said SNP marker. By using the SNP marker according to the present invention, the number of ribs that are not visually distinguishable from the outside of the pig can be easily determined. This allows for the early selection of individuals with longer body lengths and ultimately higher body weights, and additionally enables an increase in the production of pork cuts preferred by consumers, thereby contributing to increased farm productivity and income.

Description

Technology Field

[0001] The present invention relates to an SNP marker capable of determining the number of ribs in a pig, and a method for determining the number of ribs in a pig by using said SNP marker. Background Technology

[0002] Since being domesticated in the eastern regions of India about 9,000 years ago, pigs have been raised globally as the most basic livestock for the protein intake required by humans, adapting to the times, circumstances, and preferences of the people. Generally, European and Asian breeds are derived from the wild boars of each continent ( Sus scrofa It originated from ), and there are currently about 200 breeds in existence. According to results recently released by the FAO (Finance and Accounts Office), Asian breeds account for 30% and European breeds for 33%. Phenotypic differences among these breeds include coat color, size, and body shape.

[0003] Meanwhile, the pig industry has primarily focused on improving productivity related to meat quantity and the distribution of fresh meat, which has entailed a decline in pork quality. To overcome these issues, the industry has found a need for methods to increase production volume while maintaining the highest quality pork.

[0004] Meanwhile, although it is known that pigs have 15 ribs, there are significant differences between breeds and variations even within breeds; for example, the Landrace breed is known to have 14 to 18 ribs, and the Jeju native pig has 13 to 15 ribs (see Fig. 1). In other words, the number of ribs in pigs varies between breeds and between individuals.

[0005] In addition, the more ribs there are, the longer the body length becomes, and consequently, the higher the body weight, and as a byproduct, the production of consumer-preferred cuts such as pork belly increases.

[0006] Therefore, there is a need to determine the number of ribs in the pig at an early stage to compensate for the disadvantages of the small body size of native pigs. Prior art literature

[0007] Published Patent No. 10-2021-0156598 (Published December 27, 2021) Published Patent No. 10-2016-0057521 (Published May 24, 2016) The problem to be solved

[0008] In order to increase pork production, the inventors noticed that there is a difference between breeds in the number of ribs between the Jeju native pig, which is the base herd, and the Halla Land, which is an improved variety of the Landrace, and sought to develop a method to determine the number of ribs in pigs at an early stage.

[0009] Accordingly, the present invention was completed by identifying a gene locus on chromosome 7 of a pig that controls the number of ribs in the pig, and by utilizing gene mutations in the identified region to easily determine the genetically determined number of ribs in the pig and thus determine the quality of the pig.

[0010] Therefore, the objective of the present invention is to provide an SNP marker capable of determining the number of ribs in a pig.

[0011] In addition, another objective of the present invention is to provide a composition for determining the number of ribs in a pig, comprising a preparation capable of detecting or amplifying the SNP marker.

[0012] In addition, another objective of the present invention is to provide a method for determining the number of ribs in a pig using the above-mentioned SNP marker. means of solving the problem

[0013] To achieve the above objective, the present invention provides a single nucleotide polymorphism (SNP) marker for determining the number of ribs in a pig, comprising a polynucleotide in which the 151st base in the sequence represented by SEQ ID NO. 1 is A or C, or a polynucleotide complementary thereof.

[0014] In addition, the present invention provides an SNP chip for determining the number of ribs in a pig, comprising a polynucleotide in which the 151st base of the sequence represented by SEQ ID NO. 1 is A or C, or a polynucleotide complementary thereof.

[0015] In addition, the present invention

[0016] a) a step of amplifying the polymorphic region of the SNP marker from the DNA of a sample isolated from an individual; and

[0017] b) A step of determining the base of the amplified polymorphic site of step a) above

[0018] A method for determining the number of pork ribs, including Effects of the invention

[0019] The present invention provides an SNP marker that can easily determine the number of ribs in a pig. By using the SNP marker according to the present invention, the number of ribs that are not visually distinguishable from the outside of the pig can be easily determined. This allows for the early selection of individuals with longer body lengths and higher final body weights, which increase pork production. Additionally, it can help increase the production of pork cuts preferred by consumers, thereby contributing to increased farm productivity and income. Brief explanation of the drawing

[0020] Figure 1 is an X-ray image showing the number of ribs of the Landrace breed and the Jeju native pig. Figure 2 is a graph showing the relationship between the number of ribs and the carcass length of a pig. Figure 3 is a graph showing the results of a GWAS analysis on the number of ribs for the LK axis group (total of 127 animals). Figure 4 is a graph showing the results of a GWAS analysis on the number of ribs for the DK group (total of 53 animals). Figure 5 shows the results of an association analysis between SNPs identified in the LK axis group and the number of ribs. Figure 6 shows the regulatory gene region for the number of pig ribs obtained at the 97.5 to 97.8 Mb (0.4 M region, between VSX2 and LTBP2). Specific details for implementing the invention

[0021] The present invention provides a single nucleotide polymorphism (SNP) marker for determining the number of ribs in a pig, comprising a polynucleotide in which the 151st base in the sequence represented by SEQ ID NO. 1 is A or C, or a polynucleotide complementary thereof.

[0022] The above marker is preferably located at position approximately 97 Mb on chromosome 7 of pigs. VSX2 It may be a whole or part polynucleotide containing an SNP site of a gene, more preferably a whole or part polynucleotide of a polynucleotide (SNP97564617) containing SEQ ID NO. 1, and most preferably a polynucleotide in which the 151st base of the sequence of SEQ ID NO. 1 is A or C, or a nucleotide complementary thereof.

[0023] The term "polymorphism" as used in the present invention refers to the case where two or more alleles exist at a single locus, and among polymorphic regions, a case where only a single nucleotide differs depending on the individual is called a single nucleotide polymorphism (SNP). A preferred polymorphic marker has two or more alleles that exhibit an occurrence frequency of 1% or more, more preferably 5% or 10% or more, in a selected population.

[0024] The term "allele" as used in this invention refers to multiple types of a single gene located at the same locus on homologous chromosomes. Alleles are also used to indicate polymorphism; for example, an SNP has two types of alleles.

[0025] The above "Sequence No. 1" is a polymorphic sequence containing a polymorphic site. A polymorphic sequence refers to a sequence containing a polymorphic site containing an SNP among polynucleotide sequences. The above polynucleotide sequence may be DNA or RNA.

[0026] The SNP marker of the present invention can determine that pigs containing the SNP marker have a greater number of ribs than pigs without it when the polymorphic region of the SNP marker is of the A / A genotype.

[0027] As a result of analyzing the association between the variation of the SNP marker according to the present invention and the phenotype, the variation includes the A / A genotype, the A / C genotype, and the C / C genotype, each showing different results in the phenotype, and it was found that as the number of A copies of the SNP increases, the number of ribs increases significantly, and the level of increase is about 0.5 ribs per A copy.

[0028] Therefore, it is expected that the number of ribs in a pig can be accurately determined by detecting the SNP (SNP97564617) variant of the present invention or by using a primer capable of detecting said variant.

[0029] In another aspect, the present invention provides a composition for determining the number of ribs in a pig, comprising a preparation capable of detecting or amplifying the SNP marker.

[0030] The term "preparation capable of detecting or amplifying an SNP marker" as used in the present invention refers to a composition capable of determining the number of ribs in a pig by confirming a polymorphic region of the gene as described above through amplification, and preferably refers to a primer capable of specifically amplifying the polynucleotide of the SNP marker. The primer used for amplifying the SNP marker may be a single-stranded oligonucleotide capable of acting as a starting point for template-directed DNA synthesis under appropriate conditions in an appropriate buffer (e.g., a polymerizer such as four different nucleoside triphosphates and DNA, RNA polymerase, or reverse transcriptase) and an appropriate temperature, wherein the appropriate length of the primer may vary depending on the purpose of use, but is typically 15 to 30 nucleotides. Shorter primer molecules generally require lower temperatures to form a stable hybrid with the template. The primer sequence does not need to be completely complementary to the SNP marker, but must be sufficiently complementary to hybridize with the SNP marker.

[0031] The term "primer" as used in the present invention refers to a short sequence having a short free 3' hydroxyl group, capable of forming base pairs with a complementary template, and functioning as a starting point for template strand replication. The primer can initiate DNA synthesis in the presence of reagents for a polymerization reaction (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at an appropriate buffer solution and temperature. In this case, the PCR conditions and the lengths of the sense and antisense primers may be modified based on those known in the art.

[0032] The primers of the present invention can be chemically synthesized using the phosphoramidite solid support method or other widely known methods. These nucleic acid sequences can also be modified using many means known in the art. Non-limiting examples of such modifications include methylation, "capping," substitution with one or more homologues of the natural nucleotide, and modification between nucleotides, for example, modification to an uncharged linkage (e.g., methylphosphonate, phosphotriester, phosphoromidate, carbamate, etc.) or a charged linkage (e.g., phosphorothioate, phosphorodithioate, etc.).

[0033] In another aspect, the present invention provides a kit for determining the number of ribs in a pig comprising the above composition. The kit may be an RT-PCR kit or a kit for DNA analysis (e.g., a DNA chip).

[0034] The kit of the present invention can determine the number of ribs in a pig by confirming an SNP marker, which is a marker for determining the number of ribs in a pig, through amplification, or by confirming the expression level of the SNP marker or the expression level of the mRNA. As a specific example, the kit for measuring the mRNA expression level of an SNP marker for determining the number of ribs in a pig according to the present invention may be a kit containing essential elements necessary for performing RT-PCR. In addition to each primer pair specific to the gene of the SNP marker, the RT-PCR kit may include a test tube or other suitable container, a reaction buffer (with varying pH and magnesium concentration), deoxyribonucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterile water, etc. It may also include a primer pair specific to the gene used as a quantitative control. Furthermore, preferably, the kit of the present invention may be a kit for determining the number of ribs in a pig containing essential elements necessary for performing DNA chip analysis. A DNA chip kit is a tool that enables large-scale parallel analysis by attaching nucleic acid species in a gridded array to a glass surface, typically a flat solid support plate or a glass surface not larger than a microscope slide, such that nucleic acids are arranged uniformly on the chip surface, allowing multiple hybridization reactions to occur between the nucleic acids on the DNA chip and the complementary nucleic acids contained in the solution treated on the chip surface.

[0035] In another aspect, the present invention provides an SNP chip for determining the number of ribs in a pig, comprising a polynucleotide in which the 151st base in the sequence represented by SEQ ID NO. 1 is A or C, or a polynucleotide complementary thereof.

[0036] The term "SNP chip" as used in this invention refers to a DNA microarray capable of identifying each base of hundreds of thousands of SNPs at once.

[0037] In the SNP chip of the present invention, the polynucleotide may preferably be immobilized on a substrate coated with an amino-silane, poly-L-lysine, or aldehyde active group, but is not limited thereto. Methods for immobilizing the polynucleotide on the substrate may include micropipetting using a piezoelectric method, a method using a pin-shaped spotter, etc., but are not limited thereto, and various methods known in the art may be used. In addition, the substrate may be a silicon wafer, glass, quartz, metal, or plastic, but is not limited thereto.

[0038] The SNP chip according to the present invention may be configured to include a polynucleotide comprising the base sequence of SEQ ID NO. 1, which includes an SNP base within the base sequence as described above, and may also be configured to additionally include a polynucleotide comprising a known SNP base capable of determining the number of ribs of a pig in addition to the polynucleotide of SEQ ID NO. 1.

[0039] In another aspect, the present invention

[0040] a) a step of amplifying the polymorphic region of the SNP marker from the DNA of a sample isolated from an individual; and

[0041] b) A step of determining the base of the amplified polymorphic site of step a) above

[0042] A method for determining the number of pork ribs, including

[0043] The term "individual" used in the present invention refers to a pig, which is the subject whose number of ribs is to be determined, and the number of ribs of the pig can be determined by analyzing the genotype of the SNP marker using a sample obtained from the pig. The sample may include, but is not limited to, samples such as hair, urine, blood, various body fluids, isolated tissue, isolated cells, or saliva.

[0044] The step of amplifying the SNP site of the SNP marker from the DNA of step a) above may use any method known to those skilled in the art. For example, the target nucleic acid can be amplified via PCR and purified to obtain it. Other methods may include ligase chain reaction (LCR) (Wu et al., Wallace, Genomics 4, 560 (1989); Landegren et al., Science 241, 1077 (1988)), transcription amplification (Kwoh et al., Proc. Natl. Acad. Sci. USA 86, 1173 (1989)), self-maintaining sequence cloning (Guatelli et al., Proc. Natl. Acad. Sci. USA 87, 1874 (1990)), and nucleic acid-based sequence amplification (NASBA).

[0045] Determining the bases of the SNP site in step b) above may be performed using, but is not limited to, sequencing analysis, microarray hybridization, allele-specific PCR, dynamic allele-specific hybridization (DASH), PCR extension analysis, PCR-SSCP, PCR-RFLP analysis, or TaqMan techniques, the SNPlex platform (Applied Biosystems), mass spectrometry (e.g., Sequenom’s MassARRAY system), mini-sequencing methods, the Bio-Plex system (BioRad), CEQ and SNPstream systems (Beckman), molecular inversion probe array technologies (e.g., Affymetrix GeneChip), and BeadArray Technologies (e.g., Illumina GoldenGate and Infinium analysis methods). One or more alleles in the SNP marker containing the SNP site may be identified by the above methods or other methods available to those skilled in the art to which the present invention pertains. Determining the bases of such SNP sites can preferably be performed using a DNA chip.

[0046] The term "DNA chip" as used in the present invention refers to a DNA microarray capable of verifying each base of hundreds of thousands of DNA bases at once. The TaqMan method comprises: (1) a step of designing and fabricating primers and TaqMan probes to amplify a desired DNA fragment; (2) a step of labeling probes of different alleles with FAM dye and VIC dye (Applied Biosystems); (3) a step of performing PCR using the above primers and probes with the above DNA as a template; (4) a step of analyzing and verifying the TaqMan analysis plate with a nucleic acid analyzer after the above PCR reaction is completed; and (5) a step of determining the genotypes of the polynucleotides of step (1) from the analysis results.

[0047] The above sequencing analysis may be performed using conventional methods for determining base sequences or by using an automated gene analyzer. Additionally, allele-specific PCR refers to a PCR method that amplifies a DNA fragment at the location of an SNP using a primer set designed with the base at the SNP site as the 3' end. The principle of the above method utilizes the fact that, for example, when a specific base is substituted from A to G, if a PCR reaction is performed by designing a primer containing A as the 3' end base and a reverse primer capable of amplifying a DNA fragment of appropriate size, the amplification reaction proceeds normally and a band at the desired location is observed when the base at the SNP site is A, but when the base is substituted to G, the primer can bind complementarily to the template DNA, but the 3' end side fails to bind complementarily, thereby preventing the amplification reaction from proceeding properly. DASH can be performed by conventional methods, and preferably by the method of Prince et al.

[0048] Meanwhile, PCR extension analysis is performed by first amplifying a DNA fragment containing the base where the single nucleotide polymorphism is located using a primer pair, then inactivating all nucleotides added to the reaction by dephosphorylating them, and finally adding a specific extension primer, a dNTP mixture, a dideoxynucleotide, a reaction buffer, and DNA polymerase to perform a primer extension reaction. At this time, the extension primer takes the base immediately adjacent to the 5' direction of the base where the SNP site is located as its 3' end, nucleic acids having the same base as the dideoxynucleotide are excluded from the dNTP mixture, and the dideoxynucleotide is selected from one of the base types representing the SNP. For example, in the case of a substitution from A to G, if a mixture of dGTP, dCTP, and TTP and ddATP are added to the reaction, the primer at the base where the substitution occurred is extended by DNA polymerase, and after a few bases, the primer extension reaction is terminated by ddATP at the location where the A base first appears. If the above substitution does not occur, the extension reaction terminates at that location, so the type of base representing the SNP can be determined by comparing the lengths of the extended primers.

[0049] In this case, as a detection method, when an extension primer or dideoxynucleotide is fluorescently labeled, the SNP can be detected by detecting fluorescence using a gene analyzer used for general base sequence determination (e.g., ABI’s Model 3700, etc.), and when unlabeled extension primers and dideoxynucleotides are used, the SNP can be detected by measuring the molecular weight using the MALDI-TOF (matrix assisted laser desorption ionization-time of flight) technique.

[0050] Preferably, among the base sequences determined in step b), if the base of the polymorphic region of the SNP marker according to the present invention is A, it can be determined that the pig has a greater number of ribs than a normal pig.

[0052] The present invention will be explained in more detail below through examples. However, these examples are intended to illustrate the invention and the scope of the invention is not limited to these examples.

[0054] Examples 1: Number of pork ribs and Conductor Length and of the carcass Association analysis

[0055] Examples 1-1: The number of pork ribs and carcass weight Analysis of length associations

[0056] The number of ribs and carcass length were analyzed for the carcasses of 1,041 pigs with a shipping age of around 200 days, and the results are shown in Table 1 and Figure 2 below.

[0057] Number of ribs Number of heads (frequency%) Body length (cm) 14 115(11.05) 101.68±6.61 a 15 594(57.06) 102.36±5.96 ab 16 318(30.55) 103.55±5.39 b 17 14(1.34) 103.79±3.85

[0058] Looking at Table 1 above, it can be seen that pigs have 14 to 17 ribs in total, with carcasses having 15 ribs accounting for about 57%, carcasses having 16 ribs for about 30%, carcasses having 14 ribs for about 11%, and carcasses having 17 ribs for about 1%. Additionally, it can be seen that the body length increases as the number of ribs increases.

[0060] Examples 1-2: Conductor Length and of the carcass Association analysis

[0061] The relationship between carcass length and carcass weight was analyzed for pig carcasses with a shipping age of around 200 days, and the results are shown in Table 2 below.

[0062]

[0063] Looking at Table 2 above, it can be seen that there is a proportional relationship between carcass length and carcass weight, and most pigs were found to fall within the range of carcass length of 96 to 110 cm and carcass weight of 74 to 86 kg.

[0065] Examples 2: number of ribs related seq - GWAS Analysis results

[0066] Phenotypes were analyzed for second-generation offspring (F2) (hybrid) obtained by crossing F1s produced from crossing Jeju native pigs and Landrace pigs. In addition, NGS data were generated using reference populations F0 and F1:

[0067] - Phenotypic analysis head: 894 F2 offspring

[0068] - Production of F0, F1 NGS data for reference group: LK group (total 127 heads)

[0069] - F0 36 heads (19 Jeju native black pigs, 17 Landrace pigs)

[0070] - 91 F1 heads

[0071] Seq-GWAS analysis of the NGS data identified a total of 15,406,105 SNPs (see Figure 3).

[0072] In addition, phenotypes were analyzed for the second-generation offspring (F2) obtained by crossing Jeju native pigs with Duroc pigs. Furthermore, NGS data were produced for the reference populations F0 and F1:

[0073] - Phenotypic analysis head: 256 F2 offspring

[0074] - Production of F0, F1 NGS data for reference group: LK group (total 53 heads)

[0075] - F0 14 heads (5 Jeju native black pigs, 9 Duroc)

[0076] - 39 F1 heads

[0077] Specifically, DNA samples were sent to Macrogen Co., Ltd. to produce nucleotide sequence data at least 30 times the standard whole-genome sequence of pigs using a bioinformatics tool, and then NGS data was produced for reference herds F0 and F1 through a process of extracting SNPs or INDELs by attaching them to a standard pig map.

[0078] Seq-GWAS analysis of the NGS data identified a total of 13,720,525 SNPs (see Figure 4).

[0079] As shown in Figures 3 and 4, it was confirmed that the number of ribs in two Jeju native black pig-based reference populations is associated with a causative gene located on pig chromosome 7.

[0080] Specifically, as shown in Figure 3, a total of 829,058 SNPs were identified on chromosome 7 based on NGS data in the LK axis group, and an analysis of the association between the identified SNPs and the phenotype of rib number revealed a number of SNPs with high significance of phenotype association at approximately 97 Mb (see Figure 5). In addition, a rib number regulatory gene region was also identified at approximately 97 Mb in the DK axis group.

[0081] Meanwhile, a gene region regulating the number of pig ribs was secured at the 97.5 to 97.8 Mb position (0.4 M region, between VSX2 and LTBP2) (see Fig. 6).

[0083] Examples 3: 2 types Reference axis group Extraction of trait-linked common top-level SNPs and genes utilizing Marker verification

[0084] Finally, 21 trait-associated gene markers common to the LK and DK axis groups were extracted and are shown in Table 3 below.

[0085]

[0086] Among these, the p-value in the LK axis group is 10 -30 That is the case, and the p-value in the DK axis group is 10 -10 Ten SNPs were identified during extraction as being above average.

[0087] To verify these 10 SNPs, an SNP chip (Illumina, USA) was constructed, and only 3 of the 10 SNPs responded, while the remaining 7 failed to be analyzed for genotype. The 3 SNPs finally selected were SNP97539348, SNP97564617, and SNP97569950.

[0088] The results of the statistical analysis performed on these SNPs are shown in Table 4 below.

[0089]

[0091] As shown in Table 4, the selected SNPs 97539348 and 97564617 were completely linked, resulting in identical outcomes, and SNP 97564617 showed statistically more significant results than SNP 97569950. Therefore, it can be concluded that the number of ribs in pigs can be easily determined using the SNP 97564617. The sequence of SNP 97564617 is as follows:

[0092] GCACAAGCTCCAGGTAATGAAAGTGCCATTGGCAAGTTCAGAGCTAGTAGCAGCTCCAGACCCAGCTCTAAAACCAAAGCCAGAACTAGAGCCAGTTAAAGAGCTAGAGCTAGTTCAGAAGTACAGCCAGTTCCTGGGCCAGCTCTCATA [A / C]CAGCTGCAAGGCCACATCTAGCTGTAGCTCCAGCTCCAACCCCAGGGCCAGTTACAGATCTAGAGCCAGTGCTAAGTCCAGCTGGCTGCCAGCTCTAGCACCAAAGTCAGGCTTAGAACCAGTTCTAGGGTTTTGTTTTGGCTGTGCCCA (SEQ ID NO: 1)

[0094] Examples 4: SNP97564617 Analysis of the association between SNP genotypes and the number of pig ribs

[0095] Genotype analysis was performed on 905 second-generation offspring (F2) (crossbreeds) obtained by crossbreeding F1 pigs produced by crossing Jeju native pigs and Landrace pigs. For the genotype analysis, an SNP chip containing SNP97564617 was manufactured in-house to analyze whether it was an A or C variant, and the results were compared with the number of ribs. The results are shown in Table 5 below.

[0096] Genotype (97564617) Dusu Average and deviation of carcass length AA 205 15.82±0.04 a AC 414 15.27±0.03 b CC 286 14.78±0.04 c

[0097] Looking at Table 5 above, it can be seen that there are differences in carcass length depending on the genotype of SNP97564617, specifically an increase of about 0.5 ribs per A copy.

Claims

Claim 1 A single nucleotide polymorphism (SNP) marker composition for determining the number of ribs in a pig, comprising a polynucleotide in which the 151st base of the sequence indicated by SEQ ID NO. 1 is A or C, or a polynucleotide complementary thereof. Claim 2 An SNP chip for determining the number of ribs in a pig, comprising a polynucleotide in which the 151st base of the sequence indicated by SEQ ID NO. 1 is A or C, or a nucleotide complementary thereof. Claim 3 a) a step of amplifying a polymorphic region of the SNP marker of claim 1 from the DNA of a sample isolated from an individual; and b) a step of determining the base of the amplified polymorphic region of step a). A method for determining the number of pig ribs. Claim 4 A method in which, in paragraph 3, the number of ribs in pigs with a genotype of A / A of the polymorphic region of the SNP marker is determined to be greater than that of pigs with other genotypes.

Images